Detailed Information

>>> Option 1: Click the button below to Download all the analysis

>>> Option 2: View all the result online

Basic Information

The table below details the source and basic information of this item.

Title Content
iBAD ID iBAD_0000173
Karyotype Trisomy 21
Type DNA microarray
Diseases Down syndrome
Organism Mus musculus
Tissue Brain
Cell Line Hippocampus
Platform GPL13912
Accession GSE68074
GEO Title Lentiviral vector-based microRNA sponges identifies miR-155 and miR-802 target genes in the hippocampus of Ts65Dn mice
PMID 26546125
Article Title GeNme-wide miR-155 and miR-802 target gene identification in the hippocampus of Ts65Dn Down syndrome mouse model by miRNA sponges
Author Bofill-De Ros X, Santos M, Dierssen M, Fillat C
GEO Link https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE68074
Pub Link https://www.ncbi.nlm.nih.gov/pubmed/26546125
FTP Download ftp://ftp.ncbi.nlm.nih.gov/geo/series/GSE68nnn/GSE68074/
SRA Run Selector -
SRP -

Differentially Expressed Genes

The gene expression matrix, up- and down-regulated gene list are provided. Click the three following options to download the corresponding list.

Gene Symbol Gene Title logFC P-value P-adj
245038 ACAGATTCTGTTTTCTCCTTGTATTCACATCCATGGTAGGCTACAGGAGTGTGCTTCACA -0.66069248 0.00035 1
214763 AGCCTTTTCCAGTGGTCTGTAGCTGTTCCCTGTGTAACAAATAATGTCTGCCATGTATGT 0.52981926 0.000771 1
236312 CTGATAAAAGCAAGCTCTTTGGTTTAGGAAATGGCACTTATTCTTTCTACAGTTTTAGCA 1.65387706 0.000942 1
667567 TTCAATAAAAGGGAGAAAAAGTTCTCCTTGCACATCGCAGACTCTCAGCCTGGAGACTCA 0.42260189 0.001228 1
12966 GACTGGGGCTCTGTAGATGCTAAGGCGGGCTCTTTGCGGAGGGTGGTAGATTTATACTAA 1.08917237 0.001452 1
237759 TTCAGCACGCTTCCAGAAGCCACCCTGACACGGGAGCTTGTATTCTCGGACCTTGGGAAA 0.52732105 0.001785 1
67876 AACCGCACTTGGTAAAGGCATCTTGTACTGATGGGAAACTTTTCAATCATTTGGAGACTA -0.38344686 0.001785 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.53052114 0.001818 1
216859 ATCTCGACATATTCCGAGACTTCTCCCTCATGGCGTCGGACGACCCAGAGAAACTGAGCC 1.21747063 0.001999 1
107221 ACAACATGTCGCTGTTCAGGAACGAATGGAGGAAGATTTTTTGCTGCTTCTTTTTTCCAG 0.62642984 0.002471 1
100294583 CCATAATTCCTTTGCATTTTCTATGTTGCTGACAGTTTACAATATGCATCAGTGAATCAG -0.46372393 0.002475 1
67498 GAGTGTATCAAAGTCTCTTGCACTATGAACATTGTCTAGCTGTATCTTTGTATTTGTTTC -0.61771847 0.002678 1
380601 GTGTAACCCTGGTTGTACTCTAGTTGTATGTTTTGCTCAGAATAAATAAGCATCTTCAAA -0.41531188 0.002747 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.4306138 0.00325 1
74729 AGAATGTCCATCAATACACTCTCTCCCAGAATACTTGTCTTTGTAGCTAAGTGTGGGTAA -0.37748491 0.003442 1
24135 GCTTTGTGAGTGCTCAGATTAAATGTATGTGCTACTATGCCCACCCATAGAATTTTAAGG -0.32462956 0.003598 1
100043861 TCTGGTTGACTGTAATTTGAAAGGAGCCACTTTGCTGCTCATTCAAGATGAAGAAGAATT 0.83624784 0.003763 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.4224801 0.004132 1
22169 GAAACTCCATAGTAGAACATGGTATTGAATATTCTATCCTTGGGTTCAGAATCTGGGGTC 0.46695026 0.00421 1
75533 TCTCCTACTGGAAAGAACTTATGGGACCAAGTAACAGTTTAGTAGCCAAGGAGACACACC -0.34058609 0.004244 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.43399185 0.004307 1
100043063 GGTGTAACTGAAATGGTGGCAGTGAGTGGGATGTAAAGTTAATAAATAAACCAATATCTT -0.3351179 0.004493 1
14256 ATACTGACTTTAAGAAAAACAGAAAGGAAGAAGGGGGGTGCGTTGTAGCCCTGTGTGGTT 0.59689456 0.004611 1
52840 ATGCCGCAGGGTGATTGTGGGGTGTGGGTTGAAATTGTAATAAATTTGTTTAGATGGATT -0.69955413 0.004964 1
53311 AGGCAGAGACTGGGACAAGGAGACAGCTTGGTCACATACCAGGACGCAGAAGGACACTAT 0.41802939 0.005129 1
19885 TGTGGGGTAGATGGGATAGAGATAGGATGACCAAGTCAAATAAAAAACAGACTGACAATC 0.70913233 0.005284 1
66441 GGTTCTCTTATTGATGTAAATCAGTCAAAGGATCCTGAAGGCCTTCGTGTATTTTACTAT -0.36125967 0.005546 1
14805 GCTCACATAGATATTACTTGAGGAGTGAAACTGAATCTTTTCAGATGAATTTGTATGCAC 0.6401809 0.005615 1
22648 GTGTATGTGATATTTTAATCCACCCTTTTTGCACTTAACCCAGAAATTACAAAGGATGTG -0.32263158 0.005616 1
68971 ACAAAATGTGGAAAGGGTGGATGAGTAAAGCGTCCTGACTTGACTGATGTTGTGTTACGT -0.58919712 0.005724 1
353187 CTGTGAGGGGAGCTCAGATAGATGTATCTTTTTGCAATATAAAGTTTGCTGAATGTAAAA -0.55572998 0.005821 1
67905 CTTCTTGAAACCTCTGGGCAGTCTCACATTTGCTTAATTTAATTAAGATTAAAGCGATCT 0.48764593 0.005858 1
78251 GCAGTATACCATGCCTTGGTTGGACTGCTTAGTTTTCTGTCTCTTTTGCCTTTTATTTAT -0.39226661 0.005952 1
258552 TTCAAATCCACAGTCCAGTCATATCCTACGTGGGCTGCCTCACTCAGATGTCTCTTTTTA -0.35223178 0.005996 1
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.70979382 0.006025 1
209550 GAATGATTTACTTGTTGCTTTGTATAAGTGTTTTCCTCCAGCTGCAGATTTTGTGTTGTA -0.4686868 0.006036 1
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 1.71777123 0.006158 1
211586 CCATTGCTGTAAGAGAAGAAAACATCTGAAATGAGTATGTTGAGCTTGAGGAAAATTGTA -0.32631456 0.006234 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.48607948 0.00642 1
98376 AGAAACGTTAGGGATGTCCTATTTTTAGACTATTGTCTAAGACATCTTCTGATAGTAAGG -0.37256063 0.006608 1
218763 CCCCCCATTAATTGTGACCTCTGGTTCCTGAGTAACAAACTCTCTGAACATTAGTTAGAC -0.3640658 0.006676 1
69642 AGATGAACCAGCCAGGACTGAAAGCAACTCCAAGGCCAGCGTGTTAGACCTACCAGTGGA -0.32521841 0.006776 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.58261154 0.006954 1
71522 ACCACATTTCCTGGTACCCACACTGATGGAATTTCTGACTTTTCTATCAAATAAAGACCA 0.3815514 0.006962 1
19183 AAAGAGATTCAGGAGTTAAAGAAGGAGTGTGCTCAATACACAGAGAGACTGAAGAACATC -0.36514679 0.007039 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.511849 0.007188 1
229277 ACATACTTGAGGGCATTGGTGGCATCAGCTATGGCAACAATAAGAAGGTCACTGCTAAAG -0.27950179 0.007203 1
317677 TGTGATTATTCATCCCGGCTGGAAGGAAGACGATGACCTAAACCCACGGACAAATTTTGA 0.36702751 0.007217 1
622459 GAATGTTCTAAAGCCTAAGGCCAGTCTGGGCTATATATAGAAGAATGAGTTTCCTGCCTC 0.51104857 0.007326 1
12778 TGGACATGTGTACAGTAGAATCTTCTGTGTTTCTTCAAGTTTTTACTTGGTGACTTTTTG -0.4544179 0.007327 1
638531 CACCAAGGAGATGACAAACCTACTGCAGCCCTTTTCTTTGTCAAGTCTAGATTTCTCCTT -0.31382242 0.007355 1
80782 CACATGGACTCTGAAAACACTGGGATTCTTAAAGGTTCTTCATTGTATAAATGGAAGTGT 1.36859525 0.007587 1
20847 CTGAATAGTTAGAAAGAACTGTTGTCCTGAAGTCCTTCGTACGTCATAATAAACTTTTGT 0.85777729 0.007735 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.33215262 0.007879 1
74918 CTATTGTTGGTACACTCGCTCTTTATTAACCCATACGCATTGTATATTTTGTTGCACATA -0.38206064 0.007952 1
18073 CAGATGTATACAAGTATTGGATGATTCCTCAAGTTTACAGCTGTACAAATATTAGTGCAG 0.63673214 0.008203 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.37710007 0.008341 1
210719 ATATTTTGTACGTATATTTTTACTTTGTTTTCTCAAGTGCTGTTGGCAGTTGCAGTTGCC -0.41823641 0.008377 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.36395319 0.008481 1
72500 ACTCGGGGCTGAGCTGGGGACGAGCAGAGGCTGATGTTTTATAAATTGTAAAATAAAAAA -0.33174028 0.008697 1
665033 CATCAAGCCATTTGTTCATTCGATCAGACGTGCTATCAACAAATATCCCGGCAGAGACCT -0.51315305 0.008936 1
17926 CAGTAAGACCCTGACCATCCCATTCACGAATCGCTACAAGTACAGCAGTATGATTGACTA -1.29017619 0.008993 1
56349 GGCAGCTACAGATACACAGATTACTGTTAAATTGGAGACTTTAAAAAGGTATTTTCATGG -0.37142898 0.009005 1
266459 TGGTTGGTCTACAAGACTATCAAGATAACAAAGCTGATGTACTCTTAAAGTATAATCCAG -0.3173951 0.009036 1
59289 GCCAGCTTTCACCTCACGGGGCCCAATATTCAAATTGTACAGGGGACAAAAATGTTGAAT -0.6219962 0.009217 1
171170 CAGATGTTTGGACTTTTTCAAGTTATAGTGTTGTATGCCTGTTTGTGTTTAGAAGTGTTC 1.10608806 0.009515 1
105005 TCATGGTTGCAAGCAATTGGATACTATGGTTTCATTGAACAGCAAACACTATGTCCAAAG -0.37126281 0.009609 1
17532 CCCATCCCCAGTGTCTGAGCTCTTGTGTCTTTTGTAGATTTTTAAATTATTTGAGTAATG -0.28496139 0.009703 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.37128726 0.009735 1
625353 GAATCTCTCACAGCACCTTGGGATTAAGGTGAAGTTAGGAAAGTTCAGCCAATATGTTTC -0.30659246 0.009779 1
17064 ACAACATAACATTCTGAGGGGAGTCACAGGGTTGCCTTTAAAAAGTGGGAGCTATGTCAT 0.6041986 0.00979 1
20807 CCAGCTGCTTTACTTAAGAGTTGATTTTGAACTTTTTATTTGAGGAGATGACGTGAAAAC -0.28712626 0.0098 1
93873 TCCTTCAGAGTTCAGAGACAGAGAATGATACAAACCCTAGTTACAGGAATAGTTTTGAAT -0.57483335 0.009842 1
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.69462233 0.009898 1
27052 GCTTCCAAAATAAACTGTCTGCACTCCAATATTTGCCTCAATAAAGTCAAAGTTCTAAGG 0.94591629 0.010126 1
224024 TCTGGGACCTTCTGGATGGGCTCCTCATAGCAGGCCAAAGCTTTCTTTAATAAAATGCTT 0.44058432 0.010178 1
353187 CCAGAACTGTTAGTATTGCTTGTGATGCTTTAGTTAGGGTTAGTATATACATGTATACAC -0.31814206 0.010224 1
67574 GTGTATTTAAATCCTTGTGCCTATGATGATATTGGAAGATGTAGATAGAATTCCCTGGAA -0.25402685 0.010385 1
100039796 AGAGGATTCATGCTTTCCCTTCTCCTGATCCAGAAGATCACCATGGCAAAGGCTTATAGT 3.05267439 0.010546 1
27411 AGATCTTTATAACTGCCCGTTGTAGCATTAAAGGAAGCTGGTGTGCCCTTGCTGGAATTG -0.49107859 0.01055 1
22746 AACCTCAGTTTTGTCAAGTGAAAAGAACACAAGGACTAGTGATTTTATCAGAAGAACAAG -0.34544515 0.010551 1
12628 TTACCTTTTATGTCAATAGAATATTTGTTGTGGCTCCTTGCAGGAACATTCTCTATTCCG 0.32350419 0.010851 1
108907 AGGGAGGCTGGAAGACCACATTTTTGTTCAGTAGCCTGGAAAATCTATTAGTCTTATTGA 0.50561473 0.010882 1
241656 AGGAGAGTTGTGCTGCTGTCTCGATCTTCCTGAATGTTGATAAAAATGAATGACTACTAC -0.36198525 0.010931 1
13449 TATAGATGTTTTGTTCCTGGGACAACCCTGGCTTCTGGTTAGCAGCGAGAGTAGCTGTTG 1.14615388 0.010933 1
98256 CTTGCTATGGTAGAGCTGAGAATGAGAGACAAGGTGTTCTGAAGAGTTCCAGGATATATC 0.42906894 0.011182 1
11766 ACGGAAATAACAGACCCACGTAAATGGCGAAGTAAACTTTATTTAAAGGCAAACTGAGCG 0.64835449 0.011186 1
26411 AGACGCACTAGTGGTCATGACATGACCTTATCTCCCAATAAACTTGACTTTAGTCTTGTC 1.19419832 0.011395 1
109136 CATTATCATGGAGGCATATAGGAAATATTGTTTGCTGTTTTATGCTAAAGTTGTGGATCC -0.3691558 0.011405 1
14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA 1.23824882 0.011426 1
72003 GAAGAATCATAACTATAGGGACCTGTTGGCTTTAATCATGAGAGAATAAAGGTTAAATGC -0.39677461 0.011458 1
20840 CTGACATGTTTAAATGTGACTTTGGGATTATTGTTGCTTCAATTTATTTTGCCACTGAGC -0.92267795 0.011516 1
207911 TTCGCACGGTCAGCAATGCTCAGACAGCTGACGAGGAGAGGACAGAAAGCAAAGGCACCT -0.3330268 0.011556 1
666190 AGGGAGAAGATGAGGAAGGCAAGGCCTCCATCGAGGTTGCCACTAAAAGCCGTTACCAGG 0.3501665 0.0116 1
67576 CTTGTTTCATAGAAATGTAAATCTCATGACAGAGAAAATGGCCCCACAAATTAGAGCTTT -0.48205041 0.011612 1
22643 GTATAACTATAAACTGTGTGGTCAACTTGCCTTTATTGTGAGGTATGGAAAAAGTTTGGG -0.28022802 0.011724 1
17195 CTTTAGGGTACTCCTGACGTCCGCAGTTTGTTCTGAAAAATAAAATATGGGAAAATATAA -0.60084053 0.011812 1
12361 CCAGTTTAGGCATTTGCTACAAACTGAATTATTCCCAAAAGAAATAATCTATAACAGCCC -0.31506642 0.011967 1
16196 AAGATAGAAATGCACTTATTCCAAAGATACTGAACCTTAGTATTCAGTCGCTTTTGACAC 0.27314783 0.011974 1
212276 CCCTTTGTAGTGACTAGACATTTATTTGTGTCTATAGATAGCTAACAACACATGTCATTC -0.36642739 0.012009 1
17952 CAGAAGTGTTCTTTGTGCATCTAGTGCTTACCTAAAATTCATGTAAACTGATGTAAGTCT 0.72319237 0.012093 1
12442 CCTAGGCACTGGACTCCGATCCTGCGCTTCTCAGATCCTGTATGTATTTTATTCTAGTTT 0.45583652 0.012112 1
240119 GGTAGTCTTGCCAGGCTTCCAGACCCTTCGGTGTCCAGTAACCAGCCCCAACAATACACA -0.45345507 0.012289 1
70873 CCTGCCTCAATATAAGAATGCAGGGGTCCTTATTTAGAACAAATAAAGTAGGTTCGGATT 0.52694962 0.012348 1
114249 AAAGGCGTGGTCACACGGGGGAGATTGGATTGGATGATGTGAGCTTGAAAAGAGGTCGCT -0.3922245 0.012378 1
16193 CTGTTACCTAGCCAGATGGTTTCTTGGAATGTATAAGTTTACCTCAATGAATTGCTAATT 0.66196555 0.012487 1
73680 TGCTGTTGGCATGACAGATGATCAATTACCCTTTCTGTTATTACAGATACCATTTCCTTT -0.31695157 0.012662 1
12370 GTGAAGAACTGCGTTTCCTACCGAGATCCTGTGAATGGAACCTGGTATATTCAGTCACTT 0.80318574 0.012682 1
224530 TGGTCCTTGGAGGATGTTGACCTGTTTGAAATCAATGAAGCCTATGCAGCTCTCTCTGTT -0.2896657 0.012749 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 1.32526856 0.012759 1
235459 TACCAGAGAAATTGAAGAGGGGCTTGAAAAAGGTGTCCTTCAATAAAATTTTGTTTACCT -0.29880621 0.012775 1
333088 TTATGCCAGTCCTCCAGACATCCACAGTGTGAAAACACAAGAATAAACTCTACACTTGCC 0.37642651 0.012806 1
231506 GGGGAGGGTTTGGTCTATAATTTTTAAGCCCTATTTACATCCTAAGGTAGAAAGATTATA -0.314253 0.012909 1
70568 ATTACGATTTCAGCAGAAGAAATAAAGGATAACAGAGTGGTATTGTTTGAAATGGAAGCC 0.50519161 0.012942 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.34633544 0.013027 1
11459 ACATCGACATCAGGAAGGACCTGTACGCCAACAACGTCATGTCAGGGGGCACCACCATGT -0.30135005 0.013055 1
15975 GCTCTACCTCAAGAGACTAAGAGGGTGAACACAGTTTGTACTTTTCATCTTCCTTACAGA 0.47845213 0.013171 1
56791 TGAATGAATACTGCAATGCAAATGTGCTATTGTTAGAGGCTCTTAGAAACTGTCTTGAGA 0.61502577 0.01326 1
66226 ATTCAAAAGCATATGTCATAGTTAATATTTGTTAGATTGATTAAAGACTGAAAAGTTCTG -0.33236273 0.013354 1
66296 GCTTTGTGAACTTTTCCAGATTACAACAGATCTCAGATATTCAAGCTGAAATCTACCAGA -0.26534294 0.013508 1
73212 CTGGCGGTTCCAGAAGACAAGACAGACGTGGCTCCTGCTGCACATGTATGATGAGGACAA -0.30440854 0.013606 1
80892 CCGTATTACGGTAATAACATGGTTTCGAAAACTTTCTGTTTTTATTTTGTCACAGAGCTG -0.37207611 0.01366 1
171282 TGCTGGATGACATGAAATTCATGTTTAGGGCATTAATGGCTTATAAGTCACTGTACTGAA -0.24177913 0.013775 1
13711 TGTCTAGTGACCGGCACTGAATAGCAATGCAGGCTGAAGACCTCCAGGTTTAGAATTTAA -0.40678837 0.013824 1
109349 ATGGTTCAAGGCTGTTGATGGAGAAGTGGGCGGATGACAGCCGGGACTGTGGTCATCACT -0.29005351 0.014011 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.51237343 0.014065 1
75422 GACTGCTTTGGGAATGGCAAGAACAGCAGTATATTCTTTACACAAGTCCTCAACTAGGGA -0.23386393 0.014143 1
74915 TGGGGTGTCATCTTCCTCTGCAGCCCTTTCCTAGCTTTGAATAGCTAAGAGTGTTATACA -0.30118768 0.014164 1
71970 CTAAATACAGAAGTAGACTTGTGGTGGAAGATGATCTTCGCTGTGCTCTTGCAAAGACCA -0.31148625 0.014203 1
56219 TGAATGGAGTTAAAGACTACGGATAAAATGTCCAGCTAGAGGGTCACTGGTGTGTGCAGA -0.40881712 0.014247 1
171253 TAGAACTTGGTTATGTTAGTTTCAGTCCCTATGTTCTTATCAGTAGATATATCCATCCTC -0.35434743 0.014268 1
18439 GGTCAAAAAGCTCCCCAATCCATGCAACAATCACAAAATTAATGTTAGAGTTTCTTTTAG 0.52935727 0.014281 1
16426 ACTATATTGTTCCCAGCTTGTTCTGAGTAGCATGTCAGCTGCTGATGAAGTAGAAGGCCT 0.48679551 0.014314 1
240064 GTTAAATGCCAGGAAACATAAAAAGTGAGTTGTTTTCAAGCCTTTGAGATTAATGAGTGG -0.28556748 0.014416 1
319997 GGGGTTCCAGAACATAGAGCTTCCTGCAGGATCTCACACCTCCTGTGTCTGGACCAACCA 0.64485215 0.014434 1
68585 ACTCTTCAGTATTCCTGTTATATATGAACGGCATCAGGCGCAGATAGATCATTATCTAGG -0.29693663 0.014658 1
622139 GGTGGAGAATTTGGTTAAAGCATTGCATGTTTGTGACACGTAACTCTATACTCTATTAAA -0.28210678 0.01467 1
14871 ACTATAATCACTACTTTCCCCTTGAGTCTGGGTAATAAACTGGGGCTTGATTTGGGCTTT 0.34391842 0.014706 1
100038909 TCTTTCAATGTTCTACACGCTGGGAAATAAAGCTGATGACCCAAAGTTTTCTGTCAAAAG 0.72680589 0.014822 1
211896 ATTGATGAAAGTGAGTATTCTAGCAGTACAAAGAAGAAAACCAAAGATCAACTGTTGAGC -0.31406385 0.014837 1
74183 AGGGTTGGATATTCTCCAAGAGCCCCGGACAGGATATCCATAGAATGTAATAGCATCCTA 0.29159164 0.014863 1
232157 CACAAGGCATAAATCACAGGCATATGTGGACTGAGATAACCAAAGTTATTTTAAATGACT 0.40132646 0.0149 1
12095 AAACCAGTATGGCTTAAAGACCGCCTACAGACGCATCTACGGTATCACTATTTAGGACCT 0.88875002 0.01491 1
331461 GTTTTATAGTCGTTTCATAAGTCTGTTGCTCTCTATGAGTATGCTCTCTATATATCCTGT -0.28316707 0.014947 1
70441 TCCGCACAAAACCTGCTTTTGAGCCCTTTGGCTTTCTTCAGGCGAGCGCAGTCCGTCCAT -0.36370782 0.015023 1
66448 TCAGTGACACGGCCCCAAACTGTCCTGTAAAGATTGTATAAATAAAGCCTTTGCAGTGTT -0.26914787 0.015062 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.37843172 0.015549 1
19222 CAGTTGCTGACTTTGTAAATGATCCAAATACCACTGAATGGATAATTTGCTGTGAATGAT 0.48838761 0.015565 1
72003 CTGTGATGTTGAAAGCAGTTTAGCACAAAATAGGCTGTCTTAAATACTATCTGTAACTAG -0.43044611 0.015646 1
11514 GGAGATATATGTGAAGGGCATCAGTGAACAAGAAGGGAAAATCAAAACATACTTTCTCCT -0.29203092 0.015755 1
20307 ACCAGAAGTCTCAAATTCTGCAGCCTTGAACCTTCACACCTGAGTTAAGAGACAGCCAAA 2.52859261 0.015904 1
54160 ATGCTTCTATTTAATGTGTGAAAAACTCTTGGCAATGCTGGAAAATTTTATCCCAGAAGG -0.29169576 0.015909 1
268288 ACAGCATGCGGATAAGGATCATTGAGTTTCTCCAGGCAGATATGACTAAGTACCTGGAAG 0.34803266 0.015944 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.36454413 0.015984 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.57827073 0.016 1
94045 GCTCTCAGAAGCCCAGCCTTGATGTGCTAATGAGATAAAGGATAATTTTCACTGAAAAGC 0.65971596 0.016003 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.28260724 0.016022 1
18701 TGTCATTTCAACATGATGTGATTGTAGCTTTTTAACTATGAAACCCCTGAGAGATTGTAC -0.28302731 0.016058 1
22685 TACTCTGGTTTCTCATATGGGTAGAGTGTCTAATGCAATTCTGCCAGTGTTGTTAGAATT -0.32714491 0.016157 1
78197 CCAGTGTGACTACAGACCATGGACACCTTCATGGCCCTCAGTGGCAGTACAGGTCATGGA -0.30986215 0.016187 1
338467 TTTACTGTATTATGAATGTAAGTGTTTTTTAGCCTGGAGTTAATCATAAATGGGCCTGGG 0.33793133 0.016301 1
22163 GGCTTTCCTATGTATGCTATGCATACTACCTGCCTGGTGGTGCTCCTAATAAACATGCTA 0.90083566 0.016362 1
57339 TTGAATATTGGGTTGGCCATTCTTTTTGTTCACTTTCTGACTTGATTGGAATTAGGACAG -0.26162388 0.016385 1
22685 TTTCCCAAAACCACAGATTTCGGTGACTCTTTAAAGTTATTTCACCAACATTGAAAGTGG -0.29512637 0.016537 1
321003 TGTTAGATAACAATAAAATTAAATATATGGGATGCATTCAGTAGTTATGAATACCCTATG -0.2325096 0.016542 1
68328 GCTGCTTTTGTTAGAGTATTCTCAGTGTTGCACAAAGAAATACATGAACAAGGTGAGAGT 0.37488903 0.016718 1
320127 CTGTACCTCACGATTCTACTGTAACCACCCATCGATTTAGAAACTATGCTTTCGTCTCTT -0.31755041 0.016874 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.38534736 0.016883 1
211232 CACTGCTGGAAGTTAAAGGCACCTGGAGCTCTGAACCTGACCAGGAGGGCCATCTAGGTT -0.86418941 0.016885 1
66259 ATCTTTGAATGAACCCCATTTTAAAGCAGAAAGTAACTTTTCTACGGACTGATGCTTTGG -0.36857689 0.016959 1
381485 AACCAATGAGCAGGCAGCAGTGAGTGGTAAGGAGTCTAGTTCAACTGCAGCTACCTCTCA 0.32230308 0.017007 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.2453608 0.017138 1
12842 TGACCAACTGAACGTGACCAAAAACCAAAAGTGCATTCAACCTTACCAAAAAAGAAAAAA 0.72773669 0.017264 1
74129 AAACCTTTCCATTGCTTCCCAAACAGAATGGTTTGATGAATTAATGATTTGCATTGTCCA -0.32122715 0.017427 1
15312 AATAAAAATTGGAATGTCTGTACTCTGCTCCTCGACCAATAAAATCTGTTGTGAAAGAGT 0.40736508 0.017541 1
17168 CATGCCTGTGTGTGGATGGAAACAACCTCCCTTCTGCCGCAGAGTTCCTGACTGGCCTTA -0.26150286 0.017637 1
235584 CACACATATATATCCCGAGCCAGCAACGGGACGTTGTTTATATTGCAAATAAATATTATT -0.28832786 0.017645 1
17454 ATGCTAGGCAAGCACTCTGCCCCTGAGCTGCTTTAAGAAAAACAAAATGCTGTTCTATGC 0.38309492 0.017756 1
73610 GAAACAGTAAAGCTTTGGCACATCAGTGTAATCTTCAGATGCATCAAAAAACTTATACTG -0.3215468 0.017768 1
13101 TTCCAGTCATGGTAGGCAGGGCAGGCTGAGCCATGCAAAATAAACCAATCTTGTGGCTGC -0.30244977 0.017851 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.58196374 0.017991 1
20304 TCTCAGCTGCTCCGAGGCTCTGCACAGCAAACCCAAGAAATCAGCATTTCATTGAAATTT 2.70517912 0.018017 1
15042 AATGTAAATAGTTTACAGCTCAAGGCAGACCTGGCCATGATCCTCAGAGGACACAGGTTT 0.46191131 0.01815 1
18712 CCTTGGGATCCTGCTCTATGACATGGTCTGCGGAGATATTCCGTTTGAGCACGATGAAGA 0.73761776 0.018168 1
216441 AGACTCCTGGATAGCGTGTCTCCAGAACAACTCTTTGTGAGTGTCCAGGATGCTGCTGCA -0.63725886 0.018349 1
15312 TCTGAAGAAGAGAAAGAAGCTAAGTCCGACTAAGCATCCATCACGTCTGACAGTGGTCCC 0.44864495 0.018393 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.33931554 0.018425 1
231125 AAGTCCCCCAGGGAGTACTATGTGCAGCAGGAGGTCATCGTGCTGTTCTGTGAGACAGTG -0.2431151 0.018495 1
224405 TTCATCTTGGTGACAAAAGCATGTTCAAATCCAGGAGAGGCTGAAAGGCCAGCATCTATG 0.4386274 0.018537 1
67062 TGTTTGTTTTCTTTTAATAGTGGATTTAGTTTTGTGCTAATTATGATGCCAATGATAATA -0.22317388 0.018634 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.58768772 0.01864 1
22268 CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG 0.3298371 0.01869 1
74155 CTCCGCACTGTGTGTACAGTATTGGACAAAGGATTTATTCATTTTGTTGCATTATTTTGA -0.29121423 0.018699 1
215705 GGGGTAGGGCGGCAGAGATCTGGGCCTGGAGAGACTGTATAAATAAAGCGCTTTATTTGT 0.47563885 0.018797 1
13637 GGGGGGAGTGGGGTGGACTTTTTAGGATAGAAGCAACACTTTGCAATAAACTCATTTTTT -0.24744374 0.018816 1
56484 GTCTATAGCCAAGTTTTGTAGAGCCAGTGGCATCTGGTTTTGTTGTTGTTTTGGTTTTTT -0.35129026 0.018835 1
14373 ACAGCCCAGAGCTCAGATGGAAAGTGTGCAGGAGCTGATCCCTCTGGCCAAGGAGATGAT -0.25148634 0.01885 1
14406 TAACACTGTCAATATGGATATATATTACACATCATCTAAGTCTCAATCATCAGCTGCTCC -0.31484108 0.018878 1
14256 CTATATACAACAAGGCTTTCTTTTCTTCTTTCTTGGTGCTAGAGTTGGGAACCAAAACAA 0.47289473 0.019008 1
22762 TCAAATGAACTAACTGAGTTACTAAAGAAAGCAGTCACCTTTGGTACCCGTGTTTAGTAT -0.28138383 0.019032 1
381802 AAACCTTGAAATACTGAGTGACGGGTGCATTCTCAGTGAACTCACTATTTGACAGGTTGG -0.31215924 0.019173 1
19088 TCTGTCTATATTGCATATCATTCGACCTTATCCCTAGCTTTAAAGTAAACTCACAGTCAA -0.35789275 0.019196 1
237759 ACACGCCCAGTAGTGAAGCTGCTCACTGTGAATGCCAGCTGAGGAAACCCTGCTCTGGAT 0.55346953 0.01922 1
14087 TACACTAGAAAATAGATTACCAATCTCCTTGATTGCTCTAGTTAGGAAAAGAAATATTAA 0.34241318 0.019223 1
382019 GCACAAACCATGTAGCTGCTCTAATCATAGTGTAGATGTAGAACATACTATTTGCAAATA -0.33263599 0.019231 1
100045796 TTTCTTTCTTACAGATGGAAATAGCTGTTTTTCTAGAAGAGACTCAGGTAGTAGCTCTGG -0.24847289 0.01924 1
16153 GGAAAACCTCGTTTGTACCTCTCTCCGAAATATTTATTACCTCTGATACCTCAGTTCCCA 0.31169094 0.01931 1
52377 AACTCTGAATGTCAACAGCACAAGCTAACCTGTCCTGCCTAGGAGCAATAAAAGCTGTTG 0.59929086 0.019439 1
81898 ACACTTCTCAACTAAGACCTTTTCTTTAGCACTTTGATGTTTCTTAAGGTGAAACTTAGG -0.27344449 0.01944 1
14411 ACAGCTTGTCACCTCTCAGTCCTTTCCAAGTGAGCTCTAGGAAGCTGAGTCTGCCAAGTG 0.70163173 0.019475 1
73673 CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC 0.36144923 0.019487 1
100043757 CGGGTGGAGCTCAGCGATACCAGCAGTGACGATGAAGACAGACTGGTCATTGAGATCTGA -0.27115541 0.019516 1
69430 TCAATCAATATGTAACTGGTGAGCTTTCAAATGCTTCTTCATGCATCTTTAGGCTTGGTT -0.52782281 0.019543 1
258552 TTCAAATCCACAGTCCAGTCATATCCTACGTGGGCTGCCTCACTCAGATGTCTCTTTTTA -0.30805775 0.019578 1
74430 CCATGGAGTCAAAAGGAATGGAGAGAAGGGCTTTGTAAATAGCATTTAATGTTAAGAACA -0.38037131 0.019594 1
171244 AAACTATCCTCATCCTGGTGTGCACATTTATCATCTCTTATACAATCTCTTCTCTACGTG -0.39935713 0.019612 1
258951 GGCTCTGTGTTCTTCTAGTAGTAATATCATGGGCCTTATCTTTAACCAATGCTCTTGCGC -0.56163034 0.019735 1
78908 CAATTTGTATCTTATCTCTTCCTTCAGCCGGAGTTGTTGGAACCACTTTATAGTCAAGAT -0.28726885 0.019867 1
18241 GCTGTAATGCTAAGTGCCAGATCCAAATCCATGAGAAAATAGTTAAATAAAGTCATTGTG 0.31632399 0.019908 1
66832 CAGATGTGGTTTAAGGGCTTCTGCCTTTTTGTGACACAATAAATTATAAACCTGGAAAGA 0.310214 0.019975 1
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.89005929 0.01998 1
225160 GATCACAGAATTCACTGTCCAAAGGAACTCATCACCTTTACTACTTTGTATTTCTTTTGT -0.30795457 0.019998 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.56032768 0.019999 1
71837 AAGTGCTTTGGAAGCCCATGGTTATTTCAGAAACCATGAAGCTGGTTCCTGGTGTGAGTA -0.31057573 0.020155 1
16525 CCTAACAAACTCAAGAGAAAATCGGTACGATATTCTGTTCCTGTATACATTTCTACCCTC -0.35121517 0.020184 1
16528 AGACCAGTTTCTGAGGGACCATCCCTGTGTGAGCCAGAAGAGCCTGGAGGATTTCATCAA -0.70160236 0.020189 1
216166 CTGATGGGTAGGGGTCTTTGATTATTTATAGTATGACTATTCAAGCTAGAATTTTGTTGG -0.55400178 0.02035 1
15945 GCTTTGCATTGTATATGGAAGAACTTGTGTCATCAAGTATGTATCAATGGGTAGTTAAAG 2.64868268 0.020471 1
75426 CACACTTATGAGTGTCATGGGTAAACAATGTGTGATGCATTGTCTGAAATGTTCACCAAT -0.71121233 0.020718 1
50525 GGTTTGGATGCTAATGCAGAAGCTAAGATAGGCTGTTAGGTTTGGTTTTCTAAGAATGTA -0.27826169 0.020761 1
195046 AACCTGCGGAGCCACACACGTGCACCTTTCTACTGGACCAGAGATTATTCGGCGGGAATC 0.61811887 0.020788 1
242418 GACATTGAGCACAGTAATAGCATTCTCATAACTTTTAGAAACTCTTGCAACAAGATAGCT -0.27203222 0.020911 1
105364 CCTGGGGAAAACAATGCTATTCTTACTGAAACAAAAATCACCTTTTCAGTAAAGAGAAAC -0.40234328 0.020951 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.2452981 0.020962 1
69601 AAGAAGGATCATGCAGAGATGCAAGCAGCTGTAGATTCCAAACAGAAGATCATCGATGCC -0.28148985 0.021178 1
414095 GCCACCTCTGAATGCTGTGATACAGTGGTAACATGGGAAAATAAAGTCTAGCTATTAGGA 0.30483284 0.021207 1
30050 ATTTGGGCTGGCAGATAGATGATTCTGTTCAGGACTCATTGCACTGGAAGAAGGTTTATT -0.30240345 0.021237 1
73162 TGGGTTCCTTGTACCGATTCTTGAAGTCGCTCAGCACAATCATTAGAGACCTTCAGTGAC -0.23916065 0.021239 1
213006 GTTCATCTCCATCCCAGTCTCCTCAAGAATGAGGCCAGCCACCATGGTGTTCATCAATGT -0.40384513 0.021271 1
18707 TGTGCAACCTTGACCCAACAGGTAAAGACAGGTGAAAAGAAATAAAAACGTTTTTATGTT 0.34479795 0.021287 1
237403 GACTTTCCCATCACATACAAACTGATTGACAGGACACGAATGACTGGGTTGACTGGCATT -0.46146405 0.021327 1
108797 CCACTCGTTTATGTATATGTAGGTGACGTTACTTGAGCTTAAATGTACTTTACTGAGCAA -0.34507603 0.021338 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 2.01979587 0.021366 1
107753 ACCAGAACCACAGCCTTTAGGGTCTGTGCTTTTCCCCAAGGTCAAGGTCAAATAAAAGAA 0.3114696 0.021426 1
14403 AGGCCTTTTCTCTGTGGGATCAGGATCAGAGAGAAAAACAAGTGGGGGTGGATGACCACT -0.4477026 0.021441 1
276919 CGTACACAGTGAAAGGAGTACAAGAGCAGTGTAAAGAAATAGTTTTCTTAGATATTTGTC -0.221097 0.021512 1
17168 AAATTCCGCAGTGTGCTGGTGGTGACCACCCATGAGGACCCTGTTATTGCCGTCTTCCAG -0.26837507 0.021706 1
12154 GTCGTCACCTACAAGTTTAAATATGAAGGGATGGCTGTGTCTGAGTGTGGCTGTAGATAG 0.29434382 0.021766 1
14955 TAGTCTGGAAGCAGTTCCATCATAAAGTGTTCAACATGCCCTACTTCATCCTTTGCCCCT 0.47175161 0.021768 1
258832 ACTTACTGAATTTGGTTGGAAATGGAGTTATATTAATGATCGTCACTCTGGAAAGAAGAC -0.26488926 0.02179 1
320189 ATGAGCCTGGGCATGAACTCTGGAGATGTGATGTGGTCTACTGTCTGGATTCTTTATGAA 0.50796708 0.021801 1
67307 GTTTAGGAAACAAATCCTTTGTATTTTGAACTCAGCTAGGAGTAACAATCAGGACAAACC 0.25046871 0.021872 1
22051 CCAACATCTACCCTTAGTGTTTGCCATCAAATGCTGTCTTTTCTTCCTCTCTTCATGAAA 0.38547387 0.021929 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.53011281 0.022026 1
432450 TGGGTGACCTGGAATGTATTTGTTATCTGCTTCTATTTGGAGGCTGGAGATCTCTCAAAG -0.26490896 0.022056 1
218518 CCTGGCAATACTCTTGCAGACTAACTTTTGTAGTGAGACCTTGTCTCAGAGCACGAAACA 0.26197942 0.022066 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.53813242 0.02209 1
353346 GCCCATCTATTTCTATGGGCCTACATATATAGAAAACTGTTATCTATAACATAGACATGC 0.33391852 0.0223 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.26248676 0.022323 1
70478 TAGCATGAGGAAAGGAATCATTGCATGGACTTAGGTGGTTTTCCTGCCATTAAAGTCAAG -0.24789534 0.022346 1
448987 TGTCGTGCTGTATGACTCTAGAAAGCCTTAATTTACTTCCACCAAGAAATAAAGCAATAT -0.29325597 0.02243 1
16775 TTGGATGTAGACTCAGAAGTGAACCATGTAGTTGGGCCGTTGAATCCAAAGCCAGTTGAT 0.36959031 0.022488 1
380608 TAGATGCAAAGGGTGTCTGCGTACATCCCTTCATGCATGCACTTCTGTATGTTGTTTTTT 0.41694342 0.022576 1
226413 CTCATTTCAGGGTTTGATGGTAGACTCAAGAGCACGGACTTCCTTTAGTAAGAACCAGTC -0.59421968 0.022636 1
243574 GCCACTTTTAAAATGACTTTAGAAAAGGTCCTAGGAAACTTAAGATTAGTGATGTGTGTG -0.24656096 0.02273 1
66645 AATGGTTCATTCCTGACTGTTTAGAAAAACATTCAATGGTATGTCTTTACACCATGTCTG -0.24936778 0.022767 1
52715 ATACTTAAAAGTATATAGTTGGTGGTTAAGCTTATGAGATGAGTGAATGGAAAACCTGGG -0.39868652 0.022769 1
20602 GAAATGGACTTGATGCGTATTCTGTGGCCGCTCTCTGTGCACGGCGGCATTCTGTCATTT -0.31713315 0.022799 1
20911 TCACATCCTTACTCCAACCCGCTTCCTCGATGACCTCAAGACACTGGATCAGAAGCTGGA 0.50760103 0.022868 1
17069 TATCATTGTACCCACCTTGTACTCTGTTCAGGAGGCTGCCCATGGAGGACTGCCACCCCT 0.6986389 0.022901 1
15932 CCCAAATGACTCTAGCTTGTAATAAACTGAAATAAAGCCACCCCAATCTTGCCACACATT 0.35103077 0.022927 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.222826 0.022933 1
399548 TTCCTATCTAACTTTATAGGCAATACAGTGGTGGGCCGTGGGAGCCTCCAGGAGGCACCG -0.79115807 0.02299 1
226250 GGCATTTATTTCCTGTATCATAAACACTTGGTGACCTTTATCAAGTGGTGAGTTAGAATT 0.3872886 0.023001 1
68498 TGTCTTAGAGATCACTCTCCATAAAGATGGGAGTCACACCATGTGGGGATCACACTGTAT -0.47395057 0.02303 1
17329 ATGGGATTTCATTATTAACTTGATCCCATCTTCAGAGCTTATTCTAAGTTTGCCTCTTCA 2.89768164 0.023043 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.53856911 0.023047 1
67179 CAGGGCATTCGTTTCCTTACTTTGGAATAGTATTTATGTTGAATTGTAAACCCACAGTTG -0.29311197 0.023075 1
100502705 CTGTCTGTGTTAGGGCCTGGAAATCTTGTTTCACATAGATAATGTAATCTAAGCTTTAAT -0.29791221 0.02309 1
100043699 AAACTCCTCCTGCTGCACTCAATACCTGCACCAAACAAAGAAAATTGTGTTTGCCAGGCT -0.56161907 0.023407 1
100043772 GATCAGAGCACTCATATTCTTAAGTCTATGACTGAAAAGATTGTGGGAAGAACTTTAGGA -0.26304572 0.023572 1
11630 GGTAAGATATCCTATAAACGCCTGTTGAGTTTGTCTCTTGAATTAAACTTATTCCTGGTT 1.22370917 0.023765 1
269470 AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG -0.2232219 0.023786 1
107849 GGTTCTTGCAATCTGACAATGAAGATGCTCGCATTCGTTCTTCATATGGCATGATCAGCT 0.26719762 0.023799 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.34019953 0.023867 1
77963 TCCTTGCCCAGTAATTCTTAACCACTTAAAATAACAAGAATTTCACAATGATTTGGGGTC -0.61814773 0.024081 1
212892 TTACTTAGAGATGGGAGGTAGTGTTATCCAGACACTTTAGACTTACGTTCTCTATCACTC -0.25047349 0.024128 1
382075 GTACCTCCGGTCATCCTGTACTGGCTATATAGCCCATGACATCTCCATGTTCCAGGAGCC 0.32843865 0.024128 1
67547 GTGATGAGAATTAGTAATAGAAGCCAAGTTATCTCAGGAATTATGTTTTCCTATAAGCCC 0.47391787 0.024138 1
13841 CAGTTAGGCTGCAGTGTAAATATATAAAGACATTGTTCTGAGAGCAGTACGATTTCATGG -0.50140307 0.02416 1
21822 CATTAATAACCCCATGTGCTAACCAAACCCAGGCTCTTTGCTGACCATGGTAGTATTGGT 1.34075415 0.024174 1
16857 ATCGGTTCCAAGCTTTACGAAAGATAAACACGCTGGAGATCAATGGTGACCTCACCTTGT 0.40158727 0.024184 1
66714 AATGTTCATTTATACATAATTCTGGTAATTATTTAAATTGTTACTTCATCCTGGAAAAAA -0.21758015 0.024318 1
64380 ATCAGCAGTCTAACTCTGAACACTATCACCTCTGTGTTGGCTGCAACTGCAAGCATAATG 1.90256116 0.02437 1
241303 ATTTTGAGTTTTGAGATTAGATTGAGCGCTCTGCACTGGGTCCTGCAACCTCCATCCTTT 0.22490813 0.024384 1
53975 CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG -0.22184746 0.024429 1
66164 GAAGGTGGGGACATTGCTGACCTTTGTAGTCCTCTACAATGGATTAAAATTTTTTAAACT -0.33524039 0.024445 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 2.09053389 0.024458 1
80892 GACAGTGAGCTGAGCCAGAAGCTACAAGACTTAGATAATTCTTTGGAAGTGAAAGCTAAA -0.33654112 0.024472 1
16428 ACTGCAGGTATGTCTTACCCTCTGTGGGGGCCACAAGTCAATCATTGCTTATGGAAAAAA 1.13563393 0.024523 1
60361 CACTTCATTGCACTGGCTTTTGAGGTGAATATTAGATTTACTGTAAGTATGTAAGTCAAG 2.30164939 0.024533 1
50927 GGGGGGAGAAAGTGTGTTATTTTCTGTATAGAAAGGTTACTATATGTCAATAAGTGGAAT -0.26914984 0.024565 1
12064 GTAAATGTCTGTGGCCTTGTTCTCTCTATGGTAAAGATATTATTCACCATGTAAAACAAG -0.32123818 0.02467 1
239985 GGAAAATCCAACCATGAAGACTTGAATTTAATTCAACAGGAAAGACCATCGAGTCTACCA 0.23968194 0.024676 1
433424 GGATCTGGGATAGATTATACCTTGAAGTCTCCGCAAACGCTTTAGTGGAAGAAATGAAAT -0.30811956 0.02472 1
276919 CTGAAGCCTTTTGCCCAGGAACTTCAGCTCTCTGTTCTTTCTTTGAGAGTGTTCCAGTTT -0.22179635 0.024777 1
213006 GATTTCTAGGATGGTATATAAACCCACAAGGAAGTTTCCAGTTTAAGAAGAAAAGTCTAG -0.31215307 0.024873 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.5214568 0.025107 1
381822 CGGAAGCAACCTGAGGCGTCCTCTTTGTCTGTAAAGATAGAGAGTCCATTGTGGAAGGGG 0.63138351 0.025123 1
16635 GTATTTGTGGGAAGAGATTGGACAAATTCCCTCATTGACTCTCCAGTGAGTGTTAAAAGT 0.84786584 0.025188 1
230073 AGTTCTTGATAGTGGTTACTGGTAAAATTCTTAGTGCAATAAAATGAATTTGCCGAGAGC 0.51733554 0.025206 1
328232 AAAGATGTGTGTTATAAAGTAAAACAGAGTCTATATTTTATATATAATGTAGATAGTAAA -0.31024111 0.025257 1
17996 GAAGCCTGGGACAAAGACAAGACCCAGATCCACATCATGCCTGATACACCAGAAATCATG 0.50576137 0.025464 1
75624 TGAAGCCTGGTGTTCGATACAGAGAACTGGGAAAAATCATTCAGAAACACGCCCAAGCAA -0.24302375 0.025476 1
11479 AATTCTCCAGACTCAAACGCACATAGTTCAGTCACTGGAAACGCTTGTCTTTGCACCTGA -0.35083664 0.025603 1
330119 TCTAAGGAAGAAAAGAGCCTAGAGCCGATTGTGCATATCAGCTGTTCTGTTCATTTGTTG -0.3065792 0.025651 1
22268 CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG 0.36908174 0.025656 1
332397 AAAGTTTCATATAACACTTTGATAAAGTTGGCTTCTGCCTAAGAAAGCACTGTGGATCTG -0.38593119 0.025768 1
22694 TTGCTCCCCATGGTACTGTAGTATAAAAAAGGCTATGAGAAATACACTCACTGCTGGCGT -0.20150517 0.025821 1
80914 GTGCCAACTAGTACTGGTGATGCCTAATTATGAACCCAACGTGTAACCAGTTATAAATAC -0.32145148 0.025843 1
16618 ATTTGTGATGGTATTCTCCAAGGAACCACATCAAATGGCCCTGAACCATGCGGTAAACCT 0.30713987 0.025853 1
192236 TGGACTCCTCCACAAAGGCTGAGGAGCAAGCCTTCTCTGAAGGGCAGGGATGCCATGATT 0.39394697 0.025928 1
94176 GAGTAACGAGTATGACATCCTCGTCTTTGATGCTTTGATCTATATAATAGGACTCATTGC 0.58547356 0.025941 1
69310 TCAGATCCTGCCAATCCTGAACATCTTTAAGAACATGAATGTGAACTCCGGGGATGGCAT -0.26639703 0.02598 1
320802 GTTCGGGACAAGAAGCTCTTGAATGACCTGAATGGAGCTGTGGAGGATGCCAAGACAGCA -0.31720728 0.026021 1
224754 ATTTTACCCTGCTGAAATCACCCTAACCTGGGAAAGGGACAAAAGCAATCAAACCCTGGA 0.51535779 0.026064 1
236749 AATATGATGTACTAAGAGGAGTATACCAAGCAGTATGGAGCCATAGCTGTCCACAGCAGC 0.83409352 0.026129 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 2.00379147 0.026215 1
19401 TCCTGCTGGGTTTCCACTGAGATCTACTGGAGAAAGAATAAAGTTCTATTTATTCTATAA -0.36488801 0.026251 1
320127 CAGGGCACTGTTCTCTCCTTCACTACGCAGCTAAGACCGGCAATGGGGACATTGTGAAGT -0.24221886 0.026256 1
73673 CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC 0.38665938 0.026534 1
75547 AAGTCGTCTCCAAATGCTGTATGAACATTTCTGTACTAAGCCCTATTAAATAAAAAGTCG 0.38613429 0.026552 1
73293 AGGAGCTGCTAGAACTGTATGGAGTCCATTGATAGGACTGTTTGCCCTCAGCATTCCTCA -0.35956927 0.026698 1
73049 GGCAATGGGCCTTTGAAGTTGTAATCAGTTTAAAGGAGTGAAATTAATGTAAAACAAAGC -0.33862964 0.026713 1
74901 AAATCTGATCCGGTGCCAAGGAAAGGGTATGTGCTGCCAGAGACCCCAGGGCAAACCTCA -0.27162142 0.026736 1
219189 AGCATTGTCCTTCTGACTCTTAGACGCTGATAGTCCCTAATCTGCTGTAGACACTACTAA -0.29401993 0.026749 1
66632 GCATCATTACACTCCTATAACACAATAGTTTTACTGTCTTAAGAATCATGCGTAGCCAGG -0.28935798 0.026762 1
236546 TTTCAGCAAAGAGCAAAGCCATTGCTCTGAGGATGGCTGGATTGCCAATTGGGATCTATA 0.31339357 0.026763 1
20610 GACTCAAGATAGGTTTTGAATGGTGAGCCCCTGTAAAATAAACAAGTTACTCTGACATAC -0.26705157 0.026832 1
66412 CATCAGAGTGGACTACTCCTTAGCTGTAATCCAAGCTTCTTGAATCATTAAAAATACATA -0.5018268 0.026845 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.47277386 0.02687 1
68861 GCCCATTAATAGACGCAGTGAAATATTTTTGAATCAAAACATTTGGGGTTTGTATGTGCA -0.49651826 0.026875 1
241528 TGGTCTCAGTTAGGGGCTTGATGTAATGTATTTGAAGAGATCAGGACTTGAATTTCATTC -0.42806648 0.026901 1
13601 GTCCAAGGAAGAATGAGTCACCCTGAGCCTCAGAGGATTAGATGGGGGAACTCCGCCCTA 0.50397429 0.026902 1
17472 GTGTATATCAGCTATTATTTAAGCTACCTTGTGATATTGTTTCCACGGTACTGAGAGATA 2.61204612 0.026918 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 2.00622549 0.026948 1
20652 TAAGACTGCAAACTACTTAGCATTCAAAGAGCGTCTTAGGACAACCTCAAAAATACAAAA 0.57276947 0.026955 1
23876 TTAAGAGTTTTTACCCAACTGTGTTGGAAGACAGAGGTATCCAGACTGATTAAATATTTG 0.61819455 0.026994 1
230789 TTTTCTTGATAAAGGAATGATGGTAGCCTAGCTAGTTCTTGTAAAAGTGATGCCTCTTTG -0.25275607 0.027105 1
494448 TCAGACCCGTATGCCTGTGCTTAGCTTGCCTCAGATGGCTCAGTGTTGACCCAGGGATAG -0.28145945 0.027133 1
216864 CGGGTCCCCTCCTCCTTCCTTCATAACTAGTGTCGCAACAATAAAATTTGAGCTTTAATC 0.43901044 0.02719 1
668501 CTGGAACGCCATGTAAAAAAGCAATGATTGATTCTGACGCTGATTCATTAAAACTGGATG -0.28498509 0.027199 1
23928 CCCCAGGTCCCAGAGGAACTGATTGTGATTCTGAGGAAATAAAGGACCCTTTTCCTGTGC 0.34766238 0.027328 1
100504389 GGACAATGCATGCTCATCTACACATGTCCATGTATACACACATAAATGTAATAAATCCTT -0.23836624 0.02734 1
100233175 ACCTGTGCTCTAGTTGGGGAACTCATTTCTTTTGTTTGATTGGAACAAGTTCATCACAGA -0.27600952 0.027341 1
56298 GCGTGTGGGCTATATATGTAAAGCTACCATTTTTCCAGTACTTATAACCTCCTTTACAGA -0.22860539 0.027351 1
19272 AAAGGACTTGATCAGTTTCTGTGACTGTATGAGAGCATCCACATTTCATGCCACCTAATT -0.43616347 0.02741 1
75541 TTGTACAATTGCAGAGAATACGTGACTGATCCTTTGATATAGCCCAATATTGGGCCATAG -0.23603908 0.027428 1
80334 TTTACGACTGTCTGCAACAATAAATCAGGTATCTATTCTGGTGTAGAGATAGGATGTTGA -0.40119821 0.027446 1
16443 TTTAACTAGACTGTGGGGTTGCTACAGATTAATATGAAATGGCGCTCCTGGTCCGTGTGT 0.41843216 0.027482 1
320714 TTTGTTCAGTCCTTGAGCACAGATGTTTACACTGTAAGAATAAAAATTCTTTCTTGTGGC -0.29215842 0.027483 1
13185 AGGGAAACTGAGAAGACTTAGCTGAGTCACCTGACAGTGAGTTCCCAGAGAATGTACTTT 0.44916704 0.027581 1
243274 GAATGATGCTTTGGTTCAACTTAGGAGGTTTAGTATGCATGGCAAGATGTTGTCAAACCT -0.47312965 0.027631 1
16987 CGCTTAAAGTTCTTGGACTAGCTTCAGTGAGAAAGGGAAGAAGATGAGCCTTGAGATCCA -0.2814262 0.027652 1
93881 GTATGCATGTCCTCCATTACCAAAGTGTTTACTTAGTTCACAATATCCACTGTACTTAAT -0.23688902 0.027682 1
105785 ACTGCTTCATGACTTCAAGCCAAGACTTGGGACTTCATGTTAGAGTGACTGGTGTGAATT 0.43114227 0.027717 1
16188 AGCTCTTGAAGACTGCGAGGTGACGCCTGTGACAGACGCCTGAGAACTGTGTGGGGGCTG 0.93867228 0.027732 1
230597 CTCAGTGAAGGCCCTGTCGTCATGGAACTCATCTTTTATATTCTGGAAAACATCGCATAG -0.29322519 0.027779 1
767814 CTACGATTGAATCAATGTGTTGTCATGGATGAGTTGGTTATTCAAGATCTAATCAGTAGT 0.28252974 0.027815 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.56950194 0.027856 1
68026 TATAGATATAGTAGTAACTGTTTTGAGATAGGATCTCATTATATAGCCTCTTAGGTGGCC 0.22465122 0.028024 1
100689 CCACAGGAGGAACAAACGAAGAGGGGCAGTTTTTCGAAACTTGGCCCTTGTGTGTCGTTG 0.33427045 0.028067 1
110948 TCATAAACGAGTACCATCTTTATCCAGCTTCTGTAGTCAGGGCCAACTCCAGAAACCAGA 0.32649765 0.028235 1
234311 TTTAAAGAAAACATGTAGCTAATATTTTTCTTCATTTTAATTGTATATAAATGACTGTTG 0.40676697 0.028251 1
11752 ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT -0.38188452 0.028252 1
16992 AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC 0.37567859 0.028256 1
71780 CAGGCACCAACACCAAAGCTGTCCACTGCTTAAATCAAGTGACCGGACCGGACCCTTCTA 0.24425644 0.028359 1
75288 CACTCAAATGACACTATCAACTCTGAGTTTAAATAACCCATATGTGAAATATCGCCAACA -0.38589998 0.02836 1
224432 TTAGCCAAGTGGGAACCATAGACACTGTCTCAGAACTTAATAAGGGGGAGGCCATGGCCC 0.27873309 0.028379 1
104103 ATAGTCTGTTGAGTTCAAAGCCGGACTGATCTACATTCAGAGTTCTTGGACAACCAGGGA 0.41803828 0.028391 1
232854 CATCCCCTTTTCTCACTGAATATGTATGGGTCTGTATTTTGTCTAAACGAACCTGGTCTG -0.274417 0.028414 1
13650 CCGACAACCACCTCATGTGGTCAATAAATGGACTGGGAGCGTTTTAGCTGCCACTAACTC 0.36812004 0.028425 1
209378 CCCAGTATTGCTACTCTATAGCTAATGTCTAGATCTATTCACATGCACAAATATTTACCA 0.3982512 0.028448 1
64659 GTGCTGATGGTTGCACGGGATCTGTTTTCATTAAGGATTGTAGGATTTTCTAATTCTATC -0.4395255 0.028449 1
66975 ATTATCTCTTATTGGGAAAATTGATTTATTTGTACACAAATATGGTGTTATTTTTAGTAT -0.33036172 0.028475 1
75579 GTCCTTAGCCTTTCTGAACCCCTTAGCTATCACATCTGTAAAACACATAAAGTTAGGTGT -0.24231835 0.028566 1
382077 AGGCCCTACCGGACTTCCTTGGTGGTACTTCAGACAAGTTTAACCTCCTGGCCAAGCTAG -0.3145516 0.028662 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.55047343 0.028706 1
630322 ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT 0.4652926 0.028734 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.50996038 0.028863 1
235587 TTCAAACAACGCCATTCTTTAAGGCTGACTAGTAGGCCCGTTTGTGTTCACGTCCTCTTT 0.76483848 0.028968 1
27387 CATCTTACTGTAAATAAGTCTGGTGTAAATGTATGTACAGAAGCCATGCTCTCTTTCATA 0.44006398 0.028974 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 1.9085246 0.029037 1
626391 TGAATGTAGTCAACTTGATTAAGACTTTGCATATCAGAGTCTCCTCCTTTTGTATGAAAC 0.44712896 0.02907 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.57635342 0.029198 1
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.31625928 0.029291 1
59057 CCGGCACTCTCAAATATAGGTGTTCCCCAGATTTTTAAATATGGAGAAACCTGTTTTCCC -0.29185903 0.029295 1
241128 AGTTCTAGCTGTATTTTGGGGGCTCCTGGGGCTTGTATGTTCACGTAATAAACATTTTTT -0.29941904 0.029389 1
171207 TTCTAGGTCTCTTGGGAGGTAGCAAAGGAAGGAAGCTGGAGATGAGCTCCTCTTATGCCT 0.80019228 0.029442 1
230484 CTGTACATAGAACATCAACTTAGATGTGTGACCTTTAACTTTTTTAAAAACTGGGAGGTC -0.22326748 0.029451 1
69241 TATTGATGCTGTAGGTGCTATCTTCACAGTGACTGTTAGACCATAACTACCATCTGCGCT -0.25184776 0.029543 1
234515 GTAGAGTTGAATCTTTGTTATTTTTACTTGGACTGTTGCTGCAACTCTGCATTGAACAAA -0.27196074 0.029581 1
11782 CCAGTGCCATAACTTTTAAAGGATATTGCAAAGAAACTGGGAAAGGGTGAAAAAATGATC -0.32110553 0.029704 1
12560 TATTTTCCCTGTTATGTGCTGTAGATGGAGAGTGATGACAATCGTGTAAATGTACTAGAA -0.26010645 0.029732 1
12780 ATTTCTTAGTTACTTTTGTTCTTGTGACTGTGTCATAGGGGCACAGATACACAGTTTGTT -0.24121642 0.029745 1
17329 AAGTCGTCGTCGTTCAAGGAAGACTACATAAGAGACCATTACTTTACCAACAAGCACCCT 2.1374348 0.029813 1
72123 ACTGTTATGTCTTAAGTGCATTAGAATGCAATTGTTTGTAATGGAACTGAAGTGTTTCCC -0.35295947 0.02982 1
14284 GCTATGGAGGAAAGAACATATTAAAAACTTATTTTCCCTCGGGTTTGTTCTCGTTTTATG 0.29359486 0.029878 1
67320 TCTATGACATAAAGGAAACAAGGAAACAACAGCAAAAGGAAAAGGAAAAGGAAGAGGAAG -1.23935927 0.029881 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.27146939 0.029998 1
17524 AGGAGGCAGGACTGAAGTTTGTTACTGGAGACATTATCCAGATAATCAACAAAGATGACA -0.2603168 0.029999 1
212448 CGGAGCCAGTATCATTAGACTGCCTTAATAATGACAGGAGGAAGTAATAAATTTATTTTG -0.39948729 0.03006 1
320145 AAACATTGTCTTGTTATGTCTAAGTGCATTTAAGCAATGGGTGTTCCTTGAGCCATACTT -0.32807866 0.030081 1
69073 AGCAGTTCATATTGATTATTGGCTATTCTATACTGTTAACATGACCCTAGTTGCAAGCAC 0.5178378 0.030087 1
67374 TTCGTGATTTCTGTATGTGGCCTTGGCACATGCTATGCTCAGAGGAAAGGCTACTTTTCA 0.54999935 0.030152 1
18329 CACCTGACAGTCGTCAATCTCTTCTATGGGCCCCTTGTCTACACCTACATGTTACCTGCT -0.21534291 0.030191 1
68725 GGTTTGCTTTAAACTTCTCAAAGCTAATGACCCTGTCATTAAAGAAAATCATCTGAAGTG -0.31614382 0.030203 1
22003 CCTTAGGGCCAGGCACAGACTGCTTTCTATTGTACAGAAGCAATTCGCCCAGTGTAAAAT -0.22379971 0.030351 1
17122 AAATATCATTTCTACAAATCTCGGCAGGATCCGTGTAGGGGCCTTAATGACCACCATAGG -0.24900382 0.030384 1
242800 CAGGGCTCCTCCTTGGAGTTCTACCTCCACAGCCATGAGAAATAAATCTCACTTGATAAG -0.50051392 0.030424 1
13549 TGTTTTCTATTTATTGTACCAAAGACAGTGGTGGTCCGGTAGAGGGGAGATTCCCCCTTA -0.25700182 0.030478 1
100233208 CCTTATGTTGAGCGTGTGCATTTTGAAAGGAAGAACCATAAATATTAAGATCACACCTAT -0.24155332 0.030527 1
22268 CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG 0.30218575 0.030532 1
270210 ACATGTGGCAAAGCCTTCAAGAAACTGTGGTCTCTTCATGAGCACAACAAGATAGTGCAC -0.28475776 0.030576 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.5583585 0.030633 1
14062 TTTCCAAATACTGTAGAGTCGCTTCCACGAAAGTCCTATGGTTGTATGGTTAACTTGGTT 0.49386741 0.030678 1
22371 CAAGTGAGGCCTGTGCAGCTACAGCGGATTCCTACTGATACCCATGCTATGACCTGGCTA 0.99655467 0.030685 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.50126768 0.030835 1
17057 CTTTCACGTTTCTCAAGTTTCCAACACTTGGGAGGAAGGTCTAGTTGATTGTGATGGAAA 1.0965017 0.03088 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.36930322 0.030936 1
330902 TTATCTACATTCAGCGGAATTCAAATGTACTGTCTGAATGATCCAGACATACCCAAAAAA -0.2455248 0.030961 1
14394 AGACCATGATATAAGCCTTTTAGCATAATGGCCAAATAAGACAATTAGAATCCATACCTG -0.36238794 0.030981 1
243274 CAGATGCCTGTTCGCAAATCCCTCCACGTGTAGAATGTATTGTAGATTGTAAGAATGTAA -0.48201667 0.030996 1
52023 TCAAGCAAAGACTTTGAATATGCCAAGAGAACATGAAGAGAATATATTTATACCCAAGCC -0.21903689 0.031004 1
100043316 TATAAAAGAGTGAGAGGCCCAGGCTAGAGGGAGGATTATTATTCAAGAGAGGATTACTAT -0.5440072 0.031016 1
22353 GGATAAAAGAGATATGTGGCAAAAGGATTTTCAGAATTGTATTTCTCCAGTGATAGGTAC 0.25438538 0.031078 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.61869125 0.031156 1
22035 GGGAAATGTTAAACTTTGTAAACTCTGAAACGCACAAAGTGTTGCTTTGAATTTCACCTT 1.2290231 0.031174 1
30050 GGTGCTATGTTATAGCAACTTTTCTCACATGGGGTTTAGATTTTAAAAGAGCCATTGTTA -0.21879139 0.031268 1
218544 TGCATTAGAGAGGAAATAAGTAGGAACAGAGAGTAGATGCCCCATGGAACAGATCCTGGA -0.29344149 0.031333 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.58033505 0.031345 1
328795 GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC 0.40991478 0.031379 1
380930 GGCCTAACTCTAATTTTCCATTTCTGTAGGGGAAAATGTCTATAAACATTTCAGCTCAAT -0.32860834 0.031447 1
231070 ACAGCATAGAACACAACACGTGGGACCTAACTTGCAAGGATTGGGTCTTCAACTTCAAGT -0.36525145 0.03145 1
13019 TACCGCCCTAGGCTGGTCAATGGAGAGAGAAAGGCAGAAAAACATCTTTAAAGAGTTTTA 0.28862444 0.031547 1
22393 ATCTCTTCTGAGTACCCCAGGACTTGGGAAATAATGCAAGAGTGTCCCTTTCAGTACACA -0.66996078 0.031579 1
330260 TTCAAAAGGTATCTGAGGCTTGAAGAGATGGCTCCCTTGGTATGGTGTTCCTTAAGCAAG 0.35893393 0.03167 1
121022 CTGCTAGGTTGTTGTCTAGGATACTTTAGCCCATGACCATTTTGCTGCAGGAGGTAGAAA 0.46325478 0.031726 1
68612 ATAAGTGGTCTGCACTATATGATGTCAGGACTATCTTGCTCTCTATCCAGAGCCTGCTAG 0.363586 0.031768 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 1.87575865 0.031797 1
208154 GCCAATCACATAGCATTTATGCTCTTATTCCTACTTAGTAAATATGTATGTTGTAGCTCC 0.96124069 0.031839 1
75746 GGTAGGATTATGGTTGATGATTTTTTCCTTCCTATCTTCTTGCCCTCTTTACACTGCAAT -0.22010688 0.031876 1
107350 ACTGAGGGAGCTATCTTTCACAGAGTGTATTCAGTGGTATACGTGGAGCTCAGAAGTAGA 2.22456264 0.031893 1
56538 GTTTTGTTTTGTTTTGTTCCCAGCTTTGAAGACAGTCCCTGGCATATCCCAGGGTTTCAA -0.21664359 0.031907 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.56712406 0.031912 1
407800 CTCTAGCTTTGGGATCTACCTTAGTTTCTTTTCCTGTTACTGTGATAAAAATACCTCAAT 0.5316148 0.031961 1
67768 CAGAGGAATTTTTTGTGTTTATCTTCCTACTAAATTGCTCAGTGATCATGGATATCACCA 0.3568714 0.03201 1
59046 AGTCAGACTTGTATTCTTGATCTGAATATCACAGTCTTATCAAAACTGAACTATCAACCC -0.33769119 0.032061 1
171095 GCGAGGAATGGGACCTGGGACCCTGCACTACACTAGAATAAAAGCCGATACAGTATTCCT 0.48935518 0.032094 1
93876 TGAAGTTTTCCACTAGTTTAACCTACTTATATCTCTTACAGTGCTGATAGTTTCTTTCTT -0.31947892 0.032098 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.35521504 0.032102 1
667214 AGCCAGTCCTGGATACCGCAACACACCGGAAGAGCAAGATTCAGATTCAAAATCATATCT 0.48793448 0.032136 1
13184 AACTATAATGACAACAAGGACGGTCAAGTGTATGGCTCAACTGCCGGGAAGGAAATGGTA 0.28157666 0.032157 1
18432 TTTCCCTGCCCTAGAGACTCCTATTTTTTCACCAATATTTTAATAAACAATCCATGATGC 0.28648847 0.032168 1
211914 CAGCGCAACTGTATATACTGTATAACCTAAACGGATTATTTTCATTGTCTTAATGCAGTG -0.28045934 0.0322 1
231125 GTAATTCAAAACCATTTCCATAAATCTATTTAAGGATTGCACACGCTCTGGCGTCTTCTA -0.31631162 0.032232 1
106021 TTTTTTGAGAGTTATTCTGGAAGTGTGTTACAAGCTAGGAGAATGCTTTTGGACAGTTAT -0.22890856 0.032243 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 1.93557646 0.032281 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.53958296 0.032303 1
15360 CAAAATCCATAAGGTTGGCCAGGCATGATCATGCAGAACTGAAATCTCAGCACTTGGGAA 0.36430773 0.032379 1
16904 CTGGGAAGGGACTAGGTGTGCCTCTGAGGACCAATAAATCCTGATATATCTGTTGAGTCC -0.29966691 0.032542 1
12386 AAGAAACACATTTCACCTGTGCAGGCTTTAAGTGAATTCAAGGCAATGGATTCCTTCTAG -0.3184354 0.032565 1
100038683 GAGAAATAAACCTGTACAATTACCAGGTATTCCTTGTGACTTTGCACTTCCTTGTGACTC 0.30956138 0.032581 1
74386 GGTATGGAACACGTGGAGAACCTAAAGAAACGGTTGAATAAATAATTTGCCAGAATGCTA -0.26257542 0.032698 1
212190 ATTCCACTTACCCCCAAGTGTACAATTCTGCCCTTGATCTAGGTAGGAGCCTATAAAAAA -0.37162639 0.032705 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.54691851 0.032722 1
76469 CTTTTTTCACAAGAAAATGTCACCTTACTTCACTAGAGGATAATGAACCCTAGTCATTAG -0.31188466 0.032745 1
20928 ATTGCGTTGCTTGGGCTACCTCCGATGACAGAAACGTGCTTTTACTGTAGGTAAAACCAT 0.2680585 0.03286 1
20677 AATCCTGTCCGTCACTGCCTGTCAGGTTGTTCCTATATACCTTCTGTAAATAACTTTTTT -0.26348122 0.032901 1
11799 TGCTGATAATTTTGTCCTGATGAGTTTTCCTACCACGGGGTAACGGAATAAAATCACTTG 0.5527423 0.032914 1
78752 TAAGCAGAGCCAGTATCTCCTTTGTACACACTTATTTATTGTAAAGACCAGTGACCATGG -0.42056476 0.03295 1
234740 AGTATTCAGGGAGAAAAACTCTCTGGTACTAGTTTCTCCGACTTAACACAGCTGATTATG -0.18819522 0.033004 1
15953 TACCACCTGCCTCTGTGTTAAGAGATAACCTGTTTCTGATCCATTTGTACCAATAAAAAA 2.45995712 0.033038 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.5635342 0.03307 1
192198 GGTGGGAGATGCCAACAAAAGAACACTGATTGTAATGTGAGAAAAGTGTATTTTTGTATT -0.22097613 0.033091 1
232966 TGCTTCCGTTTCGTACTGATGCAAGAATGGTGGGAATGGCTGGTTACAAGTCACAAAAAA -0.47892503 0.033093 1
26381 GGCAGTCTTATGTGCAAAGATCGTGAATGGACAAAACAAAAAATTAAACTGCTTACAATG -0.4051634 0.033219 1
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.95674888 0.033254 1
72404 TTGTGATCTAAATTGTGGACTTATTCTTTACTTTGTAAGTGTATATATATATAATTTTTT -0.22290103 0.033346 1
100033459 CCATAACTTGAGAGATGGTGAATTACTACAAGCAAATTGTTCTTCTGTCTGGATTAGAAT 1.10219712 0.033423 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.63170039 0.033464 1
382639 GTGCACAGTTACTGTGAAATTAACAAAGAATGGTGACTGGTTATATGTTTATAACTGGCA 0.2949972 0.03359 1
219022 TGCATACTACTGGGCCCATTTGGTTTTGTTTTTTGTTTTTCCAGTAGTAGGGCTTATAAG -0.33094137 0.033691 1
80901 ACAGAGCTTAAGACTTTAACAAATACAAGAGGACTCTGGTGGCTTTGCTCATCTAAAAAA 2.04007937 0.033691 1
72310 TCTCCATATTAGTGGCTATGGCAGTGTACACCAGTATGAGATGGAGCCAGACTCCATTTT 1.96986735 0.033698 1
19364 CTGTTTGGGGAAAGGCGTGTGCTTTATAAATATGTATTGGAAAGTACTTAGCAAATGAGT -0.22434537 0.033761 1
75847 GTGAGCCGTTCTTGTTTAGACAGCTTGACTGTTATGTAAGTCTATGCTAATATCAGTCAT -0.32216232 0.033811 1
211586 CCAGATGTCACTACTTTTGTCTTTATTTCAAGAATATGGCCATCACTGTTCTCTTATACA -0.22173682 0.033823 1
15894 CCTCTTATGTTTATAACCGCCAGAGAAAGATCAGGATATACAAGTTACAGAAGGCTCAGG 0.91127852 0.033831 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.3272182 0.033845 1
434223 TTCCTCAAAGAAGCCATGAGCAAAGCTTTGGATCCTGCAATGAGGGAAGTAGAAGCGTAT 1.23635455 0.033874 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.70920878 0.033874 1
328795 GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC 0.41160393 0.033981 1
73061 GCAGAGCCATGGGATTGGCATACATATCTGCCATATTGTTTTTATTAAGTGCTATAATTT 0.27963037 0.033985 1
214597 TGCTACGGTTGCAATTGTTTTCTATGAACGAGTACATTCAATAAAGACAACCAGACCTGG 0.25140711 0.03411 1
208151 TTGTTAGTTGTTTGTGAATCTCCTGGGGGTACAGTTCTGAGGGAAGAAAGGCTCCAATAC -0.20825635 0.034167 1
15490 TCAGTCCTCAATAAGGTCTTCGATAGTTATTTAATCTAAAATTTCATCATATCCCTCGGG -0.33127227 0.034311 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.26558909 0.034314 1
26456 CTCTTGGGTGAGGATGACTGTTATTTTTGTAGCTGAGAACGTGGAACCCCACGAGTTTTT 0.3541155 0.034356 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.25100137 0.034372 1
382301 GTTCTCTTCTACTTTCCCATCTTCAGAAAAATGAAGCATGAAAAATTTTCACTTGCTGGT 0.35464807 0.034398 1
12837 CAGTTGTCCTCAAATATTTTACAGAAACAAAGAATGATGAAAAGACCGGTAACTTGCTTG -0.3772598 0.034535 1
75894 GAAGTTGGCATTGCATCTTGCCGAGATTCCAAACAGGGAAAAAGAAAATCAGATGCTGCT -0.27652067 0.034541 1
109264 ACCCAGCTTAATCCTTTTTATTCCAACTCCAGAATCAGTAAATATACCCAGAGAAGACAA -0.45500353 0.034549 1
15289 CCTACAGAACTAAAGGAAAACCTGATGCAGTGAAAATGGGGGTGGTCAAGGCTGAAAAGA -0.28186789 0.034644 1
109910 AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC -0.24682438 0.034678 1
79554 ACTGAGAACTTAGAGCGACTGGCCAGAAAGTAAAGATACAACAGTTGATATGTGTGCCAC 0.65444883 0.034698 1
16421 ATTTTTCAGAGTGACCTTCAGAGGGCAGCAGCCATTCCCACCACACGAAGGGCTGGTCCT 1.63995868 0.034793 1
20620 TGTGGTTGGAAAAGTGCATTCCTTGTTAATAAACTTTTTATTTATTACAGCCCCAAGAGC -0.43515418 0.034814 1
282619 CCACCATGCCCTAAACTGATGCCCAGGCAACAGAATGCTCCGGTTGTCACACCAGCTGAA -0.23665613 0.03496 1
20658 CCAGCCGCTATTTTGTTGACTGAGGAAGTTTATGTTAATTTTTTAGGGTCTGATAGAATA 0.44253968 0.034992 1
12507 GACCAGTGGGGTTGGCTTTCTCCTTGGACTCTGACGCCATTGAACAAATGAGGAGGCGAT 1.50676563 0.035045 1
386753 CCAGACTTAGTCACTGAGTGCTTGTGAGGTAAGGTAGTTTTCTTGTTTCTAGAATTCAGT -0.31130676 0.035121 1
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.30101019 0.035132 1
432729 TCTTCCATATTTCTCCAACACAGCTATACATTGGTACCGGCAAAAAGCAAAAAAGTTTGA 0.4878944 0.035135 1
67392 AGTGTGGAATTGCTACAGACCCAAGACATTGCAGATGTTACTTCTGCGGAATGATTGTGC -0.52409524 0.035181 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.52755884 0.035217 1
84544 TCTTTTTCTGCACACTATTGTTTGGGCTTGGAGTAAGAAAATGGTATCGGTATCAAAATG 1.15961866 0.035349 1
327957 GCAGGGATCCTTCAATACAATTCCTTATTTGTGGTGATCCTCAACCATAAAATTATTTTG 1.29395496 0.035366 1
192192 CTTAACGAAACTTCCTTTTGAATCTAGCCACCAATGTGCCTTCATGTGGACTGGTCCCAG 0.48024118 0.035413 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 1.93270516 0.035423 1
67238 AATGGAGCACAGCTTTCTTCCCTGCAAGAGTGGTGAAGGCTCATGGTATTTATAAGCAAT -0.3287137 0.035445 1
13508 AGGAAACAATCCCTACGCAAAATCTTACACCTTGGTATAACACATGGCACCTGATGGACA 0.33291092 0.035482 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.50327545 0.035486 1
229003 AGTGAAATATACACCAGGACATCTGGGGCTTCTAAGGCCTGGCTGCAGAACCTCCTGTGA 0.82500327 0.035499 1
100043431 ACATTGAATAAAAGGACTGGTTTGTTAAAAGGTTGTTAGTGTCCTGCCAATTAAAACAAT -0.20474948 0.035674 1
66830 GTGATAACTACAGCAGCTTCATCAGCGACACTTGCAACAAGATAGAACCGGACATGATGA -0.20875649 0.035706 1
18514 TTTCAAGAGGAAGCCAATATTTATGCTGCCAAAACGGCTGTCACAGCCACCAATGTGTCA -0.27134473 0.035976 1
66648 CTCCTTCACCCCCAATTCCTTTTGAGTAAGTTACTTGTTAAAATAAATCCTTAAGGTTCA -0.35722629 0.036035 1
24108 AGCCGATTTCCTCTGAGCTATTACCAATCACATCTCTTGATGATATAAAAAATTAACGAG 2.27546515 0.036049 1
69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA 1.78880175 0.036107 1
227835 CACTTACGATTCTTGCTCTGTTTGTTGGTGTAAAGATGTTTTAAATGGCTGGATTGTAAA -0.28598981 0.036158 1
75623 AAGCCATGTTCTGAATAAAAGTACGGTTGGTTAATTTGATAAAGTATACCTCTCACTCAG -0.23415285 0.036162 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 1.91888607 0.036251 1
432995 GCAATGGTGTGGATAACTTGGCCCTGGAACCTTAATGCTAACTTGCCCTTGGCATGGGTC -0.44105133 0.036278 1
76161 TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG -0.54037007 0.036295 1
212772 GTGGTCAGAAAGGTACCTGTTAAATGTTACTAACGAAACAAATGCTCTTCAGACTACTTT -0.21110052 0.03633 1
113868 CCCTGGTTGCAAAGCCATTTGTACCTTTGAGGGAGGGATGCAGTAAATGTGTACTGTCTC 0.5341496 0.036363 1
75678 TCCTATGGTAGGCTGTACAGATTGATTATTTATATCATCCTTTTGAGAGACTAATGAAGG -0.27458252 0.03641 1
78913 TTACTGCTTACCATCAACTAGTCAAAATGACTGTTATTGAAATAGTCTGAAAGTGGACAG 0.24122136 0.036411 1
18861 CCCTTGTAGCATAGAGTTTATTACAGATTGTTCGGTTTGCAAAGAGAAGGTTTTAAGTAA -0.23513237 0.036424 1
12335 TTCTGAAACTGTCTACTTAGCTTGTACTGGGTTGTCCATAGCACCTGTAGATGGCTCTCA 0.4321467 0.036497 1
233335 GTAAGCTAACACTGGAAAGGAAAATAGGTGCGTTTTTCTCTTTCCTACATCTTAAAAACA -0.30669685 0.036547 1
19210 GGAGGCAAGTTCATATTTTGCAGTTGACCTTAGGATAATACGTATGTATGTGTGTTCTAT -0.55065894 0.036558 1
69721 TGATGGCTTTGTTCTTGTGTATAGTGTGAATAACCTTGAGTCCTTCCAAAGAGTGGAGCT -0.32732491 0.036575 1
319166 CTTTTCAGAGCCATTCACTTAATTCAGTAAAGTGCTGAAATACTATAAGCCTTAAGTGGA 0.26686645 0.036576 1
258778 CCTTCCTCTGCTGTATCTATTGATCAAGGAAAAATCTCTTCCATTTTTTATACCATTGTG -0.71473487 0.036638 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.36228156 0.036667 1
217648 TCTCCTCTTGTCATCATTGGTTTATATTCGAGCAACAGAGAAATAAATATAGACTGATGC -0.24492897 0.03668 1
69788 CTCAATGTCTGTCTCTGACCTAAACATGCATGTACCACACATACAAGATAAATAAAACTT -0.24936118 0.036684 1
17929 AAGTCATCAGATCTCTTATTCCTATAGATGAGGAGGCACCATTGAAGAACACATTAAGGG 0.37130756 0.03672 1
22793 ACCTTGCTCTGTGCTGCTAGGTTGTGGCCACAGCTAAGATTATAAAACCTCATTTTCCAG 0.30714333 0.036744 1
54371 ATGTGTAACTATCAAATACAGAAAAGGTTTAGAGACAAAGAGAGGACGATTGTGTTAACC 0.29862027 0.036799 1
18349 TACTGTCTGCGGAACAAGGAGGTCCAAGTAGCTCTTCACAGAACCATGCACTGGTCCTGA -0.28107091 0.036819 1
381933 TGGTTCTCCCAACCCCCCAATATCGTGTCATCATCATTGATTTACTGCATTTGTGAGCTC -0.24401478 0.036821 1
12229 CAAAGATGTCTGTGAAGCAATGGAATACTTGGAGTCGAAGCAGTTCCTTCACAGAGACCT 0.41352709 0.036854 1
53417 CAGAAACCCACAAATGTCTCCAAAACCACCATAAAGACCTCTCCTTGTTAGGCACCAGAG -0.50311756 0.036929 1
215856 GCCATGAACCCTTTGATTTATGCTTTCTTTTATCCTTGGTTTCGAAAAGCCATCAAGCTC -0.23163859 0.036938 1
15950 ATTTCTGTAAAGCAGTGTGCCTTTGGCACTATCCTTTAACCATTTGAGATGTGCTTTAAG 0.37023853 0.036958 1
70081 CCCAAAAATTCTATCGTCATCTTCATTCGAGAATTCATATAGGAGAGAAGCCTTACAAAT -0.27788607 0.036959 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.52477844 0.037067 1
16882 CCTGAGATGTTAACTGGAATGGGTTCCAACTTTCATTTGGTTTAACAATAAAGTTGTTTG -0.19585689 0.03707 1
14397 GTTGAAAGATGTTGAAGATATCTTTACTTATAAATTGATTCTAGAAAACTGGGGACCGGG -0.22330266 0.037093 1
432582 GGTGACTGTCATATGCCTTATTCTTAATAAAATGTTTGGAAAACATGGAGTCCATTCTCA -0.27878344 0.037163 1
71684 GGAAAAGATTCAATGTCTCAAGTATGATTTCTACTGACTCTTTATTCCTCTTGCACCATA 0.42639665 0.03719 1
60364 CCATGTCAACTTACTACTTAGTATGCTTACAGGTAATCTGTGTTTGCATGTGTGTATAAA 0.46979663 0.037238 1
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.22369896 0.037275 1
56349 ATCAAGTGAAACCAAGCCATATTGTTTGAGCCAATTAAGAAAAGTGCAGTTTTTACAGTG -0.3098389 0.037327 1
13798 CTGCTTACGACCGTGTATATATTTAATTTCAGGTAAGGAAAACAAATATGTGTAGCGATC -0.20157818 0.03733 1
17524 TGAAACTCTTAAGAAATTGCAAGAAGCCTTTGACCAGGCTTGCAGTTCTCCACAGTGGGT -0.18734181 0.03741 1
233424 CCTTGCAAGGGTCAACAAATGTTTGTATTTTGTTTCCATGGAGCCATTTGGTTTTAATAA -0.24063658 0.037498 1
229599 TTTTTTACTTTAATGTATTTGTGGTGAGGAAATAGAAATCCTTTCTGATTAAAGACATTT -0.55514689 0.037559 1
73739 ACCCCAGGAAGGCCTAGAAATAATGAGCCTTGGATGCTGTCGGCAAGTGACAGCATGTAA -0.19358007 0.037575 1
207565 TCCTGGTAAAGACCATGATTCGAAAGCGCTCATTCGGGAACCCGTTCGAAGGTAGCCGCC -0.44456838 0.037593 1
268319 GCTGTATCACTTCATTTATTTTCTCCAAGCTCCTTGAGGAAGGATTCCGCTATGAGATAG -0.33439915 0.037609 1
432442 ATGCCTGGTAAAGTGTTTATGAACTCTCAGCCCATTAAATAGCTCTTTGGTGAGTAAACA -0.20183114 0.037643 1
107993 AGAGAATTCTGCTCCCATTTCTGTAGTCTGAGCTTGAACAACCGAGGCCTCTCTGAATAA 0.83318474 0.037643 1
12452 CATTGATGACTTACTTTTTATTAGTAAGTCAACACCCAGTGAGGTGTTTTCCAAAGTAGA -0.2892335 0.037677 1
16185 GTCTATTCTGGGGTGGGTTTTTCTGTGAAGCAGCTTCTTTGGGGTAACCTAGCCCCCTTG 1.6586051 0.037703 1
75296 GACAGGTTCTGCATGTAATAAATGTCTCTTTGAACAGTGGATTAAAATGTTGGCCGGCAG 0.35271348 0.037704 1
99480 AAAGACGATTGTGGAAGAACTGCTGGCTGACTCTGAGTTCAGGAGATTTAATCGAAGGAA -0.20449561 0.037752 1
100125931 TGGGAGGTGGGGAAATCGGATCTTGGAAGACAAGAAAAACAAAATAAAACTTTTTGCGTC -0.22873148 0.037779 1
225724 TCGCAGCACCTTAAATCTTAGCTAACTATGATTTGTATATTGGGACGTACAATGCATCAG -0.27460392 0.037823 1
15360 CCACCTGTGCACTTTGGCATGAATGTGTTCTATCCCTCAATAAAATGCATTTCAAAATTG 0.65250749 0.037832 1
67619 TGCGCTGTCATGGCTGTTTCAAGACGACATCGGACATGAACCGAGTGTTCTGTGGACATT -0.26112329 0.037888 1
236930 TGGTAATGACTATGAGAGTCTTGTAGCTCGTGGGAAAGAACTGAAAGAGTGCGGGAAGAT 0.30447861 0.037909 1
20868 TGCCTTTTGGAGTGGGGTCTAGCCTAGTTTTCCAGCCTCATAATTATAGCGTAAGTGCAA 0.60312135 0.037914 1
70750 AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC -0.21750959 0.038 1
73916 CTTCAAGCATATTCAGTGGGTATTTTTGCACATGTGTTAATATCATGGTGATTATGATGG -0.21610719 0.038024 1
60504 TGCTGTGTAAACCTTGTTCCTTAATTTAATACCATTGGTTAAATAAAATTGGCTGCAACC 1.02429134 0.038061 1
21877 CCTCAGCTCTTAGTGAGCCACTTTTCTTGTGCAAAATGAACAATATTAAAGTTTACTACT 0.75566333 0.038074 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.2321434 0.038098 1
626578 AATATGATTTATTTAAGGTGTACCCACCCCAGCTCCTCTAAGACATCCTCAAATTACCCT 0.94044322 0.038146 1
67724 TAGCCTGGTCTTAAATTATAACTATTTTGGTCAAAGCTCACAGAAAGTCCTGGCTGTCTC -0.42903034 0.038214 1
319480 GTTTCATCTGAACAATGTCATCTGTTCCCCTATGCGGTACTACCTTTACTGTCAGAAATA -0.3998598 0.038223 1
225825 TTAGCACATGAAAAGAGATTGATGGTTTTAAGTAGTAGAACACAGTAGTGTAGGAATCTG 0.73052676 0.038246 1
71691 CTTGGTGCTAGAAGGGCTGTGTCGGTACCTCATGATGCACCTGCTTCAACATCCAGGCCT -0.34465093 0.038278 1
71584 GTTTTTGTTGTGAGCAATGAATGGTTCCTGTATCTTGCCTGTTAATCTGTTATTCAATGA 0.4075932 0.038358 1
17940 AATCTATGAGTTTTATGAACTCTCTAGGGGGCTTAACAACCCCTCACTGGGCAGTGTCAT -0.23997672 0.038486 1
117149 CAGAGATGTCAACTCACCTCACAAAACTGGAAGACACGTTCATCCCCATACTGAATTTCA 0.49215357 0.038538 1
12095 TCTCTGCCCTGCAAGTATGGATGTCACAGCAGCTCCAAAATAAAGTTCAGATGAGGAAGT 0.56979506 0.038547 1
258248 AGATATGTTCTTGTTGGTGCCACCCCTGATGAACCCCATTGTGTACTGTATAAAGACTCG 0.27177015 0.038565 1
14598 AAAGACATTGATCAGGTGGTGACTGCAGGCCTGAAGATTCGGCACCACCATACAGAAGTC 0.29021226 0.038566 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.55420719 0.038615 1
22169 CCCTCGAGAGAGACAGTCCTGCAGAAGGTTTTAGAGCTGATCCAGAGTTCTGGTCGTTAA 0.67166832 0.038618 1
51786 TGCTGTATGGTTATACATTTTTGCAATTATTCCTATATTTTTGTGACTCCGTAGGTGACC -0.28663186 0.03866 1
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.39914939 0.038721 1
60440 GATTATGTATCCACATTAGGTAGAGCAAGGGGATCAGATATGTATAAATAAACTGATAGC 2.07611045 0.038765 1
108030 CCATTCATTGCTTTTTTACCTACTCAGACCTTTTCCATCCATGTCAGTGGAAACTCGCAG -0.24609632 0.038819 1
71790 GGAACGCAAATCTCAGGAAAGAAGTTTTATTTCCAAACCTCTAGGAAGGCATTAAAAATA 0.32645067 0.038832 1
22003 ACAGACTGCTTTCTATTGTACAGAAGCAATTCGCCCAGTGTAAAATAAACACTGTACGCT -0.22568419 0.038834 1
269682 TTTGAGTTTCTCATTTTTATAAAAAGTTATCTCATAAGGGAGTCAGTCTTCACGTTGGGG -0.22104839 0.038856 1
100043474 GGAGCTGAAAATAACTATGAAGAAAGCTTTCCTCAACAAATTATTTCCACAGAACTCCTA -0.21615508 0.038915 1
631323 AAGAGTTTGGTTCTCAGCGCCCATGCCAGACAACTCACAATTTCTTATAACTCCAGCTCT 1.72766826 0.03893 1
70226 AACTTAATGCATGCAGCAGCATGCCTGATATACTCATTAAGCTTTGTGCTAATTTGATAT 0.26915661 0.038958 1
381511 GGTTTGAATGCTGTCTATGGTTAGAGAAACGCCCACGGTGAATTAAAGCTTTATACCTGC -0.4112866 0.038961 1
16182 GTCCACCATAATGGGACACGGTACAACATCACCAAGACTGTCAATATAACAGTTATTGAA 0.52037599 0.038971 1
11745 GGATGACATTAGCTCTGAGACGTCTGGAGACTTCCGGAAAGCTCTGCTGACTCTGGCAGA 0.67002631 0.039006 1
104009 TTCCCCTGCTCCTGTGGCTTGGGAGGGATGTGGAATAAAATTATTTTTGTTAAGTCACGC 0.26531987 0.039046 1
215705 TCCATCGACACTCCACGTTTTTCCAAGGATCACAAATGTAGCCTCGTGTTCTACATCCTG 0.28352739 0.039124 1
80782 CTAAAAATTTGCCAAACTTTCCATGAAAATAAAAGGAGTATGAATATTGAATTTACTTTA 0.3620427 0.039142 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.4196198 0.039271 1
56045 CCTTGTGAGTACCTGTGTCGTTTACGAGACTGCATTAAAAATGGAGATTTTAACAGCTTA 0.76850457 0.039296 1
238257 TATGGCGGTCAAATGCTGAGTTACAGTGATTCTTTCCATCCATTCTATTATTCTGTCTTG -0.22538393 0.03937 1
13841 TGGCCATCAAAAGAAGATCATGAGCAGCATCCAGACTATGCGGGCACAAATGTTGCATTT -0.4628045 0.039375 1
69487 CGAATGCAGTAGCAAAACTCACTACGTTGTCCTATCGAGAATTTTTGCAAAATTTGTTAA -0.22023577 0.039429 1
22784 GAATTTGAACCCGTAAGGGACACCTTGTTGTCCGTGCCGGGAGTCCGAGCAACCCATGAT -0.37665053 0.039447 1
223646 TGGACAGTTTGAGTGCTCGAGGTCCCCTGTGAAAAAAGTCATAAATAACACGGCTCTGTT 0.31257638 0.039477 1
170767 AATGGATCAGTTGGTTGATTCCTAAACTGAAATATATCTGATGTTAAACTCGTAGCTACG -0.27232387 0.039487 1
380994 CCATCATGGAGAATAATCTGAAGTACTCTTCTACTTTCCCATTTTCAGAAAAATGAAGCA 0.3226867 0.039497 1
20655 CCTGTGTGGTCTGAGTCTCAGACTCATCTGCTACCCTCAAACCATTAAACTGTAATCTGA 0.3352227 0.03955 1
20383 CCAGATGAGATTTAGGTATCAATCTATTCCAGTGTATATTTTTGTACTACCAGACTCTTG -0.23402887 0.039568 1
19069 CAGGGAGCACTGTTTAATTTATAAAGGAGCATTTTGGATAAGATTTGGTGTGGTTATTCT -0.2251797 0.039692 1
241525 AAGAAGGGAAGTACATCATTGAGATGTCACACATGGTGAAAGACAACGGCTGGGATTGAG -0.23470386 0.039717 1
100049164 GTGTTTCTTTTATGTAAGAAGTCACCATCAGAAGAGACAGAAACCAAAAATGGCTTTTGT -0.38787046 0.039726 1
117229 AACCACTCTGAAATCCACTACCTTGTTTCGAGGCAAGAAAAGGCTCTAAGGTTCTGTCCA -0.19443833 0.039785 1
70544 TTTCGAAGTAAGATGCAATCCATATTCCCACCAATTCCCAAGAACCATGAGTCAGCCGAG 0.76888613 0.039817 1
432613 GAAACACCAGGGACGAGTGAGTTTTCTCTCGAAACTGATTCAGACCATGCGAGACGAGGT -0.20517265 0.039843 1
18526 GTCACTCTTGGCATCTCCTTATTTTGAGTCTAAGATATAACTGATTGACTTTCACGAATA -0.33222966 0.039853 1
11838 TGGAGATCTCAAGAGAGTGTGGCTATCCCCTATTTTCACCAAGCCTTGAATATCCAGCCA -0.33126354 0.039863 1
73598 CTTTGCCAGCTGTATCTGTGTCAGAACGGGTGCTCGGGAGTGTTGGGAGATGGTTGGACA -0.31504048 0.039918 1
27281 CCCCAACACTATGAAATATTGTCTGGGCATATTTTCAGCAGTCAGGAATGGAGTCCACTT -0.48421175 0.039927 1
216795 CCTGAGTGACTGCAGAGAATGTATTTATTTAACAGCTTTGTGTAACAAAACCAGAAACAA -0.39014046 0.03994 1
15160 CAATCCCAACATGTCTGAGATGTTCGGACTTTTAAATTCATGTAAATATCTCCTCTTCTG 0.74392609 0.039963 1
244701 ACGCATCTATTCCTGCACCTTCATCCAGACAGCCAGCACACAGTACACGGCAGCTGTGGT -0.23753543 0.040108 1
20290 CTCACAGACCTCAGTCATGTGATAAGCTATGTTATGGTTCTTTATCTGTTTAAAATATGG 0.91084656 0.040225 1
67399 TGAATATTGACGGTGAGAACGCGGGCAGCCTCACGCACATCGAAGCCCAGAACAAGATCC -0.32937963 0.040274 1
13347 GTTGGCCTGCAATGAGAAGTGGACTTATAATGATTCCGATGGAGGGACGGCTTGGGTTTC -0.29053835 0.040297 1
54376 TTCTACAGTTCCACAACTCCACACCCAAAGAGTTCAAAGAGTCATTGCATAACAATCCGG -0.46165321 0.0403 1
13548 AACAGAGTCCTGTAGCTAGCTCGTGACTACATTGAAACTTGAGTTTGTTTCTTGTGTGTT 0.33007933 0.040362 1
68936 GGACCGCACTCTGGCCTAGACCTTTAACTTAAATGATTGACAGAGTGGATTTTTATATGT 0.40070343 0.040367 1
331188 GTAATCTTTGTGGTAAAGCCTTTGTAAGTCATAGTTATCTTCAAGTACACAAAAGGACTC -0.22378577 0.04042 1
338350 ACGTCACAGAATACTGATTCAGATGCTCTGTGGTAAAAGGGCCTTTCGGGACACAAAGAA 0.32210371 0.040421 1
15565 GTCCTCACATGGCTGGGATACTGTAATAGCACCATGAACCCTATCATCTATCCCCTCTTC -0.22041325 0.040465 1
72667 GGATGTGACCGAAGCCCGGGGGTCAGTGTTGGAAAGGAAGAAAGTGGGGCAATTCCCTTA -0.23353343 0.040571 1
414089 AGAGCAATCTAACAGTAGCCATGACTGTACTTAAACAGCAGCTTCATAACCTAGACATTG -0.20477573 0.040608 1
103210 CCACATGTAAGGACGCTTCTTTGCCTGGATGTATATAACTGATTAATAAAAATGGAAAGA -0.3149963 0.040674 1
330463 CCAGATTGTTCACTGTACTCTACATGGAAGATCTCACACAGGTCAAAGAGCTCTTAGGAA -0.20212171 0.040689 1
94332 CGCTTTTGGGGAAACAACTTTTCCTCTTCGAGCTGAACCACTCTGTCCATATTACACAGA -0.32062806 0.040689 1
15182 TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC -0.23024897 0.04071 1
216119 ATCCAACCCTCCCGGAGTGAACAGTGCTTTGTAAACAGCGTGTGTAAATACCCATACTTA -0.2119097 0.040792 1
56173 TTTGAAATCGGCCAGGCCCTGTACATGGGCTTCATCTCCTCATCCCTGTCTCTCATCGGG 0.34933913 0.040811 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.23592817 0.040821 1
20306 TTCTGAGAACTGTTGATGAAATGTGTTGATCACGGTCCTAAGGGATAGGAGCTGTCTGTA 1.37848079 0.040863 1
26400 AAGGATGTCATGGCGAAGACCGAGTCCCCAAGGACTAGTGGAGTCCTGAGTCAGCACCAT -0.26981056 0.040869 1
104110 GCATCAAGGTCAAAGGCAAAGGGGAACTCTGTACCTACTTCCTGAACACAGACCTGACGC 0.53251882 0.040889 1
19744 TTATTTCATTGTGTTAAATGTATACTTGTAAATAAAATAGCTGCAAACCTTAAGCCTTTG -0.25786242 0.040993 1
217371 CAGCATTGTTTCAACAGATTAGCAAGGAGAGAGGTATTTCAGTAAAGGAGAAGTAAAAAC -0.33344296 0.041016 1
19344 GGGGGGTTGATTGATTTACCTATCCTTCAACCGTTTTAATTAAATGGAATCTACAATGAA -0.27295614 0.041016 1
226041 GCGCCTTAAGGAAAGATTTCCAGCAAGGTGTTTGTTTCCGTTTTCTCTCTGTGCTTCTGT 0.63164068 0.04114 1
68312 ATCAGCTTATGGACAACCGCATGGTGCTGGCGAGGCTTTGCTACAACGCTGACTTTGTGA -0.30921966 0.041186 1
13805 TACAGAACTGCCCAATCCAGGGGCTCTGGGATATGGCTGCCCGGGATTACAGAAAGACAC 0.52213068 0.04119 1
106766 CAGGCTCCCAGGGATCAGTGGGCTATCTCTGGGTACAATAGTCTTCTTCCAGCTCTATCC 0.34248986 0.041214 1
72465 GGCTTTTGTTTTGAGTGGAATCTTTTCCCCCCAATTCTTAATGTAAAGATTTTGTGCTAT -0.21350321 0.041255 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.39925009 0.041257 1
433485 AGATCAGTGATGCTGGCAAAAGGAATGGCTTAATTAACACCAGAAACTTCATGGCTGAGA -0.37412708 0.041311 1
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.30825078 0.041313 1
12481 CCCCTAATTAAGAAGGCAGAGTTCGTCATTTCCAATAAAAAGCTGTGTGGATTTATCTTC 1.93717315 0.041364 1
15356 ATGTCCACCGCCGCAGGGCCTTTGTTCTACCTCTGAGGACAGAGAGCAGTTTCCCCTTAT 0.26646065 0.041419 1
13436 GTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGATTAAAGTTGTATTTCTCT 0.2787365 0.041437 1
16453 TGGCTAGAGCAGAGACATCTCCTGCACGCGCTGGTGGCCGACGTGGACCCAGCGCTAGAC 0.66150296 0.041473 1
245020 TACTGGAGGAATGTAAGGAGGGAAGATTATCAGGAAATACTGGACTCTCCCATTAAATGA -0.25202324 0.041485 1
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.74284785 0.041546 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.22621457 0.041549 1
19646 TGGACAAGCTTGTTCATTGTTTTATACATTGACTAAGCAGTACATTTGGGCTCTATTCTC -0.42041699 0.041703 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.69727964 0.041724 1
70028 ACAGTCCTGAAGTGCTGTTCAGGTATTTTCTGTTCAGCGGCCAAACATGTCTCCCTTAAA 0.43758686 0.041807 1
57376 GTCTTAGAGACTAGAAACAAGATAGTTTGTAGTGTGTGCTCCCTAAAATCTAGAATAGAT -0.2290946 0.041807 1
26934 TCAAGTAAAGCTGTGTCTGCCTGTGTTTACTGCACGAGACACCCCTGTCTGCTCTTCAGC 0.24032519 0.041827 1
70591 TGAATCATTACGCTCTGTTTAAATGTTACATGTTCCTTAAGAACTGTGGCAGTGGAGATA -0.31856345 0.04183 1
208151 ATACACCAACTCTATCCTGTTTGACAGTGATGACAGCATCAAGTGGGTCTGCCAGGATAT -0.23858125 0.041852 1
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.21782502 0.041971 1
64103 AAATTCTAAAATTCTGGAGATTTGCGATAATGTGACCATGTACTGGATCAATCCCACTCT -0.25484018 0.041978 1
15975 ATTGATGAGTTTTTCTCTGAGCCGCCTTCAAAAAACCTTGTACTTCTGACGGCTGAGGAG 0.3334947 0.041981 1
11820 CAGGATGATTGTACAGAATCATTGCTTATGCCATGATAGCTTTCTACACTGTATTACATA 0.28914037 0.041995 1
76832 TTTGTCAAAGTAAGTGCCATTTTGAAACAACTTGTAAACTGTGGTTTGTTTTTTGGGTTT -0.30355631 0.042081 1
26570 AGTAATGTATCAGGAGCTTTATGTAAATGTACTTAGCTTTGCTTACATTCTTCTGCAAGC 0.28766907 0.042128 1
24135 ATCTTCAATTTGGAGCAAAGACTTGGGTCATGGATTGTAGAAGCCTCACACCAGTGTGTC -0.26751955 0.042159 1
67638 AATTCCCAGTTATTCATCTGTAAGTCAGCTTCAAGTTCCGTACCATGTGTCTCATCACAG -0.22235838 0.04216 1
381650 CGAAGGACTCGATGTGGCATTTTCTTCTCCATATCAAGTTTAAACTTTGGAAAATAAACT 0.26657113 0.042165 1
109700 TCATAAAAGCACATTTTTCCAGCTTAAATCTTACCATACGGGGAGAACTTCAGAGTGAAA 0.35462727 0.04218 1
233335 TGGCAAAATCACAGTTATGAAGTGGCAATGGCGTGATTTTATGGTTGGGGGTCAGCACAA -0.30728094 0.042203 1
53859 AACAATGTGGCCCATGCAACTGAAGGCAAAATGGCCCGTGTGTGCCGGAGGGGAAAACGT 0.29721996 0.042244 1
14349 AAGCAGATGCCCCTCAGATCCAGTCTTCAACATCCTTAGTTACTTCTGAACCTGTCACCA -0.31503026 0.042245 1
23892 TCCTAAATTAATTCACTTGACCGCGGGTGTAAGTCTTTTGTCTTGTGAAGAACCTTCAGA -0.54055198 0.042334 1
217119 TTTCTGGTCTGTGGCAGGATTGTGTGCCATAGGACCTTCTGCTTGTCCCTCCCTGGAGCT -0.22684494 0.042413 1
668173 TAAAACCTCCACACCGTTCTTTTGTCACATAAGCTACTACAGTTACCTGGAAAAAAGGGG -0.23179339 0.042493 1
320595 GAAGTCAATTCCCTTCAAGTATCAATGGAAAACTGAAATGACCTTCATGGATCTTTACAT -0.29485299 0.042543 1
80901 AATGTATAAAACAGAGCTTAAGACTTTAACAAATACAAGAGGACTCTGGTGGCTTTGCTC 1.8970129 0.042568 1
52589 CCAGCGGACATTTATCAATGGAAGAGTTTAAGAAAATATATGGGAACTTTTTCCCTTACG -0.34593572 0.042661 1
328699 GAGGACTTCTCTGCTTGTTGACTTTTTCCTTTCTTTGCAGTACTCAGGGTGTTACACATG -0.25244683 0.042736 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.67603939 0.042745 1
69823 TCAGTGGACAATAAACGACTTCACACATAGGCAGTAGTTTTGTGGTATTTAATGTGTCAG -0.19836916 0.04287 1
100043868 ATGTTGATGGGTACATCCTTGCTTTCAAGGAAGCCACTTAGCTGCTCACCAGTATAGATG -0.18381032 0.042909 1
213989 TGGGGACCTAGAGAGGTGGGGACATGAAGGCCTCAGAGTGAATCCCTCTCTCTTGGAGAT 0.30930301 0.042973 1
269881 ACGCCATCAGATGGGGCTTTGAGACAACGGGAGCCTCTGGAGCTCACCAACCACGGACAG -0.22284943 0.043012 1
69068 CTCCAGACACTGTAGTAAGCATTAGGAAATGAATATGGGGGATTTTAGAAGGATGCTGTG -0.36315542 0.043021 1
66641 TGCTGGGTTTTCTCATGGAAGCATTTTATTACTCACAGAAAGTTACCACATTCCTGATGC -0.22608404 0.043055 1
19127 ATAACCCTCTTGAAACACGAGAAAATTGGGGGCTCTCTTTTCCTCCTAAGGGTGAACCTA -0.2048585 0.043058 1
117229 TTGTTCCACGATTGTTAAAGGGATAAGTGCTGGGGCCATGCTCGCTTAGTTCTACTCAAA -0.21810413 0.043063 1
317677 ATCAACAGCATGGAACTCTGCATCTCTAACAAGATGCAGACAGGGAACACAGCCTTTTTT 1.55340438 0.043066 1
328417 TCAAATAGTAAAATGTACCAATAATGACGTGTAATACGTGTTAAATGTAGCTACAGCCCC 0.63588225 0.043081 1
78785 GTGTGTTGAGTTCTTCTTCCCTCATTTAAAAGCTCAATTAAACATGTCACAAGTGGCTAA -0.26126148 0.043109 1
319508 AAGGCCTCTGCACATATGATATGGTATAGCTGTGTAACTAGGTCCTTAAGTGGACAGCAG 0.35807517 0.043146 1
66204 ATGATGAAATACAAATGTGTATAATTCTAACCAATAAAAACACATTAGAACCTTATGCTT -0.260054 0.043149 1
170786 GGACATGGTGAGCCTCAATGTTATAGACCTCCCAAATTTTTTGGAGGATTTATAATTTTT 0.48157369 0.04317 1
18260 AAATGGCTTTTGATAATTGACTGGGCTGAACACTCCAATTAAGGATTTTACAGTTTCAAC -0.19788823 0.04318 1
16190 ACCTGTTGGGAATTCCAACCCTCACCAGTCCCATCTCTTCATTCTATTAAAATTACTTAT 0.37693364 0.043326 1
56392 CACTGGCTTCAAACAATTCAGTTCAGTACTGTTACTTTCAGTCTCGTCACGCCGTGGTTA -0.62165555 0.043331 1
23871 GTTGGGGTCTATATAAACCTGTTGAACTCTTACGTACATTCCAAAGACGTTTCAAGGAAC 0.62043214 0.043381 1
211253 AGAATGCTAGAAAATTGCAGGTGGGAACAAGAGCCCAGTCGGAGAGAATTCGGACATATA -0.23019015 0.043404 1
78781 ATGTTGTGAGAAGGCCAGTTTTTGTTTCTTCGAAGGATGTGGAGCAGAAGAGAAGAGGTC 0.85158094 0.043404 1
26381 CTTGTAGTGACTCTCGTGTTTTAATCAAGCCAGATTGTTGTATTTATTCCACTATTTTGC -0.3793457 0.043424 1
236312 AATGTACCCAAAGAACCTTCTGAGGAAAAATGGTTACCAGCAAGGTTCCAAAAAAGTGAT 0.53370569 0.043465 1
80748 GGCAAGGTGAGATATTGGTTTAGTTGAGATGCAGGAGTATCCTAAATAATATTCTGTGCT -0.32755123 0.04357 1
110891 CTTGATGTCCCTTCTCTGTGGTTTCTGTAAAAAACTGCCATAAAACTTTGAAATTCTGCC -0.3212789 0.043623 1
107526 AGATCTCACAAGTCAAATAATCCAGGTTGAACACAAGTTAGCAGCTCAGCAGGTGACATC 1.65003499 0.043677 1
66204 TTACAAGTATGATGAAATACAAATGTGTATAATTCTAACCAATAAAAACACATTAGAACC -0.29426579 0.043741 1
240041 GTTCTAGTGAAAACATCAAATGTGTGATTTCTCTGGGAATGATTCATACATCTCACAGAA -0.20243898 0.043784 1
229487 ACTTGCTGAGCTCCTCAACCTGCTGGACAGGAAAGCAATTTCTTCATCGGCAGCTAAGCA -0.24957684 0.04381 1
20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA 1.81970854 0.04385 1
381091 CTTCCTAGTATGTTGCTAGTGCTGTCTGAATGTGCACACACATATATTTTTTGATGAAAA 0.46350993 0.043864 1
22412 TGTCTTTCTAGCCAAAGCTTCCTCTCTCAACACCCATGAACGTCCATGCTTCCTGTCTGA -0.24614351 0.043897 1
258353 TGGGTCAGGGAACTCTCAGACTAGCTTCTACCTTACCGGCATCCCCTCTCTACAAAAATC -0.20055645 0.043921 1
232943 CTGGGCAGCTCTTGTAGATCGCTCCCTGCAATTAAAGGCGGTGCACTGGTACTGGGTGTT 0.30093326 0.043927 1
229759 GGGTCATTCTCAACTACCATCCTATCAAACTGGAGAATCTAGTTACTATAATCTTGAAAT -0.40510561 0.044051 1
13079 CCCATGATCCCTGAGCTGGTGCCTTCTGCCCAGTAATAAATGGTCTCTTCAGATTTCCTC 0.20969783 0.04406 1
76373 AATTAGTGCCATCTTCTTATTCATATGAAGTTAATGCTTTCTGGGGAATTAGCAAGAGGA -0.25425803 0.044094 1
58200 GAAAAATAGACGTCTGGAAGTAGGAGGTCGCCTCAAGGTTTTCCTTTGTTACTGTGGAAA -0.30983645 0.044096 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.22341928 0.044101 1
240754 TATGGGGATGTTGGGGATAAAAAGGCACATAGCACTTAGAGTGGAAGCATGACGTGATAG 0.88064832 0.044116 1
11492 CATCTATGCAAAATACTTGAATGGGCCATGGTGCCTTGTTTTTTGTTGTTGTTGTTATTT 0.28346915 0.044134 1
13611 CTGACATCTTTGGTTCTAATGTCTGGGCCCAGGAGTACCTGCGTGGCATGGACTGGATCC 0.33260161 0.044253 1
75695 CCAGACCACATTAATTTCAGTTAACAGGCTTTCTAAGCTGAACACTTCGCCACTATCATA -0.21222024 0.044256 1
217265 TCTGGGCAGCTAAGATGTATTGGAACAGTACAACATCTAAAGAGTAAGTTTGGTAAAGGC -0.1867751 0.044267 1
213006 TTCATTGAAAAGTACCTCATACTAGCCATATTAAAATCTAGCTGGGCAATCTAACTATGG -0.35923066 0.044332 1
75695 ATGACCAACCTCAACCACAAGGACGTGGGCTTCTCCGAGGAGGAGTTCCAGAAGCAGGAA -0.25672318 0.04438 1
434234 CAGATAGCTTTGGGATACCCTCTAAAGTATATTGTCATGTTCAAAATTCCAATAAATGCC 0.45683314 0.044384 1
20688 CTTTGGTTAGGTTTGTGTGTGTGCTGCTGATTACATTAGAAGTTGATGTTAAAAAGTCAT -0.215941 0.044437 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.23042553 0.044447 1
11519 ATCTGTCTGTATTGTGCTTCTCACAGGCTGAAAAATTAAACCCAGCTGTAGCTTAAGAAG -0.43253406 0.044496 1
216161 AGAGCTGCGACATCAATTTCAGGGAAGTGTTGGAAGACATGCTCCGCTCTTTGCGCGCGG 0.34528929 0.044551 1
16911 GAACATGATAGACCCACAGCCCTCATCAATGGCCATTTGAATTCACTTCAGAGCAATCCA -0.23513887 0.04459 1
78506 AACAGTCCAGAAGTATCCGACCTTCAAATCCTGCCTGAAAAAGGAACTTCACAGCAGATA -0.33250075 0.044606 1
213452 TGGGTCAAACAGTCCACATATTCCTTAAAAGAAAACGAGGACTTAGTTTTCTAAATGTTG -0.19946883 0.044621 1
13656 TCCTTTTTGTTGTTCATTTTTTGTAAAGCAGACGCTACTCTCAAGCATTTGACAAAACTG -0.56619646 0.044634 1
258427 CCAATATCAAGATTCTTGTTATCTTTGTTGGATTTAACCTGATATTCACTGTGCTGGTTG -0.18841807 0.044682 1
70544 TGCCTGGTGTGGAGTTGGTGTGATCAGCTTTGCAGTGTGGAAAGCCTTAGGAGTTCACAG 0.70828898 0.044702 1
258552 TTCAAATCCACAGTCCAGTCATATCCTACGTGGGCTGCCTCACTCAGATGTCTCTTTTTA -0.30163064 0.044703 1
212167 TGGACGCAGAATTTGTAGAGGAAGCTGCTCTGAAACACACCACCATGCTTTTGGGCTTAT 0.35274901 0.044739 1
71805 CTGGGGTGGGTTTCCAGTTTTGTTTCTGTTGTGTTGTGTTTTGTTTTTTGTATTATGTAT -0.19392279 0.044754 1
100040999 GAGCTGCATCAAGGAGTGACAATGTGACCGCCTCCAGTGTCTCCAGCACAGCTGTCATTA -0.2342431 0.044807 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.66887865 0.044833 1
16497 GGGGTTTTTGTTGTTGTTTTGTTTTCTGTAAAGGTGGGGTCATTTTCTAACTCTTATTTG -0.46588913 0.044864 1
99633 GCTTATCCTTTGCAGTGAGAAGAATAGATTTGTATCCTAATTATCTCTCATACAGAGACA -0.33527549 0.044899 1
64095 TACATGAGCATAAGCCTGGTCACTGCCATTGCTGTGGACCGCTATGTGGCAGTGCGGCAT 0.63440648 0.044946 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.2423815 0.04496 1
103551 GTTTTGGAGTTTCCCTTTGCCGGAAGGTTGGATGAAGGAAAGAGACCTCCAGCCTCAGCG -0.59181699 0.045083 1
76071 CTGTACCAGAGCAATCTATTTATTGCCTACCGCTTGTTTTGCACTTAATAAAATAAGTTG -0.37834774 0.045087 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.23928102 0.045119 1
30939 CCGCCTGTTTGTTACGATGCAGATATTTAAACTTCTTACTTCTTTGTAGTTTCTGTATGT -2.69600537 0.045224 1
74190 CACATCCACACTGTAGTGCGAAGCTGAGGATTCTAAAAATAAATGTGAATTAAAATAGTG 0.69700783 0.045352 1
106931 AGATCTGTGTAGAACACACATGTTGGGATGAGAATGAATTAAAATGAAATTTTTCCTTTT -0.42351496 0.045355 1
19417 GAGACGCCTGCTTTAACTGTCTTATGTATTAATTGGGCTTCCACAGAAAAGCTCATCTAT -0.50280501 0.045473 1
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.25831427 0.04549 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.64396122 0.045509 1
100043479 CAAATGATGAACAATGAAGGTAAAAGGGCTTCCTAGTATACCAAGAGTTGTGGTCCTCAC -0.43616969 0.045516 1
56696 TTTCTCCTGATTCTGTCTGTTGTCCCCATCTCTTGGGGTGGAATTAAAAGGATGCATCAC 1.38605096 0.045536 1
11637 AACTGACCAAATGCTGCCATGTTTGGCCCCTGAGTCAATAAAATATGTTGAAAATTTGTA 0.4121802 0.045562 1
258289 GACATGAAAAGGGCACTGAGAAGGCTGCTCAGCCAAAAAAGCTTGATTTGTAGTTGGTGA 0.20623283 0.045583 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.66983995 0.045583 1
230837 TCAAAAGTCTGCTTTCTAGGGCCAGAAATCCCACCATCGCTTAGTCCAATTACAAAGCCA 0.51881926 0.045616 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.26060274 0.045617 1
13480 CTGGGCCCACAGTGCATATTCCAATAAGAACTACTGTTGTTGTGTTCCCCTTTGCCAAAA -0.28683533 0.045648 1
258298 CCTGTAGTATACAGTTTAAGGAACAAGGAGGTAAAAAATGCATTTAAGAAGGTTGTTGGA -0.2697669 0.045675 1
232414 GCAATAGTCTGTAACGCTTTGCAGATTTCAGTTGACCTTGTCCATTGTGCCAAGGAAAAA 0.96950531 0.045731 1
100702 GAAATGTCAAGTTCAAAAGAATGAACTGTGTAAAGGAGAGAGAGAGATCTTGGTGCTGTT 1.2394274 0.045736 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.64270451 0.045818 1
11501 CCGTCATCTCCGGATTGAAACAGATTAGTTGTTGAAATTATGACTAAACACTATTCACTA 0.64267056 0.045938 1
68842 GTCCAGGAAGTATTCTAGAAGGGAGTAATGGTTTGCATTCAAAATGATGTAATTTTCCAA 0.35860998 0.046005 1
353211 AACCACTTGATAGAGGACTTTGCTGCTTTGTGGCATTCAGGACACTCACCAACAACAATG 0.35549377 0.046035 1
78134 GGGACACATTACAGCCAGAGAGCTACAGTATTTGTGCCCAGGTCAGGAGTAAATTGAAAA -0.20304695 0.046039 1
20677 TTTTCTGCAATGAAGACAGAAAGAAGGCTCTGGGGTGATGCGTTTGGCATTTGTGTTGAG -0.29942748 0.046104 1
68044 GCAGGTCTCAATTAACTTCCTGTTTCTATTAGAATAACCATGGTTTGTTGTACGTAAGTT -0.30237538 0.046196 1
11858 TGGCCACACTGAGGGAGCTATCCAAGCAGAGACTCATCCCTGTCACACATGAGCAGGGTA -0.29566913 0.046217 1
77706 GGAGATACATACTTTAAATTAGTAGCTGCACATTAGTAATTGCTTCATTGGGTGCACTGA -0.19888959 0.046265 1
22259 AACGTTGTATACCATCTGAAGACCTTGTTGACCCAACCAAATAAACTAGCCAGGAGAGCC 0.36329895 0.046304 1
20351 CCTCCTCCCTTTGTTTTGGGATTCAGAAAACTGCTTGTCACAGACAATTTATTTTTTATT 0.27167473 0.046311 1
239985 ATGACATCCGTGAAGGCACACATGTGTGAGTGAACATTAGAGGGTCACATATAACTGGCT 0.33052021 0.046348 1
16425 AAACTCGAGGGTGCTCATCTCTGTGAAGAAAGAAAAATCTGTGACTCTCACCCTGAATAA 0.39943924 0.046388 1
208898 GGCCAGTCTCTTTAAGAGCTTGATTTTAGCTTATATACATAAGCTTTGCAAAGGAATGTT -0.40321758 0.046417 1
13858 GTGCATCAAACTACCTATGAGCATGGGATACAAAAGGTTTGAGATTCCTAGAAATGTGAC -0.21106533 0.046513 1
53975 CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG -0.20673068 0.046546 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.49653652 0.046585 1
446101 CAGCTGCTGGATGATATCCTCATTCGCATGCGGGACCCTCGGAATGTTACTGAGGCTCCA -0.29359056 0.046612 1
333433 CCCACTGGAGGAATCCGGGGCTTGGCAGTGGGATCCTGCTGAACTGTACTTCGAATACAT -0.2373156 0.046677 1
140887 TGCCACTTTGTTATACATAAAAATATGTCCAACCTGGTGGTCTGGTGAATATTTGGGGGG 0.24030276 0.046711 1
258296 TGGTATGTCTCTTCCACCATCCCAAACATGTTGGTCAATATTCTCTCTGAGAATAAGACC -0.3992184 0.04672 1
100163 TCAAACCAGGGAGCTTTAGTTGTCTGCTTTTGTCTTGTTTCTGGTTTTGGTTTGTTTTTT 0.22699621 0.046721 1
20610 GTGTGAGGCTTTGGGGTTTGTTTTTGTTTTCATTTTTGTTCCCTCCCATCCCTAACATTT -0.25729811 0.046765 1
217219 TTCGTATCCCTGGACGGACGTTCCAATTCACAAGTGCGCCACTCCTACATCGACCTGCAG -0.31257436 0.046765 1
671927 TCGGGAAACCCAGTGGTTCAAGGAGTGAACGGCTTCAAGGCTGAGTTCAGCAAGAGCGAC 0.23487134 0.046766 1
12763 AATGAGCTCTGCATGGGAGATAAAGCCTAACAGAAGGAAAAGTGAGTGTCAGCACAGTAG 0.52786893 0.0468 1
110749 TATGCACTTGCGTCAGAGGAGGCAAGGCCAAAGCTCGAAGGCTGGTGATGGTGGCCAAAT 0.76072307 0.046805 1
13098 TTACAGAATTTCAAACTGAAACCTCTGGTTCACCCAAAAGACATTGATATGATCCCATTT 0.23332801 0.046833 1
73121 TTTGTGGGGCAAACAGAACCTAAATGACTGATAGATTTCTGTTCATCTATTAGCTTATCT 0.39278166 0.046897 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.2411413 0.0469 1
16362 CTGCTAAATGGTGTTTGGTCATGTGGTGGACCTGTGTAAATATGTATATTTGTCTTTTTA 1.54780651 0.046942 1
100037283 TCTGGGAAAACTAGCTTGAGTCCAGTCGCCATAAGTAGAACTGTTAAATTTGGTAGAAGT 0.40373099 0.046983 1
19700 TGTAGACTGGCTTGGCCTGCTGGCCCAGATGTCTCAGACAATCCATAAAGTCAGTGAATT 0.28942321 0.047002 1
13179 AACACCTTCAGATGTGTCTATGTGCGTTCTGCCATTCAACTTGGAAACTACAAGTAACCC 0.91296557 0.04703 1
100037282 CAGAGAGCAGCTCAACATCTGGTCAGTTATAATGCAAGGCAGGCACATGACCCATCCAGG 0.35237155 0.047076 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.54335363 0.047164 1
12959 TGACTACAAGCACTTCAGAGAGTGGGGCTCCCATGCTCACACCTTCCAGGTGCAGAGTGT 0.61868233 0.047199 1
99890 GGTGCAAACTTAGACAAAAGATGGTCTGTTTCATAATAGACCAAGTATGTTAAATAGGTG -0.19189157 0.047257 1
56149 CACCGTTTTCTGCATATGTTGCTTCTGAACCACAAACTGTATAAAATTGATGGGTTTTTT -0.2216979 0.047332 1
68027 GGCTTGTTGGATTTTAATGCAGCATCTTCAGAACTCGTCCTGATGGTGTCTTGTTGTGTC -0.43092014 0.047595 1
18760 TGTGTGACCAACTGTGTTGTATTAACAAAAGTTCCCGGAAACACTAAACTTGTTATTGTG -0.20887583 0.047685 1
233057 GAAAAGGCCTTTGGTCAAAGAGCACATCTTACCAAACATCAGAGAATTCACACTGGTGAA -0.22086957 0.047687 1
12399 TGTCAAACAGAGGAATCTGTGTTTGTTACAATAATATAACAGATGCCTTGAAGGACCCGC 0.51726675 0.047708 1
12151 GCTTTGTCTTGCTTGTAGCCATTAAATCATTACTTTTACACACATTGCTGTTAACTTCTG -0.41411822 0.047742 1
625638 CCCAAAGATCTATGTCATCTACTGATCATTGTAAATAAAGTAAATCTGCTTTTTCAGGCC -0.34605419 0.047781 1
219094 GTAAATGGCTGCATCCCTTTTCAGCAACCTTCGAAACTCACGTTATCAAAATAGGCAAGT 0.23313256 0.047873 1
108069 ACAGTGGCAATATTAGGTAACCTTTTTCCTATGAAGTCTTTTGTAGGTTCTTGTTGTAAC -0.21797758 0.047875 1
259300 TTATGAGGATTAATCTGAGGCTTGGCAGCAACAGCCTTTCTCTACTGAGGTATCTTGGCA 0.31423029 0.047883 1
258603 CCTGACACAGCTATGCTTTTTTGCTACTTTTGGTATTGCAGAATGTCAGATGTTGGCTGT 0.50867397 0.047916 1
27423 TATTTGTGGGAAGAGATTGGACAAATTCCCTCATTGACTCTCTGACAAGTGTTAAAGGTA 0.46247681 0.04794 1
17933 CACATTTGGGGGTCTCTATATTTCTGAAGAGGTAAGCTGATGAAAATAAATAGAGTGTAA -0.29564445 0.047967 1
16818 AATCTTATGTCTCTGTGTGTTCTGTCCTGGTGCCTAGCACACACCAGGAGCTCAATAAAA 1.25969611 0.048071 1
320560 ATTGGTCAAGGCAAATATGAGCAAGGGTTCTTTCCAAAGTTACAGTCCGATGTCTTGGCA -0.23468599 0.048075 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.5111327 0.048099 1
109900 CTGGAGTCATCTCTACATTGCAGATTCATCGTGAGAACATGAAACAGGCGCTCAGCCCTG 0.22315698 0.0481 1
57265 TCACAGTCTACATGATCAAATACCTCATGACGCTCATCGTGGGCATCACGTCGGGCTTCT -0.34795141 0.048133 1
21847 CATATCTCAGAGGTTTCTGACATGCAAACTTGAACCCTTGAAAGAAGAGTTTTCTTAAAA -0.45126273 0.048179 1
13175 AATGGAACCCCTGGTAGTCAGCTCTCTACTCCACGCTCGGGCAAGTCACCAAGTCCATCA -0.26090617 0.048213 1
225207 CACAAGTCATGGAATGAACCAAGTGTGAATAACCAAGCACATGATATTATTTGTTGTGTT 0.27230904 0.048221 1
78785 TGGGTCTTGTGTTACGTATTGAAGTTTCTGTCCTGTTACGTGTAAAGACTTATCCACTAT -0.33625687 0.048258 1
239731 CAAAGACACGGATAACCATGATGGGTATTAGAGATGCCTTTTTCTGTGGTCAGTATGTTT -0.50290329 0.048265 1
319581 TTCCAAAAAATGCAAAGGAAAGAATCCACTTGCATCCTGGGTCCTTTAACCTTTTAACCG -0.18852288 0.048278 1
105000 GAGTTTCTGAATGTTATTTTGTGAAACTTGTTTTAAAATAGTAATAAATCATGTTATTTT -0.35868642 0.048363 1
116905 ATTGCCAACCCTAATATACCTGCTTACCGGTATGACCCATATGGCAAAGTCCTATCCAGA -0.23432247 0.048395 1
80334 TGAGTTCATTGAAAGTTGCCAAAAAGATGAAAACATAATGCGCTCCATGCAGCTCTTTGA -0.42124256 0.048465 1
667350 ATCAGACAACATTGCCAAGATGAAGGGCACCTTTGTGGAGAGAGATCACAAAGGAGAGAA -0.18288162 0.048507 1
56405 CGTGCGTTGCCTGTGACGTTTTTTAAAACTAGCATTTTGAAATAGTGAACATGGAAATCT -0.35464877 0.048614 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.23158963 0.048615 1
71914 CCACGTTTGTGGCACTGCTCCAAGAAGCCTTATGCACACATACAAATATACAAATGCACA 0.39557791 0.048624 1
71405 CTCATCACTAAATACAACAAGTCCAAATTCAAGCAGCTCCGAAGTCGCTTTGAGTCCTAG 0.18368183 0.048631 1
381801 CTCCGAGAGAATACTTGTCGCCTCTACAGTCTTTGAGCAGGGAGCACGAGCAGTCATCTT -0.35099602 0.048671 1
227731 CATATTTATGTTCATGGTTGATTGTACCTTCCTGTCATCACCTGGTGGGGCATGGGAAGA -0.23331783 0.048698 1
50934 TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT -0.3568599 0.048721 1
252876 TTTTAAACCTTCCTAAAGTTGTTACATGTTTGAATACAAATAAATATATGTAACAGAAGT -0.2997106 0.048766 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.49873155 0.048794 1
12258 TGGGTAAACATTGTCACCCAAGCTTCAGCTCCTCCGGTTATTTCCTTGCCACTGCCTGCC 1.25869856 0.048833 1
245305 GAGCTCTTCCATTCCTCTTCAAATATGTGAAAAATCTCATAGAGAAAAAGGATGCTACAA 0.29827442 0.048851 1
15950 AGTGAGAGGCATGAGTGCATTTGCTATGGAATTGGAGATGATACAGGAAAAATGGCAGTG 0.96847559 0.048875 1
93757 TGATCGCTCTTGAAGGAGATATTGTAAGAACAATTGGACACAAAAACCGGTTGGTCAAAG -0.21077691 0.048876 1
71898 AGCCGACACCCATCCTCAGGCATGTCATGGTCCCCTAAATAAACCGTTTCTGTTGTTCCT 1.77828726 0.048876 1
319636 TAGATTAACTACCAAATAGGAAGCAGCCATGGAGGTTATTGCCTGCGTCCCAGAATCAAG -0.22809368 0.0489 1
101744 CCTCTTGTGAAGACACTTTGTTGCTGTGACCAGGCAGTACCTTGGCCTGGGGAGGAAGTC 0.28171982 0.048917 1
17857 ACTTTCCAAGGAAACTGGACGTTTCCACTTTAGCGCTTCCAATAAAATTCTTGCTAAGTG 1.22575403 0.048934 1
14683 CTGCACGTCTTTCTTCCTATGACTCTACAAGTAAAAATAACTATTAACGCTCCTGATAAA -0.40985014 0.048949 1
14347 GGGTTGTGGAAGGACAGTGCAGATGATTCTGGGCTTTTGACACCACAGTTCCCCCAGGGA 0.41664127 0.049 1
16909 CTTCATTTTGAGGTGAGGCGCCCCACAGATTGTTTCTATACAAATGTAAATCTTAAAAAA 0.39609521 0.04901 1
NA TCTCAGGCGCGGTTTCTGATTGAATGCAGAGGTCACACGCATGCCTCCCTGTATTACCTG 0.32289741 0.049092 1
380752 CAGCTGGTGCGTGACCTAGACTTCAACCCCAACAAGCAGTATTACCTCGCCAGCTGTGGA -0.26195645 0.049136 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.48016442 0.049175 1
70047 GTTCGATTTGTTGGACATGCAAAACAGAGAATTCAGGAAGATTATCTTCGAATTTTAAGG -0.21295357 0.049193 1
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.39208525 0.049203 1
257933 CTTGAGGAACAAGGATGTAAAGAATGCTGGACAGAGGATATGGAAGAAGTTGTGCAAGAT 0.36515507 0.049215 1
19893 AACAGAAGGCTCAGAAACTATTGATATTACTGATGAGAAGCTAGATGAAGTCCTTAAAGA -0.28124716 0.049283 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.51360524 0.049289 1
232966 ATCTGCTGTAAGGGCTTCAGTCAGAGATCGCATCTCGTCTACCACCAGAGGGTCCACAGT -0.26725504 0.049316 1
624086 ATCGGAGCAGAGGGATAATTGCGGGTTTTAGGATCCAGACGTGGTACGGGTGAAAATGCT 0.24401158 0.049497 1
68355 AAAGGAGTTTCTCCATTAGCACAGAATAAACTTCTTTCATCTATGGTTTGTGGGTCATGC -0.21323619 0.049502 1
13371 AATGATAACTACTGACGAAAGAGCTGTCTGCTCAGTCTGTGGTTGGATGTAGTCACACGA -0.38528876 0.049531 1
231570 ACAAGACTCTCACGGGAATAGCAGTGTAATAAAAAGAGGGGATGGCAAAGGACTTAGTGC -0.2339976 0.049532 1
20018 GGCCAGCATAAAGGACTATAAAGCTAAAAAGGCAAGCAAAAAGGAGCCCACATTCTAGTC -0.21082025 0.049539 1
213773 GAGCAGGCCAAACGGGAAGAGCAGGTGATCAAGCAGCAAGAACTGGACAACCTGCTCCAT -0.21209161 0.049602 1
17444 GAATGATATTGTGTTTCTCTAAGGTGAAAACTCAGGTATAAAATGAGAAAAGGGTGAGAC 0.92481099 0.049706 1
319613 CTCTAGGGCATTTGGGGACACTGTCTGGACAGCGCAATGGACACGGTCTGCAAAGGAAAC -0.28891989 0.049709 1
12772 GAAGCAGGGACAGAATTCTTGCTTTGAAAATAATACTTGGGAACATATCTTAATTACAGG 1.05710383 0.049759 1
68477 CAGGTACAGGCTTCATGAGTTTTTCATACTGATTTACAATTGAGTAGATACCAAAAACAG -0.22080097 0.049822 1
100702 GGCTCTCTTAAATGGATTTTCTACAGTTCTTTTTCATTACCTTGTCCGTTATCTAAAGCA 2.10022584 0.049831 1
74153 ATTCCTACATCTTCAGCTCACAGCAGATACTTCAACAATAAAAACTTGTTGACGGAAGGC 1.33089247 0.049857 1
15944 GCATTGTTCCACTGAGGGACAGGGACAAGTAGTGATTAAAATTCATTGACCATGATTCTT 2.0057857 0.049862 1
630322 ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT 0.50451915 0.049898 1
218772 GCTTTCTATGTTCATATACTGTTTACCTTTTTCCATGGAGTCTCCTGGCAAAGAATAAAT -0.28227081 0.049901 1
69573 TGTTTCAGACCTCTGTCCTAAAGGACTCTTTTGGACCTAAGTATCTTCTGTTGGTTTACC -0.19079522 0.049943 1
270627 GGCAGTGGCTTTGATTATGGCTTCAAAATGAAGAAGACTGAACATGAATCTACAATAAAA -0.24275133 0.049952 1
81896 TGGGACCACGGCTCCCATGGTCTCCTTGCTGTCCCCAGACTGTTGGGAGAAGGAATTAAA -0.2938728 0.050071 1
237782 GCCTCATTCACATAGATATCTAGGTAGGTTATTCCTGTGTTCCAAGAAAATAGGAAAATA -0.18149399 0.050085 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.53088094 0.050116 1
407243 AAACATACTTCTGTATCAACACAGGCTGGCTCAACTACCGCCTAGAGGTTATAGGCTTCT -0.22398062 0.050166 1
235627 TGACCAAGGAGCGCAGTCATGTGCTGGTGGGCCTGGAAGATGGCAAATTGATCGTTGTGG 0.27724719 0.050196 1
381582 AGCACTGTTTCTTGAACACCTGTTGTCCATCCGTCCGTCTGGAGGGGAGGGATGTGTCAG -0.25880409 0.050202 1
77627 TGCTCGAGTACTATGACAAATCACTGTCTTCGAAGATTTCCTACAATGACTTCCTGCGTG -0.77853381 0.050252 1
13139 ACCAGCAACGCAACAAGGAACACTGAAAAAATGCCTCATTCTAATAAAGTGACTTTCTCC 0.30259386 0.050257 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.40621963 0.050366 1
235627 CAGAAGACTTTGTTCTGCTGGGCACCGCTCAGTGCTCTCTACATATCCTCCACTTGAACA 0.26759585 0.050403 1
66717 ATGGTATCCTACAGAGTTTTGATTCATTCTGCTGATTCCTACCCATCAGCTATGTAACTG -0.20355718 0.05041 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.30392987 0.050418 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.20282918 0.05042 1
319554 CTAATTTCTTGCTAACTCTGAACAGTTGATTTATCATTGGGGATATGACTATGTTGCAAG -0.36242464 0.050484 1
258270 AATACTCTGTCATCATGAGCTGGAAAGTGTGCACCATTATGGCTGTTGCTTCTTGGGCAT 0.20939653 0.050527 1
65246 TCATGGAAAGGTGTATGTTGTGGTTATCTGTGCTGTTCCTGGACACAAGTGTTTCATCTA -0.37068415 0.050544 1
211550 GTCAGGTGGGGGAAGTTAGCCACATTCGTATTTTGTTTTTGTTTTTGTTTTTGTTTTTGT 0.49238154 0.050598 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.67544392 0.050622 1
69256 TTTCATAGCCTCAATTCAACATTTCAGGGTTCAGTAACTCTTAAAACATGCCTACTCCTG -0.44387847 0.050641 1
66616 GTGCAACCATGAGTACAAAGGCTTTCTCGGCTGCTTCCCGGACATCATTGGTGCCCACAA 0.36226999 0.050677 1
26920 GGTATGTCTAGTTACCATGGAAAAGAATGTACTAAAAGCCCCTAGGCTTAATTAATAAGT 0.31081494 0.050705 1
67088 TAGTGCCTCATTAGTTAGCAGAGTGAGAACTGTTTACAGGGAAGATAGTGTGGCTCATTG 0.30533149 0.050739 1
19401 CCTGTACATATCCTGCGTACCAATCCCCAGATATTAATTCTCGTTGGTTTTGTTTTTATT -0.39924219 0.050766 1
66895 CTTTTACACAGTCTGTTTTTAATCTATTTTAATTAAATAAAAATCTATTGTTCTACTTTG -0.21815071 0.050819 1
218772 AATTCTGAAGGACATGAACCCTTGACCCCAAGTTCAAGTGGGAATATAGCAGAGCACAGT -0.21105091 0.050822 1
100037283 CTACAAAGACCCAACATTGATGTTCACATTTTGGAAATATTTTGTGTCCCACAAAGTAAG 0.8185802 0.050822 1
20715 TGTCTCTTGTTGACCAACTACGTAGGACTGGTGGACACCTCTGCATTACTCACACAAATT 1.74694096 0.050835 1
241944 ATTTGGGTACTGCACAGTGTAAAGTATTTAAAGGAGTGAGTGTATAAGACATCAGTGGAA -0.20502968 0.05084 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.47232216 0.050874 1
60440 TGGGCTAGAGAGATGGCTCAGTAGATAAAGTAGAACTTGTAAGTTTGAAGACTTGAGTTC 1.504447 0.050967 1
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.30968532 0.050974 1
19650 ACACTGGAGGTTTAGCCTTCTGAAGAATCAGGTCGCTAGTGTTCACCTTTTCTTCTGTGT 0.61933689 0.050999 1
15944 AGAGAATAGCCAACGAGTCCTTGAAGAATTCTCTCGGTGTCAGAGATGATGACAACATGG 1.90531519 0.051025 1
244180 CTCAGTCAACACATTAAGGTGTTAATAATGGCCTGGAAGGAATTGATTAAGAAACAAAAC 0.19074359 0.051099 1
77521 TGTGCAAGACCATCCTGGTATTGGCGCTTAGGAAGGTGTAAGCAGCAGAGTCTGGTGTCC -0.31828238 0.051118 1
20499 CTGTCCACATTCACGACGTTCCAGTTAGGGTAGAGGCCACGTTTGCACCTGCACAGGTTC 0.52721072 0.05119 1
100040631 ATGCAGAAGAACGGTGCTGGGTTACACTCCGCAAGTTCCTGCTTCTGGGACAGCTCCACA 0.54618899 0.051191 1
20975 ATTCAAAGCCCATCATTGACCGTTTTGTGGAGTCCTTCAAAGCCATGTGGTCTCTGAATG 0.24125219 0.051295 1
399674 GCTTCTGCAAAGTGTTCTTTCTTGGAGCCAAATGTGGTCTTAGAATCTAGCCAGCTATGA -0.21948775 0.051353 1
78102 CGTTTGTATTCATTTTGTGTGAGTGCATGTGTGTATTTGGGTGCAAATAAAAGCCAAGGG -0.31788595 0.051359 1
13841 TGTCATCATAATTGCTGTAGTGGCTGTAGCAGGGACCATCATCTTGGTGTTCATGGTGTT -0.45870377 0.051402 1
12295 TTGGAAGATGCCTGCGAGCACCTGGCTGAGTACTTGGAAGCCTACTGGAAGGCCACACAT -0.33422694 0.051402 1
242384 CAAAACTGCTCAACTCTGTTAACTTCTGTTACTATAAATAAAGGCATGTGCCTAGTTTTG -0.19721572 0.051441 1
233335 AGTTCCTCCTGAGATCAGAACTTTTCCCTATAGGTTCAAACTAGGAAGCATGCACTAACT -0.3474567 0.051455 1
16182 TGTCACAACAGCTGTGTGTGAAAACCTAGCATCAGAAGAGAGTTGGGAGAGTTTGAGACT 1.50053548 0.051468 1
72536 GACAGTTTATTACTTGCTGATGTTATATCCTTTGCCTCAAATAAAAATCCGCCAAGAACA 0.46344169 0.051505 1
70806 CAAACTACGAGAATGTGATTGCCATTCAGATTGGAATAATGGAGCAAACGATTAGTGTTA -0.33474507 0.051508 1
16912 CAGCTGCTGGTGTGGACCATCGAGTCATCCTGGGAGATGAGCTGCCAAAATTCTACGATG 1.87722522 0.051533 1
68655 GAAAGTATACCCTCTTTGAGATTTATCCTAAAGACCTATCCATCACTGGGCTAAGTGCCT 0.77141239 0.051546 1
384619 CCACTATACCTCCTCCGTCAGCATGGGACCCACATCCCTAAGTTGTGTTATGCGACCATG -0.19996381 0.051596 1
12982 TCATAAAATCCAACGTGCCTTCATGATCAAAGTTCGATAGTCAGTAGTACTAGAAGAATC 0.49422957 0.051623 1
630322 ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT 0.34127474 0.05177 1
214791 CCCGTGGCATGCGTTATATTTTGACCTGTTTTTGCATCATTTCATGCGTTTAGACTCTTA -0.35532816 0.051808 1
100503847 CATGGCCAGCAGCCTGTCAACAGACTATTTGTAATGTTGCTACCTTTAAATATCGATGTC 0.51687646 0.051843 1
269784 TGTACGCTGTCAGCCATCAGTACAATAATGATTTCTCTCACAGCCAGGTCTAGTTTATGA -0.5691181 0.05186 1
69792 TAAAATCTGAGGAGAAGGAGAGCACAAAGAACATTCAGCAGACTGTGAGCACTAAAGGTC -0.22319555 0.051861 1
224617 TTTTTTCTGACTTTTCTACCAAAAGGTGTGTATTGTTTTCTTTATATTTTTATTCTTATC -0.23888897 0.05189 1
26382 CCACCTGATGTCTATACCGAGACAATTCATCCTGACTCTGTATCCAGCAGACACAGGCCC 0.65347259 0.051926 1
19088 CTTGTGTGTTAGCCTTGGCCTATTGGTAAAATGGTGTGAAAATCATATGCAATTTTGAAA -0.30775096 0.051942 1
27274 ACCTGCCAGTCATTTTTAAGACCAGACACTTAACTGTAGCAGACATTGACAATGGCCATT -0.28268663 0.051959 1
75547 AAAGAAGCTGATTGTAAGAGAAGTGGCCCATGAGGAGAAAGGCCTGTTCCTCATCAGTAT 0.34209871 0.051977 1
381820 CTCATGTGGATGAATATATATTGTTACAGGCTTGGCATGGAATTGTCTCTGTTATTTGTT -0.40374974 0.051991 1
104816 CTGCTTCCCAGCCTTTCCGCACGACAATCTGAAGGTCTTTGTTGAGAAGAATGTCAATAA 0.63389011 0.051992 1
74528 CTAGTAGCATTAAAATTATAAGTTACACAATCACATTTAGTTTTCATTAGTCTTAAAAAA -0.24101113 0.052011 1
78826 CACCAAAAGGAGGAATTAAAAGAAAATTTCTTGGTTTTGGGGGAATGAGATAGTTCTGTA 1.04000167 0.052011 1
226539 ACTTTAGAACCAAATGTCTGTGTAGAAGCAATCATTACCGAGTAAGAAAGAGAAGCTACA -0.29708691 0.052125 1
16911 ATTGTATCTCTGTAAAATACAATGTATGTATGCATGTGAGTGTTCTTGTCCTGATGTTGC -0.20735292 0.052127 1
28080 AATTGGGGAGAAGTACCTTGTTATGTCTGCAAAGAGCAAGATTCAGAAGCTCAGCAAGGC 0.30914978 0.052267 1
14268 GGTGATTATTTTTATAAGCACATGCCAACGCTTTACTACTGTGGAAAGACAAGTGTTTTA 0.40776166 0.052288 1
67311 GCGTGAACATGACATTGTTATAGTTTGGTGAAAAACTATTAAAAATCAAACCGTGGTGCT -0.25953802 0.052313 1
68870 CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT -0.29025191 0.052365 1
240665 CTGGACAATCATTAAATGTGTACTGTGAAGAGATTAATGATGTGTGTAAAGGACTTAACC -0.23257374 0.052378 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.21261965 0.052401 1
13664 CCACAGCTCAATGAAAACACGGTTCCTGTTTTCTAAATGGAGGCGCCCAGAAACACAATA -0.19734373 0.052402 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.40256358 0.05251 1
15289 TTGAGATTATCGTTCTCTTAAAGTGCCAGTGTTTTAAATAGCGTTCTTGTAATTTCACGC -0.18945744 0.052516 1
56525 GCCCTGAATTCATTGAGGAAAGAGCTTTTTATTGTAATCACTACTGCAAATGTTTTTGCA -0.23099912 0.052565 1
209837 CCTAGATGAAGCTGTTAGGGTTACCCTGGCGCTAAAAGGGAAGAATAAAGATGCTGAATG 0.50953565 0.05262 1
16517 TTATAACATGCTTTGACACGCCTGATGGCTTACTTAATAAAGATCTTAGACTGGTGCAAA 0.1907841 0.052653 1
73451 TAATTTCAGTTCAGTGGGTGTTGTTTAATGAAGTGAGGCAGTGCTTTTTCTACTTTACTG -0.24357186 0.052722 1
240261 CCCAGATGTTTTTATCATGGCTTAGTGATGTAATTTGGGAAAATCAGTCTTTTTTAAGCC -0.25882407 0.052724 1
67337 ACACTAGCGTTTGAGCCGTTGCACACGTCCAGAATATCACACACTCATTTTTGTCACAGA -0.17265294 0.052758 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.4404963 0.052785 1
22763 AAACTTATTGTACAGTGTCAGGTATTATATGGGTGGAAAGAAAGAGATTTGACTAGGGGG -0.2226109 0.052791 1
100040563 GGTGGAAACAGCTCTACTTTCTGAAATGATTCAGATACACTAACTTTCCATACTTTATTC 0.56878409 0.052815 1
68032 TGTGGTGAGGCCAGTGTGCAGCATGTTACAGCAGAAAAGAAACTACAGCACAACTTATGA -0.18897963 0.052825 1
226841 GGTTCATTTTTCAAGGCAGAGTTAGTCACAGAAACATCTAAAAATGTTTGTCTTTGTCAC -0.21568731 0.052884 1
14191 TTGGAAACCAGGAGAACAGGATATATGGAGTCTCACCTCTCCTGTCAGGAAGTGTTTATT 0.49131643 0.052918 1
53975 CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG -0.19118056 0.052994 1
16992 AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC 0.27157847 0.053025 1
50723 TAGATGGGGCATAGTGACTTCTAGAAACCTAACAAGGGAATAAATGTAAGATGTGCTTTC 0.47883842 0.05306 1
16994 ATCTGTATTCATTCCTGGAGGATCGACTGACGGTGCGAATGTGTGAATCGTGATGTCCGG 1.85808949 0.053139 1
237859 AATAAAGATAGTAATATGCTACTGCATTTAATTCAACATTTACTTAACTATAAAGGTGAT -0.2044995 0.053215 1
15978 CTTCCCTATACAGCTGAAAACTGTGACTACACCCGAATGACAAATAACTCGCTCATTTAT 1.50859859 0.053217 1
70546 GTCTTGACAAGGAACTTACATCAGAAATGTACTTTCATGTCTTCTCATTTGAAATCAGAG -0.36558857 0.053253 1
217716 GTTTATTTCTTTGCATCCATGCACACAGGAGCTTGACATATAATACCTATCTTTTGTAAG -0.26779925 0.053284 1
67946 ATTTTCTACAACTTCAGTGATCACTGAATGTCTGATAAGCTCAAGGAAGTGCCGCACTCA 0.24988625 0.053293 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.47878862 0.053379 1
666914 GATTCTAAATTCCAGCATGGCTATATTGTTATGGCACACTTCAAGGAACACCAGCTCCTG 0.20301993 0.053398 1
13590 CTTTCATGCAAATCTGAAGTGCTCATTATACTGGGAGAGCTGGGGATTCTAACTCCCTAA -0.75902184 0.053452 1
242748 TAACTGTTGGCACCACCGGGTCCCAGAGGCACCAACTCCCGTGAATAGAAGCTTGACCTT -0.27932821 0.053469 1
13121 AGGTTCCTTTTAGTATTATCTTTGGTTATTTAGGTAAGTCACTCTTGTTATCAATGCCCC -0.39144715 0.053492 1
74748 GGGGTCTGAGTTCCTTGTGTTCAAGATGTTATTATAAGAAAAGGCAAAGAACAGGAAATG 1.58709483 0.053496 1
67422 TTCCTGAAGGCCTTGGAACTTAAACGGGCCAACTGGCTGGCACTTTGGGGCACTGCATCT -0.28038566 0.053507 1
229227 TTGCTCAGACCAAGACCACAGCCATTGTGGAAGTGAAAGGAACTGTTGATGTTGTTCTCA -0.28746117 0.05352 1
53313 ATTTTATATGTAAATCAAGATTCACATCACTGTCCTGACCCCCAGTAACAAAAGCCCCCT 0.34495336 0.053541 1
217578 GCAGATAGATATCTGGGTTTGAGGCAAGCATCGTCTACAGTCAATTCTGGACATTGAGGG 0.49478602 0.053578 1
232533 TTTTTAAGCAATATAATCCAGCAGTTGTCCAGAACCATCAGGCTTCTGAGCCCATCCAGC -0.24391774 0.053618 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.46966088 0.053642 1
14247 TTTTCAGGTAATCGTGACTTTTTAAACGATATTGTTAAGGTGACAACTCTTAGTCCACTG 0.60066992 0.053661 1
93683 TTGTACATGTGGGGTATATGCCATGTGTCAAATATGCAATAATGTGTTTACTGGATGCCC -0.21914911 0.053722 1
66634 GCAGGCATTCAGCTAATGCAAAAACAGATTAGTATGTGTTCAGGTGAACTTTTACTTAAA -0.24582776 0.053753 1
83408 CAATGCGTGCTTTAAAACTCGGCGTTTCAGCCTAATAAACAGAGACCTTGATAGGAAAGA 1.58359919 0.053813 1
667597 TCCCATTCTGACATCTTTTCGTTATACTAGTCGATCTACTGTATCTATGGAAGAAACCCC 0.87056207 0.053834 1
110084 ATGAGACGTTTGCCTTATTTAATGCCATTCTCCAGCTGCAGCCCAAATCCTCTTCTATGG -0.23157774 0.053838 1
56552 AACAATCACATTCAGCATGCTGGTTTTCTGCAGTGTGTGGATTTCTTTTGTACCAGCTTA 0.22203202 0.05384 1
67781 CCCCAAAATATGCATCAGTGTGACCATGTCCTGAACCCTTTGAAACCATAATAAAATAAA -0.20680819 0.053875 1
15182 TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC -0.24310699 0.053984 1
20737 CGTGGGGTCGGGAAAATTAAATGATCTGTAAATACATCTGTAAGAAGCTACATCCTGCGT 1.40597962 0.054167 1
380918 TTCTCAACACTTCACTGGCTCAGCTCTTCTCTGACAACGGCAGCCTCGCCATTGGAATCG 0.20470189 0.05426 1
22762 GAACTTTATAACTCACAAGAAGTTTTATTGCTCATCACATGCAGCAGAACATGTCAAATG -0.21048524 0.05427 1
19260 ATGTGACAAACTTCCAGCAAACTTGTATTTTCATATTCCTTATATTTCACTGGGAACTGC 1.03057402 0.054347 1
245525 GGATATGCATCATACTGAAGGAAATTTGTTAGAGCTAAATTCATTACTATCTAGGAAGGC 0.24670251 0.054442 1
19265 CATGCATGTTATGGTGAAACACAAGCTGCCCTGGACCTTCGTCACCCCACCCTTACATCA 1.17481982 0.054488 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.42892338 0.054506 1
13041 AGTAAAGAAGGCACGGACCTCTTGTCCTCCCTGAAGGCAGCAGCCACTCTTCTGCTTCTC 1.34853002 0.054525 1
100042588 GGAATAATACAGCAATATGTGATTGATTGCTACGGCTGCTCTCACCAAGTTGCCCTGCAT -0.27339087 0.054574 1
442825 TAGCAAGTTAAAGACTTACAAGAGGATAACGAGGAAGCGTCAGTGCGTGGTCGATGGACC 0.19425692 0.05458 1
68176 AACAGGGGCCGCAGTCGGCAGCCCCTGGTGCTAGGGGATAACTGTTTTGCTGATTTAGTT -0.227193 0.054594 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.24370022 0.054606 1
51812 AGATCACCCCACAGTGAGGCGGTAGCAGAAACCAGGGTATTCTCCAGCCTCAGTTTCCCT -0.18286403 0.05461 1
74270 AGAAGCCAGCCTTGTGCAAAAGTTACCAGAAGTTGATCTCTGAGGTGTGGCACAAGAAGC -0.19249944 0.054771 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.20726118 0.05478 1
70375 AGCTTACAGCATTAAGATGGTAACTTAAGTGTGCTCTTGCTCTCTCTTGAGCATCTATAA 0.33462649 0.054808 1
380711 TCTATGAGGAGGAGGAAGAGGACAGCCTGAGCCCCAACACATTCGGCTACAAGCTCGAGT -0.19771549 0.054813 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.30326007 0.054826 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.45086489 0.054906 1
12368 ACCAAAAAGCTGCATTTCTGTCCCAAACCTAGCAAGTAGGGCCATCTGTCTTGCTACATA 0.2980986 0.054988 1
80857 CAAAGACCTACTGATGTACACTTGATGAATCTAGAGCCATTGTTTAAAAATCACAGTTCC 0.17277422 0.055039 1
75805 GTTTCAACTGGCCTAGTATATAAGTTTTGTGTCTTGCACTAGAAGCTCAAATGTCAAGTC -0.27251415 0.05506 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.67222447 0.055123 1
75712 TCTATTCTCAGCACATCAGCATCCTGACACAATGCACTCAGTGTTGAAATAAAATGCATC -0.24352143 0.055212 1
18045 TTGTGTATGTGCTGTGGTAGTTCTAGCTCTATCAAAAATGGCTTATTGTATAGTCTGTCC -0.34517806 0.055221 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.52083595 0.055237 1
269470 AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG -0.17386597 0.055253 1
407803 TATCCTTGGGTTTCTCAAAATGGGTTTCCCTGAAATAAAGGTTCCCCCATCTTTTCACAA -0.27259957 0.055394 1
68870 CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT -0.30217865 0.055437 1
19046 TTTTTTGTTTGTTTAGAGACAGAGTCAAGTCCAGGTTGGCTTCCAGCTCTAGTCTCCTGC -0.17826061 0.055456 1
73100 AGTTTAGTTTGCCCAAGTTCCAGGGTAATTAATCAACTGTAAAATAAATGCAACAGGTAC -0.32345572 0.055506 1
671535 CTTGGTTGGACCGCGCCCTAGAGGGGTTCTCTGTCTTTGAATAAACCTGTACTTGAAACC 1.51233077 0.055644 1
18390 GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT -0.2069193 0.055735 1
109593 TTGTGTAAATGTTGTCCAGATTTCTCCCTAGGAGATGAGGGCTTTGTGTCCGTGGTTAAT -0.40165495 0.055744 1
64452 TCAATGTCATCCTCCTCTTGGCTGTAGCAGCGTTTTTCTATGGCTATTTTGCCTGAACTC -0.60268487 0.05578 1
21405 TTACCTGTGGTATTAACAAGTCAACATGTTACAGACAAATGTGGGGAGAGGAGGAGGTGG -0.2749841 0.055798 1
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.18376456 0.055806 1
100505017 ATAAAGAGTGAACAATGAAGCCATCATTCCGTAGGGTTGTACGGCTAAGCACTGCACAGA 0.27421443 0.055832 1
12263 TCTCTAGTGTGGATGACCCGTGCTCCTTTTGCTTTCACACGGAATTTCCCAGTTATGTAA 1.49247527 0.055843 1
668139 TTGATCTTTGTTCTAGTGTTGTAGCAAGTGATTCTTTCTTCATTTTACATGACCGCCGGA 1.08072854 0.055851 1
217258 TATTGTGGCCTTTCAGAATTCTGGAGAGATGGGTTTGTGGCTCTTCAAGCTGCCATTAAC 0.25309789 0.055878 1
223672 AGCCCACGCCCATCCTCAGGCATGTCATTGTCCCCTAAATAAACCGTTTCTGTTGTTCCT 1.21251224 0.055918 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.43520632 0.055952 1
433022 CCATATGATGTGTTTCCTTGTGTTTGACTTGAGCCAGTTAAAAAGGTTTAAACCTAGTAA -0.37167231 0.055966 1
67434 CCTGAGCATTCTATACACTAAGAGGTCAGTTTACCTAGAAGTCACCCTTAAAGAACCCCA -0.18279522 0.055983 1
319909 GGGGTGGGTAGTAAGTGAATGTGCAGAGTCAAATCTAAGACATCGTTTTCAATGGCTTTA -0.29226273 0.056002 1
72117 GACGAACAGAATTGCATTACGTAAAAGGCTTAGATGGACTTGTAACACATTAAGTGTATT -0.19699011 0.056068 1
209200 CATCCAGTGTGCACATGCAAATTCCACGTGGTGGAGGGCTCAATGACATTTGGATTTTTT 0.96098174 0.05608 1
98396 TCACCTGAAATCAGAACTGTCGAATTGGACAGATTCATAGAGATTGTCTAGTTGGGGTTG 0.21583565 0.056144 1
70769 GTTGTCAATTGCCTTCCTGTTCTGTGGGTCTTCATACTGAGAGATTTGTATATTTTATAT -0.18674636 0.056178 1
56229 CACCCAGATTATATGTGTGCGCGCGCATGTGGTTTTGATTAATCAGGAAGAAGTGGTTTA 0.29674621 0.056196 1
68051 AGTTCACTCCTCCAGATGCTCCAAATATCATACACAAACGAGCAGGGCCGAGGCGGGAGC -0.17063384 0.056224 1
381694 TGTTTATGTCCTCAAGCCCTCTAAACAAGTCACCTGCAAAATGTGTTCTCCTCCTTTCTA -0.22181455 0.056224 1
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA 0.27394074 0.056329 1
80285 GCCTGTTATTTTCTAAAATGATAGCACAAACTAGGACAACAGGATGATTTCAGGTTTTCT 1.03667638 0.056356 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.46933557 0.056409 1
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.26142654 0.056458 1
13857 GAACGGGATTGGTGAAGCCATACTTAAAGTCAGAGCTGACCTTGGCCCTCTGAGCAGGAA -0.39428405 0.056482 1
228550 CCCGATCCATAATTGTACTTCACAGGTATATAGACTTCCTGGTCTAACTCCTGCACTACA -0.45647026 0.056558 1
245522 ATGAAAAAGAATTAGCTCCAGGACTCTATCCCTGCCAGGGGAGAAGAGGGAGCTATTTAT -0.18317965 0.056586 1
16790 CACGAGATCCAGAACCAAAGAATCAACAGGGCACAAGATCTATATATATTTTTAAGAGAA 0.6204258 0.056722 1
16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA 2.50680905 0.05673 1
59289 GCACTGCTATGCGGATTTTGGCGGACATGCGACCATTTGGAAGCTGTACCTGCGCTTCCA -0.18223172 0.056745 1
235674 TCTGCGTGGGACACTCAGCAGTGGAGGAGTGTGTCACAGCACTTTAATTTAGAAAATGTA 0.23636436 0.056776 1
380753 GTCTATAAACCTGTGATACTAACAGCCACCTCATATGGTCATTGTGATAATTTCATGAAA -0.19399435 0.056787 1
278795 TATCCGTAGAATCATCCCTACTCTGACTCTGGATGTCAGGGCATCTATAACTTTCACTTG -0.4548132 0.056801 1
272589 GACAGAGTTCTCTGAGAGGCTTTTTTACGCTTTGAAACTCGTATCTTCTGTTATTACTCA -0.18750646 0.056847 1
109082 TTTGTGGTAGTGCTGAATTTATAGCCTGCTCGTTTGCAGTGTCCAGATGGCAACAGAGTT 0.21752002 0.056904 1
14200 TGTGTTATGAACTTGAATGTATTTTCACGGGAGAGCTGGGATTTGCAGCTTTGTGACTTC -0.45537577 0.056917 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.23941318 0.056995 1
28126 ACCCAACGGAGTGGCAAGCCTTCATCGATTCTCTGCAGAGTAAGAAGATGGAGGTAGACT -0.20731257 0.057047 1
70802 GAACAACAGGACTGAATAAGATTGGAGCTTTAAACTGCACTAAGAAGTAAATGTAAAGGC -0.2595827 0.057053 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 1.00505131 0.057066 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.21692425 0.057078 1
100503774 GGCTGCAGCTGGATAGTTGTGTGGTACTTGTTAGTTTTGTCTTATTTTATAATTGTATAC -0.23501645 0.057099 1
75292 CCTTGGCTACAGGATTATCAGACTTGGCTTGACCTCAGAGAATTTGAAACTCGCATTGGA 0.31340734 0.057122 1
233335 AGACGCGCTGCGGAACCAGGCGCTGGAGTTGGAGCAGCTGCGCGCGAGGCTGGAGGATGA -0.29781478 0.057158 1
109910 AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC -0.20080271 0.057167 1
70024 GCTCTCCTCACCTTTAGTGTGGGTTTATTTAAAATAAAGTTTGATGCTCCTAATAAAAGC 0.20333028 0.057184 1
408062 TATCTCACTAGTCTCTGTAGTCACAGAAAATTCTGTGCTGGAGAGAAACCCTGTGGCAGT -0.1871383 0.057213 1
26371 AGCAGACACGCTAACTGGCTTCTCTTAAGCTAGACGTAAAGTGATTATAACACTGTACCA -0.1811217 0.057222 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 1.02895633 0.057233 1
13006 GTGACTAACTTAGTGTAAATGTGGCCTTTGGTCTTTGCAATGGTTAGAAACATTAAATAC -0.22756621 0.057274 1
74279 TCCCAGATCCTACCCAACTAGGTATGCAGATGCTTTGAAAGATGAGATAGACAGGACCTA 0.24768416 0.057286 1
16643 TCTCATACATTTGTACCCAAGTAATTTATACTTGATGGCTTCTTCACACGTGTGCATAAA 1.02519401 0.057321 1
109264 TCTCCAGAGATGGTTTGGGCTGGATGAAGAAATACAATATAAACCGGTTCCAAAATGGCC -0.52915163 0.057327 1
76522 GTTATACATTGTGAGGGGCGACAATGTAGCAGTCATTGGGGAAATAGATGAAGAGACGGA -0.29610062 0.057406 1
18707 GGGGCACACAAGGCAGCTTTATGGACGGACAGGACTGATCTCTTCCAGAGCTGAAATCGC 0.21477344 0.057471 1
666244 GAAAGAACATAAAATGATACTCTCCTTTCAAGAGCAACATCAATATTGCCTGACAGTCAT -0.24657947 0.057481 1
213819 CAGTGGATGCTTATTTTTGTATTGGCAAAGAATCAAGCCATGTGTGGTTTTTGTTTTGTT -0.1958759 0.057484 1
320784 GGTTCTGTGCTGTTCTAGCTAGTGCATAGTGTCTCTAAATAAACATGCTAAATGATCAGG -0.41612643 0.057494 1
64424 CAGAACTCTGATCGACAGTCAAAGCGGAGGAAAATGAACTAGATGTTTTCCACAGCCACT -0.16768483 0.057501 1
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.77155904 0.057504 1
60315 AAATAGTGGAACTCGCAAAAGGTGGATGCCCTTGGAAGGAGCATCTATACCACCTAGAAT -0.16652354 0.057692 1
14866 TCTCACCTATGATGTCTTGGATCAGAACCGTATATTTGAGCCCAAGTGTCTGGATGAGTT -0.26899379 0.057744 1
67111 GTGTCCTGTGATTCTGTGTTCACACTCCTGCTTGTCCACTGAAGAAGGGACAGGACAAGA 0.31856154 0.057825 1
213573 ACATAGCAAGTTCCAAGACATCCGGAGCTACATAGAGAGATTCTACCTCAAAACAAAAAA 0.27050556 0.057861 1
78600 CATGGAGGGGCTAGGAACAGATATCACGGTCATCTGTCCCTGGGAAGCGTTCAGCCATCT 0.35785987 0.057983 1
18755 CTTCTCACTTCTCACCCAATCACATATTGTCGATGTGCATCACAGCTCCTGCGTCTAGGA 0.2659791 0.057986 1
12766 GCCAGGCGTTGTCAGCACTGAATGTGCCCATCTCAGTATCTCAATATTTGCCCAATTTTA 1.48721268 0.058024 1
232337 CTATCAGTGCAAAGAGTGTGGGAAAAGCTTCAGTCAGCGAGGCAGCCTGGCTGTCCACGA -0.20520986 0.05806 1
67187 AAGATATTTGCATATGCCTTTGACAAAAACCGAGGAAGGGGCTCTGGCAGGCTTCTACAT -0.20910573 0.058101 1
192653 TTGGGCCCTAGGAGCCATGGGGACTCCAAATGATCAGGCAGTGTTGCAGGCCATCTTCAA -0.17059009 0.058134 1
22259 TCCTGGGAGCTGGGTGAAGGAGAGAGCCTTGCGTAGCATTAAGGGAGAGTCAACAGGTTG 0.34775441 0.058173 1
215387 GAATCATTTCTCCATAGCCTCTTTCTGTCCTTAAAGAATTCCCAGATCTATGTACATAAA 0.33190688 0.058279 1
20439 GGGTTTAGTTTTTGTTGTTTTTGTTTTTATCTTTACATACGCGCACACACATACACACAC -0.21853845 0.058314 1
547349 CTTTTGTGTTGAAGAGCAAGAGAAAAATAGGTGGAAAAGGAGGGGTCTATGCTCTGGCTG 1.47149846 0.058347 1
78895 CACATACCAACGACATTGGAAATGGTAGTGATTCTCTTTGAAAAATAAAGACATTCTCGA -0.20668482 0.058381 1
74347 CCTTGAGACCTCTACGTCTTGTTTGTAAACCTCTATGTCTTTTGCTGTAAACTTCAACCT -0.18049555 0.058419 1
56532 TGAAGTGTGCCATTCAGCGTGGCAATAAAAAGCACGTTTTAAGCAACCTGGACTGGCTAA 0.90036979 0.058429 1
72112 GTCAGCTGTAGTTTTGTCTAATGCTTTTCCTTAGCAGCCAAGATAAACCTTTAGGAACCC 0.27314803 0.058465 1
66046 CAGGGTAGTAATGAAACCTGGAGGTCTGGGAAGTTGTGAATTCCTAAAGTGACACTGTTG -0.17575494 0.058538 1
414072 CTCAAGACTTAATTCTTTATGTAAAAATAAACAGACCCGGCTGTGTCATTCATATGCAGA -0.22257695 0.058624 1
257958 GTGGTAACATTAGAAGTAGCTAAGGAGATGACTCTTTCTGTATTCTATACCATTGTTCCT -0.20111758 0.058625 1
246791 CAGGAACCCTCATATACATGCAGAACTTGCAATCATATGATAGAAAAGCAATAAATCTGA -0.28837798 0.05863 1
24047 ACCTCCAGACCAGCTCTGGGTGGATCGCATCATCCGAAGACTGAAGACGTCTTCTGCCAA 1.30481899 0.058657 1
330941 CTTAGCTTTAATTGAGAGACAGTGCATTATTCGGGTTGCTTTACCCATTTGAGGAAGGAT -0.27204994 0.058659 1
232337 GACTCACCTGGAGTGAGGCAGAAGGTCTATGATTGCCAGGAATGTGGGAAGTCTTTCCGG -0.20482451 0.05868 1
74600 TCAAGGAAAGGACTGGAAGAATTTTTTGATGACCCAAAGAATTGGGGGGAAGAAAAAGTC -0.20055272 0.05868 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.24102083 0.058735 1
231655 AAGGTAGGAGGGGATCAAGTTCCTTTCAAATGGAGAATAAAAAAGCCATTGTTTCTTCCC 1.5151236 0.058757 1
223601 TTATTCCTTCAGTGTCTCAAGCAAGGATCTTGCATAGTACCTAAATATGGAGAGCTGCCA -0.33300511 0.058778 1
74558 CTCTTTGGATCATTGACATAGCTAGTCTTCAACATCCTCATACAAATTGAAGTTGCATTA 1.30549177 0.058815 1
77056 AAGGACTGGGCCTTGGTAAGCATGGATTACATGAGGGGGGACCAATAAACACTGATTATC 0.70147175 0.058823 1
108067 TCCGCTGCTATGTCCACATCATGAAAGAAGGACTTTGCTCTCGAGTAAGCACACTGGGAC -0.24651013 0.058837 1
56183 TGTGCATCCGTTGCTGCAGCTCGTCCCTCAACTGCATGAGAGAAGAATGAAGAGATTCAA -0.227437 0.058842 1
15387 GTCATGAATCTGGAGCATCAATCAAAATTGATGAACCTTTAGAAGGATCTGAAGATCGGA -0.21344209 0.058911 1
381334 TGGGGGATGGGATGCCCCTCTTTATAAGCTCAGATTCTTAAGTAAACTTTGGGCCTTGAT 0.32155256 0.058941 1
29820 ATGGAATATATTTTGAATCGCAGGATTTTCTACTCTAAAGAGTGCTGCTGTCTGTGTTAG 0.27188547 0.058949 1
66713 TGGATATTAACTTTCACAGTTCTGAGCACTATTAGTATCTATCTGACAAGTATTGGGAAG -0.26320423 0.059044 1
18293 ATTAATTTATAAAAAAGAAATTGGTCTGGCAAGATGGCTTAGCACTGACTGCTCTTCCAA 0.6316403 0.059058 1
16396 GACTAAGTTGCTTTTAAGACCTTTTTCTCTGTAAGCATCGTAAATGCTAATCAACCTGTT -0.17314255 0.059115 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.30111862 0.05917 1
13067 GTATTTAAAACAGGCCACATCCTCATGAAGTGAAGTAGTATTTCAGCTTCAAAATATTCG -0.61055571 0.059188 1
76758 GTCTACAGGCTGGTTCCAGGATAACAAGGGCTATGTTGTCTCAAAAATAAATAAATAAAA -0.18085492 0.059265 1
14060 CAATTTTAGGAAGACTCCACTAAGTTCAGTGTTCTGAGCCTTTACTTTTGCATAAAATTG 0.31698165 0.059328 1
328162 TCCTACTGTCATATGTCATACCCGAGGGCACCCAAAGGATAATAAATATTTTCCCCACTG -0.22972917 0.059338 1
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.66987417 0.059359 1
269994 AGGAGAGGGCTTAAAGTACTGTCCTGTGTTAGGCAGGGCACGAGGGGCAAAGGATGACTC -0.53424586 0.059366 1
232164 TATCCAGTGTTGTGAGGAAGCACAATTGTACCCGAGACTACAGACTTAGCCCCAATTACA -0.20037577 0.059371 1
78405 CCCTGGCTCATCAAAACGGACGAGGAAAGAACGCATGAAAAGGGGATGCATGATGCATGC -0.24295674 0.059379 1
19346 CAGTGCTTACGCTTACGCTTCTTTCCTAGTGTGATAAAGTGCATTGGAAATAAATTATAT -0.32635527 0.059476 1
57815 GAGTTGAAGAGCCAATGTTTTGACTCATTTGAGTATAATAAACATTTCTCTGGGCAGTTC -0.26468041 0.059509 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.23597631 0.059513 1
67235 TGGTGAAAGATTTAGACAGAGTACACACCTTGTCCGACACCAAAGAATCCATCAAAATTC -0.18812435 0.059539 1
223435 TCACTGTGCATCGCCCACTCCCGAAGTAGCATGGAGATGGAGGGCATCTTCAACCACAAA -0.18918532 0.059577 1
692132 CAGCACTGTGAATGAACTTATGCCTATTGAAATGCATTCTTAAAGATGGTGAAGAGTATA -0.23141225 0.059666 1
622554 AAACCAGTAAGAACGAGGCTAGAGAGATGGTAGTTGAGTGCACACTGATAGTGCAGAGGG 0.60566253 0.059694 1
433632 TAAAAAGTCTGATTGCTTGCAATAAACTTGTCTCAACCTTAGGTTTTCGGAGACCCCTTC 0.2106237 0.059698 1
66573 TATTTTTTATACTTTGTAGAACTATTAGGACTATCTCCAAAAACAAAAAAGGAACCTATT -0.33132658 0.059709 1
214763 TATTTTTTAAGAGCACAAAAAGAAAATGAAATTATAATCTGACCCCATAATATGATAAGT 0.74788631 0.059803 1
22042 ATCTCTATATAGAGACAGCAATTGGATTAGCAAAGTTGAGAAACTTTCCTTTGACAATGC -0.22828757 0.059819 1
11883 TGTCTGGAGTTAGGTGATAAACTGATCATTCCGGGTAGAGTTAAAGGACCTGGGGACCCT 0.20876032 0.05989 1
56403 TCTTTGATTTGGATTAGATGTGTGAAGTACTGTCTTTCGCCAAAAACCTCAAATTTCCTG -0.21253515 0.059918 1
67008 GGACGGAATTGTTAAGGGTCTTCAGTATTAACACTAGTAAATGGAATGACATTGGTAAAT -0.18224355 0.05994 1
100042092 CCCAATGACGGTGATGTATAATGCTCAAGTATTCTCCTGCTTTTTTACCACTAACTGGGA 0.32100847 0.05995 1
232539 CTGGCAAAGCAAAGGAAAATGTGATTTGTTGTATCACTTCAGGGTGCGACATTTCTCTGT -0.26995238 0.059968 1
12703 GAGGGTCTCTGGCTTCATTTTTCTGCTGTGCAGAATATCCTATTTTATATTTTTACAGCC 1.06309719 0.05998 1
65107 GTATTGTTATTGCCACTGGCTGAGCCAGAAGTCTGGGTGGTGGAGGCAGAGGATGAACCA 0.25353867 0.059987 1
66616 AATGGAACACAAGAGAACTCCGAAGTGCTTCATTTACCTGGGGCAATGCGATTCAATTCC 0.4064593 0.060017 1
50787 AATTTCCTGGACATGCAGCTTTATGAGTATGCGAAGGATCTCTTCCAGCAACGCTACCAT -0.37241018 0.060065 1
69217 GCTATGGTCAAAGATTGATTTTCCCAACACTGTCCAAAATTGGATGAAAACTTTGAACTA 0.78959864 0.060116 1
67596 CACAGTACCACATAAACTCTACACAGGTAAGGAGACAGCTGTGGGTTCTACAGGACATTA 0.74378026 0.060177 1
67187 AGTTTTCACCTCCAGCAGAGACAACAGGGAGGCTCCCTAGGACCTTTCTCATTATTTATA -0.21167737 0.060177 1
100042894 ACATGGTCGACACTTTCACTTATACATAGACATGATTGAAGTGGCCACAGGAAGTAGAAA -0.23603302 0.060197 1
11744 AGACCTAAAATCAGAACTGTCGGGAAACTTTGAGAAGACTATCCTGGCCCTGATGAAGAC -0.22042166 0.060201 1
78785 TTGAGTTCTTCTTCCCTCATTTAAAAGCTCAATTAAACATGTCACAAGTGGCTAAAAGCA -0.25101181 0.06021 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.52849612 0.060234 1
54396 GTGTCTTAGGTCATAGACATAGATTTTCTCTTTGCTGGTTGTATGTACATACCTATCTAT 2.0895987 0.060256 1
18301 AACATGAAAGAATCCTGAAAGGAAGAGGCCACTGGAGGGAGTCAGGCTTAAGGCTAATGG 0.81293215 0.060259 1
15289 GTTCTTGTTGGTGCACAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGCTTTTTCT -0.19398538 0.06026 1
28036 GTAATGAATGCACAGACTGAAATTAGAAAGAAGCACAGTTGGAACCTCGAGGTCCTTTCT -0.19846991 0.060412 1
19186 AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA 0.65726251 0.060465 1
22194 GGAAACCTGTAGTGAAATACCTTAAGCTGTTAACTGTACATGTGGAATAGAAATTGTTCA -0.1869952 0.060493 1
99890 AACCTTACGCACGCACAACTCTGACTTTCTAATTGTAAACAAAAATTCACTCCTGTTATA -0.2240372 0.060561 1
15042 AAACCTTTAATCCCAGGAGACAAAGACAAACAGATCTCTAAATTCAAGGCCAGCCTAGGA 0.37793291 0.060592 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.97455824 0.060643 1
71059 CACACATAAATATGTAAAGACGAAATCCTGCAAAAAATAAAAAGAACTTGTGGCCTGGGA -0.26691786 0.060702 1
71354 GAAGTGGCAGCCTTCTAAAATCAAGAGATATTGATTGGATAATATCAAACCATGGTCCCT -0.20811644 0.06074 1
70208 CTGTATGAAATGAAACCATCAGAAAGTTAGAAATGAAATAAAGCCGTGCTCAGACGTCTG -0.29333425 0.060745 1
12500 GCAGCTGTATCAGCCTCTTCGAGATCGTGAAGATACCCAGTACAGCCGTCTTGGAGGGAA 1.68902426 0.060756 1
666926 ACACCAAGGGAAAAATGTTCCAGGAAATGTATACAAGAACCACCTGGGAGAAAGGCTCTA 0.92022075 0.060774 1
53420 CTTCCCACACAGCTTGACTCCTATGCTGCTCTTGGGGCCAAATAAAATACTCAATAGCTT -0.22985165 0.060795 1
171247 GATTGTGCCTTTTCCCTAATTTTAAGTCTCTCCTCAAAGGACAACACCTTAATGGTAAAT -0.28625108 0.060856 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.95621486 0.060859 1
21846 GTGAACATGTCGCTGTTTGAGAACTTCACCTATGCGGGCATCGATGCCACAGCTGAGGAG 0.32520741 0.060882 1
384534 ATGGTGAACACTTTCAATTACATTTAGACATGTTTGAGTTGGCTACAGGAAGTAGAAAGA 0.17253779 0.060958 1
16639 CAGAATTGTGTTCTTTCTGATTTCTTAAACTCCCATAAAACTGAATAAAGAGTCCCCCCT 0.6372582 0.060982 1
26401 TAAGACTTCCAGGGCTTAAGGGCTAACTCCTATTAGCACCTTACTATGTAAGCAAATGCT 0.44232373 0.061015 1
70967 CGTCGCACTGTTTACAGCACACCCTGGAATAAATTGGGAGGAAGCCGTGGTGTCTTGCAA 0.28651907 0.061018 1
70785 ACCTCGAGTTGCTGATCTGAAGAAGTGTTTCGAAAACTAAGATAAGGAGTGTGAGGGGTT 0.88979893 0.061024 1
23872 CATGGTGACCTCAGATCAGCAAGTGACATTGATAAAGAGCCGTTATACCATGAGACCACA 0.303098 0.061089 1
230657 GAAGCCATAGTCACATTAATAATAGGTTTAGGGATAGCATTACACAATGAACTTTTCCTC -0.24617179 0.061106 1
107065 GGAATTGGGTTGGTGGGACTATAGTACAGTGTACAGAAAAGTTTTGTTATTAAAATTGTG -0.24497072 0.061113 1
21885 CGGCTTCATATTTACAGTTGGATTGGGCCAAATGTTTGGAATTTGTAGAAATAGAAGTTA -0.33061389 0.061122 1
30939 TCATGGGAATCTGGTAAGGGAGTCCGTTCAAACTCGGGCTGTAAGCAACTTGTCACATGA -0.65263049 0.061144 1
11554 CTCCTTCTTCTGCGAGCTCTGGACTTCGGTAGATGTGCTGTGTGTGACGGCCAGCATTGA -0.24897236 0.061155 1
12616 TTGATGATAGTGATGAAGAGGAGGAAGAAAGTTCCTCTGAGGGTTTAGAGGCTGAAGACT -0.25555645 0.061155 1
13830 AGCAGGGTTTTCTAGAGGTGTATGGAGCACTTCCACCTGGACTCAAGTTGCATTTACATT 0.62869139 0.061167 1
13346 CCCGGGATGGAGAGGTTGTCAGCGAGGCTACACAGCAACAACATGAAGTGCTGTAAGCCA 0.43094207 0.061207 1
101497 GTGTCCACAGATGGCCCTCCTGAGGTCATGGTTATTTTGTTAATTAATTTTATGAAACGC 0.38828304 0.061307 1
68263 GAATGCCCCCACAGAAGGTAACTTATATGTCTAAGAAGTATATTATCTACATTTGCTGTT -0.43967812 0.061363 1
71601 AGCTCCAGTGGCACCCCTCACACCAGCATACAGGCATATAAAAATAAAGATAAACTATTT -0.16223509 0.061382 1
14962 TCTCATTGTTCACAAGAGAAGCCGCTTCATTCAAGTTGGTGTGATTAGCTGGGGAGTAGT 2.16389686 0.06141 1
210853 CTTATGCTGGTTTTAAGTTTCAGGATAGCAATTGTCTTTCAGTCCCTTGTGCTCTCATTT -0.18179148 0.061475 1
243864 GAGGACAGTCAGGATGTTGCTAGCTCTGCTACAGCTTCAGCTGGATCTGCACTCCCTGTT 0.17950437 0.061579 1
230612 CTGGGTCTCCAATTCCAACTCTCTTTCTACTATACTGCCCTGTAATCCTACCTCAAAAAA -0.19821177 0.061656 1
225594 GTTGGCCGGAGTAGGACAACGACAATTATCTATCTTGTTTATGATTGTAAAGAAATGTTA 1.61648643 0.061658 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.24389109 0.06173 1
50909 AACAGAAGATAAGTTAGCTTTCGATCTCAGGTTCGTCAGACTGCCTGTAGCTGACAGTGA 1.36053209 0.061772 1
19014 GTGGCTTTGGGGGGTATACATTTGTTTTCAGAGTCTATACCCTATCGTATAAAAATCAGC -0.3210509 0.061774 1
56275 TATGGGGCTCAAGCATCTATTGGCCTGTCAGGCTCATATGGAGCTCAGTCTGCTGCTGCG -0.24378226 0.061835 1
11737 ACTGTTCTATTTGGTTCTGTAAAATATTAGAGCAACTGGTTTTGCAGAAATGACAGGAGG -0.24994835 0.061861 1
57875 ATGGTGCTGTTGTAGGTGCTGTGGATGCACAGGTGCTAACTGTGGTTCCCAGGCACAGCT 0.23398682 0.061877 1
26465 AAACCTGCACACCACAAACTATAACCGATAGTAAAAGTCAGATATATGGGGGGTATTGAA -0.20411079 0.061878 1
100505163 TTTCAAAGTATGAAGTCAACAGAATACGGTCCTCATTCAGGTTCCTCACAGACCCAGGGA 0.61058963 0.06189 1
382066 AGTACATCATCACAACCACCACCAATGGCAACGGGGGCAGCGAAGTGCACATCACCAAGC 0.23964064 0.061894 1
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.30195663 0.061911 1
50788 CTAAGCAAGTTGCGCAGGCACGCCCCAGTTGCTAGTCTCTTTAGGGGCTCCGTTGACTAA 0.30095167 0.061959 1
20021 TATTGATCAACAGTAGTTGTCTTTTTAAAAGTTTTTATTTTTGGCAATAAAGAGCACAAC -0.17598654 0.061966 1
216454 ACATGGGGGACATGGGACCACAGGAATCTGCTATGCTTAAATGATCATTACCATTGTTGG 0.38421962 0.061969 1
13421 CGCCATTCTCAGATCTCTCCACATGTAAACATGCCCCCAATAAATAAATGTAATAAAATT 0.65894904 0.061997 1
629378 ATTGGGAGGTTAGAGAGAGGAAGGAAGATGGTTTCAATCTCGTGCCTCTCCCCACGGGGG -0.21060245 0.062004 1
20687 GAGAAATGTATGTTTTTTATTATGCTGTATTTTCTTTTTATTTTTTAATTATTGTTTATA -0.20994134 0.062105 1
433771 AGCCCAGAACAATATGTATTTTGAACTCATTTAGATGGATGACTTTTGTATTCTGAGTGG -0.23917828 0.062108 1
259011 TTCCACTGTAAAAGAGAGTGCCATGGCTATGATGTACACAGTGGTGACTCCTATGCTGAA 0.18580615 0.062128 1
12822 GGGATACAATCCTGTATAGTTCCCATTTTTATGTAATCCTCAAGAAATAAAAGGAAGCCA 0.61014274 0.062154 1
13347 AATATCTGACTCAGTGGTGTAAAGCTGTTACCACTGTGAAACTCCGTTCCATTTTCTAAT -0.24171212 0.062167 1
16716 AGAGGCCAGGGCCCTCTAGAAGAAAAAGGTGCTATGTAAATCCAAGGTATTGTGAAACGT -0.28043023 0.062168 1
19331 GAACTGGCTTGCCCTTTGTCACTCTGACTACAAGGGTGGAAGAAATGCCTACTATGAATT 0.9883921 0.062189 1
240261 TCTGCCTTCTCAAAGCAAAGCAGAAGATAGTCCAAAGCAGAGAGAGGAACAGAGGAAGAA -0.23660501 0.062191 1
71393 TCAGAGAACTTCCTGCAAGCTCACGTTTTGGGACATGGAAGAGACTGTTGTTGGGTTTTA -0.32406838 0.062221 1
16913 ACCTCAGTCCTGAAGAGGCCTACGACCTTGGCCGCAGAGCTATTGCTTATGCTACCCACA 1.76181018 0.062251 1
246177 AAGGCCAGGACTTGTCTACCCTTACATGGAACATTGCAAAATAAAGATGTTATATTTGTT 1.65077281 0.062354 1
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.36721538 0.062397 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.2236036 0.062421 1
229302 CCCTGACCACATGTGTTGCTAATTCCTGTCTGGTTCCTCTCTGGCAGAGCTTGGGAGGCA 0.33893204 0.062469 1
15182 TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC -0.35321251 0.062513 1
75338 GCTTCCAGGAAAACTCTAACTCTTCCTTTAGGGGCAGACTTTCATGACCTATGAATCATT 0.22717336 0.062514 1
242819 GGTACACTTTTTCAGATCTGTCCGATAGAAGCACTAGTTTGTGACATATCCCTGCTGCGA -0.24115749 0.062534 1
14186 GAGAGACGAGAAGCCTGTGGGAACGACAGAAGAACATGGCATTTTTATAAATTATTTTTT 0.21494579 0.062581 1
244237 CCAACACTATAGAACTATTCACTTGATAAAACTATTCTCCACCAGTCCAAGTACTGTGAA 0.28333148 0.062592 1
258649 CATCTCCTTCATTCCATGTATAATGCAAACATTCTTGTATCTGGCCTTTGCTTCCATAGA -0.26252384 0.06263 1
73728 TATGCAGCACTGCTTCGAGTCAAGATGAAGGCAGCCAGCGAGGAGCTGGACACCATAGAG -0.40486737 0.062644 1
74558 GGCTCAAGCTCACTCCTGCTATCTCTGTCAGCATATGGAAAATAATGGTTCAAAAAATAG 1.26538838 0.062681 1
67664 CTACAGTATTACCTGCTTGTCTTTGTTATGTTGCATTCAAAAACCGTGTTCATTCTGGCT 0.43807553 0.062716 1
278679 TGTGCTGAGAGGGGAGTCCCCAATATGTTGGATCAATAAAAATCCTCATGCAGTTTGCAG 0.3145908 0.062838 1
78929 GCAGTAGATCTTTGTTTATGGGACCAGACTGAGTACTGAACCTAGTGGCGGTGTGATAAA -0.24002339 0.062856 1
71836 ACCCAAACTGAAGATGACGAACAATCATATCTACAACAACAATGGCTATGGAGTGAGCAT -0.17986493 0.062875 1
70369 TCAGTATTTCTGCTGCTTTTGATGTTGCAAACGAATATCATTATAGCACATTACCTTTTC -0.24070927 0.062881 1
19049 AATGCACTTACTATCTGTCCTTAGGGGGCCACACAGTGGGGGGAGCCTGGTTCTCCTTGT -0.37173446 0.06293 1
15431 AAAGAAAAGAAACTGAACAGGGACCGTCTGCAATATTTCACTGGAAACCCCTTATTTTGA 0.24939722 0.062961 1
68087 GTTACGACTGTGTAGCCAAAAGTGTCTTGGGCTTGAACCTTTCCAGAGCATCTGCCGCAT -0.32993556 0.062974 1
27382 ACATCATAGAGTGTGGATAGCTGTAAATGTGGAAACTTCTCATTCATCACATGGCAACAG 0.29720411 0.063029 1
70047 ACTACTAAGTTACATAAAGAAGACCTAAAGATGAGCCCTGTATGAAACAGGGGAAGTCTT -0.2025455 0.063043 1
17127 TATAAACGCCCTTCTAATAAACTTTTCACCGTAAAGCTCCTGAGACAGGAGCACAGTCTG -0.17412116 0.063123 1
28036 AATGCACAGACTGAAATTAGAAAGAAGCACAGTTGGAACCTCGAGGTCCTTTCTGGGGAT -0.17479571 0.063179 1
117592 TGCAGACTGTGTTGAATTCATCTCAAAATGTTACTTGTCAAAGTTGTCTTTGTATTGTCC -0.24363651 0.063184 1
101739 TCACAGGAGGAACATGCTAAAAGGCCAACATGAGAAAGAAGCTGGAGATCGGAAACGCAA -0.24996146 0.063197 1
239554 CTTTGGATCAAATTTGTGTTTATTTTTCGAATGTGATTATATGCTACTGAAATAAAAAAT -0.25169539 0.063231 1
258027 CCCAAGAGCAGTTATTCTGAGAGTGATGGAAAATTTGTGGCCCTTTTTTATACTATTGTC -0.22447554 0.063234 1
12580 CAGTGTCTGACTTGGAGACTTTGTTTTAAAAATTATTTGTCCTGATGCATCTTTTGCCTA 0.24766899 0.06333 1
13112 AAGGCACCTCCCACGTATGATACTGTGATGGAGATGGAATACCTGGATATGGTGCTTAAT -0.38059485 0.063339 1
67374 CCATGAAGACCTGTCTGTCTGCTGTTTTCTGTGACTTGAACTCTAACAATGTGTCAAAAT 0.33707434 0.063346 1
114228 TTCAATAGGAAGACCCTGAACAATGACATCATGTTGATCAAGCTCTCATCCCCTGTGACC -0.21670575 0.063348 1
23856 GTAAGAAGGCTGGCTAACGTATCTGACTGTGCAAATATGTTTGATAGTTCCTTTTATATT -0.32950528 0.0634 1
73748 CTAAGACCGATGCTAGAAATAAGTTGGATTTCATGAAATAAAAAGCTCTGTCAGCACTGT 0.32755475 0.06341 1
68080 CAAAGTAGAAATTAATGCACAAAGACTTGTGTATAATATAAACCAACCTAGCCACACACG -0.16079053 0.063421 1
12315 TGTGTTCAGTTCAAGCTGTGAAGAAAAATATATATCAATGTTTTCCAATAAAATACAGTG -0.24735207 0.063422 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.96821465 0.063426 1
26448 TATGACCCTGACGAACGAATTGCGGCTCACCAAGCCCTTCAGCACCCCTATTTCCAGGTG -0.17085649 0.063501 1
20462 AACCATTCTTAAGTTATCAGTAAAAAAGTAAAAAGTTAAATAAATGTCTTTCAGGAGTCC -0.25260264 0.063509 1
66618 CTTGGATGCTTGCTAGGTGTTCTTAAAAACTGAAAGTGAATTGCATACATTTCCCCAATA -0.16029709 0.063519 1
227327 GAGGTCCAGGAATAGCCAGAACTTCCCTGACTGGAGGTCATCCGAGAACCTGGATCTCTC 0.18805626 0.063534 1
666676 TCTTTGGGTCACCTGCATTCCATAGCATTGTGCTTGTACTTGTGCTCACACGATTACGTA -0.23077536 0.063549 1
73533 TGTTTCAAAGCCCCAACCAGATCTGTAAACGGGGAACTTTGGTACAAAGCAATATGGTAA -0.25161356 0.063564 1
258917 CTCAGGAACAGGGAGGTGCAATCAGCTTTCCACAGAACCATGCGCTGGTCTTCAGTTTGA -0.18598876 0.063676 1
76469 TATGATGAGAAAGCACAGAGCTTCGAGGAAGTGAAGAAGAAGAAGATGGAGTTCCTGCAT 0.41892647 0.063693 1
19058 GAGGGCATGGTTTATGTTGAATGTTTAAATTTTCTTCTGCATGATACATGTCATGTTGTG -0.34401358 0.063697 1
69893 TCAAGTTTGTTTTCAGAATGTCTTGAAAATAGTATTTGGTGTGATTGAACACCATAGGCC -0.16683042 0.063751 1
329697 GCTTTAAATAGCACATTCTAGGCTTAAAGGACATAGGGAGACCTTGTCTTAAATAAACAA -0.26121506 0.063766 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.20381214 0.063786 1
268319 TGACCTTGTTGTAGGGTTTTGGACAAGCATAGCCCAGGGCCTTGGCCTCATCCCACACAG -0.24222226 0.063798 1
434197 AACTCATAAGTATCTCTGTGATTTAGTAACATTATTGCTCAATAAAGACCTTCCACATGT 0.33692186 0.063824 1
269784 GGCACAGTTTGTCCTGTCTTTTCCTTGTGTTGCCACCACATGACTAATAAATGTCTAACC -0.3552544 0.063898 1
269999 TTGATAGATGGTATGAGTCCATCAGGTGCTGACAAGATCTGATAAACTTCTGAATGTGGT -0.33381952 0.06393 1
21784 TTCAACCCCTCAGACTTTTAGTCCTCGAATTCGGCCTGAGAATTAAAAGAGATGAATGTT 0.73631336 0.063955 1
18627 ACCTTTCACAGTGATCAGGTAGTAGCCATGTTTTAAAGGAAATTCAATGTTACAGACAGC -0.37208372 0.063968 1
108098 GAAAATCACGAAGCTGCTACATGTCTGGAGGATGTTGTTTATCGAGGAGACATGCTTCTG -0.17398474 0.064065 1
77521 AAATGTTTTAGTATAGTGAGAAGCAAAAGAGAAACAACTCCAATTGTCCTTGAGCGACGA -0.29263395 0.064081 1
66147 GGAGTAAGCAGCTTTTTGAAAATGTTAATACATTACTCTGCTAATATGCTGACCTGCACT 0.33694258 0.064088 1
66775 GCATTCACCATCTATCAGTCACTGCCTTATTTTGAGTCATTTGGTACAAACTCCACCGTG 0.6356261 0.064116 1
80837 CAATCATGTTGAGCATATGAAAGCCAATTGAGAAGACCAAGTGAGATTGTTTTGTTTTGT 0.20950204 0.064137 1
432589 TACATACATGGGGCCTAGAAAAATCTAAGTAAGAAAATAAGTCTGTTGTTTGTGTACAGA -0.52067442 0.064146 1
73415 TATGGTGAAGAAATGAGGTTCTGTGATGCGACCAGCAAGAACATACATCCCAAATCCTAA -0.17391953 0.06415 1
245638 TGTGTTACCATACCACATACTATTTTCAGTGAAGCTAAGCACTTCTCAAATTGTGTCTTT -0.21367268 0.064158 1
234839 GCCTGGCTCTCCCTTCCCACAAGTACTGTAGGGTTTTCTAAGTAAAACATTTTTATTTAT 0.34133313 0.064165 1
18861 CTGTCAATGAAGCTGTACTGATAGAAAATCTGGAAATATTCAGAAAGAATGGCTTTGACT -0.21771159 0.064227 1
100042480 CGAAGGATTATTGCACAGTTCTCAAAAGACTACGAACCCACTGACAACCCCAGTACCTAA -0.30810376 0.064258 1
319455 TCTTGAAATAATCTCTGTGGTATCCTGGTAGCACCAATACCAGGCACTCTCCCGAAGAAT -0.35061675 0.064324 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.18556996 0.064417 1
100042568 ACAATCCTTCTGGGACAAAGCAGAGTGGGAGACTGACATCCACAACAGTCATTAAAGAAC 0.2641449 0.064426 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.97824646 0.064438 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.62956126 0.06446 1
13796 AATGACTAGGGGAACAATCAAGAGCCCACAAGGGCAGGGCATTGCTTGCTGCTGGCCAAG -0.27070083 0.064465 1
225471 TAAGCAAAGCCTGAAACTTTTATGAGGTGAAACATAATTGTAATCATTGCAGAAGGCATG 0.23119167 0.064478 1
14283 CTAGAGCTGGCCTATCATAATTTGCACAAAATTAGAGGAAAATATGTTCCCTCTGCCAGA 0.30489617 0.064493 1
66682 TATGTGCCTAAAATAAATGTAGAGTGGTTATTCGCCCTTTAGACATCGGCTACTCAAAGT -0.18668435 0.064509 1
56468 GTGTCTGAGAACGTCATCCAAACCTACTTTCAAAGCATAATGTGCAATTAAGTTGTTATG -0.25611004 0.06454 1
18226 TGTCTATTTTATTTCTCTGCACTCTATTGTAGCCTTTGTGGTCCCTGATCAAAATGTTTG -0.19475635 0.064543 1
75345 TGAGCCAGGTGCTGTGTTACACTTTCATGGATTGTTGCAATACACTCACTCTTGCTTGAT 0.81122408 0.064569 1
100046290 AAGACAATACTGATACCCTGTTTGTTTAGCCTGCCTTTAAGAGAACAATGTTGGGCCGCC 0.23270574 0.064572 1
226823 AGGATGAAAATGAGCATAAAGTGGAGTTCCGAAAGAAAGGGTTTGAAGCAGGAGGATTTC -0.20449305 0.064587 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 1.0632609 0.064605 1
18037 GGTCATGCACGAAGAAGGAGAAGAAATAAATCAACATACTTTCCGATGCTTAGCGCTTAT 0.62333536 0.064643 1
70357 TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA -0.27164923 0.064646 1
20975 GAATTTTAAATGGTTGTTCAATCTGTGTGTGTGTGCCATTTGCTTGTTCGTTTTGTGTTT 0.31744311 0.064665 1
214111 AAAGCAAGAAGGCTAGTCCTTTGAATAGTTTATCAGTGGGTCTTAAGAGAGTTTACAAAG 0.23251345 0.064693 1
15978 CTTCCCTATACAGCTGAAAACTGTGACTACACCCGAATGACAAATAACTCGCTCATTTAT 1.36532003 0.064726 1
16186 CATCAATCCTTTGATGGAACCTCAAAGTCCTATAGTCCTAAGTGACGCTAACCTCCCCTA 1.4422192 0.064732 1
246179 CTGTTCTTCTATTCCAATATTACTTCAAGTTTCCAAAATGGAAGGTTAACATGAACCTGG -0.23734694 0.064763 1
17954 CAGGCAAAATCATATTTATTATTGATAACAGCTAGTGCAAGGCTTCTGATTGTATGTGAC -0.31012981 0.064779 1
209200 GCTGTGGCACCATTGTGATTAATTATGAAATAAAAGATGGCATCCAAACAGTAAGTGTGC 0.4955195 0.064781 1
22293 AAAGGAAATTTGTCCATGTGCCTTCAGATGTAAAAGATAAAGCTATGGGTTTCCACTCTC -0.18561036 0.064869 1
14998 GGAAGTGAGCCCGAAGCTTGAAGGTCAAATCCCAGTGTCCAGAGGTTTGCCTGTGGCAGA 1.02715079 0.064871 1
57444 CCGCAATGTGTAAAACCAAGAACACTCCCCCATTACAGCAACTCTCTTGCTTTGAGGCAA 1.09658684 0.064949 1
434341 TAAACTCACAACACTCCATATCAAATGATCAATAAACGCAGATGTAACTGGTGTCTGATG 1.76559122 0.065173 1
93670 TCCTTTTACCTCTGCATGTGTCATGGCATATGTTACACAAAATAAAAAGACAGTTTGGAA 0.37926776 0.065184 1
14103 GCAATGATGTCTGTGTGTTTGTATGTATGAGAGCAAACAGATTCTAAGGAGTCATATAAA 0.83961447 0.065186 1
74934 CCAGGAAGCCAGAGTTGAGAAGCATTTACAACCAGTTCTTCAAACAGCCTAAAGAAAAAA -0.2867062 0.065218 1
12583 CTATGCTCAGTTCTACTGCAAAGGGTGTGTCCTAAGGAAGCAAACAATACCCTGAGCTAT -0.17690779 0.065223 1
93878 GTACTAAGCATAGTTCATGTTTTTTCCTCCACCTATGAATGATTTTGGTGATTAGTACTC -0.35097382 0.065285 1
241656 ATTGGCAGAAGCTGCACCACAAATAAAGTAAGTGTTTGCCTTTTTCCCACCGTGCTGTTG -0.28962054 0.065311 1
207686 CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT -0.31462659 0.065312 1
13406 GCAGTGTAAATTCTATCCCTGAGTCCTTTCTATGTGTTGCACATAGAAAAAATTCTGCAC -0.22507658 0.065345 1
17868 CTAAGGATAATGTTAATACTGGGAGCATAAAGTGTGTGGGCTTCAGAAGTGGTGACTGGG 0.22163629 0.065358 1
17311 TCTTCAGTCACAACCTGCAGCCTGTCGTTAATTATGGTCTCTGCAAGTAGATTTCAGCCT -0.31818757 0.06538 1
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA 0.20851867 0.065384 1
75901 CAAACGCTGCAATGCAATACAGATCACTTTGAAGTGGGGAAAAATGCAAAGTTGTGTTTC -0.1891293 0.065489 1
77106 GAGCCCGTATGCAGTCATGAGGAGAAGTTACCCATTTTTAATAAAAAGAATTATGTACTT 0.38513177 0.065524 1
641221 TTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAAACA 2.14684112 0.06553 1
56176 CTGTGTATAAACATCCTAAAACCAGTCATTTACAGTTGTGGGCTGAATAATTTTGAGCAT 0.29375207 0.065555 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.21757225 0.065632 1
240328 GTTTTACAAAACTTGAACTAGACCTCGCCAAAGCAATCACAAATATGAAAAAGAATTACT 1.55991752 0.065672 1
223473 TGTTGGCCTGCTATTCAATACCACCTTTTAAAGGATTGCACATGTTCGTTCTGTGTCAGC -0.2289004 0.065711 1
71797 TGGTCACACTCATTCCGACTGGGTAGGGTACAGGTTGCTTTAGGTGACCATAACCTTGTC 0.21407817 0.065728 1
15434 TAGTTGATGTTAAAGGATTGAGATCACAAATGGTCCTTCATGGGTAGAGTCAGGCAGCCC -0.18675398 0.065742 1
81703 CTATGGTCTGTTATGGACATCCACCCACCAGTTAAGGCCATTGTAATTCCTAAGTACTGT -0.32464519 0.065745 1
16391 GTCATGGACCCTAAACCTTTAGAAATGTGAGCTCCAAATTAAATTTTGCCTTTTCTAAGT 0.94880157 0.065746 1
632737 AAACATCTCCTTCCACACAAAGTCAGGATGTTGTGGAAGGAGAACAGACAGTTGCTAGAG 0.26894388 0.065748 1
434156 CTACATAGTACGTACATATATCAGCATCTGAGGTTTGATATGTTCAGTTATCATGGAAGT -0.22621674 0.065753 1
216011 CCTATGCTGTATAATGAGAGCCTATCTCAGTGCAACAAAAGCAGACAAAGTAAAAGAAGA -0.37480988 0.065841 1
71753 AGCCTCTTGGGGGAACTGCACAGAGAAAGAAGGTGCCTCTATCAAGGCTCTATCAGAGCC -0.67562257 0.065859 1
66385 CACTGCTTTTACATAAGAACATAAATGCAAAGGTCTGAAATCAAAGATCAGCAAATCAAA -0.22112473 0.065859 1
16061 TCGGGTAAACCCACCAATGTCAGCGTGTCTGTGATCATGTCAGAGGGAGATGGCATCTGC 3.15193362 0.065865 1
14042 TGTGACAAAATTGCCTCCAATCAAAGTGACCCAGAAGAAACAGTATAAGGAGACAATGAT -0.24977312 0.06589 1
64450 CTTCCCTACCAGTGAAATTGCTAGCATTGAACTGTATTATGTGTTTTTTGTTGATTCAGT -0.29805961 0.065949 1
276742 GGGAGATTTACTGTAAATTACACACTTGTTTTGATGTATCTTTCTGTAGTTCTTCTATTT 0.24684088 0.065958 1
207565 TGCGAGCATTCCTCAGCTGTGGTGGTAGAGGTCTGTCTGGAGGCTGAACACACTTCATGT -0.34800493 0.066018 1
56335 AGCTATTAAATACCACAACAGCCAAGGAACAGTCCATTGTTGAAAAGTTTCGCTCTCGAG -0.20243065 0.066094 1
98741 ACTGCCAGCACAAACTACAAAGTGTATTGTTTAAGGGGGGAAAAAATCTAAATTTTGTTC -0.27029784 0.066117 1
75766 TGATATTGATGGAGTCTTACCTCTCTGAAACCTTAAGCCCAAATAAATCCTTCCTTCTAT 0.31313147 0.066194 1
56045 TGAACTGAAGGCCGAAGATTTCATAGTTGATGTTATCAATGTGGATTATGGGATGGAAGA 0.98973635 0.066259 1
112419 CCTTGCAAATATGTCACCCAACTTCCTTATTGTCTTCTACATAAAAAGTCTAATGCTTGA 0.20921221 0.06627 1
57443 CCGCCACACTATTTCTTCACATACCGAATCAGGATTGAAATGTCAAGGGATGCTCTTCCT -0.1745342 0.066297 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.51772085 0.066308 1
449000 CCCGGATAATGCAGTGAATGTGATAAAGGCTTTGTTATTGTAGTCTGAAAAGGAATTTTA 0.29689127 0.066311 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 1.09593622 0.066363 1
16443 GTTGGGCTCTTCCCATCCAATTATGTAAAGCTGACCACAGACATGGACCCCAGCCAGCAA 0.27362544 0.066364 1
14841 TAGACTTTCAGAGCCTCTTTAAGTACACTTTTAGGCCTCTGGTACTAATCTCTGCCACTA 0.42372305 0.066368 1
74486 AAGACACACTGATGGGCGGAGGTGCAGTGCTTCCCGTAATAGGCCTGGTTTTGTAGGAAT -0.27941645 0.066389 1
16539 GGGGGAATCCCAAAGTGCTTTAGAGACTGTCTTTTTAACATTTCTTGTAGATATATGTAT -0.34908619 0.066392 1
240327 CCATGTCATGTTCATGCCTGATATCACACATGGATATGCACACACAAAAAAGAAATTTTT 2.16502794 0.066399 1
11490 GAAGGACATGGACACTGTCTATCTCTGCTCTGTTGTAATAAATGTGAGATCTTGGAATGT 0.20657425 0.066404 1
12491 AAGAATGAAAAATGAACAATTCACATGTGAGCCACTGCTTATATATTAAGTCTCTCCCTC 0.65162294 0.066457 1
100465 ACAGGGGAGGGGGGAGGAGGGAAATCTATTTTTGTGAAAAGAAAGATTTTGCTATTTTTT 0.29803634 0.066595 1
192156 TTTCTGAAGGGCTAGCTGACCCACTCGATGGACCTTCCAGCACTCCAGACAGCTGCTCAT -0.30322482 0.06666 1
218629 CTTGAAAATCCAAAGATGTCCCTTGAAAATGACAAGATTCTACAGATCATTACAGAATTG -0.17555172 0.06675 1
12408 GATAAAAAAGTTGAACCATGGTGAACCCAACTCTCACCTCCCACCCCCTTGTATCCAGAC 0.33367837 0.066757 1
73420 TCCCCATTCATGTACAGAGCCCTCCCTCTGAGGTGTATATTTAATTAAAGAGTAAGTTCT -0.24431638 0.066795 1
380780 GACCCCCCTGCATGGCAGGACCCCTGTGCTTCAGTTCTAATAAATCTGAATTTGGCTGTG -0.19811094 0.066798 1
15976 GTCCTTAGAGACTTACTTCCAAAGACAAACTACTGTGTATCTCTTTATTTTGATGATGAC 0.7107871 0.066872 1
14265 AGCAAATGAAAAAGAGCCTTGCTGTTGGTGGTTAGCTAAAGTGAGGATGATAAAGGGTGA -0.26152125 0.066875 1
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.17150514 0.066918 1
21355 TCAGGATAAAGATTGGGACCGTTTTGGACTTTGTGTGTTTTTGTGGCCTTGATGGGTGAG 1.18935765 0.06695 1
19335 CTTTGCACCACTGTATTTTCTACCTAACTTAAAAAGGTCTAAAATCAGCCACAGGTAATA -0.19649153 0.067012 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.20712402 0.067034 1
68401 CTGGTGGGGAGGGGGAGCTGCTCAGGAAGACCCCAATAAAGCCCTTGGAACTTGTGAATT 0.20333109 0.067037 1
66864 TCGTTTTGGTCGTCTTGACCATTACAGTGCTGGGGCTTTTCAAACTCTGCTTCCACAAAA 0.21645063 0.067085 1
231014 AGGAGGCAAAGCTTATGAGTAAGGTTTTCACCATGTGTTTTTCCTGGTGTTTCAGTGCTT -0.25409578 0.067101 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.48884034 0.067112 1
98238 AACCTAGAAACTTGACTTCATGGAAGCAGGTTTAGAGTTGATTCTGGACCTGTAACAGAA -0.23219667 0.067123 1
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.21742379 0.067124 1
140499 AAGCAAAAACCAAAATGTGATCTGGAGGAGACTGGTGGTTCTCAACTCCCTCTTGAGGTT 0.32708475 0.06716 1
19294 GGGCATCTGGGTTGGGAATTTTATTTTGTAAGCATTTCCTACATAATATGAGTTTCTACT 0.51886632 0.067171 1
73668 GTTCTGTGATAAAGCTTAACTCGTTTCTACAGAGGATATTTTTGTTAAAGTCTGGGTGAT -0.19552835 0.067194 1
24136 CTGTATTTTCGACTGAAAATTCCACTTTCTTCATCTTGTTTTTTAGCTAACCTCAAGAGG -0.18714161 0.06723 1
211712 AGGAACCAATTCAATGACCGTAAGCAGTATGGCTCCAATGAAGGCCATTTCAACAATGGC -0.21062314 0.067264 1
238266 AACAGAAATGAATCAGATGCTGAGTGCTAAGGAAGGGTGTAACCAATCCGCAATCCTCTG -0.37777971 0.067312 1
233221 GATTAAGGATGATTTTCATGTATTTGATCTTGGATTTTATCTGGCATCAGTTGTCCTGAC 0.39526416 0.067316 1
50933 AATTTTTAATATTTTCATTAACTTGACTAATTAAACTTTATGTGAATAAACTTTGACTCT -0.27777962 0.067319 1
18505 AAATATTAGTCTCGATCCTTTGATACCGTGGTATTAAATATGACATTGTCAGCCTGTAGC -0.25718681 0.067327 1
269717 GACACTGTAAATAACTCCTTTCCTGGGTGTGTGGTTTTTTGTTTGTTTGTTTGTTGATTT -0.31534748 0.067343 1
22658 AGATTGTCAGTCTTTCCATTGAGTTCTACGAAGGCGTCAGGGACCGAGAGGAGAAGAAGA 0.31198875 0.067439 1
69572 CTGAGCTGGATGTTGGTTAGGGCTGTCTATAAAGCCAATAAAGCTATGTATGGCCTGGAT -0.20022489 0.067457 1
12010 TTGAACCTGCTTAATTACAAATCCAGTTTCTAATATGCTATACAATTTATGCACGCAGAA 1.33753007 0.067491 1
14390 AAGGGAGGAGAATTTTTGCATACATTTTTACTCTTTAAATAAAGACACTTATACTATCAT 0.27903508 0.067505 1
67392 TCCTTTAGAACAACCAGAGAGAATCCGTCAACGGACACACTTTGTTATTAGCAACTACCG -0.44429413 0.067539 1
14230 CTCAAAGGCTAAACTGATCCAGTCCTTTCTCCTTTTGGTCAATAAAAGGCTAAACTGAAG 0.32622309 0.06754 1
70316 TGTAAATGGCTACTTTAAATCCCAGGGTAGCTGAAGAATTGGCGCAAAAATGCATGTGGA -0.17572731 0.067543 1
235584 TTTGTGACCCTACATACATATATATATATAGACACACACACACATACACATATATATCCC -0.31470183 0.067548 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.35501077 0.067572 1
13605 CTCGAGGTAAATTTGTACTCATTGAAGTTTAACACTGCTGTATTTTGTGATCTCCCTAAT 0.18339123 0.067576 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.21257698 0.067617 1
70750 AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC -0.17231434 0.067629 1
233271 GTCACATGATGGTCAAGTATTGAAAACTAAAAAGTGCTGAAAGTGGCCTATTTTTCTTCA -0.20748452 0.067651 1
28081 AATTGGAACAGTAAGGCAAACAGGGCTATGAGAAGAGAAGCTGTCAAGCACACATGGACA -0.19580378 0.067667 1
68634 CTGTACTTGGCTTGCCTTGATGAAGGTAAAATAAAGAAATCGAACACTGAACCACGACAA -0.16457252 0.067676 1
17919 CTAAAGATAGCTATAATCTAGACCATGTTCAAATACAAGATTTTCTTTCCCCCATAGCTG -0.20579875 0.067697 1
114871 ACATTATACATCAACGGGTCCCTGTGGATCCAAAATGTCACACAGGAGGACACAGGATAT -0.23993095 0.067718 1
16351 TGTGACAGAGAAGGCACAAAAGCACAAGGAACATTTGAAAATGTAGGTTCTGACCATTTG -0.19355756 0.067719 1
17450 AACGAAAAGCTAAAAACGTGTTTCAACCAGATCCAGAATATCTACATGGCTCAGTATGAG 0.30099287 0.06777 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.64397239 0.067774 1
229504 TAGCCACGTTACATAGCACTGACTAACAGTGTTTACTTAATTTAGGTTCCACTTAGTTTA -0.18697027 0.0678 1
328424 ACCCCTCAGCAGATGATCCTTCTGTATAGACACATATTATCATAAAACCAGGTTTCCCTC -0.26073114 0.067823 1
56724 GACAAGTTGCATATTTTACTTAAATTTGCTGTTGACACTAAAGTCCAACATGTGACTGAG -0.42139294 0.067834 1
74132 GTGTTGCTGGAGCTTCATAGTCAAACGCTTTTCTTGAGTTACTTGTGATCAGGTAACCAA -0.19756306 0.067849 1
269346 GTGTAGGAGTGGATGTGAGGGGAGATATTTTTTAAGTTATATTGGAAACATGTGTGAATT 0.7020421 0.06787 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.32826469 0.067883 1
100040475 AGAGCTGGGTACTAAGTCTTTCAGGTTTCTGTTTTAATAGCAATTTCATAGCGGCAATGA -0.27990567 0.067901 1
67509 GTTTCATTGGAATTGGGCCACACATACTTTTTCTGTGAGTCATTCTGATGAATAAAAAGA -0.2872596 0.067919 1
74159 AAGAGGTTGGTATGATAAAGTGATGGCTTTTTTCTTATATAAATAGAATGCAAATCAAAG -0.17047255 0.067944 1
74571 AAGGATGGAGCAGCCCCTGACTCTGAGCCTAGATCACAGAAAATCCCCATCTCTGCATGA -0.19276069 0.067948 1
14667 GCATTAATGACAGGTGATGTGACATTTGAGCTATTTCTGTCTTGCTTTAGAAGTTTTTCA -0.29700226 0.067964 1
71702 CTACGAACCATCTGGAAATAAAAAAGGAAAAAATGTTGGGTTTGCTACCAACAATTCAGA -0.25150623 0.067971 1
80515 AACACTAGTGACGCATTAAAGTGCCAAAGTGACATTCTTTTGAGAAAAATTTTTCTGAGC -0.22747089 0.068008 1
100046119 TTTTTCTCAGTGATGGGGAATGGAGCACCATATTTGGATGCTGTGTTTAAGGGTGTGGCT -0.19735219 0.068033 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.22282431 0.068081 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.38430066 0.068182 1
24086 TATAATTAAACTTATCCATACTGTTTTGGCCTTTTCCAACATTGGATATAGGGCACAAGG -0.21626486 0.068191 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.23779564 0.068206 1
20682 ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC 0.3180562 0.068208 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.23651845 0.068215 1
12550 ACATTCTAACGGGAAAAAGGAGACAAGACCTTTGAGAGTTTTCATTCAAAATGCAAATCT 0.43566308 0.06828 1
108841 CCAATTCCTGTGTAATTTTAACTGTAGACTCTTAAGCTTGTTGTTTGATTACAGTAACAT -0.2839975 0.068327 1
58909 GTGGGTGGAGGATTCCTTCAGTTTTGCTTTTACAAACAATCCCCTAGAAGCATGAGCTAT -0.19304451 0.068365 1
236576 CTAATTCTACTGCTTTCCACATATTAGTGCCTTGATATGTGTTCTATGTCATTAGCTGAA -0.29651624 0.068386 1
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.6703787 0.06841 1
243653 TAAAGTGAAATGTCTGAGGCGAAATCATGACGTTGAGGTTGGTATGTTGACTAACTGGGG 0.25348984 0.068424 1
14105 GAAAGTGTTTACCGGATACGACTTTTTAGTGATCTACTTGTACATTTTATAGGGGACATA -0.31945813 0.068461 1
50908 AAAGAGTCTGCATGGAGGCAGGGTTGATCACTGAGCCGTGTTGGTTATTCAGTTACTATT 1.34973024 0.068541 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.32407609 0.068595 1
56428 ACACTTAATGAAGGCAAAATCACTTTAGAAGGAAAATTTTCAACTCAAGCATTGAGCTCC -0.19910553 0.068648 1
229644 CAGGTCAGACTTTGGCTCACAGTAGAGACAAATAGTATGTTGAATGAATAAAAATTCAAG -0.32434012 0.068658 1
208263 CCATTAAGAAGCCCAAGACTTGACTCAACATACCAAACAAATGGAAATACTAAAACGAAT 0.52666784 0.068691 1
214230 AGCAGCCAGGGGGGAATCTTCTGAGAGAGAGTGGGGTTGGCAGTAAACGTGGTTCCATTG -0.23937435 0.068699 1
106628 GATCTTTCTTCCCGCCGCTTGGCTTGAGCCAAGTTTTGTTTTATATTAAAAAAGTATATA 0.2870543 0.068719 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.1562779 0.068783 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.26069134 0.068848 1
171256 AACATTCATTGGCCACTGCTATATGCTACCATCCAGACATATCATCAAATGGCTTTTCCT -0.1905418 0.06888 1
20732 GGAGAAGGCCCAAGAGTCTGGAAGGAGCAGAGCAGCCTTGAGCCAGGAGTACTGTATATA 0.42634875 0.068881 1
105372 TCCAACTAACTGTAGGTTTTCTGAAAGCACAAGGGGGTACAGTAAGACTGTTCTGATGTG -0.22191484 0.068908 1
22668 CTCCTGTTTAGGGTACTAGGAAAATCACCCCTTGTGTCTTTGTGAGAGCCACGTCTTTGG 0.2829279 0.068928 1
24012 CTCATACCCCCGCTTTATAAGATCTAGTGCCTACCAGGAACTTCTACAGGCAAAGAGAAA -0.40293823 0.068979 1
56032 GATGAAGAACCTTATCCGGAGACTACAGAAATATCCAGTCCGAGTGTCTCGGGAGGAGCG -0.23536837 0.069044 1
18552 ACCACTCTTCAGAGGGTGGCTACAAATCCTGCAAGAGATGTGATAACAGCTGTTTGACAT -0.19941433 0.069081 1
55932 CACATTGGCATATGTATCCCAGTTGTACACTACAGATAAATTGTTAAAAAGAGCTCTTGT 1.75859489 0.06916 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.30215828 0.069172 1
246728 CTGGGGACTCTGCAGTTGGCTGTTCATTTATATGCTTCATAATAAATGGTTTCTTTGTGT 1.35794229 0.069181 1
14860 GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA -0.27540706 0.06926 1
54562 CAAACAAACCCCAGAAAAAAGCAGATAGAAAGATTGGAAGTTGACCCCAGCAAGCATTCC -0.23089114 0.069293 1
258946 AATCGGGATATGAAAGGAGCTTTGAGAAATATGCTTGCAAGAGCAACTTCTTCCATGTAA 0.17931317 0.069331 1
15051 GTTTTCATTTTGCTCATCATTTGTCTCTGTGTGGTTTGCATATGCATGAAGAAGAATGCA 1.30437547 0.06936 1
630322 ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT 0.34730812 0.069368 1
18769 ATGGAAGTCGAGTCCTCTTACTCGGACTTCATCTCCTGCGACCGGACAGGCCATCGGAAT -0.16385701 0.069384 1
75943 GAATTGAACCTAGGACTTTATGCATTTGAGGCAAACACTTTAATATTGAACTGTATCCCC 0.3966827 0.0694 1
16443 TGGAAGACTTATTCCAGAGAAACAGATACTCAGTGACCAGTTAAAACAAGTCCAGCAGAA 0.31233268 0.069516 1
338349 TATTCATCGGGGAGTGGGATAAGTTGGAGTATGAATCTATTCATTGCACATATTTTATAC -0.23887975 0.069518 1
17125 CTCTCTTCAGCCCAAAGCTGCAGATTCAAAATTTATTGACTTTTTTCTTTCTGCAAATAC 0.21409596 0.069525 1
20744 GGTAGCTGAGTGATATGTGCTTACTCCAGGGCACTTGAATTTGGGCTGTAGTTATTTTTT -0.26121243 0.069544 1
12502 ACCCTACAGGTAGACTGCAAGCAGAGAGGAAGAACTGTCAAAGAAATTTTGGTCTTTTTT 1.55205466 0.069559 1
98828 TCGATTTCCTTAAGCTGAAAAGAAATGAGCAAGAGGACGACTGAGTGCTGCTTGGAGAAC -0.16722805 0.06956 1
140742 GACCCTGACTTTGAAGGTTATACAGCTCCTTAAAGAATAAAGCTGGAAAATATTTTAGTG -0.20200101 0.06958 1
69577 TTAGATGCCTTCACCGCATCGAGCAGGATTATTCAAATGCAATAAAGCAATGTAACAAGT -0.41514367 0.069661 1
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.27242667 0.069682 1
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.70109705 0.069689 1
14457 GTCAGAGAGCACAAAACAGGCAACATCCGCCCAGTGGACATGGAGATCTAGAAGTGACTG -0.17667684 0.069694 1
54381 TCTTTACAACATCCATCGTCACAAAAGAGTGTTATACATTTAATCCACAGGGCATAGTTT 0.51703616 0.069707 1
230577 GGGTCACTTCAGCACTGAGATCATGTTCTGTTGATTGAATAAAGTCAAGCCTTTGGGGTG -0.2058381 0.069719 1
76829 GATTACATATGAGTACATCTGTCTTTGGGACGTCCAGAATCCCAGAGTTAAACTCATCTC -0.20094038 0.069796 1
21817 CTGGGAAGAATCAAACTGATGCATTTAACGTGTTCTGCTTTACACAGAGGATCGCACCGT 0.77882457 0.069833 1
12825 ATAAGCCAAACTCTCTGAAACCCCAGCAAAACAAAAACCACATCCATGTGTTCATCTTGT 0.42628701 0.06984 1
26557 TGTGTCCAGCCAGTCACTGATTCTTTTTATCCTAATCCTTTTGGTCTGAATTTCATTTGC -0.45938208 0.069874 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 1.09094854 0.069944 1
28042 TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA -0.24207397 0.069951 1
12013 TCCTAGATGGTGATTCTAGACTGACGGTTAAATAAAGTTCCTAACATGGCTTTCAGTCGA 0.46912793 0.070051 1
26885 TGTGCTTGGCGTATTCAGATCAACAGTCTGATTCACTTACCTGTTATTGGTCAGAATGTT -0.19087183 0.070088 1
74455 TAGCTTCTTCAGTAAGTTTTCAGGACATGGACAGTAACACTAACCTCATCATAACTGAGG -0.1971777 0.07009 1
76366 AACAGCAAAGAGTCGGATGTTGTGTGTCAGTGACTTTAATAGGAAAAGTGCAGGCCAGGA -0.2181534 0.07009 1
319229 CCTGGAGCAGGAAACAGGCCTGGGATTTGGTCTTTCTAGTTCTTCTAAGAAGAGCACTTC 0.67337489 0.070135 1
14611 AAACCACCCAGTCAAACACTGCAATGGCCACCACCTGACGACAGAGCAGAACTGGACCAG -0.3166847 0.070156 1
18991 GGAGCTTCCCCCTTCACCATTTCTTCATCTGTTTGTTAAGGTTTCAGCTTAAATTTTGTT -0.47602532 0.070176 1
67391 CCAGTGGATGTGTAAAACTAATTAGGATTCACCTATTTGCATTTCCTCACTACGTTTTGA -0.24081458 0.070192 1
432868 TAATGCTTTCTCTGTGCCAGACATAATGCCAAGGGCTTGGCATGCTAGTCCTTAAGCAAA -0.20491468 0.070202 1
12671 GGATTTGACTCTTGGTTCTTGCAAAGTACTGTTTTGTGCAGTTCAAGTTTCATACAAATA -0.64595548 0.070203 1
14339 AAAGTGGTCGACAGTGTTAAAGTGTGTACTGCCCGTCTTTTTGACCAGCCCAAGATAGAA -0.17534127 0.070206 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.16383699 0.070264 1
330173 GATTATAACTCAAGCACTTCCCTGAAGTTTGGTTATCTATGCTCAAGAATTAGTCGGCAT -0.35505115 0.070339 1
94044 GAAGCAACATCATGGGGGGAAGCACCCTGGAGGTGACAATAAAACGAGATTTTATGATAA -0.22346385 0.070343 1
637873 GATTCAACTTATTATCTGTGGAATCTGGATTCTAACATCTCCACCCTTCATTGATCAAGA -0.18460534 0.07038 1
381813 AGGAAATCTACGGGACCATATCCATGAAGCCAAATGCCAAAAATGTGCGAGACCTCGATT -0.3144802 0.070414 1
16155 GTAATTTGAGCCCTTTGTGCTCACTAAAACAAGGATCACATTTAACTTGTGACAAACAAA 0.74120336 0.070434 1
207686 CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT -0.29466629 0.070526 1
239250 GCGTTTCTACAGGTAAGTGTTCTGAGCTTCCTCAGGAGAGGGACAGTGTAGCTTTATTTT -0.30383407 0.070539 1
269994 ACCCAGCTGGAAAGCCAGGAAGAACATGGGCATTGACCACTGGATGCTAGACACCCCACA -0.34071516 0.070547 1
12516 GGAGGTACCTGCCTTGGAGCCGCCTGGCCAGGAAAAATTAAATAAACACACAAATACATT 0.94864053 0.070548 1
69577 TACAAAGGAAGCTGTTTTCTCAAAGCTCCGCTGTCCACTGGTAATAGAGGAAACTGGCTT -0.31409542 0.07057 1
75677 TTTACTGTGCATAAACTAGGCTGCGACTGTGCACACACAGGGCACCTGTAAATAAAACGT -0.78138281 0.070652 1
56692 TGTCTCTCCGCTTTGCTGTAACCGTGCTTCCACCATTGTGTTCTTTGTACAATTGAAATG -0.17325119 0.070668 1
71331 GAGCAGAAATTTCACCAAATTTGTTCCTGTGGTACTAAGTCTCATAGGGCGTGTGAGGAA -0.20661811 0.070726 1
12097 CAGTGTGAGCTTAACCCTGCTTGTGACGAGCTATCAGACCAGTATGGCTTGAAGACCGCC 0.8575279 0.070754 1
100048658 GTGTTGAAACATACGTCACTATGGAGAGACTTGGCTGATTCTTAAAATAATAGTGTGTTA 0.3571059 0.070775 1
83703 CTGAGTGATGAACACGAACCTGAACAAAGGAAGAAAATAAAGAGGAGGAACCAAGCCATC -0.2083376 0.070777 1
21924 TGCAGGAGATGATCGACGAAGTAGACGAGGATGGCAGTGGCACAGTGGACTTCGATGAGT -0.41472149 0.070795 1
14412 GGTCCACACATTGTGACGTGCCCGAATCAATAACATCCCATTGAGGCAGCTTGGGAAGCC 0.49398805 0.070799 1
257635 TTCCTTCCAGGTAGCCCTCCTGGGTTGCTCTCAGTGGCTCCCTGCTGTCCAGTGAATAAA 0.2449182 0.070805 1
620592 TTCTTATACTCCTCCATACCGTAGTGTCCTTCTCCAGCAGCCAGAGTGGTGGGGGACTGG -0.21110542 0.070829 1
67921 GAAGCTTCCCAGAATGCATAGTCATTCACTGTAGATCTTACTGAAATGCGTATTTTATTT -0.1578454 0.070863 1
11576 GTGAGCCTTTTGGCTTAACTGTAACTGCTAGTACTTTAACCACATGGTGAAGATGTCCAT 0.84043268 0.070879 1
50794 TTTTAGCTTTGAAAGATACAGCTTCCAGAACGGACAGATGGAAACTTTGGACAGAAAAAA -0.23931076 0.070883 1
67568 GTTTGCTTGAAAAGATCAGCCCGGAGAGTTACTAAGAAATATTAAGTGAAGTCTTCCTTC -0.210904 0.071014 1
238384 CAGCCGTTATTTGAGCAGCTCCACAGACTCTTGGCTACCAGCTGCAGGGATGCATCATAT -0.26689541 0.071056 1
100040462 AGCATCAACTGTCCTGTCAAGCACAAAAAATGAAGAAGAAAATAATTACCCAAAAGATGG 0.55480552 0.071073 1
18720 TATGAAATATGACCTGAAGGGTTCAACTTACAAGCGGCGGGCTTCTCAGAAAGAACGAGA -0.28495373 0.071095 1
384061 CCAAGGCTCCTTAAGGGAGGTCCTTACCTCCAATCCAGTTAGAGCAATAACCACTTTTTA -0.29371031 0.071127 1
637515 ATGAATGGGTCTCAGTGAAAAGGATGGGCTTAGGCCTTCTGTAAGTGGATGTTAGAGGAT 0.56527788 0.071155 1
12046 AGAACCTAAAGTCATACTTGGATGACTTTCACGTGGAATCCATAGATACCACCAGAATAA 1.09771539 0.071162 1
192232 CAGGATTCACTGCTGACCGTTTACTTGAGATACCCATGGTGCTTTGTAACCGTATGGTGC 0.28077593 0.071175 1
77794 CTTCCTTGGACACCCACTCTGCAGGGGATGCTGAACTGTGAAGATGTGACACAGGGCACA -0.28251208 0.071233 1
56738 GTTCACTGTGGTCTGCCCACACCTGTCTACTCTGGCATGTGTCAGGAAAAGGAGCGTCAA 0.24055839 0.071275 1
16392 CCCCCAAAGATGTGTATAGTTATTGGTTAAAATGACTGTTTTCGCTCTTTCTGGAAATAA -0.23301545 0.071292 1
18416 ACACCGCTCGTGTCTTATCTAGCATGACAGATGCAGTGTTAGCTCGAGTGTATAAACAAT 0.21109066 0.071349 1
66975 TTATCAGCATCTTCTTATGACTGAACCACTGTTTCAGTCAGTAGGAATGTACAACTTATT -0.41996727 0.071355 1
11555 ATTTCAGGATTGCCTTTCAAGAGCTTCTGTGCCTTCGCAGGTCTTCTTCGAAAACCTATG 0.23002968 0.071357 1
16841 GCCAGGGAGTTTGACATTTTCGATTTTTAGGTTCTGGTGACTGAGATAAATGAATGACCT -0.22663546 0.071381 1
22379 AAGGATTGTGGAGGAAGACCTGTGGCTTTCAAAAGTGGAAAAAGAAGGGCTAACACTTAA 0.41028422 0.071383 1
66598 GTCATTCCAGAATTGTATAAATGCTTCATATGTGGCGTTTTTGTGATGAAATAACCTCAG -0.20268638 0.071462 1
235106 TTTTTCAACGTCTCTGAACATGACTATGGGAACTACACATGTGTGGCCTCCAACAAGCTG -0.24850289 0.071551 1
15289 GAGCTTTTGTCCACATGCCCTGCCATTGTGGTAGGGTAACATTTTCATCCATAGTTGAAG -0.18484154 0.071557 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.95063834 0.071576 1
50909 TCTGACCAATTGTTGATAAGCACTATGATTCTCATATAAAAATCAAAGATGCAGAACGCG 1.31692088 0.071662 1
328795 GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC 0.36688572 0.071696 1
233437 AGTGCTATCTTATTTTATTAAGACCACAGACAAATTCTTTTTACAAGTTCAGGCGACCAC -0.26095183 0.071745 1
72310 AAGGAATGCAGAATTCTGTCTCTGTCCCTCCCACCTTGCCTTATCCTTCATTGGTTTCTT 0.71004311 0.071755 1
243374 GTCTTGGACTGCCTAAACCTTTGTATTTGTATTCTTTATAGCCACTCTGATTAAATCTCT 0.98739932 0.071765 1
18260 CCCAATTTGGTCTGTTTTAGCTGAAAATGTTTTATATACCTTTCAGACATGGCAGTACAT -0.19328697 0.071772 1
13199 TGAGCGCTTTCTGCCTCCCATTCTTTTGTCCCTAGGATTTTGTGAATAAGCGAGTAGAGA -0.43477365 0.071779 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.17354309 0.071803 1
434632 TGACGCAGGTGCTAATGAGTTAGGAGAGGTCATCAAAGATGACATTTGGCCAAATCCCAT -0.18872896 0.071847 1
268816 ACTGGAAGACTACTTGATGCTGCAGAAAATACAACCAAGGACTGGTGTCCACATTGGGAA 0.3945832 0.071865 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.81592133 0.071975 1
21410 CACTCTGTGCACAGCAACAAGGACCCCATTTTCCACACCATCAGTCTCTGGGGAAGTCCA -0.2519166 0.072118 1
546185 CTTTCAGAAAGACAACAGGTTATAAAATCCTCACCTTTGAATATAAGGAGGAGTGAATTC 0.36395067 0.072132 1
15016 TGCAGAGAATGGAACCTTCCAGAAGTGGGCATCTGTGGTGGTGCCTCTTGGGAAGGAGCA 1.68484127 0.072162 1
16068 AAACTCAAGCTTCACTTCTACCCTAGATTATCATAGTAATTAAGTCCTTAGAGTTCTTCC 1.49201071 0.072186 1
76933 CCAAAAGGCACCTTCAGAACCCTCACTGATGTCAAAGAATGATGAAAACAACAAAGTATA 1.77749855 0.0722 1
403183 ATTTTCTGTACAAACATATGGTACTATTGGTGGGATAGGGTGCATTAAATGACCTTAGAA 0.53332245 0.072264 1
20416 CGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCATTAAAGTTCGT 0.35607561 0.072298 1
630499 ACTAAGTGACAGACAATGTCTTCACACATCTCCTGTGACATCCAGAGCCCTCAGTTTTCT 1.74698597 0.072298 1
243833 CCACAGTGAGTTTACCAGGAATAAAGTCTCTGCACTGGCATAGTGTGGAAATAACATATG -0.23059175 0.072406 1
71091 GTTGCCTTGAGTCCTATCTCCTAGGTTGTTTTCAAATCATATTTAAGTATGATTTTAGGC -0.27582237 0.072425 1
244202 ACAGGGGGACTGAACCTATAACTTCATATGAGCTAGGCAAGTAAGTTATGTCCCTATTCA -0.19124839 0.072447 1
71706 CGTCTGCACAATGGGCTTGCTGGCCTCTCAGGGATTTTGAAGACATAATGAGGAATTTTT 0.31183796 0.072501 1
244867 GAGCTACTCCCCTAGTCCAAAAGTTTCCTAAAGTCTATGTGATCTCTTGAATCCCTGTTT -0.19646888 0.072547 1
320484 ACTGGGAGCTGGTATCTCAAAGTTGGATTCTAAGGGTGGTCTCCCAAGCAACGGAAGCCA 0.82672461 0.072549 1
74978 CCATTCTCCAGTATGGCCCTTGGAAATCTTTAAAGCAGGTATTTATAATTTAGCAATACT -0.24434229 0.072561 1
207686 CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT -0.2954841 0.072566 1
12918 GTGGCTAGGACGAAATGTGTAAGCTCTTTGAATCAACTTTTTCTTGTAAATGTTTCAGTA -0.37966434 0.072584 1
74192 GATGCTACCGAGAGACCTTTTGCTGAGTGTTTATTTTTCTTACTCTTTTGATTTGTATGT -0.16846132 0.072645 1
66648 CGCTTTATGTTTTGAGAAAACATTTTCAAAGACAGTCTTGTGTTCTTTACAACCTAGACC -0.37612063 0.072683 1
67049 GCCTTGTGTTCAAATCCATTAAAGTCTGGTCTACAAGTATATTTGTTCTTTTTCAAGGCA -0.1988281 0.072688 1
19298 CCCTGACTGTCCTTACGTCCTCTCTGTTTAGAGTCTTATTTATTCTGCCCTTTTAACCAG -0.19718603 0.072704 1
30937 GTGGTAGATCTTAGAGGGTCAGTAGTTTCAAAAACAGAGGTATTCTAAGAAGTCTTAGAA 0.18577251 0.072719 1
54153 TCAACTGTTCTGGGGAGGGCTGTGACCCAGCATAGTCTTCTCCATGTCTGCGAGGGACAA 0.83423569 0.072728 1
78781 CCCCCAGTTTTTAAAAACAAGGTGTTCCTTGATTTATAATCCTTCTTGTTTATGCTGTGT 0.79695843 0.072732 1
66857 GATGACAGAAAGCTGCGAATAGGACACCAAAGGCACTCTTAGCTGTATTTTCCCATCTGT 1.84289574 0.07275 1
319236 TATTTTTGAAGAGCATTGATAGTCTAAATCATGTTAGAGAGGAGGGAAGGGAAGGGAAGG 0.77540635 0.072762 1
12010 TTGAACCTGCTTAATTACAAATCCAGTTTCTAATATGCTATACAATTTATGCACGCAGAA 1.35720313 0.072837 1
64095 GAAGACGGGAGGTAGAAAATGAAGGACAATCTTTACACAAAAGCTGCAAAATTAGCACAC 0.56187011 0.072879 1
432842 GATTGTGCCTACCAGAGTTCTTTGCACAGGCGTGATTAATAAATTACTTTTTGATGGCAG -0.29436306 0.072913 1
27424 TTAGTCTGCAGTGCAAAGAGAGAGAAAATCTGGAAGATTTTGGGAATATAGTGCAAAGAG 0.27408539 0.072934 1
75452 GGGAAAGGATGGGGATGCCGAACCAAAGTGTCTTTCATCTTGTGCAGCGAGGCACCACCT 0.31478334 0.072969 1
70771 AACTAACTTTTCCTCCTAGGAATATATATCCACTTTAGTCCCCATTAGGGATGATGTGGG -0.218787 0.072978 1
210009 TTGTGTATAGTAACGGTCTCATTTTATAGTCCACCTTTAAAACACATCTCTACCTGGTGA -0.20581052 0.072984 1
242702 GGGAGGAGTTATCAAATTCTAGCTGTTTGCTGCCAAATCTTAGATGATTTTGGAAATTAT -0.3185071 0.073018 1
70556 ACCTTAATGAATCCTATTTGGATGGTTAAAACGAGGATGCAGCTAGAACGCAAGGTGAGG -0.18261994 0.073074 1
69131 TAATAGCAGATTTGCTTAACCCAGTTTCTTTAGTTTTTTCATCTGTCTATAGGGAACAGG -0.25058964 0.073101 1
224045 AACATTAGCCTAAAGGAAGTGATGCAGGTCCTGACCCTTGTAGTCCTGGAGTTCCCCCTG -0.17077574 0.073125 1
107701 TATCTTGTTATAGTATGGAGGCATTAGCAACAGAAATAAAATGTCTGGTGATGTGCTAGC -0.23556978 0.07322 1
233328 AAATTATAAAAAAGAAAACGTTAAGATGTGCCGCGGGGTGCGCATGCTGGTGAGACTGGT 0.63222777 0.073223 1
23806 AGAGGACAACACAGTATTTTTCAAAATTGTATATAGCGCATATGCATGGATAAAGCAAGC -0.19868303 0.073258 1
18221 AAAGGATGCAGAGGATCAGGAGGCCCAGCTCAAGAACGGCAGCCTTGACTCACCAGGAAA -0.27163629 0.073365 1
270198 TTATCCTGGTTTTCACTTGTGCATTGCACTGTGTCCAGCATTCTTTGCAATAAATACTTT 0.31185588 0.073393 1
14173 AGCGACCCACACGTCAAACTACAACTCCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAG 0.19349949 0.0734 1
208982 TACCTCAGTGTACCAGTTGACTTTCATGACCACCTTGATATTATCTAATTGCACTTGACA -0.23530904 0.073435 1
56277 TCTGGTCTCAAGAACACTTGTCTGAGGCTGACTCCATGCTGTTTGTACTTCCAGTTTTGT 0.23324946 0.07349 1
100036518 TAGGCAGTAGCATGAACAGTTCTGAAGTTGGAATGTTTACTGGATATTGTTATATGCTAC 0.26099762 0.073525 1
109050 AAATCTGTAGCTTTTTGCTAGGCAATGTACCTATCTCAGAACGATTAATCAATGGGGTCA -0.31911923 0.073533 1
242700 TATACGTCTTACGTGTTTGTATTACCTGTCTTGCATGTTTGTATTTTTGTCGAAATCGTG 0.48426036 0.073598 1
93885 TATTCCTTGCATTTTTTGCTAACTATCTTTCCCTCAAGCACACAATATAGCTGCAAAATG -0.27178544 0.073788 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.20324816 0.073796 1
64934 AAGTATGTATGGCTCACACTTCCACATTGTATGTACAAAAGTATGTATGGTTCACACTTC 0.18711191 0.073796 1
59020 ATGCAAAATACACACTGTGGTCTTAGTAATAAAGGGAGGCTTCCAGGAAATATACTTCAG -0.18491314 0.073822 1
72097 CAGACCTGCCCGTCAACCAGGAAGAGAAACCTGGGTCGAGGATCCTAAAGACAGAAACTG -0.31785927 0.073836 1
213233 GCCTCCGAATACAAAGTAAAGTACTCCACATCCTGGCTACTTAAAGGACCCCGTGTGAGG 0.98154655 0.07386 1
76074 GAGAAGTTGCTTCATTTATTTTTTCTCCCATTTCAATGATTGAAAAGGGTATAAGGTCCC 2.03048305 0.073881 1
258185 GACATGAAGGGAGCCCTAGTTAGAGTTGTCTGCAATAAGAAAATCAGTTTGAAATGGTAG -0.18394193 0.073896 1
103765 ATGTATGGCACTTCAGACGAAATTGCTTTGTTCAGTGGAATCTCACCAAGTGTGACAACA -0.22189615 0.073906 1
170770 TGGGAGCGGGGAGGGACGGCCCAGCCTGTAAGATACTGTACATGCACTGCTGTAGATATA -0.17613935 0.073917 1
16774 AACTTTAAAACATGTTAAATTGCTACAGTTCATTGGGATTAAATAAATACAATGCACTCT 0.78872642 0.073965 1
22030 GGATTATTGCTCTAGGATTTCTCCATAGACATTGCCCATTTCTGTCCGTTTTTTCTACTT -0.21330688 0.073977 1
56177 TGCTGAAGATCGGGGTCGTGCTAAGCACCATGGCCATGATCACCAACTGGATGTCCCAGA -0.34729807 0.073997 1
75731 CGTTATGGAAGCCCTCAAGTGAAGAACTCGTTCATAGCAGAGTACACTCTGCTCCCAAGC 0.39477352 0.074032 1
16429 ATCCCTTGGAGTGTGGAGACTTTGCTGCATTTGATGGGAATGGATATGGAACTCACATTG 0.34312289 0.074083 1
12258 GTAAAGAGCAGCCAAGACATGCTGTCAGTCATGGAGAAACTGGAATTCTTTGACTTCACT 1.12784843 0.074115 1
620928 GGGCTTCTTCTTTGCATCTTTGCCCCAAAATGTTATAATATTTTATTAAGACCAGGGAAA -0.28438909 0.074156 1
547349 TGATAATCATAGAAGTTCTGATTGTCCTTGGAGCTGTGATCAACATTGGAGCTATGGTGG 1.93091909 0.074156 1
217698 CGCTGGTCCTGTTCCCCTGAGAATTAGGATATATATGCATTGTTTTCTTCTTTTAATAAA -0.25929678 0.074166 1
20324 AGTGAGGTGAATAATGGGTGTTGATGGTGTAACCTCTTCAGCTGTGTTCCTGTACTGCAA -0.36493187 0.074202 1
71834 CCAATGTTTCTTCCAGAAAGTTATTTTATTTATGCAAGTCAGGTGACTCTTAGACCACAG -0.14923365 0.07423 1
226654 GGCTAGGCAAATCCTTGTAGTGCTTCACACATGAAAAACTCAAATAAAAAGTACACTTAA 0.33922879 0.074252 1
100039946 AATTACAAAAGCCCATGGAGACTCCAGAACCCCCAAGTCCATAATAAACTTGAGGTCCTG -0.236111 0.074303 1
11306 TGCAGGAATGTTCTTTTAAATGTACTAGGGGATGAATAATTTGAGCTCTGAAAATAGAGG -0.24322004 0.074318 1
67418 CTCACACAGATGAACCTAAAACATGGTCTAGAAGAATGAGCAGGGACAGGCTGGAAGCAA -0.45677852 0.074367 1
211712 GGGATAAATCTCTAATTATTGCTGTTTAACTGTTTGTTATCATAGTTGGTCAATGCCTGG -0.19454499 0.074367 1
14658 TTTCATTGGTTGGTATGGAGAGCATTAAGCATAAGCCTTAAAAAGAGTTGCACACATTTC -0.32725762 0.074391 1
67122 TTTTTTGAATCTTGGTTATGAACCCAATTTTAAAGGGCGTTGTATCCAGCGTTGTGAAGG -0.295461 0.074418 1
22770 CCTAACATGTTAAAAATTACCTTTTCGTGTAAGAATCGGGGCTTTTTAACGGTAAGTATG -0.20529822 0.074445 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.80978498 0.074482 1
11554 GTTGGAAGGCCATTTTGCACAGTGTTAGGCATTGTAAAATTCATAGAAGTTGTTAACTTG -0.20988412 0.074483 1
68094 AGCTTTGTGTTTGTGTTTAAGTCACCTGCTTACTCGTCAGCGTCTGTGTACTTGTGGGAA -0.20548332 0.074556 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.77269981 0.074565 1
67569 GGAGATTAAATGGCTGTCTTATGTGGGAGAAAAGTAATATCTAAAGAAACTAGGTTTTGG -0.32096363 0.074567 1
13085 GACCACGTGCATGGAAGAAATAGAAAACACTACTCACCTTGATAAAATTGTAACAGTAAT -0.2011237 0.074575 1
105853 AGACGAAGGTGTTTAAGAATCTCTCTACGTATCTTAGCTGTAAAAATGAAAAAGTGTTGG -0.34007078 0.074608 1
360216 TGTTAAGCTCTTGAACTAAACCAACAGCCATAATTATTGTCCCAAGAAAGTGTAATGCCG -0.24308985 0.074653 1
319163 TGGTGCACCAGTGTATCTGGCGGCAGTGCTAGAATACTTGACAGCTGAGGTCCTGGAGCT -0.16091632 0.074675 1
21356 ATTAGGACGAAAGGTCTTCATAGCATCTTAAGATTCTAGAGACCTCAGGGACAGCCCACA 1.02998439 0.07474 1
68888 TCTGAACCTCTACGTCAGCCAGACTGGACAGACCTCATCTAGCCTCTGCCTGTGAGAAGT -0.34222155 0.074844 1
226525 ACCAACCCCACCAAGCTTTCCATCACGGAGAATGGTGAATTCAAAAATAGCAGCTGCTGA -0.20848634 0.07485 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.16297172 0.074911 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.25545699 0.074928 1
20135 CTAGCTTCCTCATGAACTGACATAACCCTGATCAGTTTCCTTGATTATTGTATAAATGTT 0.46113513 0.074947 1
26401 CTTCCAGGGCTTAAGGGCTAACTCCTATTAGCACCTTACTATGTAAGCAAATGCTACAAA 0.43365398 0.075002 1
13669 TAACTACATGTAGGCAGTTTATAGCTTCTGATCAGTGTAGTAGACATTACAAACACTGGT -0.29862585 0.075006 1
14963 AAGTTCTACCTAGAGGGCGAATGCGTGGAGTGGCTTCGCAGATACCTGGAGCTCGGGAAT 1.67973264 0.075033 1
227731 GAGGATTTCTTTATTTTGCCCTTTGGAACGACAAGGCAGTGAGGTGCTTCACCAGGAATT -0.17221901 0.07505 1
74189 CCAACATTTTGATTCCTGTTAATTTTGTTCTTTAATTAAATGACTACTTATTACAGGAAA -0.2375812 0.075111 1
15013 ATCCACTGACTCTTACATGGTGATCATTGCTGTTCTGGTTGTCCTTGGAGCTGTGATCAT 1.67347714 0.075117 1
217364 GTACAGAGTATGCTTTTAAAAGTGCTGGTTCCTTCAAATATTTTATGCAGAGAAGGAGAG -0.2482867 0.075126 1
328561 CCTGAGATAACAATTCCTTCACTTTCTGGTATTCCTCTTGAAATATAAACCTTGTTTGGT 0.5117205 0.075182 1
13714 AAATAACTCATCAAGATCTAAGAAGCCCAAAGGGTTAGAACTGACACCCGCCCTTGTGGT -0.21841629 0.075203 1
77652 AATTTGGCAGGCTATATTTGTAGACACTTTATAAAATTGCGGTGATTTATTGTGCACGTG -0.23664069 0.075203 1
15007 AAGACACATGTGACCCATCACCCAGGATCTGAAGGTGATGTCACCCTGAGGTGTTGGGCC 1.72157701 0.07521 1
66446 CACGTTGGTTGCCTCACTTTTCATTGACACTGGTTTGTATATATTTCTCTTAATTGTCAA -0.18563176 0.075212 1
14466 GGATTTCCTGGCTCCAGCCAAAGCTACTTTAGGAGAGACACACCGCTTGTTCCCCAACAC 0.25409814 0.075256 1
14580 GGTTATATTAACAGAGCTAGCCTATGCTAAAGGTTAGGTTGTACTAATAGAGCTAGCCTA 1.0139768 0.075256 1
193003 AGGTCTCCAGATATCTCAACCATTCACAGTACTTCTATAGGCAGTTAGAATCCACCACCT 0.40662479 0.075304 1
63913 TAATCACCTTTTAAGGAAACTCAGATGGGGCAAGAGATTTCATTGGCACAAATTAGCCTT 0.61781873 0.075326 1
434484 CTTGTCTCTTACTCTCCTGAGAACAATCCACAATAAACCATAAGCTTCCAGGACTTCAAA 0.43581627 0.075398 1
71241 ATTTTCTTGACTGAGGGTGGCTATTCTTGTAGCCCGTTTAAATACTAAGTCCCCCAATAA -0.22722497 0.075434 1
19088 CGGCTATGAATGCCAGCTCTGTTCTGTTCAGTATTGTTGGTTATATTTAAATTTTCCTTA -0.252292 0.075453 1
17067 TATTATAGTATCACCATCCACACATAAGTATCTGGGGTCCTGCAGGGTTCCCATGTATGC 1.4473416 0.075471 1
16439 GCCATTTAGCTCCCAGAACAATCCGTAACTGTGTTTGCACGCTTGAGAAGATTCAAGCTT 0.35007074 0.075496 1
328440 TGACCTCATTTTAGCATCTTCTGCGTCCAAGGCAGGATGTCCAGCAGCTGTGCTCTGGTG 0.30353624 0.075566 1
20382 GAGCGACTTCAGATTTCATTATTGGATTGGATATTTGAGGTAAAATTTCATTTTTGTTTA -0.19522734 0.075578 1
106489 GGACCTGTGAAGCAACTGAAGAAAATGTTTGAAACAACAAGATTGCTTGCAACAATTATT 0.31754461 0.075585 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 1.07320556 0.075609 1
22068 AGAGTCCTAATATCAACTTTTTGGGTGATTAAATTGCATTGCTGAGGCTAACAATTGCTG -0.28930984 0.075644 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.5364083 0.075689 1
69161 GCACAAGAGTAGTAATGATAGCCTTTGGGGTTTGCTGAAAAAGGTGCTATTTTAAACAGC -0.21387687 0.075745 1
66405 TATCCATTATCTAAATGACGGGCTGTGGCACATGAAGACATATAAGTGAGCCTTAGACAC -0.27100433 0.075751 1
57269 CCTTTAGGAATGAGGACATGAAGAGTGCCTTGAAGAAGTTAATCAGGAGAAAAGAGGGGA -0.31830113 0.075771 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.20613443 0.075875 1
69379 GAAGCACCCCTTCATACAGCTCTGTTGTCCTAGGTCTTTTCATTAAACATCAGACTTGGC 0.17938169 0.075893 1
12479 TAATGACCATCTTAGGACACAGTCTCTATGGAAATTTTGCATTAATGACTGAAAGGTGTT 0.44644383 0.075916 1
223920 ACACGTTTGGTTCTTTCTGCTTCTCCCAATGCAACAATAAAAATCTTAGTCTCGGACTGG 0.42607249 0.075934 1
404316 TCATTGGGAAACACAGACAGTTATATACTAGCTGCAATGGCATATGACCGAGCTGTGGCT 0.18728975 0.075948 1
20482 TGCCAATGCATATAGTTTTATGATTAAAATTGCTGTGGTTGGTTGCATTACATGACACAC -0.17620314 0.075952 1
14950 GCCTATCTCGTGATTGTTTCACGTAAGCTTTGAAAGAGATAACTATGAAGATACGTACGG -0.33776168 0.075997 1
12741 TCCTACTGAGATCCTGGGGGCACTAGATGCTGCCTTAATGTCCAGTGGCACCTGCTAACC 0.60830815 0.076013 1
74747 TGCCACCTGGGTCTTCCATCTAGAACCTGTTTACATGAAGTTACTCGCGGTTCATGAATA -0.31939886 0.076024 1
269470 AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG -0.15739742 0.076045 1
20346 GATGGGAACTAGAAAACTGGAGAGAAAAATGTAACGATATTGCTGCTGTAAATTATTCCT -0.73152127 0.076073 1
73149 GCCAATGGTTATACATATGATAATACTGGCACATGTGTAAACTTACTTGGTCATTGTCAT 0.6784996 0.076088 1
751864 CCAAACTTCTTCTGGTTATTGTCTCTGTCATGTACAGGCACAAGAAGCAGAAGGCCTGAA 0.3691575 0.076106 1
109910 AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC -0.20091963 0.07614 1
21915 CGTCGTATTTGACCATCGTATTTAACCACATCCGGCTTGTTTTGTTTTATTAAAAGGTTT -0.19887902 0.076148 1
227800 CAAGGTAGAGACAGTGTCAGAACAAAGATTGTATTTAGGCTCATATAAAGTACAGTGCAG -0.20421103 0.076155 1
228714 TTTAAAGAGTCTGTTCTGTCTGGATAGAGTGCTTGTGGGCAGATGTCCTTCTGAAGGTCT -0.1744387 0.076184 1
79554 CAAACTTTGGGGCATATCTCTTCCATTAAGCACTGTGATATATGTAGTATTTCCAACAAA 0.35812037 0.076292 1
269016 AGAGTTCTCAGGAAAGAATATAAACAGGTCTGGTTGAAGCAATGTTTACACTGACAGAAG -0.46925753 0.076322 1
108143 GAAGACGATGATGATGACGATGATGACGATGATGATGATGACTATGATAATATGTAGTCT -0.278115 0.076322 1
68870 CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT -0.29770541 0.076325 1
54160 TGTGGATGTTATCTTGGCTTCTGTGGGATAAGTTCTTGCTGGGAAGGGTGATGTTGCTAT -0.21703284 0.076348 1
12235 AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA 0.23484337 0.076361 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.25034927 0.076375 1
71398 ATTCCTATGAATCCCAAGGCACTATTGTATTAATTTGATCAGAGGATGTGATGGAGGGAA 0.59837805 0.076399 1
232973 CAAGGTATCTCTTGGAGTGTTCTCTTATGCCTTCTTATACTCCTCAGAGATTGACCACCC -0.16793376 0.076406 1
66983 GACACATGTTTATATGACCTCGATGTATATATATTTTCAAGCCTTAAACTCCAAGGGTTG -0.18243057 0.076501 1
230162 GCCCCAAAAGAAAATTACTGATTTATTTTGTGCTGCCTCATCTGTGAAATCTGTTTGTAA -0.33513225 0.076589 1
113860 TAGGAGTCCTAGCTAATATGTGTCTTCTTGTTTTCTATATTTTCATGGTCCTAGGGCACA -0.20130515 0.076619 1
243369 TGTGCTCAGGGTGAAGTGATCATGCAGGAGCCAGGGAGCTGTTGCCCCATTTGTCAGCAA 0.3121619 0.076626 1
18537 TCTCATGGGGGTGATATACGTGCCTTTAACAGATAAAGAAAAGCAGTGGTCCAGGTGGAA -0.31280822 0.076654 1
216760 CCCTGTCACACAAAAGGGAATGAGTGTTGTTTGATAGTACTTGTATCTCAACAATTATTT -0.22394089 0.076704 1
72135 TACTAACAATGCTTCATTTTATTGTTTTTTGTTGGTTGTCTTGAAATGAGATTAATGGGG -0.208186 0.076708 1
26894 TTAAAGTTACGACAGCAGCTGCTGCTGCAGCCACCTCCCAGGATCCTGAGCAACACCTGA -0.22711902 0.076756 1
11600 CATGTGTGTAGCAATTTGATACGCATAGCTTTTTGCATTTAATTAATGCAGGGCAGAAAA 0.29197015 0.076784 1
435616 TCTGCAGAGGAGTTGGACGCCCAGCTGGATACTTATTGGGAAATGATGGACACCAGTTAA -0.18931837 0.076784 1
67304 TTAAGAACACTGACTGCTCTTCATACAATGCATCCTGAATCCTTGTGTTGGGCTCGGCTA -0.4746775 0.076801 1
242894 GTGGAGGAACCCTGGCCTTCCCAGCCTATTTTTGTAAATAAAATGTTATAAACTTGAAAT -0.30836665 0.076821 1
20682 ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC 0.30827351 0.07683 1
228859 TATGTATCGTTATGTCTTGGGGTTTGGAGCAGTAACAGAGAACCCCATTTTCTCTCTTCT -0.24720487 0.076844 1
28240 CAGTTCAACCATCAGACACAATTTTGAGAACTCAAGAGAAATGAATTGTACTGACTCATA 0.21790941 0.076956 1
16801 CTACCCCAAGTGCCTTTGCTATGTTTTTATATCCTGGACTGGAGGTTTATTTTTAATATA 0.37020125 0.076963 1
100038601 GACAGCGCAAACGGAAATATACCCAGCCTCCTAAAAGGGTGATTAAACATTTAAAATATC 0.48129449 0.076966 1
12556 AGACATTATCACAGGCATGTCCCCAAAGCCTGAGCACCTACTTTATGGGATGACCATGGG 0.36638016 0.076986 1
20821 GTGTCTTTGTTACATAAAAGTTACCTTGAGAAAGATCTCCAAGTATTGGTTCCAATTCTG 1.01799161 0.076999 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.75462711 0.077052 1
20469 CTAATGCCTGTCCCTGTTTGTAAATATCCTGTAAAGAAAAGGAGACATCAGAGTTTAAAA 0.35831568 0.077072 1
108079 GTCTTTGTATACTTCCAAAGCTTGATCTCTGTGACCTTCACTGTTGAACCTGATTGGACA -0.16573057 0.077125 1
218793 TGCTTGTAAATTTCTTAGGGACCTGCCACTTTTGACTGTGGATCAGTTGATGTATACTTG -0.26135812 0.077141 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.9540255 0.077148 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.75510257 0.077162 1
103737 GGGAGGAGTCTGGAAATTTCAGTATGAATGAAAACTAGCAGGCAATGGTGAGATGCAGTA -0.21055494 0.077174 1
13712 GTTAGCCATCTCAAGGAGAAACATAGTTAAACTGACAGACTTAAGCTCTGATTGTGGTGG -0.17271089 0.077202 1
195040 TCAGACAGTGTTTCTGTAAAACTAAAAAGACTGATCTCAGTAACTTCTGAATCCAGTGCC -0.20675816 0.077234 1
14105 TACTAAAAGTAGATTTAAAGTGTATTCCAGGATTGTAGGCTGTTGGAGCTCCAGCACTCT -0.25066742 0.077239 1
70750 AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC -0.16141908 0.077265 1
72318 TCTTTCCTGTTGTAACACTCAGGAGCAAGAATAAAAGCTCATGACGTCGCTCGTAGACTG 0.61768589 0.077277 1
56378 GGGCGATTTCGATTTTTGGCAGTTTTAAGCTGGTACTTAATATATAATAAATGTCACTGC -0.14959175 0.077279 1
26364 CGCTGCTCCACATCCAGGGCAGAAGGTCTCACAGCTAAAGACTAGGTTTTGTAATTTTTT 0.61720234 0.077302 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.63461688 0.077367 1
27366 AGCAGAATTTGTAGCTCTAAGGAAAGAACACGCAGAAATTAAATTGCATTCTCTAACCTG -0.1821421 0.077374 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.3986888 0.077379 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.57726899 0.077397 1
19171 GGAACTTCTTGAGGAAACTGTGCAGGCCATGGAGGTGGAATGAAGTGGCCTGAGATGTAG 0.58359439 0.077454 1
81904 GACATCTCTAGCGACGTCTCCATTCAGATGACGCAAAATTACCCCCCGGCCATCAAGTAC -0.22088228 0.07746 1
19038 GGTGACCCGAGGGTTTGTTTGAGGAAGGTGACTATAATGAAGGTTAGCATTTTCTGTTCA 0.23276728 0.077462 1
387564 GAGTCACCAAGGTACTACTGGGAGAATATTACTTTACTGTATGTATCTCTCTAGTAAAAT 0.19025605 0.077496 1
74309 ATAACTATCCTGGCAAGAAGCCCTTTTTTAAAGACTCGAGGAAGCCAGGCCCCTTTGAAT -0.243443 0.077497 1
68046 GACAAGAACCCAAAGCTGGACTTCAGGCACTTCTTATCTTCTCTATGAAGAGAATGGCCT -0.17593703 0.077519 1
50934 TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT -0.35957523 0.07756 1
17391 CCTGTAGGCTCTGAGAGAGGCTGAGGGTAGCACTCATCTTACCCTCAGATGAAGCACAAG -0.30695168 0.077561 1
105638 TACAGTACATGTCAGATTTCTTCCTTTGTTTGTGGGAGGTGGGAAGGCATTGAACCCAGA -0.18410809 0.077628 1
20438 GCTGCTGTGGTTTTGGTTTGGTTTGCTTTTGGTTTTTGATGTGTGTGTATTTGATAATTT -0.19023298 0.077657 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.38686007 0.077673 1
223669 TAATGCCTGTGGCAAGGCTTTTCATCAGATCGCAAAGCTCACTCAGCACCAAAAACTTCA -0.15913164 0.077694 1
18045 TAGTTCTAGCTCTATCAAAAATGGCTTATTGTATAGTCTGTCCAGAAGGAAATTTTGGGT -0.34104183 0.077739 1
231712 GCGCCAGCCCCTCCCCTTTTTATTTTACTGTTCTAATTGTCTATTTCCTTGTAATAGAAA 0.21118935 0.077805 1
17144 CAAGATACTAGAGACACTGAAACTGTAACTTTCTGGGCAATGGAAAAAATGTGAATGTTT -0.30290378 0.077854 1
21939 GGGTTTCTACCTGTGTGTTACCATTTAGTTCTTGAATAAAAGACACACTCAACCTTTATA 0.96648343 0.077884 1
28000 GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT -0.19610106 0.077899 1
14613 CCGACACTGGCACTAAGACTCTCTGTTCTGGCTATGGAGTGTGTGTTTGTTTTCTGAAAT 0.2740528 0.077911 1
269643 AAGCCACAGACTTTGCCACTTTACTCTGCTTAAGTTCTCTGGTCTTGAGTACGTGGCATT -0.21347798 0.077947 1
384732 ACCCCAAAGTCTTCCAAAGAACAGGAGAAACTGGTGTCTGTCTTCTATGCAATGGTGACA -0.21002448 0.077978 1
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA 0.21849064 0.077983 1
72097 GAGAAGGAGAGGAAGGGACGTGGCAGGGTTTGTCAATTCATAGACTGTTTCCAAAAAGAA -0.27509208 0.077999 1
230810 ATGACTCTCCAGCCAGACACCGTCTCCTCGGAAACATGGTCAGGACCTGTGGGTAGAACT -0.18355481 0.078025 1
60321 CTTCCCACAAGCTAAACTCTTTTGAGTGTTTCATGGACAAATAAAATGTTCCATACCAAG -0.54242062 0.078055 1
633640 ATACGGAATGCGCATTGATGTCTGAGATGACCTTATATGTGGCTCTAAGAGAAGGAATTC -0.83238091 0.078057 1
246228 AGGAATGGGACGAGACCTTGGCATTTAGGGCCTCAGGGATAGGAGAGCCGCACTATGACA 0.40736951 0.078064 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.30773114 0.078088 1
20018 GAGATTGTTTAAAAACTCCTAGTTTTTTGATGTACTGCTCTTTTGTGGTCATTTCCCAGA 0.24238675 0.078099 1
14462 TTAAGGAATATAGGGGGATTAAAGTATGGAGATACAGAAGAAACCACTAAGTCTGATGTC 0.85186454 0.078104 1
19746 TTGGTTTCATGACAGAGACTATTAATACTTTGGGATGAATACACCTCATTAAAGTTCTGG 0.27751056 0.078173 1
231507 ATTGCTCTTTGACTTGGTTTCTTCTTGCTCCCATATCATCAAATATTGGAGCCTATAATT 1.93205487 0.078173 1
17955 ACTGTGATGGGTGTACAATAGACTGGAAGAAAGGAAAAAATGTCACAGTCAAAACCATCA -0.22206891 0.078175 1
11957 CCAGTCCTGAGGAACATATAAAATCCATGTGGTAATTTGTCATGAATTAGTTGTACAACT 0.25629098 0.078195 1
213234 ATGTCATTAAACTGCCGTGGGAAAAGAGGGCTTGACCGTTCACTACTCTTCCATTCTGTA -0.20262103 0.078257 1
12487 TGCTGTATCCCCAGTGCCTAGAATAATGCTTAGCCTGCAATAAATATTTATTCATTGACT 0.68005641 0.078351 1
58172 CAATCGCTACTCTACTCTCTGAATTGTCTTAATTGTGAAACCTTGCTCTTACAGATTGAA -0.17139325 0.078354 1
70981 CGAAGCCCATAGTTATCATGACTCCTGAAAGCATGAAGTTGGCTACCATGAACAGCTGAA -0.31660247 0.078372 1
330941 TGCCTGCATCTGATATACAGCAAAGGGGATCTTTCTTCTTCCCAAGTCTGGCCTAATTAA -0.28707167 0.0784 1
16061 TTGCGTGTATCAGCTGAACTCTGGAAACAGGGTGACCAGTACTCCTGCATGGTGGGCCAC 2.900287 0.078419 1
77329 CACCCAATAACAGTCATGATAAGCATTTCAAAAGAATTTTACTTGGATGCCAAAGAGACT -0.19895148 0.078448 1
66700 ACTGTGTGGAGCAGTTTGAAAAGCTTTCTGGTATGCATGATCTTCACAAATGAGGACAGC -0.22617747 0.078454 1
668166 GTGTGTTTGGCAAATAAGTCTGTCAAGGATGAGCTAAATACACAAGTCATACAAATAAAG -0.21778972 0.078491 1
74375 TCTTTTGGTTAATTCTGTTCTTTAAGGAAAGTAGCTCTCAGAAAATTTGGGTCAAAGCAC -0.16639403 0.0785 1
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.82297618 0.078502 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.77779422 0.078502 1
20732 ATAGAAGGACCTGCTTATCCAAGAGCTGGAGAAAGTTGGTGTTTTGTGTCTTGTTCAAAG 0.50525953 0.078531 1
80732 CAGCGAGACTAACTTAACTGGAGAGAGTATGAAATACCACCTTTGTACAATAAACTTATT -0.17143212 0.078537 1
619331 TGAATGCGGGAAGTCCTTCAGCCAGAGTGCTAGCCTGATTCAACACCAGAGAAGCCACAG -0.22719192 0.078543 1
216877 GCCTCTTTTGTTGGGCCTCCTTTCCCTTATTTAAAGAATGCTGTTTAGAATATTAAACAT -0.21891127 0.078576 1
216021 CAAAACCTTGCATCGAATTCCTTGTTTCAACTAACCCCAGCTATAAATGTCTAACTTAAT -0.24304231 0.07861 1
751865 GGTCCCAGTGGTGACCAGAGCTGTTCTGGGACTGACACATGAACCACATAGTACCCCAAT 0.61705477 0.078704 1
78938 CTGCAGACACAGCCGACCCTCAGGAGAATCCCTTGCAGCCAATATCTGTTGGTGAAGAAC -0.38748661 0.078743 1
192199 CCGTGGTACACGTCACGGATGACCTGACTTGGAAACTGCTTAAAGGTTTATTTCAAATTA 0.74079945 0.078786 1
66139 TCCTGCTGTCTCTCCCAAGGTACTTCCTATACTTTGTTATGCGGCCTGTACATGAGAAAT -0.19075091 0.078805 1
258165 GTCTGAGGAATAAGGATGTCAAAGTTGCTCTAAATAAGTTACTTCGAAAGAAGACATTTC -0.17277367 0.078966 1
225908 CCGTGAATTCACATACCACTTCCGGGTGACATTGCTGGGTCAGGCCAACTGCAGCTCAGA 0.22314227 0.078974 1
217122 GTCAGACATGCACATACACTGGACATCCATCAAATAAGGATGAAGGATCTGTCATGCCAA 0.51442089 0.079026 1
18817 CCCCTTTGAAGGGGTTGCTGTGTGTAAGTTATTTTGTACATGTCTGGGTGTGGGTTTACA 0.16608965 0.079033 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.7873886 0.079146 1
237758 CCACAGTTGGATAGTAGTGCCTTTTTATTGGCCTGAATTACTATTAGAACCAAAATGAAA -0.23478988 0.079217 1
15357 GCTAAGTAGTGCTAAATAGTTCTTGACGAAGAAAACAGTCACTGCATTTATCTCTGTGAG -0.23049215 0.079262 1
22029 GGTCAGACATTAATGTGAATTTAACCTGCCCTGGACTGAGTTCCTATGTTAACAGACACG 1.00387468 0.079331 1
68910 TGTTCTCTGAGGAGGAAACATCTCATGTCTCCTGATGCCTGCTCTTCAGTTTCTGTCTAG -0.25243055 0.07935 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.19929143 0.079364 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.19676869 0.079406 1
57765 GAGGGGGGAGGCTATTTATTGTAGAGAGTGGTGTCTGGATGTATTTCTTCTGTTTTGCAT 1.1013802 0.079423 1
64050 AGCATATGTGAAGAAGATCCAGTTTAAATTACACGAAAGCTACGGCAATCCTCTAAGAGT -0.21678583 0.079429 1
67768 ATTGAATCCATTCCACTGAACATGTAGCCATGAAACAAGGCACTGTGTAGATCCTGCACC 0.21616294 0.079431 1
27215 CTCTAACTAGTAGTAACCGTTATCAAAAAGGATTGCTAGAACAGTCTGATGGGTGTTAAC -0.19373527 0.079461 1
242285 GACCTCATGGAAAAGTCATTTGATGTCAATTTCAAAGCACATTTATGGATGTATAAAGCC 0.19763493 0.079522 1
20730 AAACGCATAGAGCCTGTCCTCATTCGAAAAGGTGGGCCTTGCTGAAAGTCAAGATTTGAA -0.20633734 0.07953 1
16949 AACGTGGTGAGATGCAACATCCACTACACAGGTCGCTACGTTTCTACAACAAACTGCAAA 0.24515222 0.079581 1
107568 CTCAGTCACCTACCTGTCTTTGGGAAAGAAGCTACTATTTGTTTTAGAAAATGAAAATGT -0.1786441 0.079587 1
71954 TGCTCTGAGCAGTTTCCAGCGAACACGATTCATTTAGGTATGCCCGTCCTTGTTCAGGGT -0.23083996 0.079601 1
71912 CTGGGCGAATCCTGTGTCCCTTCTCCCTGTAGCACCAGCAAATAAAGGCCGTGTTGTGAC -0.41345667 0.079611 1
21858 CCGTGAGCGTTCTTGTGCCGTGTTGATGCCTTTCGTAGCATTAGACTTTGCACTTTTAAA 0.29103847 0.079615 1
258559 AACAGGGATATGAAGGAGGCCCTGAAGAAAGTTATTGGTAGGACAGCTTCTCTTCTGTGA -0.20405252 0.07962 1
71956 GAGCTGGTCTGGAGTGTCTCCTCACAGTGACCTCTGAGGCCTCAGAATAGCCTGCCTAAT 0.44036333 0.079643 1
118445 GTAAACAGGGGGAAAGGACTGAGGTTCTTAGGAGTTAACTCCATAAGCAATCAGAGCTTT -0.25173979 0.079713 1
73845 GTTTGTGAGAAGGTACTAATCAGTGCAGTAAGGTTAAATACATCCTGATTTTCCTTCACT -0.30030524 0.079729 1
52668 CCAACTTGTCTAACACAGAGAAGGATTAATTACCCCCAGGCGACAATCTCCTAACACATA 0.52298481 0.079872 1
22040 TCCTGGCCTCACCTGGGCAGTAAGTCAAGAGGGGAAATATGATGAATAAAGACTTCCATA 0.43660845 0.079885 1
74400 CTGTGAAAGGCTTTACCACAAAGTCAATTCCTCATCCATGTTTTTAAATAAAGAGACCTA -0.39753645 0.079898 1
216445 GGTGATGCTTGTTCTCAGTATTCCTTTATTGTCAGGAAACTGTGTCATTATTAAAGTTTG 1.21150946 0.079912 1
78369 CTGGAGCGCTTCACCGGTTCAGATTTGGCTAATGTCACTTTGACCTACGTGATGCGGGCC -0.17217512 0.079973 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.58980936 0.079973 1
212974 TAAATGAAGTCAGACTGGCGACCAGAGGGAATGGAGTCAGATGGACAGGGTTCCAGGCCA 0.20841155 0.079987 1
23920 CAGCCTCTCTGGGGAAGACTGGAGAAGACTCAATAAATACGGAGGTCTGTTTGTATCTGG 0.55243176 0.079994 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.76846071 0.08 1
320495 ATGAATCCCACGTCTTCTGATTGTGTGGAAAATTCTCTTTGAGCAGATGCCCAGATCCCA -0.44558534 0.080031 1
13492 CCACAATTTCTAGGGTCTTTTAGATGTGATATGCTTCAAAATGCTTCAAAACCGAAATCC -0.53662303 0.080108 1
22428 GTTGGAGAGAGGTGGGTCCTATTGTAACGACCGCTATAATTTATATGGACTATATTGTCT -0.19380327 0.080121 1
110557 GTAGCTATTCTGGTTGTCCTTGTAGCTTGGCCATCATTGGAGCTGTGGTGGATTTTGTGA 1.68685312 0.080214 1
68385 GGACATTGTGGTTAGCAAGCAAACTCGAGCTTCTTGGGAATACCTTGTTCATCATGTCAT -0.23448608 0.080216 1
636808 AGTCACACCGCACCAATCAGATGAAGAAGGAATACCCAGAGAACTTGGACAATTCCTTTA -0.26157096 0.080216 1
74315 GCACCCTTTCTTTGACAAGGATGTGTCATATTTAAATTTTTACATTCATCATGGCTACAG -0.1749969 0.080238 1
224481 TGACCTCGTGACTTTACTATCCAGCTTGGTAAGAAAAGAAATACCAAGTAGATACAGTGC 0.25282819 0.080251 1
69089 CAGCCATACTTTAAGAAGAAGCTGAAGTGTTTATGCACTAGCTTTTCCCATTCATGACAT -0.20013586 0.080273 1
231861 TGCTGTTTGTACGCGGTTTTGGTAATGCCAAGCTTCATTAAACATACCGAGTTCATTTTT -0.21168234 0.080339 1
23956 CTGCCTGTTTCCCCATGCCTAGTGTTTGAATGAGTATTAATAAAATATCCAACCCAGCCC -0.55133557 0.080342 1
229898 GTAAAGTTTAAAAATGATTTCTCACTATTCTAAGCCTGTCTCTGTTTCTGGGTCGATTTG 1.80805973 0.080342 1
52855 GCTCCTTTTCCTTCTGCTGGTTTGCCTTATCTGACTTTGATGTGGTGTTTTTTGTTGTAA 0.58708193 0.080349 1
67890 TGTTACACTGTAAATCATGGCTACCTTTATTTTACAATAAGACATACTAGCCAGCATACC -0.21052572 0.080408 1
15975 CCTCACTACTACCTTGTATCTCAGTCTCCTCAACAGAGAGAGAATGCAGATTGATTTTCG 0.27153389 0.080453 1
12902 TGGCCTACAGATTGTTCTTGTGATATTTCAGAGAAGGTAGTGGCTGCTCTCTGCTCTTGT 0.17651374 0.080485 1
216565 GATGAACCAGAAACTTTTGTAATGATAAAGGATTCTCCACCCCAGTCTACACGAAGAAAA -0.30295147 0.080495 1
74479 ATGCCATTCTTTCCTATGCTATGTCCAACTGTGGCTGGGCCCAGGAGGAGAGGCAGAGCA -0.25828358 0.080496 1
319293 CTCTTTGCTACACCCCTTCTACACTGATATTTTACTCAAGTGCATAAAATCTAACTGATA 0.43010296 0.080514 1
258344 AATGTTGAACCCTTTTATCTATAGCCTGAGGAACAGAGACATAAAGGGAGCTCTAAAAAA 0.27862318 0.080526 1
12488 CCCGGTCTTAACAGAGGACTCCTTACACTCCTAACTGTGATCACAGACAAGAAATACCTT 0.20200648 0.080567 1
320923 AACTCCCAAGGCCAAGACTCAAAATTGTCTCCTTTTAGACTTGAACCTGGCAAAATAAAT 0.39775876 0.080594 1
258056 AAACTCATTTCCCTCTTGAGAACTTTGAGCTTGGAGATGAACTCTAAAAGCAATGGGTAA 0.18898248 0.080636 1
17345 ATACTACTGCTACTGCCTGAGTTTAAGGAAGGAAGCTTTGAGCTTTCCTGGTCATACTCT 0.69105425 0.080644 1
170930 TTTCTACCTTCCATTATTCCTTGGGAGGGAGAAGGTTGAGGCAGTGTCTACTATGTAACC -0.19578511 0.080653 1
435518 CACAAACACCCAGACAATCTCAAGGTGGCCTGTGAGAAAACAGTGTCTGCTGTGCAGCAC -0.26092675 0.080657 1
14455 GCGCAATGTAAGCAATTTTGTGTGTGCATGTGGTCCCATTACAAGGAATACCCAATGGCA -0.53208578 0.08071 1
24013 AGATTACGAGGTATGGTCTTGGAGTGAGTGTGACCTTTTTGGAGTGGATGTGTCCTTGTT 0.27497271 0.080732 1
13684 CACCATAATTACATTCCTAACTAGAATTAGTATGTCTGCCTTTGTATCTCTATGCTGTAC -0.16768352 0.080756 1
71520 TGCTGCTACCCAGAGTCAGAGCATCTGCAGATTGGGGAAACTGAGTCAGACTTGGCAAGG 0.61142465 0.080769 1
435815 ATGAGGCTGCCTTTCTGGAAATCAGACATAATTCTGGTTTAGAGGTTTCACCTATCCTAG -0.30640027 0.080781 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.2278748 0.080819 1
110749 ATGCCCAAAACCTGGCCCCTGATGACTCTTCCAAGACTGTCTGAGCCTGCTATGCACCTG 0.57668755 0.080841 1
78581 TGTGTATACCAGAGGACTAACTTATTTTTGTAAACTACTACTGCTACATACACTTTTGCC -0.16216459 0.080896 1
240068 CAGCCCCTTGATAGCATTTTCTGATCAGTGATTTTTGTTTCCCAACCACTTAAAATAAAA -0.23913181 0.0809 1
226422 TGTTTGGCTCCTTTTCTATCCAGGTCTCTGAGTCATTCCAATTCTTCCTGTTGGATGCCA 0.42773629 0.080914 1
11820 CAGGATGATTGTACAGAATCATTGCTTATGCCATGATAGCTTTCTACACTGTATTACATA 0.26094753 0.080951 1
12235 AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA 0.19739501 0.080957 1
109222 ACATAGCAGATGGATCAACAATTGCTTTGGGAAAAGGTTTCGTCTTTTTTGTTTTGAGTT -0.20400409 0.08099 1
15040 ATCATCCTTGGAGCTGTGGTGGCTTTTGTGATGAAGAGGAGGAGACACATAGGTGTAAAA 1.7169574 0.08101 1
70314 CCCCAAGATATAAGGAAGCAAGGCCAGACTTTTCTGTCATTTATTTTCAATAAATAAGCA 0.23109738 0.081035 1
18505 AAATATTAGTCTCGATCCTTTGATACCGTGGTATTAAATATGACATTGTCAGCCTGTAGC 0.18533276 0.081065 1
18807 TGGGCCCAGACCTTTGGCCCACCCCCAAAGGGCCAAGATTATAAGTAAATAATTGTCTGT -0.16280896 0.081076 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.94087803 0.081093 1
14969 GGCACTTCTGAGCCAGTCTGCTGTCATATGCTTTTTTACATTTTTCTCAAATAAACAAAT 2.20800309 0.081116 1
68691 TTTTGTTATGCAAAGAAAGGTTACTCAATTTGTAGTTCCCATACTACTGAAAATCCTGGC -0.24970994 0.081122 1
16563 ACGACCACTCAATAAAAAAGAAACTCAAATGAAAGATCTTGATGTGATCACAATCCCTAG -0.2431295 0.081162 1
677289 ACCTGGGATGTAATGGGTATTACAGTTGTAGATGGAGCCATGCAATAAATGTATGTATAC 0.20609755 0.08117 1
246730 TGATGTGTGGGTATGGTACCCATGTTTTATTAAAAAGGATGGTTCCCGAGTGAGCTCCTG 1.54575587 0.081188 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.25468289 0.081234 1
77011 CAGGAATTCTTGGGGGACATATTTAAGATGTAAGCCATAATGAGATTACTCCTGTTTATT 0.83776727 0.081342 1
11431 TGAATGTATGTCAGAAAGGAACATGAATTCAACTGGGAAGTTATCAAATACAACTGAGAT -0.20131203 0.08143 1
217517 GAGACAAGTTAACAGCTGTTCTTTTGGTTCACTATTAGAGCAACTCAGATTTTGTCATTA -0.23767272 0.081442 1
17082 GCCATTGACTCCTTGTGTGTTTTCTTCATGTGTGTTTGAAGAGTTCTAGCTTATTAAAAA 0.61181906 0.081443 1
67429 AACCAATGATCCTATTTTAGGCTTTCAGGCAACAAATGAGAGATTATTTGTTCTCACTAC -0.2341913 0.081468 1
100715 AGATCTGAACAGTGTGCTGCCTTTGAGAGCTGCTACCCTGAAAAGATAACTGGTCTCTAA 0.23160716 0.081501 1
217698 GGAGAAGCCCCAGATTGTCTGCTACCCCAAAACAGGACACCACATTGAACCCCCTTACAT -0.24050641 0.081507 1
15558 AGAAACCGGGCTGCCATGTTGTTGATGGGTAGCATGGGAGTAAGTTGGTGACATATTGTT -0.3532337 0.081535 1
78317 CTGATATCTGAGCATTGTCTGGGACACGAGGGAAAGAAGAATAAAGCTGAAACCCCTTGA 0.62196052 0.081569 1
73336 GCAGTTTTGGAGAGGATAGATGTTAGATGTTGACTGAATAAACATGTCTCATGTGTTCTG -0.24402322 0.081577 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.756349 0.081636 1
56494 ACCTGGTGCAATGCAGAATTTGTGTGAGGGTTAATGTATCTTGAGCACACATTGTATTAA -0.17191267 0.081638 1
11911 TCTTCACGAAATCCAGCAGCAGTGTTGCTGTAACGGACAAAGATACCTTCGAGTTAAGCA -0.30481862 0.081658 1
207686 CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT -0.24758642 0.081665 1
54167 CTTCTCCATTGTAAAGGGATTCTGCTCCTGAACAGCCAATAAATATGCTTTGTGAGAGAA 1.16677835 0.081687 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.22457205 0.081694 1
81012 CTCCATCTTGATTGGTAAAATAAAGGCTTGAGCTTGTAATGGGCAGAGGAAGGGAATGTG -0.27993757 0.081698 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.23615558 0.081747 1
98752 CTGTTCGAGTGTAAATAAATGCATACAGGGTTATACCCAGAATTTCCCTATAACTATGTT 0.49844104 0.081786 1
110454 TATGAGTTATAGAAGCTCCAAGGTGGGAGTAGTGTGTGAAATACCATGTTTTGCCTTTAT 2.09803335 0.081799 1
654818 GTGTGGAACATTGTAAACAAAACAAGGCATAAAATGCAGTGATCCCTGCATAAAATATGT 0.52886517 0.081831 1
330301 GGGGGTCTAGTTAATATCAGCTCTACTCTTTTGTTCTTTCCAGATTATAATTCGGTTAAA -0.22830908 0.081838 1
73360 ATCTAGGTATTCATGATTTAGGAATCTCAAAAATGGTCTGCAACAGCATCATGAACTGTG -0.20811108 0.081844 1
630499 TCACACATCTCCTGTGACATCCAGAGACCTCAGTTCTCTTTAGTCAAGTGTCTGATGTTC 1.65790477 0.081879 1
228839 GAAGCAGCAAGAGCCAGCGCCACCTTTGCTACACACTCCGCTGCCTTTCGTCTCAGAAAA -0.19014956 0.081906 1
667666 CCAGGAAAGAAATCTTACATATATAGTGAAAGTGACAAATGCTTTACCCAACCTTCCCAT 0.27445348 0.081952 1
22589 ATTTTAAAGGGCCTGAATTTAGAAGCAGAAGTAAAATGAAAGCTGACAATCTCATAAAAC -0.23265483 0.081978 1
268902 CAAATCTGTTTGACCCATTTTGAATGAGTAAATCGGAAAGAACAGTCAAAAGGGAGAAAA -0.31574701 0.081983 1
14972 GCTGCAATAGTCACTGGAGCTGTGGTGGCTTTTGTGATGAAGATGAGAAGGAGAAACACA 1.68816258 0.082022 1
332110 TGGTCATGATCCTGAGCATGTGGAAGTTCGCAGGCAGAGCTCAGACCCCCTGTTCCAACT -0.24117496 0.082049 1
71146 ATTGCGTGAGTATACATGTCTATGTGTAAGTATGCATGTGTTTGTGTGTGTGTGTGGGGA -0.1810906 0.082118 1
12775 CAGCCACTGATACCTTTCCTCATGTTCTGCTTTTGATTCATATATCTTTTATGAAGAAAC 1.47840905 0.082141 1
21869 AGTTGGACTAAATGCCTAGTTTTTAGTAACCTGTACATTATGTTGTAAAAAGAACCCCAG -0.1663772 0.082243 1
192232 CCAGTTCCAGGTTTATGAAGCAGATTCCCAAAGGCTCAAAAATAAAATGACCAAAGTGAG 0.25888854 0.082246 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.92364273 0.082254 1
66801 GGAGTTTCAGCAGTCGTGAGCCCAGCTCATTCTGTGACCAGCCTCAGAAGAGAAATGGCT -0.14760389 0.082336 1
634650 CTGGAAACTACTTAAACATCCCTGAGTTAGATTGGCAACAAATTTTTATATGGCTTGATC 2.07480293 0.082345 1
259105 CGCGTCAATGTTTGGTATGGCTTGTCTGTCCTCCTCTCTACTGTAGTGCTCGATGCTCTG -0.22827412 0.082405 1
619517 CTGTACTCTGATGAAAAGTGAGTGGAAATGGTTTATGTTTCAAACAATGAAGCTTTGTAG 0.19308762 0.082426 1
12069 GTTTGTGATGTACTGTTGTAATATTTCTGGTGTCACTTGTTTCCCCATGGGGCTCCAACT -0.23411894 0.082446 1
433931 TGCATCGTGGATTTGAGTATTGAACTGCTTACATACAAGATTTTTCTGAGGTGGAAAAAA -0.16008345 0.082457 1
28000 GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT -0.19905704 0.082478 1
18386 GCAGGTTTGACAGAAAGGACCTTTATCCACCAACCCCAATTAAAAGAAATTATTTATTTG -0.24053141 0.08248 1
238871 GCGGAAGAGGAAAGCCAGCCTGAAACTTGCGTCCCAGATGACTGCTGTCCTGATACGTAA -0.22129915 0.082494 1
71088 AAGAACTTATACACTGGGAAGAGATCTGGGGCAAAGAAGACAAAGGAGTTGCAGTTGGTA 0.80058762 0.082497 1
100044874 TTTGTGATGAAGATGAGAAGGAACACAGGTGGAAAAGGAGTGAACTATGCTCTGGCTCCA 1.6689301 0.0825 1
545861 TTTAAAAGACACTGAGAAAATACACTCATTGCTGGCATGGTATTGACCAGCAGCCCTCTC -0.18173093 0.082506 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.90592032 0.082515 1
117600 AACTGGAGAGTTTGGCTTTTCTATGTTGTGTCGAATGTAATGATGTCTGGGACTAGCTAA -0.22907265 0.082521 1
19179 GCTGGCTTGATGGCCTTACGGGGACGCAGAATGAAAGTAACAAATGAAGACTACAAAAAA -0.16393267 0.082526 1
70750 AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC -0.16210658 0.082566 1
69368 ACCCCTCCTCCCATTGTTAGCTGCTTTGAAGACAGAATGACTCCTGTGGATTTATCCTAA 1.50888531 0.082577 1
68550 GAACTGGAAGCTTTCAGGTTGCTTCGAGGAAGGAAGTCCGTCAATATTGTAGAACACAGA -0.20213874 0.082626 1
382089 GAGGGGCTGGCCTGTGAAAATCAATCTAATTAGTTACTTCTGTTGACAATTTGAATTTTG -0.30266507 0.082642 1
83962 GCATGCCTTGTGCTTTACTGAACAACTGTAACTGAATGTAGTCATGGAAGGAACAAGATA -0.17179244 0.082711 1
18726 TGAGGCTTGGCAAAGCCATAGACAGACCCACCCTGCAGCTGGAAACTAATCTAAAGAGAA 0.41045091 0.082711 1
545047 AGGGAATCTTGGCCAATTATTGTAACAAGAATTTGAATGACAGGATCAACTTTGAGACAT 0.3826223 0.082746 1
14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG 1.77179866 0.082748 1
66403 GGTTCAGATCTGCTCTTTCTTTCAGTTTACAGAAATGCCGAACTTACAAGGGTAATTTAG -0.21163272 0.082789 1
381903 GCTGGTACTGACCATTGTTAGGATATAGTGCATAATTAGATTCTGTACCTAAGGAAATAT -0.25452379 0.082846 1
26877 GTATTTTGAGATCTTTTAGTTTAAGAGGTGCTACATAATGCCATGTATCATGCATGATGC -0.19276706 0.082853 1
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.1738102 0.082858 1
27386 GTCACATACATGGTTGTCTTTATGTAACTTAATTTTTTCATCCGCAGGTGCCATTTTCAT 0.21426793 0.082889 1
21959 GAACATGTCACTGCAGCAATTTCTATGCAACATGGATTAAAGCTTGTACCCTGGAAGACT 0.18743937 0.082896 1
100042869 GGGGCTGATTTAAATAACTAATAAGCTCAGAGAAATTTTACGAGGGGAACTTTTCCTTTT -0.17880595 0.08291 1
258347 CTGAGGAACAAGGACATCATGGCCGCTCTGAGAAAACTCCTTAGTAAGATACTAGTGTGA -0.19824529 0.082948 1
14204 CTCTTCAGGGCAGACAGACCACCTACACTAATAGCCCACAATAAAGTTATTTTTGTTAAA 1.00888553 0.082953 1
258933 CCAGAGCAGGCTCTTCTGTCACCACAGACCGCATCCTTAGTCTCTTCTACACAGTGGTCA -0.23466546 0.083 1
12511 AGCCAGGCTACAGTGGCCTGTCCTGAGTTCCAGAGATTAAACGATTACTGAGTGAAAACT 1.22755165 0.083048 1
12526 AGTAGGAAGTTTCTAAGCTTCACTTCTTCTCTCTCGTGGCTTATATATTTCTTCTCTCAC 0.29560136 0.08305 1
28042 TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA -0.22961386 0.083143 1
68236 GCGCCAACTGTCACCCAATGTTCGTCCTTAAGAGTTTTGTTCCCCAAAAACTTGTTTGTG -0.25966123 0.083221 1
54135 GTCGGGAAAGTTTAGTCGTCTGATCCCACGTTTTGTTATGTAGCTTTTATACTTTTTTAA 0.40967573 0.0833 1
70382 CTCCAGAGAACTAAATAATTCTACCAATGGCATCGTCATAGAGCCGAGCGAAAAGGCCAA -0.23431777 0.083317 1
269060 ATGAATATATCTGTATATAAAGTTTTCTGTATATTGTATAGAGCTGTGTATAAACTGAAT -0.31384648 0.083351 1
381308 GTCACCTCTAAATGACAGCTTTAGTAGTATATCCAACCATTGATTAATCTTCATACCTGA 1.41988135 0.083388 1
71835 GTGTTCACAAAAAGTGTTTGGGGTTCTTTGGTTTTGTTAATAAAAGACAGTTTTGTGGTG -0.18826502 0.083429 1
207213 TTACATCTTTCTTCCAAGAGCAACAAACAACAACGTCTAGTGTTGTGACCAATGACTTCT 0.2345356 0.08347 1
110948 GCTGTTGCAAAGGTTCATTTCTCAGACTTTGTAATATAAGGCTGTTCATCTCTCAGAACC 0.29420726 0.083483 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 1.04881392 0.083497 1
19419 CTGACCACTTGTGAAATTGTCTAAAGATGTATACTGTAAAAGCTTCGAAAGAACTGTACA -0.37319802 0.083517 1
20638 GAACTCCAAACAAGCAGAAAGGGAAGAGAAGCGAGTCCTTGGTCTGGTGTTGCTTCGAGG -0.20106074 0.083526 1
15024 TGGTACCAAAAGCCTTGGATTTGGATTGTTGCCACGGTTTTTTCCATTTTGCTCATTTGT 1.28438215 0.083532 1
71803 ACTAAACTTTCTGAACCAGAGATGTTCGGAAGCCCCAACCTCTTATGTACTATGGCAGGA 0.22922755 0.083567 1
16467 TGGTGGTTTGTAAGTTGTCTTTATCCAGCATCAGAAGATGAGAACCAAGATGGTGCCTGG -0.23660382 0.083674 1
67863 CATAGGGGGAGGTAGCTGCACAAAGAAGCTTATATCTCTGGAAAACAAACTGGAGTTTTA -0.17086278 0.08372 1
70357 TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA -0.16666658 0.083741 1
14284 GATTGCTGAGCTGCAGAAGGAGAAGGAGAAGCTAGAGTTCATGAAGGTGGCTCACGGCCC 0.20956306 0.083753 1
20482 TGCCAATGCATATAGTTTTATGATTAAAATTGCTGTGGTTGGTTGCATTACATGACACAC -0.17984536 0.083799 1
14999 TCCTTGTCACGAGGGCACCGTGTCTTAGGTGATCACTAAGAAATAAACTGGTGGACTTTT 1.63070835 0.083818 1
66234 AAATGTGATTTTTGTCCGATCCTTCTGGTTTTCATGAAGATTAGCTGCCATGTTTTATTC -0.38935683 0.083818 1
100033459 TGGTTTCTGCCAGTCTTTATGTATGCATCTTTTGTTTTGTGTCAGATTACTTCAATGTAC 0.26546758 0.083853 1
66932 CAGTGCCTGCATGCACCTTGTCATCTGGAAGATCCGAGAAGATGCCAAGACCAAGCGATG -0.22952477 0.083857 1
69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA 0.94720546 0.083879 1
76041 CAAGCGAACCCTTATCACATGTCCTCCAAGAAATGTCTTAATATTTGTGTTGACATTTTT -0.18636199 0.083906 1
277854 AAGCTCCACTCAGCCAGCTGAGAACAGCAGTGTTGCCATGACTCCCACCTATGTGGACAG -0.16144797 0.083907 1
18667 GAGATGAGATCAAGCTATATCCGCGAATTGATCAAGGCAATTGGTTTAAGACAGAAAGGG -0.23583845 0.083967 1
319352 CTTCTTGTGGTGATAATCTTGTGGGATGTAAGTTTCAAAATTTTCAAATAAAGCCTTTGC -0.34087386 0.083967 1
16773 CCTGACCACCAACATTAGGTTCCGAGGCTGCATCCGATCTCTGAAGCTCACCAAAGGCAC 0.46638864 0.08399 1
73254 GACATTGATAATTCAAGGGTGGAACTGAAGAGTTTAGAAAAACTGATAACCCAGATACCA 0.24793915 0.083992 1
18173 CCGGTTTCCAGTTTGGACAAGTGCTTTACCTCGGAATAATGACACCATTCTTATCACCAC 0.95441172 0.084005 1
327766 CAAAGATGTTTATTCAGGAAACTTCCTAAATTGGAGGCAACCATTAGACAATCAGTTGGG 0.26800294 0.084023 1
15115 CTGCTGGAGGAGAGACTGAAGCTTGTCTCAGAGTTATGGGATGCTGGGATCAAGGCTGAG -0.17418721 0.084096 1
75778 ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT 0.25885942 0.084105 1
74249 GTGCTTAAGGACAAAGTCTAGAAACTACTACCATCATCACTGTTAAGAAAGATAACATTC 0.20144884 0.084157 1
69556 ATCATTTCCCAAGTGGTAGACCCCAAACTAAACCACATCTTCAGGCCACAGATAGAGAGA -0.19566769 0.084161 1
240239 CTTGAAAGGCCTATGGAAATGGATGATAACCAGAAAGCCAGCAGTTACTTCAGAGGTTCA -0.27911121 0.084182 1
107869 ATCAATGACACACTGATACGACTTTCTGTGGGCCTAGAGGATGAACAGGACCTTCTTGAA -0.20325885 0.084191 1
100042510 ACATATTTGTTTCCCCGAGTCTATTGATCTCCATGGATTGTGCAGAAATGCATTCTAAGC -0.33747886 0.084205 1
108062 TGGTTGGTTGGTTTGTTTGCTGTTATTTTTTACTGTTGTAATAATACAGTTAGCTACCCC -0.19056241 0.084225 1
619548 CCAGATGGCATTTTGTAAGAAGCTTTGCAATAAATGGCACCCCGTGGTCTTCCTTGTCTT 0.31605459 0.084243 1
14077 TAAAACTGTATCCAAAGGGTGCTCCAAGGTCAATAAAGCAGAACCAAGGCCACCCAAAAA -0.20947093 0.0843 1
100038947 CAGAAGTTCTATCCTCGAAGGTTTCAGGTGACCTGGTTAGAGAATGGAAATATATCCCGG 0.87698865 0.084308 1
15896 GCAGCAGATGCGGGGGACATTTCCTCTCCTTTTTAGCCTCAATACAAATATCTGGATTTC 0.46822186 0.084315 1
66643 GCCCTATTCCAATGTCCTAAAAAGGTGATGGTGTGTAGTGTTAGATGATTTCATTTTAAA -0.18723261 0.084359 1
381511 CTCACCCATGATTTCCTCAGTGTAACAGTAATATTTTGTTTTGCTACACCTAAAAGACAA -0.30104922 0.084419 1
67367 AATTTTTGCCGATATCTTGTACATTTAGCAGATACAATTTACAGGAACAGTATTGGGTGC 0.34867134 0.084447 1
233410 ATATTGGGGTATTTGTATTTTTGTTCCTGTGCCATTAGAGCTGCTGCTGCCTCAGGAAGG -0.18534448 0.084456 1
78890 AGGGCTATTGGACAGTTTTTCCTTTCAGGAAAAATCATTTCCATTTAAATTTGTTTTCAG -0.18388221 0.084465 1
13909 GGTATGCCTTCCAGGAATTGCTGGGTGATATCTCGTTCATCATTCCTACCTTGAACTTCT -0.29479366 0.084496 1
71876 GTCATCACCAGGCATAAGCTTTTTAACTACAATAAACTTTAATGATGTCAGTGCAAATGC -0.21010535 0.084618 1
12626 GATCCACATGAGGAGATACTGAAAGCATTTAAACTATTTGACGATGACGATTCAGGAAAG -0.16236843 0.084678 1
320522 CTGCTGCTGAACTGAGAGAAGCCCAGAAAATGATCAAATAAAAAGGAAACATGTCTTCTC -0.28820055 0.084751 1
100039861 TAAACTATTCTATCAAACCCGTTTCTCTGTATTGCTTTGAATGTGGTTTGCACTAAATTA -0.30579498 0.084756 1
627178 CAAGCTTGTAAACACAAAGTACTCACAATTATCACTCAGGAATTACTTCACAACTTACTG 0.27678764 0.084776 1
234129 GAAGTACAAATCATAATGTGGCAGGAGACTGTTTTTTCCTTTTGTAATTCCAGGAATTGT -0.1731957 0.084881 1
258904 TTGGTGTTTGCCAATAGTGGTTCTATCTGCATCATTATCTTCTCCTTGCTTCTTGTCTCC 0.239336 0.084891 1
223254 TGACTAGTGTCAGAGATTCACATGGATAAGGAGTAAGATGTATCAATCATTTGCCTTACA 0.20586561 0.084924 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.18975691 0.084974 1
68298 CCCCACCCTTGTAGAAGTGCTTGTTGTCTGTGGTTTTAACATGGAAATGGCCTTTGCATT 0.15808821 0.084991 1
18045 CACCACCTTTTTGACAGGTATTTGAGAATACCACTGATACACAATACAGTATTTCATGAC -0.28266918 0.085029 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.56085393 0.085066 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.58269059 0.08517 1
72121 GAACTTTGAAAGCTCACATCCAAACTCAGAACTGTACTCAAAGCTGCATTTTTTGGCAGA 0.53455122 0.085205 1
69902 CTTTGTTTCTATAAAGAATAAAATTGTGTCCGCAGGGTGTTCCCGGGAGACAGCAAAAAA -0.19203476 0.085224 1
14469 GTTTCTCCTGTATAATCTTAAGTGTTCCTCTTTCCTACAGATAGCTTCTGTAATCACAGA 1.95142912 0.085249 1
320415 CCGAGGACGAGGACAGTCCCTGGATCCTACACAGCTAATCCAAGCCAATAAAGGGCTCTC 0.46467678 0.085261 1
235180 GTCCTGCTACAAGAGATGCAGGCCTTGACACAGACCTTCAACGACAACTGGTCCTATGAA -0.16375789 0.085299 1
74238 TACTGAGATTGAGTTGTGTTCAAGTTACCTCTTAATTGGTAGTTTCTGACTCATTTGCTG -0.22884722 0.085308 1
94109 TACCTTCCAAGAGTAACCAGAGACTTTATCCAGCCTAGAATCCTTCTCCTGGAGATTGGA -0.19957279 0.085402 1
21869 AGTTGGACTAAATGCCTAGTTTTTAGTAACCTGTACATTATGTTGTAAAAAGAACCCCAG -0.25890579 0.085436 1
13798 CTGCTTACGACCGTGTATATATTTAATTTCAGGTAAGGAAAACAAATATGTGTAGCGATC -0.17600278 0.085464 1
100043801 AATCATTGCATCAGATGTGGGGGAGTAGTTACAGGCACACTGTACAACAGAAAAGACTAG 0.23457257 0.085487 1
245610 CCTGCTACTGTAGGCTATATAGTTTCATACGTTGAACATCCTTTCTAACCCTGTTAAAAC 0.20038699 0.085501 1
20287 TCTCTAGGACCCTGGCTGGAGTAGGGATTGGTTGTCCTTGGCATCAATAAAAAAGGAATT 1.09544629 0.085558 1
66882 TGCTTTTCTTTTTGCTATCCATTTATAGTTAGTAGTGGAAGATGTAGCCACCTTTTTTGG -0.19877771 0.085571 1
16779 GCCCTGAAACTGAAACGGGCAGGAAATAGCCTGGCAGCATCTACAGCGGAAGAAACAGCA 0.25108587 0.085591 1
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.79647927 0.085597 1
71904 TCACTGTTTCCTGGGGCTCCAGGCTTTAGAACCGTTAGGAATTGTCAAGGAAAACTCAAA -0.15962975 0.085619 1
622708 CTACTGAGTGATTGAGGGTGTCTAAATGCTTGAGATCCTGACAGTCAAACGATGCACAGA 0.15229961 0.085619 1
320139 GCTCCTGGATGTGCTAAGTGACACAAGTCCTCCATGAAAACCCCGAGGAGTTGGAGGAGT 0.84909222 0.085654 1
100042480 TACCAGTTCCCACTGTTGATTATCTACTTCCTTGAAGAGGCCTTGATGGCCCTTTGTGAA -0.2753216 0.085683 1
14711 AGGCACTGGCAGAGATGGCTCTCCTGGCTTCAGTAAGTTCCGGCTCTCTTACTACCCACA -0.2265674 0.085697 1
18596 CCACATTTAGACACCGGAAGTGCTATTTTATATGCTGTTAAGTTTTCCTATCTGTACTTT 0.17246881 0.085698 1
12337 AAGCCTTGAAGACTGGACAAGGGAGGACAGGGTGGAGCAGGGATAGCCGTGGCTTCATTT 0.20835027 0.085703 1
18619 GCTATGTTGTTATCAATAGTTTGTTACCTCATCTCTCCTGACGAAACATCAATAAATGCT -0.27394748 0.085738 1
69641 AGGATATACAAAGGGACGCAGCCCACTTGCCATGACTTCAACCTCCTCACAGCTACAGCA -0.18377744 0.08579 1
69743 CGGTGACTTTGTATCATAAAGTGTGTGGCTTCCTGTTCTCAATAAAAAGTAATAAATTGG 0.24456359 0.085831 1
16988 CCTGGGTGCGTGCTCAGTCACACTATGGTCATCTAGTAAAGTCTGGTTCCCCACTTCTGC 0.81550977 0.085853 1
170740 CATAACCTGTGATTCTTCAACTCTTCGTATATTTCAAGTATGTTTTATTGAGGCCTTAGG -0.1662908 0.085881 1
56495 AATATCATCGAGCAGCGTAGCCTTAAGTGGATCTTTGTCGGGGGCAAGGGTGGCGTTGGT -0.27617601 0.08589 1
321007 CTACAGTTAAACATTGGTTTAAAAATAAGGCTATTCCAACTGTTGTCCTGTTCCCCACCC 0.35021106 0.08589 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.31541969 0.085923 1
106389 TTTTAAAAAATAGAGGTGCACAATGCTCTGGCCACTCCTCGAACCTGTGTGTCTGCCAAT 0.23363587 0.08601 1
80861 GGAAGATGAACGCAGGAGAATTATTATGCCATGATGTTCTAAGAACTACAACATCCCTCC 0.6886545 0.086043 1
113850 ATCTCCTACTCAAGAACTATTATTACAGGGAAATCCACTGCCCTATTGTGTCCAGATTCT -0.15678797 0.086077 1
68870 CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT -0.25785782 0.086078 1
21946 ATCCAAAGCTGGGAACACTACCGAGAGTGAGAGACCTTGAGACCTAGTGAGAATCCCCCC 0.3778367 0.086106 1
76484 CTGTTTTGGGACTTTTCTATAAGGATTATGTTCTGTTGATCAACGCCTACATTTTCAGAT 0.21730818 0.086158 1
97820 CATGGGCAGCATCCCCTGGAAGCCAGTGATTCCAGAGCGCAAGTATCAGCATCTTGACAA -0.20293588 0.086245 1
268451 ACTTGGTAACTTTTGTACAGGATTTTGTTACAATCTTAAGCATAGGGACCACTTAATCCC -0.23619891 0.086281 1
74387 GAGGAACCACAGCAATTACTAAATTGTTCACCATTACATAAAGAAAAGTTCCCCTGTAAT 0.23854881 0.086345 1
109910 AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC -0.21124657 0.086381 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.3421381 0.086419 1
16638 TCTGTATTTGTGGTAAGAGACTGGATAAATTTCCTCATTGACTCTCCAATGAGTGTAAAA 0.83735486 0.086444 1
73229 CAGAAAATCCATACTTCTGAAGAACACTGTAGTTGTCCAGAATGTGGCAGGGAATTTCAT -0.18108748 0.086455 1
15201 GAGAGAAGGTCATTAGTGACGAAGATCTAGAATTACTGTTGGATCGAAGTGATCTCATTG 0.36891193 0.086483 1
67876 CTTTGTGCTGATTGTGTGTCAAAATTTTGTCTGCCACTGTAGGCAACAGATAAGTAAGTA -0.25177041 0.086498 1
11752 GTATACCGCCCACCCTAGCATTACCTCTGAGCAAACGGAAACATCAACATGAAGAAAGAA -0.2315564 0.086656 1
30049 TTCAGGGTAGGTGTCTCAAGCCAAATCCAACCAGCTCTTCCTGGATGTTCTCTGTTAATT -0.27416887 0.086659 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.16459739 0.086699 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.54717752 0.086729 1
28040 CTCAGTCCCTTTATGAAATAATAGCTCTTCTTTCTACTTATATGTCCTATCAGGGAATGA -0.21514564 0.086739 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.39298208 0.086747 1
93892 TAGCAATTTGTTGACTCTCATCATGGTTCCTGATGTACACTGGTTCTTTTTAAACATTCT -0.22374466 0.086755 1
15019 GACATGGACATCTACACTAGGCTGGTTCCCCCAGTTTCTAGAACTTTCCAAAGAATACAG 2.11938916 0.0869 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.35176188 0.086954 1
71586 TATTGACACCCTTCAGGGTTTTAAATACACCTACGCATTATAGCAGCTGTTTTGTATGCC 0.320976 0.08696 1
232798 CATTACCTACTTACCCCATAGCTGTGTGTAGACTTTATTAAAATCTGGGTTTTTGCTTTT -0.18283096 0.086968 1
100529082 TTTGGAGCTGTGATCATCATTGGAGCTGTGGTGGCTTTTATGATGAAGAGGAGAAACACA 1.63680516 0.08708 1
23833 GGGAAGGGTTGATAGCAGATATCCAAGGAGGCTAAAGTTGACAGCCAATGGCCGGAATGG 1.61952241 0.087106 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.1729421 0.087106 1
14941 CCTACATGGCATTCGTTATGTCTGTGGATATTAAGGGGAACAGGATATACTGTGGAGGCT -0.19983398 0.08712 1
66225 CTAAAATAGTCTTAAAAAGGCCATCAGTGGATCTTACCAGTAGTACTTACTTGAAGTGTT -0.15091995 0.08716 1
433759 GTGGAGGTTGATAGCCTAGCTTCCTTTTTGAGATATTTTCATTTTGTGAAACTCTTTGTA 0.30908247 0.087203 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.28218933 0.087213 1
211147 GAATGGCAAAACCATAGCACTTCTAACTGTACATCCACGAACTTTTTAAAATCTATGCTT -0.21538652 0.087251 1
380959 CTTGGAAGAGGAATTTCTGGTTTCATAGACATCTCTGTTTGTCCTGTTACAAGATGCCCA -0.15809321 0.087273 1
20312 TCCCAGAGCAGAATGTGGGCCGTAACAATCTGAGGAGGACTTTAAAAGTTGTTGATCCTT -0.25385297 0.087376 1
76898 TGACCTGGAGCCCAAGGCAGCAAACTGTACCAAGATCTTGGTCTGGCATACACGAACAGA -0.30164378 0.087379 1
58180 ACCACGCATCACATTGATTTGAGTTTACTTCCCTAAAGAGTTTGGATGGATGCATTCAGG -0.21768128 0.087496 1
68922 TTCTCCATGGCCCTCAGCCTCCATTATACCCTCTTTGCACAAATAAAGGCCAGCTGGACA -0.22763725 0.087498 1
21745 GACACACAAGGAAACTTGTATTTTCTATCTTGGGAATGAAGATGCAGTACTCAGGACAAA 0.65861198 0.087597 1
68260 AAGGACGTTGGGGGTATTCTGCATATCCACCAAAATGTGGAGTCTTTCTCAGGAAAGACT -0.18767233 0.087633 1
100039319 TTGGCTGTCTACAGCAATATGGAGCTAAGTGATGTGTTCCAATTCATCACCATCTCCCAG -0.16695991 0.087671 1
12299 TATGATTGACAGCGAGGACACGGTCTGGATAGAGCACTACTATTCGTGGTCTTTCGCCTG -0.37268884 0.087706 1
100504710 CCTATTTGTCCAGACTAAGGAAATCTCCAATGATAAACTTAAAGTATAGCCTCACTTCTC -0.21600818 0.087724 1
193043 CATCAGTGTAATGAGTGTGCAAGAACCTTCTGGGATAATTCTGAGCTGTTGCTTCACCAG -0.25757675 0.087807 1
30945 GCAGACTAACCTCATAGTGGTCAAGTACTCCACCTTAGGTGTTTCCTCTAAGTGTTACCA -0.18395259 0.087913 1
54326 GGGAGGCAGAAGCCATTTTTCTTTTAGATGAAAAGCATTCTGTGTGATTGTTGTATAATA -0.16929186 0.087944 1
70750 AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC -0.16049211 0.087957 1
320747 ATTCCTACACAGAACTCTCCTATTTCACATTGTCCGCGGTTCCCAGTGTTGTGTATTCCA 0.25270157 0.087972 1
231932 ACCTTCGTGAGGAAGCAGAGAAGAACATATTCAACCAGATTATTGAAGAAGTTAAGAAAG 0.52241878 0.088 1
67946 GGAAATACATTTTGATGCAAACAGAATAATGAAGCAGCCTGTGTTAGTAAGCATGTAGAA 0.26459071 0.088061 1
54189 GCAGTGTTCAGCTAGCAGAGAGGTGTAGTGTGCTATATGAGTATTTTATATTAAAATATG -0.17328128 0.088083 1
21350 CCCTTAGTTTGACACACTTGGTACTGACTCTTTTAATTCAGCCCAAATTCATGCTGACTT -0.54305836 0.088135 1
432939 CCGCTGAGCATGTTATTCTCACAGCACCTTTAAAAGAAGTTTGTTTTCCCAAATTGAGAT -0.22842119 0.088143 1
72180 CTCTGTGTCTTACAGCGTGCCTTGCAAATATTAGGTGATCAATAAATGTTTATCTAAATG -0.29146558 0.088175 1
331188 AAGTAAAGGTAATCTTCAAACGCACCAAAGAACTCACACAGGAGAGAAACCTTATTGCTG -0.18809915 0.088199 1
68017 TGTGGACATCCTGCATCCCGGAGGGACACTGCTGTGTAAAACCTGGGCCGGAAGTAAAAG -0.2063336 0.088199 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.55179406 0.088201 1
12925 TACCCCCGGACAGCAGGGCTCTCGGGAACCCTCAGTGCCTTTAATAAACCTGATCTTTGG 0.5262674 0.088211 1
12549 GCTCTTGGAATATGAAAAGACCTAACCAAGACCAAGACCTCGCTATGAAATACTAGCTTA 0.22744707 0.088245 1
210108 GTGAGCACAGACATTCCCAAGCTCTGAAATATGCTCCTAATGAGGGGAAAGTGGTCGGTC -0.31678079 0.088252 1
258910 CTCTCTACATGTACTTCTCATATTATAGTGGTTGTGCTGTTCTTTGGACCCTGCATTTTC -0.18492802 0.08826 1
68662 GTTGAGGGGAACCTGGGAAAATTCTGCCTGACGAGATGCCTGACGAGATATTTTTCTTTA 0.54201411 0.088306 1
77781 GTATTTCTGGAAGTAACTCTAGCTGCATGGCAGTTTTTTCTTTCCTTTTTCCGTTTTAAA -0.29759371 0.088318 1
227929 GACTCTCATTATTTTCGCCCATTTCAATTTTTATTTTCTGCCTGAACATTCATGCCAAGG 1.43355437 0.08836 1
72792 AGCCTAACCCTATTCCCTCTCAGTCTCAAGTAGAAACTGTGAAGTCGAAAGAGACAGTGT 0.30653563 0.08837 1
22342 CCAGGGTCGTGGAACTACCGAAGACTGATGAGGGTTTGGGCTTCAACATCATGGGTGGCA -0.23596787 0.088377 1
22038 TAACTCCCTGAGAGTTCTTGAGGTTTAAGGACGACAACTTTATGGACCCTGAATGGAAAC 0.51254615 0.08838 1
60533 TTGATGAGTCTCATGTTAATGTCTTGTTTGTATGAAGTTTAAGAAAATATCGGGTTGGGC 1.7981263 0.088415 1
85031 TCTAACGCTTTACATAAATGCCCTTTTAGCTTCTCTATTTCGACACAACTGTGATTACCT 0.60550139 0.088423 1
402757 TCTGTCTGAAGGACTTTCTACTACTGTTGCCTTTGCCGTAGCAAAAACAGATTATTTTTT -0.26636132 0.088442 1
69792 ACAGCGTGTGGATGCTTTACTCATAGACCTTAGACAGAAATTTCCACCCAGATTTGTTCA -0.15123522 0.088456 1
74901 GTTGGGCCAGCTGTTTCTGGGTGTGCAGTTAAAGTGCTGACGCTTGAGTTTCCCCCTAGG -0.23746048 0.088471 1
234723 TTCTAAGAGTCAGATCCCTAATGCTACTGAAGTCCTAGGTGAACAATAAATGTTCCTCCA -0.17432715 0.08849 1
246730 TGTCCACCTGTTGGAAGGTTCTGTCTGACAAAGTCTGATCAACAATAAACCACAGCAGGT 1.71431503 0.088493 1
239134 AAATGCAGAAGTTCAAAATGTGGTCCTTTCCATATCTTCCTCAGGACCCCTTTGAGAATA -0.37220962 0.088555 1
218506 CAAGGATGGCTCTATGCCAAGACACTGTCTGCCCATCTAGATGTCAAGGGCCCTGAACTA -0.190153 0.088559 1
194227 CCATGATACCTGTGTGGCCCTTCCCATACCTTTCTTTAGGAAAGCAGATAAATAATTGCA 0.39648502 0.088575 1
242864 ATGTAAGTTCCACTCGTGAAGTACACCAAATCTCTCTCACACAACCACCCTATTGAATGG -0.1911151 0.088593 1
94190 CTGGCCTTGTAGGGTTCAGTGTCTGGGAACCTATAAAATAAGGAACACATGTCTTAGGCA 0.20412254 0.0886 1
216963 TGTCAGAACGTGTGTCATGTACATTTGTATCAAAAATAAATAAGTGACCATGTGCCACTT -0.27728183 0.088704 1
17933 CCAGAAAATAAAGCCCTACTGGAAAATATAAAGCAGGCTGTGAGAGGAATTCAGGTCTGA -0.27841845 0.088717 1
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 1.19584945 0.088718 1
11859 GTCGGGGAACGGAACAAAATGGTTTTCCTTTTCCTTTATTTTTTCTTTGAAAAACGTGTA -0.22743386 0.088758 1
12235 AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA 0.20622088 0.088763 1
67115 CAGGGGGTACCATGACAGTACAACAGTGTCGTTAACCCTAACAAATAAATTTCCCACCAA -0.19659696 0.088773 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.92975828 0.088803 1
68487 TATTTTGTTCAGTGCCTGTATATCAGAAAACCTACGTGGCAATGAGTTCTTCATTCTGTG 1.8086569 0.088827 1
67030 GAGAAAACCTTGAATGGAACCTACCTGTGAAGAGATGGAATGCTTAAAAGTTGTTTAAAA -0.22727583 0.08888 1
546272 CGTGAAGTGATTACAAAGTTAAATAGGAGGTATACCTTCAGAGTCAAAATAGAACTCCTT 0.23442159 0.088897 1
14261 GATCTAACTGGCTTTTCAAATGTATGGAGTATAACGTTCCAACTCCTCTAATGTAACAAC 0.226301 0.088939 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.58444657 0.088981 1
259026 CTTCATCTACAGCCTGAGTAATAGAGACATAAAAGATGCACTAGAAAAGATAATGTGCAA -0.1723578 0.088989 1
433759 TGTTAAACTTTTTAGGAGGGGTCTGGGTCTCCTAGGACCCCTTTTCAGGCTTGGGTAATA 0.60618507 0.088993 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.24704083 0.089018 1
217700 TGTGCTGATATTGTAGTTCTACACGGTCATGCCTAGTGCTATGCCTTGCCAAGGACAAAA -0.17677378 0.089056 1
16010 GAGAAGAGAAACCTCATTCTTGGAGTGAGAGAGAAAGAAAGTGGTGAACATTGAACGCCC -0.44926113 0.089062 1
675812 ACTCAAAAGAGTTTATACAGAGATGTGATGTTGGAGAACTGCAGCAGCCTTGTCTTCTTG -0.7905509 0.089109 1
100038948 GAAACAAACCTAGTTGGCTACCAGTCATTTTTGAATGCTGGAGAGTCCTATCCTTATTCT -0.20787317 0.089165 1
67490 TAATGCCCCTAACTGACTTTTGTTACATAGTATTTTCCCCAAAGTAGGTGAGTGATCACA -0.17747096 0.089181 1
54519 CAATATACCCTAGGGACATGTTAGTATTTGGGATGCTCTCTATTAAAATTCATGTTTTGG 0.56011938 0.089224 1
67872 TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG -0.15620831 0.089231 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.14976111 0.08927 1
53975 CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG -0.15528732 0.089319 1
74264 TGGATGAGGAAACCCAATTTCAGATCGCCATTGAAGAGTCCTTCCACGTCAACATCTAGA -0.23869892 0.089332 1
208768 CTTCATCAGCGTTTGCTAAGTTGTCAGTTGTATATTAATTCAGTGACTTTATATGTCTGG -0.16816898 0.08934 1
321008 GAGGGAAGGGAACTAAGTGAACAGCTGTACTTTTAGATTGAAATAAACAGCATTATTTTG -0.21165905 0.089341 1
23859 GTATTGTGTGGCTGAGTACAATCCAATTGAACCACAAACCATTGGTTTTGTAGTAATATA -0.23635762 0.089411 1
76742 CTGTTTTGAATATGCGCGAGGAGAGAAGAAGCCTCGATGGGTTAAAATCTTCACACCATA -0.25202617 0.089433 1
68310 GAACCTGAAAGACTGGGGGGAATTGTCGAAAAGTTCATTAGTCAAATGAAAGATACGTGA -0.25143895 0.089453 1
107766 CTGTCCCCATGTGCCCAGCAGCCTGACACTAAGAAATCTCTCAATAAAGGCATCCTGCTG 0.28924272 0.089457 1
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 1.17985124 0.089478 1
57785 TGGATGTAAACCTAAGACACCTCCTCTGCAGAAATAAACTTGCTTTATGAAGAACAAAAA -0.19882502 0.089483 1
320438 GCGCTATCATTCTTTCTGTTTTCTTTCCAAGTACATGAAAAGTCCATTCTCTTGGTATCA -0.23432385 0.089504 1
320923 TCTGTCCCTTTGACCAATGTTTTGTCCCACCTCCACATAACTGGAAGAGCATCTAATCTT 0.30877267 0.089533 1
67862 TGGGTCCTGGGTTACCAGTCTAGTGGTTCTAAGAGGGTAGTGCTCTTGCCTTGTCCCCCT -0.15619568 0.089539 1
102626 GCTGGGAAACCTTAGATCTTATCAATTACAATGCTGCTGGGTTTTATATTCTGATATCAA 0.67557296 0.089585 1
56417 AAGTCCCCACCTCCCTTTTCTCAAGGGAAGAGGCCAAGATTAAAGGAAATGGAAATGCTA 0.36280439 0.089662 1
56429 TATAACTTGAGCTTCAGATTCAGCTTCGTGAACTTGGAGAGAAAGAAGGAGCTTGAGAGA 0.27614985 0.089726 1
53970 CACCACTGTGTGCTCTTTGTAGGCATAATATTAACTACTGGTTCAAGTTACTTAATAACT -0.29430999 0.089784 1
108699 TCCTCCACTGTCTTGCAATTCATTTGTTGAAAAATACCAATACTGATTTGGAATTTTCCC -0.28249681 0.089821 1
171199 TCCTTCACCTCAACCCTGTCATGGATGTATGTACCCGTTGTACTGACTGTTCAGAAATTG 0.27616823 0.08983 1
50934 TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT -0.34095833 0.08989 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.33450585 0.089892 1
630322 ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT 0.36289424 0.089896 1
11796 ACAGATAATGCCCAGCTAATAGAACAGGGTCTGAAGGAGAACGTGAAGAGACAACTGTCT 0.48210431 0.089914 1
75712 AGTACACAGCAGGCCTGTCCATCAGCGTGACTGTCCCTCTGTCTTCCTCTTCCTGTGACT -0.19735114 0.089976 1
13058 TTTCCTTGTCTTTATTTTTCTTGCAGACAATAGATCCAGACTGCAGACTGGCCCCTCTCC 0.99668391 0.089983 1
70866 AGGTCAATATATTGATGCTGTTTCTGGAACATGTAATACCAGATGCCTTACATTGCCTTT 0.2133547 0.090058 1
21803 ACTGCCCATCGTCTACTACGTGGGTCGCAAGCCCAAGGTGGAGCAGTTGTCCAACATGAT 0.52336451 0.090223 1
16408 TGGGGAAGAGACCAAAGATATGGGCTGTCTAGAGCCCCTCCGGGAGAGTGACAAGGACTA 0.8810562 0.090237 1
23945 TATGATGAGCTGGCTCATATGTTGAAGGGGCTGGACATGCTGGTATTTGCCCATGACCAT -0.17382405 0.090268 1
77015 TGGAATGTGAGGGACGGTCTACAAACTGCCATTTTTCTAATTATAAACTCACATTCTCTG -0.26538249 0.090292 1
71834 TGAGCAGAATACAACTGAGGCTAACTAAAAATAGGGTCTGGCCCTTGAGTGGCATGCATA -0.15906865 0.090301 1
242406 AACAGGTGCCTGTAGACACCTTCAGCTGGGACCTCCCCATCAAAGTGCTTCCTACAAGCC -0.16962757 0.090306 1
14238 TTTTATGATCTTCGTATACTCACACTTCGCTTGTATTGTAAAAGGAGGGTATATTTGCAC 0.22259721 0.090324 1
239096 TGATGGTACTGGAGGAGGAGGACGTCCGCGAGAACATCATCACCTATGATGACGAGGGTG -0.17352821 0.090325 1
257996 AGGAATAAGGATGTCCATCTTGCACTGAGAAAAACATTGATGAAACTGAGGTTTTCCTAA 0.54182713 0.090325 1
108995 CCAGCCCCAGGCATGTATCCTCTATTGCTGTGCTATGTGACAATGCTGTTTCCAGCAAGG 0.86222119 0.090342 1
17252 AAATCTGGCAGTCTGAAGCTTTGGCTTCTGAGACACTTTTCTATGTCCAGACCACTGAAG -0.15307615 0.090372 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.34243507 0.09039 1
207781 CTTGGTTGTTTTTCCCAATAATCTTGTCTTTGAAAGGAACAAAACAATCTGTGTGTATGG 0.34546691 0.090392 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.98915713 0.090407 1
20708 CCTTCATCCTCTCTGCAGCAATACTGGGATCTCAATTTTTTGGTTACTTAGTAATTTATT 0.85098173 0.090422 1
243262 CCTGTCCACCTGTTGGGAGGTTCTGTCCAATGTCTGATGCACAATAATAAATCACAGAGA 1.59136973 0.090439 1
70450 CACCTGCCACCTAGAAATGTTCTCAGAGAAAATAAAAATAAAACATTATCCACTGCCCTC 0.59102406 0.090441 1
67145 CCCTCGGGCTCCTTTGTTTTGTTTTGTTTTGTTAATATGTTGGAGTTAATTGAACTGATT -0.21863135 0.090489 1
19951 CGCAGCGAAGAAAATGAGTAGATGGCTTGTGTGCATGTTTTATGTTTAAATAAAATCACA 0.25869279 0.090492 1
107527 TTCACAGAGCAGTCACAGTGTGCCAAGACCAAGTTCTGGAAGAAAGTGAGATACCATATG 0.19552399 0.090539 1
331195 GGGACAGATTAACTAGATCCTTTGTCATGGACTTGTAAACTTTTTGTTCTTCACTGTAAT 0.4100747 0.090556 1
16498 TTCACTGGATACTGTCCGACAACGGATGCCAGGGGATGGCATCAGTTAGGGGGACATCCA -0.35581972 0.090637 1
270163 GTAGTTTCCATAAGTTATAATGTCAGAAGCATCATGTACTAGCAATTGTGGGACTAGAAC -0.19178803 0.090648 1
12283 CTCCTGAGGAAAAGTGAATTTCTTATCAGAATATCTGGCTGGCCCTGTAATTTAAATTAA -0.20320658 0.090649 1
241520 TTTGGAATGCCGAAAATGAATAGACTGTGGAGACAAAGGGAAATGGATATTCTGTATAAT -0.23919768 0.090683 1
170829 AGAAGCCTTGGCATCAAAGGGGGAGTTCCTCTCTACCTTCTAGTCTTTCTCTTCTTTCAT 0.43355333 0.090711 1
382864 TTCCGGGGCTTCTGGGTGGGCAAACAAGGAATAAAGGTGATTCTTGGCTGTGGCCCACTC 0.3375588 0.090715 1
73910 CTTTCAGAGTAAGTCTTCAGGGTATGACAATCATTTATGTGAACAAGCTTTTGTCGGTGT 0.37419203 0.090716 1
276920 CCTGGAGAAGGTGGTGGAGAACTCTGAGTTTGAAGAGATCCACGAGGTGATTGCCCGCTA -0.18529386 0.090753 1
67433 TAATTCCACCTTCAGATAAAGCTCTTGTCCGTAGCTATTTACCATGTCTTTCTGCTGTAT -0.2000654 0.090783 1
15182 TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC -0.24479894 0.090824 1
69934 AACACTCCTCTTTATCCAAAACCTGAGCTCGTAGGTTTTTAAGATTGTGGGAATTCTGTT -0.18602835 0.090864 1
12870 TCTGATGTCTTTGACCTTTTCCCTGGAACATACCAAACCCTAGAAATGTTTCCCCAAACA 1.03416612 0.090871 1
107526 GACTAGACCTTATTTCTATTTTCTGCATTTCCCTTGATAACCCTGCCCTATAGTGCTCAC 0.3979042 0.090949 1
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.2028744 0.090987 1
277854 CCATTAGGGTCCTTTTCCTTCACCAGCAGTGGGATATTCGGAACAGAACCTCCTGCTTTC -0.2167096 0.091016 1
98878 CGGGAGGTCTTGACTTTCCTCCTAGTTGTCTTCTGCTTTCTCTGCACAGTTGTCATATAT 0.56301835 0.091017 1
101148 ACTTGGTTAGCAGGAACTATCCAGGGATGTTGTATATTCCTCAAGATTTCAACAGTGTAG -0.1623548 0.091083 1
15000 TAATTTCAAATATCCTCAACGAACAGGAGAGCCTTATTCATCGCTTGCAAAACGGGCTTC 0.99640037 0.091093 1
67775 CTTTCCTGGACATGCTCTGAAAATAGCCTAAACCATGGCCCACACATAATGGACCCAATA 1.47158374 0.091153 1
246196 CCTGTGTACACTGTCTGACAGTGAAAGTGACCTAACAGCTCAAGAGCAAACGGAAAATGT -0.18550214 0.091196 1
16985 TCTTGGGTCCTGCCCTGTTTACGGATCCCTCATTTTGTGTAATAAAGTGCATTGAGTGTC 1.07989296 0.091212 1
76406 AAATACAGTCACATAGAGCCCCCACTGGGCAGACAACGTTTCTTCTCTACTCAGAATCAA -0.35696199 0.091264 1
76022 TTTGATGACCTCACCCAAGATGAAGAAGATGAACTGTCATCAGCTTCTGAGGAGTCTGTG -0.29153563 0.091306 1
276952 TACATCCTGGTCTATGACATCTGCTGCTTTGACAGCTTTGAGTACGTCAAGACTATCCGT -0.17682231 0.091359 1
259119 CATCGCTTTGGTGAGCACCTTCCCCGCATTGTACATCTTCTGATGTCATATGTGTATCTA 0.53894929 0.091382 1
29875 TTTTCATTGGGTTAATCTGTATATCTGAATTCTTGAAGCTTTTCTCTAGCCTACAGTAGG 0.36221532 0.091393 1
101202 TTTATCACCCAGACTGGGAGGAAGAAGAGAACGAAGCTCCCTAGTTACTTGCTACTGAAA 0.23362775 0.091425 1
14390 TGAAGACTCTTATTGGATACAGTGCAGCAGAACTGAACCGTCTGGTCATAGAGTGTGAAC 0.2761409 0.091428 1
77605 ATTATGGAAGTTCTGACAAATGCACAGAAATAAAGAAACTAGCACTAGTGTGACAAAGCC -0.17266539 0.09144 1
109910 AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC -0.19796091 0.091466 1
58203 CAAGCTGGTCTTGAACCCACAGAGATCTTCTTGCTTCTGCCTATTAAATTCTGGGATTAA 1.86307178 0.091499 1
56284 AGCCATGGATTGAGTTTGATATGATGAGAGAATATGACACTTCAAAAATTGAAGCTGCAT -0.17547125 0.091513 1
74670 TGACCACTAACTCCTTGCCCATACTCCTATGTGTAACTCCAATAAATCTCATTGATTCAA -0.17386179 0.091549 1
11532 GAATTCATCCACATGGGTTTAGAATAGCCGAAATCAGAATATTCTTTCTTTCTCAGCAAA -0.15043505 0.091576 1
93969 ATGACATGACAGAGCAGAGGACATCTTCCTTCCTTGTGGAAAATGGACAGATCTTCTCTG 0.89863217 0.09159 1
12371 CCAGGGGAATCTTCATTTCTTACGTGATACACTCTTGTGTTCCTTTTATAAGCAATATTT -0.37309534 0.091626 1
257915 GGCTTTATTAACTCTTCCATCATCACCAAGAAAACGTTTACCTTTGATTTCTGTAATGAC 0.21903622 0.091661 1
258493 ATATGAGCATATGATTGTCATGAGTGTCCTTGTCCTTGTGTTGCTCCCCTTTCTGGCCAT -0.18940367 0.091664 1
14617 GGCAAGAGTAGCATTGAGATAATATGTTTTTATGGAAGCCCTCTATTTCATTTGAATCCT -0.18258085 0.091683 1
66592 AGAGATGTCCAGGCTACAGACACGAGTATTGAAAAACTGGGTAGAGACAAGCTCAGTTAG -0.14224138 0.09169 1
67057 CCTCTTAATGCACCTGCTGGTACTTGGTGTGATTAAATAGGAAGTTGTTATTAAATAAAG -0.20304181 0.091691 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.60875141 0.091693 1
381229 ACACATGACTGGGATTTCAAAAAGTGTATATTGAGAGTGATTTCCACGTGGGACATCGTT -0.28634952 0.091701 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.95075158 0.091707 1
77805 CCCTTTCAGGGAGTTTCTTTGGTTTGGGACTGAAATAAGATTAAAACACAGGCTTCTTAA -0.37350055 0.091783 1
20612 TTTTCTCCATTCCCCAAGTGTTGCCTTTGATTATGAAGCTCAGGTAACTGCAGTGCCCAT 0.6089134 0.091796 1
29810 TGAGGGGTAGGAAGAGAGTTACAGGAATAGAGAACCTGTTTTTGAGACATGTTGTCATTT 0.36379865 0.091801 1
58203 ACAGATGTGACATGAAAGTACATGTAACACCAACCAGGGGATGAGGATGGTGCATGGGGA 1.41539961 0.091804 1
16979 CTTGCTACTTTGTTGAATGATGTTAGTTGACTGTACTGTAATGTTGTATCAACTGAACTG -0.18723465 0.09188 1
50934 TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT -0.32941661 0.091937 1
17877 TTGTATATGCCTTAAAATAACTTGATAAATAAATGTACTATTATTATCAATAAAATATTT -0.18580155 0.091955 1
74487 GGATTTTAGAATGTTTTAGTTAAAATTTTATTATATATACATATATAAAATATCCTTTGA 0.8780215 0.091964 1
666168 TGATACTATCTACAAACTTTCTTCCAATGGCCGCTTGTCCAACCAAGCTTGTCAACTTGC 0.23440113 0.09198 1
70487 CTGTTCACCATGCTCCAAATGATGGTTAAAGAACCGAGACAATAAATATAAATGAAACAG -0.26681145 0.091994 1
434215 CCCTGGGACCCGCTCTTTGTATAACTCACATGAATGTATTAAAGTATAATTTTGGAGAAA 0.33424177 0.092004 1
244179 ACCAGAAGCCTCAAGTTGATAAGGATACTACCATCACTCTAGGTATCTCTGACCAGTGGT 0.69912969 0.092021 1
56526 AGACACCAACATTCTGCTGTCTCGTCTCTTGAGAGAGCCTCTTTGCATGTTTTCCAGAAT -0.35815291 0.092024 1
18426 AGCACCCGTCCAACTAGTAAAGTGAGAGAACTAATACTTTCTGTATTTCTGGGGTTTTGT -0.18743973 0.092031 1
58205 ATCCTGGCAGCCTCTGAAGTTCTAATTAACTGGAAGCATTTAAGCAACACGTCAAGTGCC 0.54469329 0.092045 1
70572 CAGAGCAGTAACTGATGAGCTGTTGTTTCCTTTAAGTAATTTTCTAAGGGATCTTAATAG -0.1737713 0.092084 1
107971 GTTGATTTTATTTATCAGTTTATTTTTCTATTTATTGTTTTAAATGTAACTTAACATATT -0.215469 0.092154 1
13731 GCTGCGTTATCCAAGAAGCAAGTATTAGGACCAAAACCTGTTACTGTATTTAAAGGAACT -0.15420681 0.092166 1
56380 ACAAGCAACATTGGGAGCATCAATATGTCTGTGGATATTGATGGTACCACCTATACAGGT -0.21179973 0.092174 1
14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA 1.04126303 0.092186 1
52897 CTTTTGAAACTAGCTCAGATGCTGAGCCGAGCCCGGGAGAAGCTGAATGGGACGATCGTA -0.34810057 0.092196 1
100039796 TTACATTCTCACTGGCAGCCCTGATTGTCACATTGCCAAGTGGTATTTTGGAAACAGGGA 1.05161983 0.092208 1
68295 TGAGTCTCTTACAGCTAATCTGCCCAGTTTCCAAAGTAGCCAAGCTGTGTGCATAGACAA -0.16821606 0.092212 1
93886 GGGATAACCAGTGAATTTAAGTTTCTAAGTCCAATTGCCTCTAACTTCCTAACCGAAAGC -0.21712288 0.09223 1
59028 CGGCCTCTTAACATTACAGACTTTCTTTTCCACTGAAAATACTGATTTGCAAATACAAGC -0.19479697 0.092231 1
665374 TTATTTCCATTACAACAGATTGTTTAAAGAGATGTTATTTAGTTTATGATTTTTTCCTAC -0.25887379 0.092319 1
319953 TTTCCTGAGCAGGCCTTGTAAATAAAGACTCAATGCAAGGTGGAGGAGTCCACATCACTG -0.1602663 0.092323 1
76273 CAATCATTTTTCTTTAAATGTTTAATTTGTTAAGTGTAGAAAATAAAATCTTGTTCTGTT -0.22544035 0.09237 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.15519491 0.092398 1
545951 TGACAGTGTGCTTTTAGAGCTAACATCTTGCTACATTTGAGAAGGTGTCTTTTGTTTGCT 0.22452687 0.092423 1
16801 CCTGGGACCAGGAGGCCCAGATATATGAGCTGGTGGCACAGACATCTTCGGAACGCAAAA 0.21205397 0.092464 1
269955 CTGGGATTAAAGGTGCATGATTTCAGAATAAGACAAAGCTTACAAGGCATGTATGAAAGA 0.33892222 0.092473 1
212712 ACAGGGAGAAGACACGTTGCAATACAAGCTAATTCTAGCTGCTTAGTAACCTCTGGAGTT -0.63811756 0.092482 1
14663 GAAGAACTGGGTAAAATAATTGAAGGATTTGTAACTGGTGCAGAAGACATAATCTCTGGT 0.78440245 0.092508 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.4241905 0.092523 1
12411 GCACCCACTTTCTGTCTCAATGGATCTCCCTGTTCTGGACTCTTCCTATAAATGGAATCA -0.26676607 0.092538 1
16194 AGGACCAAGTGCAGTAACGGTAGCCCAAACACCAAGTCAAGTGAAAATCGAGGGAAAAAA 0.38814514 0.092584 1
67213 GAGAAGTGTATTTCTACGTTGCTTATATCTGATCACTTTTGTATTTGTTGATTTAAAGCC 0.33386609 0.092605 1
14860 GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA -0.24281213 0.092609 1
245865 ATGACGAGACAGAAGTGTTCTTGGGGAAATTCATCTTTGATGTGCAGAAATCTGAAATTC -0.29113388 0.092629 1
233005 AGTAGTGTGGGTAGTAGAACATGCCATGGGTCACATGTGGAAACAAAAGAATGATTTTTG 0.21089563 0.092694 1
16641 ATACTTTTTCCTGTTTCACAGAATGACTTCTGTGCAGAGACTATTTAGAACATGTATAGG 0.78094833 0.092696 1
19188 AATCTTTTCCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCC 0.64646947 0.092738 1
237759 GGTGACACAGTGGTAATCGACTATGACGGCAGGATCTTAGATGCCCTAAAGGGTCCCCCT 0.20936966 0.092744 1
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.19100303 0.092782 1
19656 TGTGTAAGACTTGACTTGTACTAGTGTTGTAATTTTCCAAGTAAAAGTGTTCCTAAAGGC -0.17773821 0.092789 1
66585 TGAAACTGGGGAGAGAGTGAAAAGGCTAAAGGGGCATACTTCCTTTGTGAACTCCTGTTA -0.16333454 0.092791 1
14167 ATCTCTACAGCTCAGATGTTTTTACCCCAGAATGCAAATTTAAGGAGTCTGTGTTTGAAA -0.18313288 0.092809 1
243834 GTTGAGATACACCTGTATGAACAATAATATTGTTTTTTACCTTAAAACAAAGCAGATGAT -0.19730656 0.092835 1
77305 TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA -0.15781601 0.092917 1
12047 CACTTGGCATTTCCATTTACAAACATGAAACTTGTCTTTCCAGAGTTGCAGATATTTTGT 1.45917937 0.092937 1
15289 CTTGTTGGTGCACAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGTTTTTTGTTTT -0.17938 0.092947 1
21374 GCCAAGAGTGAAGAACAATCCAGACTAGCAGCAAGAAAATATGCTAGAGTTGTGCAGAAG -0.25218092 0.092949 1
105590 GTCACACTCAAACTGGTGACACCACAGGAAAAGAAAGATACAAGATGTTGGAATGGCCGT -0.18029533 0.092969 1
219181 ACTGTTCTTTAAAACCAGTTTTATTTCCCTAGTTCAGCTATTGGTACTTGTAGATTTCCC -0.20351566 0.092982 1
20183 AGGTCTTTCCGGCAGTTCTTGGGAAGAGTGGCCAAGCCTCTGTACATATAATTGGTTTAA 0.30005561 0.092983 1
71413 ATGTAGAAGAATTGTCATTCTCAGTCCTGAGATTGTCCGGGTGGACCTAGGTCATTGTCT 0.34410452 0.093058 1
234577 CCACCCTCCTGCCACTCTAAGTATTGAATGTACTTTGTATAATTTTAGTGGAATTATTGT 0.32435965 0.0931 1
94041 AGTACATACCCACTGTCTTCAGTGTTCTGAACACCTGGTGGTTCCAATAAAACGATCACC -0.21568693 0.093155 1
19672 TAGTGGATTTATTATTTGTTGAGTCCTGAATCTCTGAGCCTGCTTCTAGCACAGCTTATG 0.40995991 0.093174 1
100336 CAGGACAGGCTAATGGGTTTGTACAGTATTGTTGGACTTTACCTATGTTTCTTGTCCACA -0.15809579 0.093179 1
72535 AAATCTGATTTCAGCCTGAGTTCCCAGTGAAGTGTTACAAGAAGTGTCAACCAATAAAGT -0.25467872 0.093195 1
63828 GCCCCAGGGTGTGACCAAGTTTGGCTTTCACACAGTGACATGCTGTGGCTTTATCCCACA -0.19278868 0.093216 1
268903 ACAGTTGCAAGTCTGGACAAATGTATAAAATAAACCTTTTATTTAAGTCTGCGTACCTGC -0.2777221 0.093229 1
23961 CAGAAGGAGAATATTATGGTTTGTATATGGTTGGCCCAGGGAATGGCACTGTTAGGAGGT 0.22599736 0.09326 1
545056 AAAGAGAAAGCAAAAACCAAAATGTGATCTGGAGGAGGGAGACTGGTGGTTCTCAACTCC 0.45775627 0.093266 1
21854 TGGGACATCAGCGGCCAAGCGGGCCATAAAGAGACATTTAGCACATTTTTCTATTTAAAA -0.19616668 0.09331 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.37632106 0.093322 1
230777 ATTCGTTCAGCATGGAGGCCAGCAGCCCGGAGCAGCTGTAATTAAAAGCCTGGCACTGAA -0.3298756 0.093334 1
78806 GAATCAGTTACTAAGTTGGACGGTGTCCCTGAGAGATCATGGCTTGTGGGAGATCTGACC -0.38554769 0.093383 1
110095 CTTCCCTGATTCTGTTTTTGTCATTGAATAGTTAAGTGTCTCCGGGGATGGGAAGGGAAA 0.35782898 0.093394 1
19264 GAGGAACCAGAACATGCTGCCAATGGTTCTGCGAGCCCAGCTCCAACCCAGAGTTCATAG 0.83939498 0.093425 1
18221 GGCAGAAGTCCATGGGCTTGCCCACCTCTGATGAGCAGAAGAAACAGGAAATCCTGAAGA -0.20973602 0.09343 1
72565 CTCTTCTGGGCCTTACTCTGATAGTATCAGTAAAATAAACTATATTTTGTTCCGTTGTTG 0.30873959 0.093432 1
29818 GGCCTAGGTAGACTGCCTCAGGGAAGCCAGAGAGATAGCCATGACTGTTACCTTCCTTGT -0.22339728 0.093443 1
54216 TAATATGGGGCTGCTTAAATATCACTGGACAGTGAAATCATTGGTTATAGAATCACACAG -0.40289176 0.09359 1
226422 GATCACCTCATTCCTCGACTGTGAGATGAGTTTATGAAAAGAATTAAAAGTGAGCACTTG 0.43100137 0.093592 1
17764 AACTTGGAAACTAAGGTTACGTGTATGCATAAAAGTTCTAAATGAAAGGGTGTGGTTTCC -0.19645172 0.093635 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.9660145 0.093659 1
74081 TAAAGGAAGCACCGTTGTTGTAACTAAGCTGTGGAAAAGCTTTTCCTTCTGGACTTTGCA -0.23026126 0.093666 1
55951 CAGTGATAACAAGTATCGGTGTTTTCCATATGTAACTCAGATCTGTAACTTAATGGCAAT 0.29125718 0.093708 1
245511 CCAAAAGACCTAATCTTAGTACATGAGATTTTATGAGGCCTTCAACTCTACGTTCAAATA -0.28508907 0.093724 1
263764 GGGGAAATTGGGGTGGAGGGGTATGATAATATTTCTTTGTAAACATATACTAAATTGTCA -0.37523161 0.093731 1
103468 ACTAGAGGAGGATGCTTGCTTGCTTCGTTGAGTTGCTTGGTTGGTTGGTTTTGGTCAAAT -0.19000779 0.093797 1
12260 ATTCTGGGGACTACGGGGCTACACAGAAAGTCGCCTTCTCTGCCCTGAGGACCATCAACA 1.09461955 0.0938 1
30947 GAGTGCTGAGATTAAAGTTGTGTGCCACCATGCAGTGTTCTTTTATGAGATTTTTATATT -0.21546015 0.093812 1
18726 AAGAATGCATCTTTCTATGTTCTACACTCTGGGAAATATATCTGATGACCCAAAGTTGTC 0.44690842 0.093859 1
258658 GGGCCCAATGAACTAGACAATTATTTTTGTGACATCACTCAGGTTGTCCGGATTGCTTGT -0.14710138 0.093873 1
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.16981902 0.093887 1
234959 ATAAGTGACGAGTACTTTGGAATGAAAAATGTATGTACAGTTATAGTATGCAGTATGGGG -0.15149992 0.093909 1
16633 CATTGTGGGCCTTAGTGTGAGACTCTGTTATGAAATATAATTATGATGATGATGATGATG 0.86468423 0.093944 1
100041654 AACCATGACCTGAGGAAGTTATCTTTCCTGTCCTTCCTGAATTATATCAGAACACTGAGA 0.38072651 0.094013 1
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.6852036 0.094022 1
245007 GGCCCTTATATGTGGATATTTTTTAAGTGGACTTGTATGCTGATAATTCTAGACCAAAGT -0.18628153 0.094136 1
76246 TCGGAAGACCTGTTCAAAGTGCATGACTTTGACGTGAAGATTGACTTACAGGTTCCAAGC -0.22568355 0.09415 1
67204 GATGGGGGTAAGGAGGTACTTTTTAAAATCGTTCATAGACTTCTGTAAAATGCAAGATAA -0.16664118 0.094162 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.08565294 0.094173 1
70601 CAGTGGATGTAGACCTGAACCTGATTTCAAATATACTGGAATCCTACAGCTCCCAAGCGG -0.15463522 0.094187 1
16159 AAGTACATGAGCCTATTTATATTTATTTATTTTCTATTTATTATAATATTTCTTATCAGA -0.23798917 0.094198 1
68720 CTGCAAAGTTGTGACTTTCCCCTAAAATGACAAAATTGCAATAATAAAGTCTCCCCTTGC 0.36076162 0.094218 1
14581 GTGAGGGTTGTAGACGTTCCTAAATCTTCTTGAGTGCATTATGTATTAGCATAATCATAT 0.95688219 0.094239 1
108100 GGTTCCCCTTCTCCTACACCCGGGTCCTGGACAGTGACGGAAGTGACAGATTGCATATGA -0.21847873 0.094256 1
59048 CAATGATGCATTGGTTTTCTTACCTCCAAATGGTTCTGAGAATGACTGACAGAAAGCAAG -0.20965102 0.094259 1
16512 CATTCCTTGCATGTGCCCGTCTCCACTGTCCTCATGTTTTTTATATTAAAAAACATTAAA -0.27956557 0.094274 1
541307 CCAGGGGCCAAATGGGTGCAGAGATTCATCTCTCTGGTGAACACCAGGAACCATTTGTGA 0.51736532 0.094354 1
77914 CAATGAGGTGGTCACCAAGTTCAATGTTCCTGACTTCATTTACATGAAGTTACACGCCTC 0.26711187 0.094372 1
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.58669078 0.094459 1
108911 TTTTATATCTATATTTCTGGGAGTAAACATTTTAAATAAACGGCGTCATTGTTTACTCTG -0.16951893 0.094488 1
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.19023588 0.094501 1
69535 CGAAGGAAGCACACTGCGAACATTTGGCAGGTTGTATCTCTATGACATGGCACGCTCCCT -0.15085717 0.094551 1
14169 TAAACCTGTGCTATCATGGATTTCTCTTCTCTCCATTTTTACAGGGCTGCTCGCTCCACT -0.21215009 0.094561 1
16323 TCAACATTTGCTGTAAGAAACAGTTCTTTGTCAGCTTCAAGGACATTGGCTGGAATGACT -0.26213868 0.094569 1
65973 GAAAGCCATCTTGCTCCTCAAGATGATCATTAGTAAAGCATTGCTGCATTTTATTTTCTA 0.21430155 0.09459 1
76629 TTCAGGCAGTGACCAGGCCCGCCAGCTTCCGGAAGTCATCATAACCTGTGCTCTGAGTTT -0.21606821 0.094615 1
12984 AACCCTAAGCAGGCAGATCAAGTGTTCCTTGGTCTATGTTCACTGCAGCAAAGAAAACCA 0.76769507 0.094622 1
319713 AAATGTCCCCCCGGCCAGATGCGATCATTGAAACTGCCTCATTGTCACTGGTTAACAACT -0.2128807 0.094687 1
70896 ATTTAGGGTGTTGTTCCCTTTCCTGTTCTGGCAACACCTCTTGAGAAACAACTGAGGTGA 0.26375592 0.094702 1
216578 TCGCCAACAGTTTCTTCATGGATTAGGCATGCAGAAATAAGCAGTGGATTTTATTGAAAC -0.23412897 0.094712 1
80782 TCTCCCAAAGGCAGGAACTTGACATTGACATAGGAGAGAGGAACCCAAAAGACATTTTTT 0.82049296 0.094733 1
67103 GCTTTTTACCATTCAGTGCAAGTGTATACTGTCCTATGTAAGATGTAACAGCAATGCGTT 0.2659011 0.094749 1
171207 GCAGCATCAGCAAAAACAAAGTCTTCTCCCGGGGACCTGGGGCTCCAATTTCCCCCTCAA 0.47085685 0.094781 1
212892 TCTAGTATCCCTTTCTGACATCCATGTGTAACACACACACACATGCAAAATACTCATAAA -0.17301219 0.09479 1
54006 CTCTTGCAGGGAAGCTGCTGTGACCCAGGCGAGAATGCAGGTTGATACAGAGAGGAAAGA -0.26583674 0.094792 1
13164 GTACCATTCTGTGACTAAATATCCAACTTACTATGAATGATAACCTAAATTCTGAGGCAC -0.22698915 0.094832 1
233877 GCCATCTTTCTCTTACCATCTGATTCCCTTTCTGTTTTGTTAATACATTGAACACACGTG -0.23481909 0.094881 1
16149 CTATAAAGGCCCGCAGACAGGGACAAGGGATGCCCTACCCTTAACCTAGGCTGGACACAT 2.11035145 0.094907 1
14860 GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA -0.26727327 0.095046 1
14938 TGTCTTTCACTCCATCCCTGTCACTTCTGTGTCTGATCACAAATAAAATCAACTTGAATG 0.91019873 0.095067 1
67106 AATGGAAAACTAGTGAGTAGCAGTGGTCTCTAGATAATGAATTCCTCAGTTTTTGAGGAG -0.14585406 0.095081 1
71066 AAGGAAAGAGTAGCATCTACCACGTTGGCATCAACATCAAACCATCACTCATCTTCTTGA -0.29790639 0.095088 1
20682 ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC 0.3178292 0.095129 1
218461 GCTTTCTATTGTACTGCTGCGTTATCTACATGTGATGAAATGTTTTTGTGAAGTACTTGT -0.18888572 0.095225 1
70238 GTTGAGCTTCTATCTTTTGTTAAGACAACTTAGCAAGCTGTAGTTTCAGTAGATTCTCTT -0.15536223 0.095347 1
66695 CTCAACTCATAATAAAGCTTCAAGTATTCACAGATAATATTCATCAGAGTTGGTTTGGGC 0.571397 0.09538 1
13837 ACCCAGAGAATTATATGTTCTTTTCTACAACTGTTGAACAATCCACTTACATGTACCAAC -0.45580911 0.095397 1
16612 TTACACCCGTCAAATATGAATACCCAGATGAGCTCCAGTGTGTGAACCTCAAGCTCCTGC 0.19304151 0.095398 1
258552 TTCAAATCCACAGTCCAGTCATATCCTACGTGGGCTGCCTCACTCAGATGTCTCTTTTTA -0.21833119 0.095409 1
104582 GCTCATCAAGTCCGAGAGCATGATCAACTTTCTGATGCAGGAGCGCAGGCCCTCCAAGGA -0.43311226 0.095413 1
668976 ATAAGTATTCATAATGTAGAAGGAAGCCATGACTCTGGAGAGAATGATTCAAACTTGGCA -0.21087798 0.09543 1
224893 CATCTAAGAAATGAGGAATAACTTTCCATACCAAATTCAATTTCCCCACTGAGCTCTCTC -0.16664029 0.095489 1
320840 CATTTTGTTACCAAAGTAGTATTGTCTAATTCACAGCATGATATATGCAATTAGCACCCG -0.28827576 0.095577 1
433486 AATGGTTTAATCAGAGGCCTGCGAACTTTATGTTGCTGCCTGCCAATCGAAAAGAGAGTG -0.18340363 0.095579 1
209018 AGCGGGCAAACTCAGTGAAAATCCTTCTGAAAACAAGAAAGGACGGATAACCTCGTCTCA -0.18029267 0.095586 1
50934 TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT -0.32229971 0.095595 1
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.22563633 0.095692 1
234396 TGAGCCATCAAGGTGTCTGAGCATCTGGCTGGTTCCTAACTGTTCCCAGCTCTAGCTTCA 0.29420077 0.095769 1
329260 AATCAGGTACTAACTTGTACATAGGCTGAAAGTGTGTTTTGAATTTAAGCTTTCCCAGTG 0.19844988 0.095772 1
66822 GATCAGCTTCATCAAATTCGCATCTAACTGAATGGTAGTGTCTTTAAAATGTGCTGTTTT -0.24616018 0.095791 1
238161 CTGGTACATTCTACTATTAAGTTTGTTTTTGGTTTCTATGCTTCTTGAGGTGGTAATGAG -0.20920676 0.095792 1
15018 TGCACTGAGTGACAGACGATGTGTTCATGTCTCTCCTGTGACATCCAGAGCCCTCAGTTC 1.74669615 0.095825 1
217666 GGGTCTACCGGCTGCGTTTTAAAATTAGAATTTAAGAAAACAATTTGAAAACCATGCCTT -0.18143521 0.095911 1
11690 AGAGACGCATCATAACGCAATGCCGCGAAGGCTTCTGCTCCTCTTCAAGCTGTAGATGCT 0.63425635 0.095931 1
17749 GTGGGAGTTCAGAAGTATCTTCATTCATACATTTGCCTCATTGATGTTTCTCTTTAATGT -0.15917522 0.09594 1
16700 GTCATGACTCTGTCACATATGCTTTTGGTTTTTAACCAAGAGGATTTTCTCTTTTCTCAA -0.15573978 0.095952 1
14169 ACAAGTGCATCTGCAATAATGAATGGAGGCAAACCAGTCAACAAGTGCAAGACCACATAG -0.1646521 0.095979 1
214968 TAAAGAGGACACCATCCTTAAAACCTGATGTGCCACCAAAGCCTTCCTTTGTTCCGCAAA 0.421634 0.095995 1
235459 GCGATAATGTTTGGACTTTTGTATTGAATGATGTTGAATTCAGAGAGGTGACAGAACTTA -0.16568998 0.096001 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.34901724 0.096014 1
110835 GGCTTTTTGTTCCTGTTATTTATAAATGGGCCAATATAATAGTCCCAGTTCACATTGGAA -0.24283836 0.096048 1
100042150 GGCAAAGACGTTTTTATAGGGAAACTATTTATATGTAACATCCTGATTTACAGCTTCGGA -0.17078713 0.096065 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.97354527 0.096108 1
258538 TCATGCTTATCCACAAGTTAGATTTTTGTGCTTCCAATACCATTGATCACTTCTGCTGTG 0.21584541 0.09617 1
72180 TAGGTCTCTGTGTCTTACAGCGTGCCTTGCAAATATTAGGTGATCAATAAATGTTTATCT -0.24000727 0.096175 1
100041655 GAGCTGGAAAGCTGTCAGCTGCCACGCCATGGTGCCAAGCACATAGTAGGACTTCAAGCA 0.17126651 0.096198 1
80885 CCCAGGAGGGACTGAACTCAGTGCTGGAGAGAAACAATAACAAATTCAGCTGAGCTTTAA 1.20470786 0.096212 1
103768 TCACCCCTGGCGCTTGGCTGGCTTGGTTAAGTTCTAATAAATAAAGCGTGATGATGCATT -0.28221371 0.096214 1
226861 TTCTATGTGAAGTACCTGGTGCTCTTTGGTGTCCCGGCTCTGCTCATGCGCCTGGATGGA -0.16418803 0.09625 1
67048 GCAAAAAATTTCCCATAATGTTAACTACCTGCAGATTATCAGTAGTTTAGTTCACAACCC -0.22269313 0.096365 1
108116 GTGGTAGTCTGTATTTTTGCAGCTTCTATTTTCCAGATGAGCAGTTTAGAGATACATGAT -0.29182139 0.096383 1
338363 CATTTTGCATAATGTAGCTGAAGTTCTCACCTGTGGGTACCAGAAGTGTGTCTGGAAAGA 0.21414286 0.096393 1
20343 CTGTAGGCTATCTCATTTTCTCGCTTCACTCTGCAAGGTTTATAACATGATGAATTTAAA 0.52693523 0.096407 1
69627 CAGTGCTGGAAAACATTGTTTCCAAGCAGTACTTACCCGAAGCCTTAATATTATTTATTA 0.32210842 0.096437 1
13496 CAGCCTGGGGGTTGCACACAAACTCAGGTAAAAGTGAAAAAATAAATAAGTGGATTTTAA 0.18819419 0.096462 1
93891 GTCTAAATGTTGTTGTACCTGGGTAGAAACTGTACTGGATCATTTGTAGTATTCTCTGTT -0.25363798 0.096466 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.12899147 0.096481 1
94094 AAATACCCATTTAACTGTCTTGTACATAATACATGGGCCTATAGTCCTTTGTACTCAATG 0.87180076 0.096483 1
12363 CCAGCCTAAGCAACACAGTGGGATTCTGTTCCATAGACAAGCAAACAAGCAAAAATAAAA 1.11735214 0.096489 1
384309 TGTGAGATCAAATCCAGATGCAGCATCACACACACTCACACACACCTGTTATCCCAGCAC 0.36316215 0.096593 1
19073 AAGACTCTTGAATCCTGTTACCCCTTTCCTCATTAACTCGTAAGGAATTATGCTTTAATG 0.89258754 0.096619 1
30946 CGTCAGGAAGGTCTTGATCCAAACAGTCACAAAGGTAATAAAAGTCAGATTTACATCTTC -0.18998399 0.096645 1
109857 TCTGCAAACTCAGTCTGAACAATTCGCTGTGTCCACACTCTCAGCTCATCGTGTTTTCAA 0.39245799 0.096645 1
54139 CCAACTTGGAAAGTCAAAACTGTTTGTCTTAGATTTATTGCCAGGTCTTTAGCAGTGTCT 0.25270647 0.096676 1
432870 GTTAAAACTGATTTATCTGCTCTGGCTGGAGCTTAAGAGAGTATTTGGCACATAGAAGGC -0.18103536 0.09669 1
51960 AAAGGGAAGTTAAACAAGTTAACTTTTTAACTCGTTAGTTGGTTTAGAAGTGACCATGGG -0.16493069 0.096723 1
72049 CTATGAGTAAGAAGCTTTTCTTTGAGCTGGGAAAGGTACTGTTAAACCAAAATTAATCTG 0.49271452 0.096775 1
226418 GCTGTACATTAAAACTGTAAAATTGGGTTATGCACCGTATTTATAGAGCTTACCTTTACC -0.23444585 0.096804 1
214704 ACAAGTTTCCATGGTTTTAGAGGGAAGAGAAGGGGAGTTAATGGTTGAACAGTTATGGAG 0.25652693 0.096896 1
12959 CCAGCCCATGCCCCGCCAGCTCATGGAGCTCAAAGAAATAAAATGAAAAACAAAAGACTC 0.57067364 0.096902 1
225998 CCTGAGTGGGGCTCTTTTGTTTGTTCGTTTGTTGTTTGTTTGTTTTTGAAATGATCATAA -0.21222653 0.096914 1
68870 CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT -0.28498372 0.096944 1
209387 ATGTAACGTTTCAGCCTAAATGTGGCTACTGGGTTATAGGGATGAAGAATTCATCTGTAT 0.93691643 0.097019 1
66810 CTAATCATTGTAGTGGCATAAAAGTGATTTAACTAATTTGAAGTCATACCCTCAGAGAGG -0.16624316 0.097048 1
76905 CAATGTGGTCCCATGTCAGTGTGCAGATTCCTCATTCCCTCAGCCAGGAATGCTATTCTC 0.79074739 0.097053 1
19293 AGTTTGTTTGTGTTATTTTTTACTCCCCCATCCTCTATGGCCCTCGGATGACGCCATTCT -0.25267632 0.09706 1
258759 TACTGTGCCAGTCATCAATCAAGTCTTGACATTAGTACTCACTCTCATGGTCCTCACAGC -0.17342737 0.09706 1
192161 TACACCTTGCCCAGTGGCCGAAGTGGGAATGGAAAGTCATTCTGTTGGAGGAGACGTGCC -0.35672873 0.097066 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.34619753 0.097075 1
403180 AAGGAACAGAGAGCTTCAAAGACCATGCTGAGCACCAAATCAAAAGCAAGTTCAAAGTAA -0.24812148 0.097126 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.22970399 0.097127 1
638532 TATCTTGACCAGATCAACATGATTGAGGACCAGGCAGCCTACAAGCTCGATGCTTATTCA -0.15836552 0.097136 1
235048 CACGTGTGGTCCACAGATATCCATGCTGGTAAAATACTCATAACACATGAAATAAAAATA -0.23217894 0.097172 1
666468 GTTTTGGTTGAGAACTATATGTAGAAAGAACTATTCATGTGGTGACATTCAATCTGTCCA 0.29473087 0.097187 1
14007 TAACCGTGTAGTTGAAACAGTCAGACTTATTTTTGTAATGTATGTTATTGTGTGATGCGG 0.19973327 0.097212 1
73442 TGCATGCACCAATATAAACAGGAGTTCAAAATGCATTATTAACCGAAGATGAACTTCACA -0.38596576 0.09723 1
57750 TAGCAACATTTTACTGTCTTTGTCCTTCGTGCTTATAAAATACAGTAAGTATGTGGTCTG -0.25694606 0.097236 1
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.18779193 0.097255 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.95951544 0.097275 1
52705 GCCACAACTACCAGATGAATCTGGTTTTGAGCTATGGTTGAAACTAAAGATTAAAATATG -0.22975604 0.097276 1
19200 TCTACGACTACACTGCACAGAATTCTGATGAGCTGGACATTTCCGCGGGAGACATCCTGG 0.5612465 0.097293 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.12938668 0.097435 1
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.17668814 0.097502 1
19696 AAGGTGAAAAACGTGTAATGGCTATGCATTGGGTAAATAAACTCATATTATTGTTGAGGC -0.15540372 0.097507 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.54199512 0.09753 1
68202 TGCAGCCTATAGAAAATACACAGAACAGATCACCAACGAGAAGCTGGATATGGTCAAGGC -0.17599044 0.097589 1
11836 TATCTCCAATGGCTGTGACTCAGTGCAAGGATTCCACTCAGAACCTCTTTCTAAAGTTTT 0.32666707 0.097665 1
74112 CTGTGATAACAAAAAGTGCTTTCTCTGGAAATACACCTATGGCTTTTATACTGGCTATTA 0.32809555 0.097676 1
13512 TGACCCTCTACAGCTTGGGAACTACTTGCTCACAGAAACTTACTCAACTTCAGGTTCCTT 0.21226102 0.097693 1
232984 ATGTGCCGAAGACCTTCTTTGAAGGGGACTATCCAGCCTATGCGAGTGGAGGTGGCTATG 0.29073136 0.0977 1
18725 CCATTTTTCCATTCTGTGTGACTACTTACATTATTGTGCCTAATGTCATTTCACTGTGAA 0.37445668 0.097706 1
19716 TTTTTACTCGGCCTATAATTCTTTTGTTAGCAGAATTTATCAATTGCATGGGAAGATCCG -0.32472578 0.097712 1
22775 TTGAGCCATTTGAATAGCTGTATAATAACACACTGTATAGTCTTAATTGCTTTTTTCGTG -0.25453852 0.097756 1
384059 CCGCGGGGTATGTGACATTCCCAAGATCTTCAAATCCTCAGTAAACTTGCTAAATTCATG 1.10299723 0.097801 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.22632271 0.097825 1
328795 GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC 0.39014885 0.097863 1
667240 TCCTAAGAATCCTTGTCTTGAGCTCTTCCACTGTTTTAAACCAGAGTCGCTACAAAATTT 0.1945053 0.097867 1
68127 GCATGGTTGTAAAGTCCTTATTCTTTGTGCTTACCTATAAAGCATTGAAACAAAATGGCT -0.25238965 0.097882 1
100503880 GGAAGTGACTGCTTTGGGTGTAGTTTCATTTGAGGACATAGATAAAAAATATTGTAACTG 0.19160119 0.097959 1
69641 TATGCTTTAACTGGGATATTTTTTGCGTAACCACTCAACTAGATTATTGTATACCTGGTC -0.16702735 0.097988 1
69260 CGCTGCCTCATATTGGCAAGATGTGGATTATTCAGCATCATGGTTCAAGGTTGAACAATT -0.24959488 0.097992 1
320873 GGAGACCAAAACTACGATTACCTCCGAGAATGGGGACCTCGGTTTAATAAACTAGCAGAA -0.25959122 0.098041 1
271786 GCATTCAAAAATCCCCATGAGAAAGTAGTGATGCAATACAGTCTTTTGTCAATAAATGTG -0.22392896 0.098042 1
192157 TGTGTTTGTATCTCCTTTTTATGATTGCTGTACCGACCCATGTCTTTTTGGGGAGGGATG -0.24449529 0.098064 1
17242 CCCTCTTTTGTTCTCCCCACCCTGATACTTGTTATTAAGAAATGAATAAAATAAACTCAC 0.24882407 0.098115 1
12662 TTCCCTAACCTGGCCAGGTTTCAGCGATGTTAAAGCTCCCAGCACAGATTCATAAGAAAT -0.18845421 0.098222 1
210105 GGAAGATGTCCTCATAGAAATGGCTTCTTTGTAAAAGTGACTAGGCTGTAGGCAAACTTG -0.17296958 0.098227 1
208595 CATCAGACCTTGAAATTGTAAATATTTTGGAGCGTTCTCCTGAATCCTTTTTTCGATCTA -0.20056882 0.098231 1
105283 ACATCCAAGTGCCTATATGCTCTCTTAACTAAACAAAACAAGCACATAGGCTGTAGAGTA -0.18928623 0.098239 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.22253349 0.098287 1
170656 CTGTGGAGGCTGTGGATACGGCTCAAGATATGGCTATGGCTGTGGATACGGCTCAGGCTA -0.1695236 0.098292 1
217201 TTGTGAGTTCTGATTCCCCTTTGTTCAGAGGGAGTTTTAAGATGAGCCTAAGATGAAGTC -0.21412615 0.098311 1
236915 CGACTGTTTGACCCTGTCAAACAAGTGTCAAAATTGTGTATTTGGAAATGTTTAACAACA -0.24186302 0.098342 1
18439 TTTCGGCACTGGAGGAAAATTTGACATCATCCAGCTGGTTGTATACATTGGATCCACCCT 0.24289904 0.098344 1
171188 GCCTGTATATTTGTACCTCATTTCACCCACCCTGTGAAATATTGATAAATAAAACTGTGT -0.3165846 0.098402 1
21817 AAAGCGTGGAAGCCTGTGTGGGGGTCATCATCCCAAGTTAGCCCACTCCTACCTCTCTGT 0.67170075 0.09842 1
73754 GGAAAAACTTCAAGCCCACCAAGTACAGCAGCATCTGCTCGGAGCACTTCACCCCGGACT -0.20498411 0.098434 1
258519 GTTCAACAGTTTCTAGTTCTTCCAAGGAAAGTATGGTGGCTTCGGTAATGTATACAATGG 0.59495796 0.098436 1
57783 GCTGTCTGTTGCTAGGCAGCCGTTTGCACAAATCTTGGACATAAATCCAACTTGAAGATC 0.20860258 0.098466 1
67608 CTGGTTTACCATTTGAGAGAGTGCAGTCATTTATGTCAGAGAAGACACCTCGCATCTCAC -0.19180302 0.098469 1
78232 GCATTCACATGTGGCTTAATCAGAGGTGGTTTGTCGAACTTGGGAATAAAAAGTATTGTA -0.20639793 0.098515 1
68939 GTTGTTGTTTTTCTTCTTTAAACTGTGGCATCAGGTACAGAAAAAAGTGTTAGTTGATGG -0.42452799 0.098537 1
67618 ATGCTTCAGCTAGTTGTGTTTTACCTTTCTTTTACCTGAAGATTGGTTTGTTGGTTTTTG -0.14242035 0.098601 1
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.36460971 0.098607 1
26572 CCGTGTACAGTTATCTGGACCACAGGAGGCAGAAAAATATGTTCTACACATGATAGAAGA -0.18636726 0.09861 1
11806 TTCAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAA 0.22313244 0.098624 1
270802 GGCAACATAAACTTAAGTCCCTATGCACTGCCAGGATTGGAGGAACCTCGAAGATTAGTA -0.21016674 0.098678 1
544717 AGAACTCTAAATGGAGCTTTTGGGACTGAAAGAGAGACGCCACGAACCTCATGTTTCACA -0.2250947 0.098681 1
675812 TTTGCACAAAAGTCCCAGCTTGCTATCCACCAAAAGACTCACTCAGGAGAAGAACCAGAA -0.18388446 0.098684 1
432769 AAGCACTTTGTAAACAGTGTTGCAACACTTTGCTCATCATGTAAATCTTGAGAGATTGGA -0.23757921 0.098706 1
226744 CTGCGGGGATTTGATGATCTTTGTTTCTGCCAATTTTATGTCAAGAAAAGTTCAAATCTC -0.26628842 0.098765 1
23829 GTGATCCTGCATCTGGACGCAGGGGATGAGGTCTTCATCAAGCTGGATGGAGGCAAAGCA -0.28965002 0.098766 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.32991282 0.098773 1
66202 AGAAAGAACTCACAAAAACAAATAAAAAATAGCAGTCTCCTTTCTTTTGACAGTGAAGAT -0.16504096 0.098805 1
545030 TTGGATTTGATGCTTCAGTGGCTTCTTCAGAAACATCATCAGCAAGAAGTCCTCCAGGCT 0.26692856 0.09882 1
66573 TTGTCACTACGGGTTTGGGTAGAAATCAAGAGTTGTGTTCCAGACTCTGTGTCTACCACA -0.48789348 0.098872 1
69550 AGGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGT 1.47706318 0.098878 1
329152 GTTCTGCTATTGTGTTAAAGATAAGTCCTGGATATGGGAAAATGTTCTAGGAGAAAACAA -0.29411753 0.098897 1
226548 GAGCAATGGTTCATGGGAGTGACTAGCCTCCTAAGTGAGAGTAGACCTAGAATAGGAAAT 0.19591404 0.098904 1
625360 GTGTCTTCGCAGCCATCTGGTTTGTGTTTGTTTGTTTGTTTGTTTGTTTGTTTACAGCTT 0.39320458 0.098914 1
56744 CTGGAGAGTTAGGTATCAGCTGCCTAAATGTCAATTGTGTTACAAGACTCCTGGAATCTT -0.38496231 0.098945 1
14806 TAGAAAATATACATCAAGGGGTCTTAGGATCTCAAAGTTAGAATCTTCCCAACTTACAGC -0.25064735 0.098947 1
245839 AACAAAGCTCATGGAGTTTTGTCTTATGTGAAATCCAAGAAGATCTCTTCAGGAGTCTTC -1.15918161 0.098949 1
18129 CCACTTGAAGTCTTGCATAGAAATGAACCAAAGGTGTTCAGTGTTCACGTGTGATTTCAG 0.26604541 0.099041 1
15893 CATGGCAGCCATTCATGAGAGCTTCAAAGGTTATCAACCATATGAATTCACAACGTTAAA -0.25520568 0.099043 1
100041864 CATCCTGTGAGAACTGGAGAGCGGAGGCGCATAGCAGCAAAAGACAAATATGGAACACGG 0.29878854 0.099052 1
72795 CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA -0.3141807 0.099096 1
60507 AGGTCTGAGTGGAGGAGAAAGCAAGGCACAGTTCTGGAAGATGGTGGCGTTGAGCACCTC -0.15423556 0.099105 1
15182 TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC -0.19153287 0.099118 1
574429 CACTAAGGATGATATTCTCAAGTTCCATTCAACTGCCTTCAAATTAATGATGTCGTTGTT 0.18148166 0.099134 1
67736 ATGAGGACAAGCAGCGAATGAAGCGGACAGAGATCATCCACCGCTCTTGGTTCCCCTCAG -0.16725831 0.099143 1
100044339 GCGAGATATGTACATTGTTTGAGGCCCAGAGGCTTGACCTATGGCATCCTCCAGAAGTCA -0.42030661 0.099144 1
68891 ACCCGTGGATGTGAGCGAGCGCTGCAGTCCTCCGTCAGAAACAACAGAGTTGTCCTGTTA -0.4218912 0.099165 1
210876 TTGGGATGGATGGAATGGCAGCATGCTGTTTTCATTGCAAACCATGCCCAGAAAATGAAA -0.23342881 0.099282 1
66236 TCGCAGGAGCTGGACAGGTTGCACACGGAGCTGCAGATACAGATCCTGAACCTTAATTGA -0.45726779 0.09929 1
237887 TATTGTAACGAACTGAGGCTGAAAACAAAGCTGGAGAGAAGGCTGGCAAGGCAATGTACA 0.93004881 0.09931 1
232946 TAGTGGTGTCTCTCTAGTTTACATCCCTAAATGATGATCACTCCTGACCCGAGGATACCT -0.14349867 0.099323 1
226255 ACCTGCACACGGGAAAGTGTTTTTGCACAACCAAGGGGATCAAGGGTGACCAGTGCCAGC -0.1725837 0.099353 1
30931 CGCTGTAGGGACCACAGATGCAACATGGACCTGAAGCTCCTGGAGCCTCCAGAGATGAAA -0.16229151 0.099437 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.31487286 0.099491 1
100040894 GTGTTTAAAAGAGACATCATGAAGCATACTCTGAAGTACTCTTCTACATTCCCATCTTGA 0.45493118 0.09953 1
218194 CTTAACCAGGTTTCATCGACCTTAACAGTGGGATTACTCTTGAGTGCTCTGCTGTCTTCA -0.17962523 0.099552 1
11496 TGGGAGGCAACAAAAAGAAAATCAGAGGGAAAAGATTTAGACCTCGATCTAACTCAACTG -0.20291513 0.09957 1
14058 TGGCATCTACACAAAGGTCACGACCTTCCTCAAGTGGATTGACAGGTCCATGAAAGCCAG 0.62874232 0.099573 1
93736 ACATGCGTTTAATGTGTATTTTTAAACAAATTTATGGCAATTAAAATATTTGGAGACAAG -0.19886471 0.099589 1
52570 AACTGCAAGAGACACAATCCAAGAAACAGGAACACAGTGTTGTTTTTACTGAGTAGAGAG 0.23100307 0.099605 1
65116 TTAGTCTATATGGGATTGGCCACCTGCCTGGACACCTCACCTCACAGAGAGCAAAACCAA -0.16243771 0.099666 1
16561 CTTCTGATCCTTCTAGCATAGCACATTGTTTCTCCTTTCATAGGTAACACGACAAATAGG -0.20324508 0.099737 1
212980 AGTCTCCCACCCCCCACTTGTTTCAGGAAATGGCTCAGCTTGTTGGCCACAGAGACACAG 0.26053862 0.099752 1
270120 TGGTTGTGTGTCGGAGGGGGTTTAAAGTAGCCATTCGTGGGTTTGACATCAGTGAATATT -0.25685427 0.099761 1
69962 TTTAAGCACCCCAGTTAATATGCACCGAATGGCGTAATGAAATAAAAAGAATACCCCAGA -0.18610974 0.099804 1
57783 TGAGATGACTCCGGCCTCCACAGTTAGATGTTTATGGTGCCAGAGGTCTATATTAAGGTA 0.2246191 0.099896 1
667977 GGAGTTGTGATCATCATTGGAGCTATGGTGCCTTTTGTGTTGAAGAGCAGGAGAAAAATA 0.95933788 0.099896 1
66268 CCTGGCTGTTGCAGATTCTTTTGTAGCTGAAAAATACTTTTCAATAAAATGTCTTATGGG -0.15894076 0.09992 1
20269 GAGAAAGAACACCTCTGAAAGATACCTTTCTAGAAAAGTGTTGTTATACAAACATAGAGG -0.38440493 0.099925 1
66361 CCACTATCAGTAGACAGTCAGCTTTGTTGTGTTTGTTTTGTTTGTTTTACTACAGATACT -0.17728016 0.099995 1
18476 AAGGCATCCCTCTGCCAGAGACAGCATCCTAAGCATCTTTCCTTCCCTTGATATTAAATG 0.30229172 0.100009 1
79410 TCATACATCTGTATTTGTAGTAAGAGACTGGATAAATTTCCTCATTGACTCTCCAACGAG 0.67111464 0.100021 1
18107 AGGCTCTGAAGAGGTTTCATGGAGCTGTCTACGTCTAAGAGAGAAAGAGACTCTCAGAAA -0.2690487 0.100029 1
15013 AGATCCCCCAAAGGCACATGTGACTCATCACCCCAGATCTCAAGGTGATGTCACCCTGAG 1.59265006 0.10005 1
229323 ACCAATAGCTAGCAAACGGGACTGGTTCATGCAGAAAGTCCTTTCTTCAATCCAAGCCAA 0.81089223 0.100054 1
68729 GGACACCATGCTTTTTTCAGTTCATTATGCTTAACCAAACACCAATAAAAAGCTGAACAA -0.2403977 0.100118 1
101488 CAGTTTGTACAGGAATAGCCTGGCTGTATACATACAGCTGATTATTAAATTTGTCTCTGC 0.5666229 0.100133 1
73301 CCCGTGAATCCATAAGGGTAGTACATTACCAAGAATAAAGACTTTCTTCCTTTTCAATGC -0.56727944 0.100149 1
53881 GGCTTCAGTTTCAAAGAAAATAGAATTTGATATAAGCCAGGTTACTTCCATCTTGAAAGG 0.29291566 0.100162 1
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.15127958 0.100237 1
224440 GGAGGATGTACCAGCGGCTGCGTCTTTACTGAGGTTGGAATAAACAGACTTTTATATGAA 0.32822914 0.10024 1
258587 AAAGTGCTATCCATAGAGTTATCAAAAAGCAGAAAGGCTCAAGACTTAAATTCAGAGTGG -0.14565974 0.100265 1
57895 GAGGAGTCCTGAGCATCTCTGATTTCATTGCTTTCAGGGATGAAATAAAATATATTGTTT -0.31551582 0.100304 1
72745 CCTATTGTCTACAAGTACTGTTACTTGAGAGTAGCAGGAATATTCTTTTAAAGTGAATGC -0.22056468 0.100317 1
321020 AGGTTTTGTGAATTCCAGTCGTCCTTTACGTGTCCTCACTGCTGTAGCAATTTCTTTCTT 0.16949428 0.100335 1
17126 TTTTCTGCCTTTTACCAAAAATAAACAAACTCTTGGGGGAAGACAAGTGGATTAACTTGG -0.19480523 0.100372 1
12424 CTTCAGTGACTCCCAGACCTAATGTTGCTATGCTATTAAAGAGATTTCCTTCTGCCCCTC -0.2720348 0.100374 1
57781 GCACATGGTTATGGTGAAATATCAAGTTGTGCAATAAAGTATGATGAAAACTGAGTTTCC 0.38532698 0.100392 1
108067 TTGTGGATGCCCATCTCTACTGCCTGAAGAAGTACGTTGTGGATTTCTTAATGGAGAATA -0.26446994 0.100415 1
66756 TGAGCCGTGATGTATATGAGGATGCAGAGGCTTTAAAGAATGATTCAAGATGTGTGAAAT -0.17702991 0.100429 1
76367 ACACCGAGACCGCGTTTGAAGCCTTTCTGAAGAGTTACGGGGCCTCGTCCAAGAAGTCCA -0.18857884 0.100455 1
243910 GTGATTGTTCCCCTTGGTCTGTGTATCCCTGTAGCTACCAATTAAACTCAATTTGGCCTC 0.2138077 0.100469 1
619331 ACAGTAACCGGCATTGGAAGAGTTACAGTGGTGAAAAGTCCTGTGAAAGGGATTCTCACA -0.18834976 0.100503 1
71886 ATAGCCAGAGTCAGTAGGACCTGCATATGTCGGACCCATCCAAGATTTGATTTCCACATT -0.2059074 0.100553 1
258994 ACCCCTTTATTTACAGCTTAAGAAACAAGGAAGTTTTGGGTGCTCTAAAGAAACTCATAA -0.23880356 0.100563 1
353155 GGCGGCAGCGGCCACAGCAAAGCGTCGCTGGCTACCGTGCGCCAGGACCTGGCCATCTAG -0.20400276 0.100572 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.16681371 0.100696 1
211712 TCAGAAATGTCCCGGCTCTACCAGTTTCCACATTCGAGAGAATGAAGAAAGTCATTCTGA -0.21464769 0.10073 1
320832 AAATACTGCTGTTAATTGCTGCCACTGTCATTTACATGCATAAGAAGCAAAATGCCTGAA 1.24267079 0.10075 1
71640 AGACCTTTAAGCCTTAGAATGCATCAAGAATAACAAGCAAGAATCCACTCCAGGGGAGGG -0.14167019 0.100767 1
239849 ATGGCCCTTTTGGTGATTATTCTTCTTAACGTAGGATTTGCTTTCTTCCAGAAGAGAAAT 0.62124485 0.100838 1
20482 TGCCAATGCATATAGTTTTATGATTAAAATTGCTGTGGTTGGTTGCATTACATGACACAC -0.15872367 0.100857 1
100042408 TTTCAAAGCCACTGGCATTCCTAAATCTTATTCTGCTTTCTGATTAAAGATGTGAGCCCT -0.1564339 0.100865 1
317757 ATTAATTTCACTCTCATTTGATTCCCATGGATCAGACATGCCAGGGAATCTTCTTTTAAA 0.79226039 0.100946 1
100046275 AAGCGCTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGAAAC 0.20437636 0.100964 1
230857 AAAGGCAGAGTAATGACCTTCATATCACGTGGCACCCGAACACTCTAGACTAGAACATAG -0.25042657 0.100978 1
107650 TAGCCATGGGGAAATTTCTTACCCTGATCCTTTCCTCACATCCAGGGAAACAGCTTTTTT -0.30295283 0.101026 1
19885 TTGAGGTTGCAGCTCTGAGAAGCCTGAGGTTCTAATTCATACAGGACACCAGAATTCATC 0.21267571 0.101041 1
20682 ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC 0.33470085 0.101072 1
67685 CATAACCACATAGTTTTCTTTGTATCATTTGTCGTTTGAGGCTAGACCAGTTAGAGTATA -0.20215644 0.101072 1
212398 GAGGGCGCCTCTCCTGCTAAACCTGTCAGTTCTTGGTGAGTGACTGAAACTTTTTTAAAA -0.25734088 0.101089 1
229776 TTGCCCTAGGAGAAGCCTCACGTGAAGTAGGAAGTACTAATGGAAGGGTGGAGACATGTC 0.20323173 0.101097 1
72083 ACTTGCAGAGACTCTGTCCAACACAGATCCCTTTTCAGGCTATACGAATGGCGGCGGCGG -0.19842365 0.101174 1
239857 ATTTGCGGGGAAGAAGGATGATTGAATACAACATCCTATGCTAATAACAACACGAGGACA -0.32918428 0.101252 1
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 1.07177267 0.101281 1
66583 GAATCTCATTTAAAGGCACTCAACAAACAAAATCATGTAATATTGAAAATACCTTATGCC -0.16894021 0.101318 1
26895 CCTAAGGGGAGATGGAGACCCTGTACTGATTTAAACCTAATTAAGTTTTAAAAAGTACAT -0.22143218 0.101359 1
244911 GCGTGCCAGTGTGGTCCGCCGCAGCCGCAAGGCCGCCCTGGACCAGGACTGCTGCTTTGA -0.24168619 0.101391 1
15251 CCTAATCTGTTACTACTTGTGTGTAATTGTCAACTTGATGTTTCTGCCTACACCATTTTC -0.25164845 0.101406 1
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.6378336 0.101436 1
319929 TGGATAGCTGTCAATGTGGCCCAAGGCAAAAAGTGTAAGCTTACTGAAAAAGAGATTTGG 0.45376651 0.101455 1
24109 AGATTGGCGTGTAGCATTATAGACCAGTATTCCATATCAATAACTTTATCCAGCCTTTTG -0.29987508 0.101571 1
100017 TCTGGCATCCTGAATCTCAGCCAAACTAACAACATCTTTCCATCGCTTGTGAAAGCTGGT 0.67961548 0.101583 1
68515 CCATCAACTGAGTGTCCTTCAGGTCTTACAGCAGAAAATAAAAAGTGGATGTCTGGTTTC -0.1524988 0.101598 1
70383 CTCGACACAGCCAAAGAGAAAAAGGAAGAAAGGCAGTGGAAAGAGATGAAACTTCACACT -0.2121992 0.101621 1
29862 GCTCCAGGCCTCAATGTTCCCTTTCTGCAAAATGGAATCTATCTATAAAGATATCTGAAA 0.55610879 0.101665 1
19352 GGAGACATTTGGGGAGAAATTGATACAAGATTCTCATTTTGTGCGGTGGCAACTTTGGCT -0.25554586 0.101716 1
231014 GTGTGACTTGGATATTATTTTTGAAAGAAGTTTGACGGTGAACTTGATCAAGCTTGTGTA -0.22416286 0.101756 1
77519 GTGGAAAGGCCTTTAAAAATATGTCATACCTTAATGATCACGTTAGAATTCACACTGGAA -0.17172213 0.101788 1
22268 CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG 0.24595937 0.101794 1
70556 AGTGTTCAAAACTGAAACAGTGAAGGCCATAGAATACCTGGCTCATGTCACCTGTTGGAC -0.14400155 0.101825 1
66977 ATCTTTGTAAACTTGAAAAGTGCTCTGGAGAAGTACCATGAGGGCATCGAGAAGGTAGCG -0.5731873 0.101827 1
57782 GTTTCGCAATCTCGGCTTTGAATCATTTGTGAGAACATGTCAGCAAGGATTAAAATGACT -0.14219991 0.101828 1
544807 AAACAGGTTTCCCTTTTCTACTGCTGGTTGTTTTGAAACCAACTCACACAAAACCACCTC -0.21155156 0.10185 1
317758 GGAGGCAGCCCTGAAGTACATGATCATCTTGTTTACTCACAAAGAAGACCTTGAGGATCA 0.47708331 0.10186 1
320782 CCTCTGTTATGGAAATAGAGATGGAAGAGCTTGATAAATGGATGAACAGCATGAACAGAA 0.33604704 0.1019 1
212569 TTTGGCCTGATATAAGAACTCATTACACACTTTGGATCATGCAGATAAGTCTGTGAGGAC -0.1449799 0.101913 1
11553 TGACTTCCTATGACCTGAAAAAGGCATCTGTCTGGGGGAGGAGAGATAGCACAGGCAATC -0.50548615 0.10192 1
56376 AATGATGGCGTTTCGTGTTTTCTTCGTTTCTATAATGAATAAAAGCGTGTGATCCTGCTG 0.22504062 0.101936 1
78243 ATGTCCAAAATTCAGCTTTTCCTTGTCATCACACATCTGATGGTATACGCAACTGCCAAA 0.16415651 0.101958 1
20523 AGCACAGTTCCTGCTATGTATGCTTTTGACCTTGGTTCTCATTAAAGTATTTATTGGTTG -0.18889128 0.101962 1
238692 CCTGTACCTCTGTATCTGTTGTTGTGGTATAAACTGCTCCTGGAATAGGCACCTATGTAT -1.01330444 0.101993 1
67724 CTGTCTCTGTCACCATCTGATTTAAGATATATTGTGGAACTGCGTGGAAACAAGAATTAA -0.41805309 0.101996 1
140484 AGGAACTGTTGCTGAAGTGCTTCCTTTATATCCTAATAACTCTTCCATTACCCGTGCCGG 0.15508622 0.102009 1
545600 AGCCTAGATGCATGTAACCTGTGTTCTTGGACTTGGATCCATTGTACTACAAGTTAAAAA -0.21481046 0.102013 1
12176 CTGTCCCACACTTAACTCAGGTGTGCTAAAATAAAAGTGACATTTTAACAGTCTTTTGTT -0.14922727 0.102034 1
171382 TAAGTGTTGACACTCCTTTCCCACGACTGTGACTCTGGCCCTGATTTTATACTTATACTG -0.22469945 0.102036 1
16427 GAGGCCGAGACCTTGATGGGAAGAGGATGCTCCCTTGTTACAAATAAAGAAGGGCAGTGT 0.48469393 0.102045 1
67252 CGATCACGCACATACACATTCAGTTGTACTTTAATAGTCAAAATGAAAATTGCCATCACA -0.24019179 0.102081 1
51800 AACAAGAGATCCTGTGGATGAGGGGGTTTGTATAAGTTAAAATCCAATAAAGCTTTACCT -0.55445141 0.10209 1
11857 AGCTCTCCTTTTGTGGGAGACACTGTAAACAACACCAAAGGAAAAGAATAAAATCGTTGT 0.88110552 0.102115 1
71973 CTGTTGTAATTGGTGACCCTGTGAGAATGTGAAACTGGATCATAAATGAAATGCAAAATA -0.18274645 0.102152 1
56861 AACAAAGAGGTTAAAGAAGCCATGAAAAAACTGATTGCTAAAACACATTGGTGGTCCTGA -0.15509133 0.102152 1
22598 AAGTGGTGGGAGTCATTCACATTTATGGGATGAAACGGTTCTGTGATGACATTGAATGGA -0.16495357 0.102156 1
93887 ACTTTCTGGTGCAGTTAACCTTTTATCTTTGGCAAAATAATGCCCGTTGATGCCTTCTTT -0.29029505 0.102229 1
13024 AACACTGTGGTGTAAACTCTGAGGCACATTCATGCAATAAAACTACTAGTTTTGGCAGTC 0.54056861 0.102243 1
19226 ACTGACATATGCTGCTACCTTTTCAAGCTTATGAAGATCACCAAGTGCTAATACTTCTAC -0.14907346 0.102248 1
226791 TAACATTTTTTCTTATTTGATCCTCACAAAAATTAAGGTTTTTGAAACAGCCCGTGCCCC -0.20657433 0.102257 1
67897 CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT -0.29705202 0.102274 1
72397 TAGGAGAAGCCATTGTTGCTATGACAAATTATAATGAAGCTCTAGCTGCAGTTAAAGATC -0.34237518 0.102291 1
107526 ATTCATGATTCTCTTGCTCACCAGGAAGGATGACTTAGAAGACACTGATATCCATGAGTA 0.67096072 0.10235 1
232334 TTATGAAGATGGACCTGTTGAACTACCAATACTTGGACAAGATGAACAACAATATCGGCG -0.24141891 0.102355 1
242050 CCTCATCTTAACAAATAAAACAAACAACGACAAAGGAATAACCATAGCCTTCATGTGCAA -0.16769776 0.102359 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.16721339 0.102365 1
20595 ATGAAAGTCAAGTTTCCACAGACGACAGTGAACACTCCTCCAGATCGCTCAGAAGTAAAG -0.17625508 0.102488 1
330695 GGACGCTGCCTACCTATAATGCACGGTACAGTTTGCCTCAGAGACAGACCCAGAAACCCC -0.21227816 0.102519 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.38465329 0.102523 1
619326 ACCCAATAAGTGGCAATCTTATAGGGGACCATTACATGTTCTTAAAGGACCAGGAAACAT 0.73667334 0.102532 1
30049 AAGACATCCGTCCTGAAATGAAAGAAGATATATACGACCCCACCTATCAGGATGAGGAGG -0.22133381 0.102536 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.18847594 0.102545 1
78267 AAGTCAAGCGGTGGAAGCACTGTGTCTACGGGATGGAGTCTGAAGACCTGGTGAGACCCA 0.25631907 0.102572 1
547253 TGACTAGCCAACCAATGTTACAGACACTTTCATTCAAAGTAAATATGTCATTGTCTTCAC 1.36884118 0.102612 1
12479 TCTGGGGATGAAGGAGAGGAATCCTGAAGAAGTGAAGAGCAGCCAGTACGCTCTTTTCAA 0.2638825 0.102643 1
71675 TCAACTGGCTGATAAAATATGTTAAACGGAACACTAAGGAGAGTAAAGATTGTGAGATTC -0.19670077 0.10265 1
20755 GTTCCCATGGAAACCAACATCATTGTATAAACCTTTGTGATATCAACTTCCTATAGATGA 0.27747531 0.102666 1
20021 TGGTTTTCAGGCAGCATGGGGGGAAACACACACCAGCACGGAAAAGAAGGAATATTTATT -0.15788725 0.102722 1
66988 TTGAGTTCTTACTTCGATTCAGTAAAGACAGTTCTTAGTTCACTCACAGATTACTCCATC 0.47372584 0.102723 1
16536 AACTCTGGAGTTAGCCAGGATTTCCTGCCAGATGAATGTGGTCTCTGTATCTTTCTTTTT -0.64109125 0.102726 1
70789 GCACTTTTATACTGGACAGCTGTTCAACATTCCTGCCATAACAAAAGCTGGACATGCAAA 0.33842994 0.102736 1
27027 GCACTGGAATCGAATCAAGATTGCCAAATGCCAGATACTGATCACCAACTTCCTAGTCTT 0.29282441 0.102752 1
320865 AGCTCACTGGACTCCGCAACCACGCAATCAGACCAGGATTATCACTACCTTGGAGACTGG -0.37839348 0.10279 1
74923 CTTTTCACCCTTAGATACTGCACTTCATTTGTAAAATGGAAATAAAATCACTCTGATCCG 0.74779125 0.102808 1
232934 TAATAGTTACTGTTCATGACTTAAAGAGAAGCAACGTGTGGGGACCTCCCTACTCCCCCA -0.20960781 0.102824 1
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.13663128 0.102875 1
14680 TTATTCATTATCTGTCTCTCTATCTGCATTGCTAGGGATGAGCCCAGCACCTAGAGCATG -0.20582503 0.102888 1
239650 ATCCTTTCTTAGTGCTTTGCTTGATGTCAACCTTAATAAAAAGGCACCATGTCCCCTCTT -0.1848724 0.102912 1
67718 AAGACTTCAAACAAATGGTGCAGGAGGAGCACATGCTCAGAAGATTATCCATTGCCCGAT 0.16546277 0.102922 1
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA 0.19872204 0.102926 1
224344 CATGCTTATGAATGACAAAAGCCTTGAAACAGTAATATATTGTTGTGCGTTTGCATTTGC -0.24968819 0.102936 1
66662 GCTGAGGACTTGTTAAATAGGTAAGATTTTACAGTGGAGAAACTGTTGTGAGTAACATGG -0.15998082 0.102938 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.24056273 0.102941 1
18503 TCAATTGTTGTAGTCATAAACATATTACTGGTGAGAGTCTGACTTCACCTGTTAAACATG -0.28075988 0.102943 1
16992 AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC 0.27703281 0.102957 1
18140 AGCTATACGGCAACATCAGGCTCTTGAATGACTCTCAGCTCAACAACTGTCGGATCATGT 0.14455253 0.10299 1
69824 GGTTTATGGTGCAAACGTTTGTGTCTAGAAAGCCTCCATTCAAGCTACTCCAATAAACGA 0.17279819 0.10299 1
13929 TTGCCCTATCTGCTTACGAAAGCTGCAGAGTGCCATTGGCTTCAATATTGTGGAGAGATA -0.16720478 0.102998 1
19325 GACTGACAGTTTTGTTGTTTGCATAATTATAATCGACATTGTACAGAGAAAGGATAAGGC -0.20728459 0.103041 1
381417 GGTGGAGGTGAGGGGAGATATTTTTAAAGTTATATTGGAAACATGTGTGAATTTAAAGAC 0.26717071 0.103043 1
16184 GTGGCTTCTGTTTGATCTCTCTCAATGATAGATTGTGACCTAGAAGTATAAGCTAAAATA 0.70346259 0.103096 1
57376 CCAGAAGACGAGAAGAAGGAGTAAATGTTGCCTTGTTTTATGTGACCTAAAACTTTTTTA 0.26346251 0.103097 1
100040257 TTATGTTGTTTGAAATACTTTCCAGACTGCTAGGAAGTGTCCCCAAGTGGGGGGCATGAA -0.24134183 0.103098 1
434377 TGTATGGTCATAATCAGTTTGTTGGAGTATTTAGTTGGTGTAGTTATAGTTTTATGAGGA -0.19749812 0.103104 1
20682 ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC 0.26825383 0.103132 1
21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG 1.48369448 0.103139 1
114643 TGTCTGTGTGAGGGTGAGATTTGAAGCACTGAATTAAATCACAATGCACTGACTCGAACT 0.462405 0.103184 1
57444 AAGATGCCAGGGCCACAATGGAGCTCTACAAAATCTCTCAGCGACTCAGAGCCCAGCGAG 0.87567105 0.103278 1
21788 ATACTGTAACTGATCGCAGTACTGTAAATAACATCGTGGTTCCCCAGTCTCCCAAAGTGC 0.25052517 0.103287 1
239554 CATGGAGAGTCCCAGTATGGGCAACTTAAAAAGATCCTCTCTCAAAGAAACTTTAAAAGG -0.19434213 0.103308 1
77037 ACCGGGACAAAACCAAGTTTACAAAGAGGACCATCACACACATTGATAGTGCAGCTAGGA 0.43527784 0.103318 1
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.19042591 0.103343 1
73942 TTGACAAAATCAAACAGGTACAGCTTAACTGTTTGGACTGGAAAAGATGACATTTATTCC -0.21368534 0.103354 1
21374 GTACATACTTTTCTTTCTTCAGAGTACTCTGCACAAAAACGCAGCTTGTAAATTGTTAGA -0.17712022 0.103365 1
54367 TTTGAACTTAAAATGCTGCTCTTGGGAGTGAACCTTTAAGTGTGCATTCAGTTTTTGAGT -0.21581179 0.103396 1
258701 GGTATTTTCAACACTGTCATCAACCCTATGCTAAACCCACTCATCTACAGTCTTAGGAAC 0.25544847 0.103485 1
20606 ACGCCTTCTTGTCTGACAACTTCAAGAAGAGCTTCCAGAATGTTCTTTGCTTGGTCAAGG -0.36952102 0.103485 1
16855 AGCACCTTTTCGACTTCTCCCATCGGTTCCAAGCATTCCAAATGGTAGACACGCTGGAGA 0.60130886 0.10349 1
66973 ACAGCGGACCCGAAAGACATGTATTCGTAACAATAAAGTTGCTGGGAATCCTTGCCCAAT -0.18148822 0.103507 1
66112 AGAATGTTCTGTTACCCCTGGACATGGTGCATACAACGGGAATTAAATACTCTCCCAAGT -0.32559079 0.103528 1
544881 GAGGAGTCCAGAAACAGAGACACATTAAAAACGTGTTGGTATATACACATTGTTTTCTTT 0.38118188 0.103547 1
19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG 1.21203994 0.103556 1
110460 GTCATCAAGGGCTCCAGAGTGAACAGCATTTTCATAACTTCCATGTTTATCGTCTTTACT -0.15658555 0.103585 1
319887 TCGGGCCCCTTCCCCTGCTTCATAACTGAGTGTCGGAATTAGTAAAATCGAACCTTGATC 0.18783601 0.103605 1
268749 ATTCGCTACCTACATTTAGCTCCTCAGCCCGCGGATGGAGAGGATCTGCCTGCTTACCAG 0.25197558 0.103616 1
21936 CCACCAAGAGCACCACGTTTAGCACAAGATCTTGTACAAGAATAAATACTTGTCTAGTAA 1.25076779 0.10363 1
230979 CCGAGGAGGAGACAGCCTCCAACTGAACAAATTCTGGGTGACAAGACACCGAGGAGACGT 0.40803253 0.103669 1
436062 TGGGGTCTCGCTTTCTTTATTGGCACAGTAGGCCGCTCTACCGGCCTATACTCCCTGTGT -0.30192798 0.103745 1
18617 TGGAGTGAGATGGGGAGAAAGATGCCCTTTTGCGACACCGAGATTTTGATTTGATCACAT 0.4496355 0.103747 1
78926 TGATCAAGGTCTCCGAGGGGAAGTACCGAGTGGGAGACTCCAGCTTGCTCATCTTCGTGA -0.14854047 0.103782 1
28030 TTCACTTCAGGTTAGCCTGGCAGAAAACTAGTTTCTTAAAATAATAACAATTCTTCTTTC -0.14283206 0.103786 1
240396 GTAGGATAGTTGATTGTCAGTATTGAATCCTAATCTCTAGCTGCCGTCTTGTAGATATGG -0.17682681 0.103795 1
21753 CCATCCTTGGGTGTTTTTAATGTTTTCCCTTGTATGCATTCATACATAACTATGCACTAT 0.86127608 0.103809 1
15529 TAATGGCCTTAATTCATACCTTTCTGTCCAATTACAGCTGTAATTCACCATGTTAAAAGG 0.229683 0.103831 1
57394 TTTGCATTGTTACAGTTGCAATTGCACTACTGGTTCTATCTGGAATCCGGCAACGCAGAA -0.15370547 0.103842 1
353211 TATGTGCTTACATGTAGTACTGTATGGCTGGGTTCAAAGGACACTGATGCATCCAGGACT 0.57977629 0.103895 1
17318 AGGTTGGATGTCACCACCACAAGGGAAAACAAACACATGGGTTTTTCCCCAACACGATTA 0.20697418 0.104078 1
109032 ATATAAATGAAGGTGAACATCGCCTATGCCATCAACAAGCCATTCCCCTTCTTCGAAGCG 0.6850715 0.104196 1
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.6528307 0.104216 1
66816 CACATAAGTTATGTAGTTCTTCTTCAAGTTTGTGAGCTTACCATATGAACATAACATGCC -0.21084162 0.104289 1
52276 TCTCCTATTCTGTTGTCATTTGTGCCCTCTATGGGCGGGTGTGTTTCAAGTTGGTTTTCT 0.27778409 0.104302 1
17532 GCTTTCCATGCTGTGGGTAAATTCTATGTTCAGATATGGACAGTGTCCCTGTTTGCTCTC -0.18856225 0.104412 1
67458 TTAGCAAAACTTCCCTTTTTATATGAGTTGATTCTTATTGTGTATGTAAACTGCCCCTGG -0.18262754 0.104422 1
233016 AATAGAGGGGTCAATAAATTTTTAGCCAAAAGCTTCAAATTCTTTCAGGAAGCCTAACCC 0.25424935 0.104443 1
237730 ATGGAGAACGGGGAGAAACAGGAGTACCGCACGTGGAATCCCTTCCGCTCCAAATTGGCA -0.29117952 0.104447 1
70310 AGCTTCCGATTGTGGCACTCTGAGGGGATCCTTGCCTCCTCACTAATAGCTGTAGCGGTT 0.16374734 0.104455 1
240888 ACTGCACTTGCCCACCCAAGAGGAGGAGCTCCGTGACATTTGAGGACGAAGTGGAACAGA -0.22999907 0.104476 1
238393 AAGGTTTAAGAAGGGAACCTGCAACTGTGGTCCTATCTGCAGCATCTGAAATGTTTGGTG 1.26330308 0.104573 1
71928 GAGTGGTATGCTGTAAATGTTTTATAGAATTTAGTTGGAGATACAACCAGTATTGAAGGG -0.24729846 0.104606 1
18127 TGTAGACTCCCTTTAACTCTCTCTCTGGAGTATCTTACGTTTAAAGTCTAAGTCATCCCG 0.22487777 0.104606 1
666021 ATTCATTTGGAAACCCATCTCCAATCTCCAACTCAGATACCATGGTCAGCTCCTGTTGTG -0.25682701 0.104618 1
22717 CTCACTGGGTGTATCAACACCTCAGGGCCCACACAAAATAAACTTGGTGGTATTTTTGTG -0.14888447 0.104622 1
13649 GTTGCAAGCCACTCTAACTGTAGCAATGAAACCCTAGTATTTTTGTACTTTGAAATACTT 0.16769953 0.104634 1
77604 GGATTGCCTTTAGGAGAAGCTATCGTTTCTATGACAAATTATAATGAAGCTCTATCTGCA -0.30059729 0.104648 1
58179 ACAGCAGACAGCTGTACAACTTTACATCCATATCTTTGTAAGTGTAAATTCCCCATCTGA 0.5449092 0.104687 1
271970 CCGTGATGAATCATGAGTGAGTTGACCAAACAGAATGCTTTGAATCCCTTGAATCACGAG -0.59232048 0.104704 1
233328 GCTTCGTGCCTGTTGGCTTCTGGCAACGGTTCATAGCACGGATGCTAATCAGCTTGGCTG 0.70447699 0.104767 1
54698 TGACAAGAGGCTTCCTGACTAACCATGAGCCAACCTGACAGGCCACTTTTATCCTAATTA 0.36818896 0.104787 1
56323 GGGTTCTTAGGTTTTCTCACTTTGACAAGCCCCTGAATGTTTTTATAGTAGTTTTTTGTA -0.3475481 0.104852 1
229333 GTGATGTGCTGGTAATTCTGCTCCTTGTGTATGGTTGTTGGACATGTTTGGTGCTTTTTT -0.16753419 0.10487 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.52606969 0.104871 1
81006 GATATACTACTGGAGGATTAAGAAGTTCCACGATGCCTGCTTAGATATGATGCCCAAGTC -0.20600211 0.104893 1
15951 AGTCGGGAGAACCTCTCTGGAACCATACTTCTGAAAACCTGAATGCCAATGATATTTTTT 1.35334325 0.10491 1
56205 GGTCTCTCTGGTTCTGCAGAACAAGTTGAGGATTTAGGATAAACTGTTCCTTTTAAAAAA -0.16253761 0.104943 1
66251 ATGGTGCCGATTCCTACTGGAAGAAAGACAGCAGCAGAGACCCCGAGCCTGCCATGAGAA -0.15239029 0.10498 1
214932 CTTGCCATTACTTCCTGGGACAGAGAAGACTGTAGCTTCAGTAGCTACAGAAAGCCCTTG -0.23454792 0.104982 1
72139 CGTGATACATCAAAATGTTAAATGTATAAACCTGTTCTCCAAAGCAAAAATAAAAGGGTC -0.21879095 0.105109 1
232493 CTTTCCAAAGGGGAAGAAAAAGCTTCATGGAGAATATAAGAACTGACTGAGCTCAAACGA -0.16656462 0.105128 1
67872 TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG -0.15526151 0.105167 1
277939 GCGGAATGCCATGTTGATTTCTGCAATGAACTCCAACCCAGATACTAGTATGCTGCTTGA -0.19619775 0.105189 1
57916 CCTGGAGAATATAGCCTGGCTCCATTTGCAATGTTCCCTTAAATTGTTTTTATTAGTATA 0.5959683 0.105243 1
66044 ACAGGGCTGGTGTTAGGCAACCAATAATAACATATTGTATGAGACTTTGCATCTTGTACA -0.17628938 0.105246 1
243548 GGCAGAGGACAGTTGCATAGCAGGAAAAGACAGAAGAGCAAAAACTGTATCATTTCGTAA -0.2488842 0.105275 1
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.17424593 0.105291 1
18754 ACGTTCCTTTTGGACCCCTACATTGCCCTTAACGTGGACGACTCGCGCATCGGCCAAACA -0.31822991 0.105294 1
23900 GATCCTGTGGGTTTGGGGTGCGTGGGAACGCACTTCTTCAGGACAGGAATAAAGCGATTC 1.250144 0.105396 1
13548 TTTCTGCTAATACAGGTCCTGCACATTACATGACTGAAGGACATCTGGCGATGAGACAAG 0.29970168 0.10542 1
75778 ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT 0.26379129 0.105436 1
233905 TTCCCCCAAGAAGGGCATGAGGTAGTCTTCATGTCTGTGCCCATGAAGGATGAAGGATCT -0.20285676 0.105441 1
67949 GTAAGAAATGTCACCATCTCCTGTTGTAAGTTTCTGTACCCTTTCTATGCTTTTGTTTTA -0.16467696 0.10545 1
75873 ATTTCAAAATCTTACCCATGGCTTACAAGTTCAGAACAGTTACACACTTAACAGACTCAG -0.34140965 0.105458 1
74513 TCTCCGCATCCAATCTTGTTCTATCAAATTTAGAAAGCCCTTCATAACTTATCATAATGC -0.1940693 0.105488 1
12563 ATTATGACTATTTGAGTGACTGGGGCCCTCGGTTCAAAAAGCTGGCAGATATGTATGGAG -0.48610021 0.105493 1
193116 ATTGTGTTCTATCTCTACCTCGACATGGGTGGTTCAACACAAAGTCGGTTATTGGTGTCT -0.20082097 0.105503 1
19652 ATGACAGTCGTCCTGGAGGATATGGATATGGGTATGGGCGGTCTAGAGACTACAGTGGCA -0.29624982 0.105541 1
53877 ACAATGCAGATACCAAACGACAGGTTCAGTGAAGTACTACAGAGTAGCCTGTGAGAACAG 0.18693233 0.105549 1
258089 GGGATCGGTATGTGTCTATGCATGTCTTGCTTTTACTGTGTTATGATATCCTACTTTTAC -0.23900742 0.105552 1
71827 TGGCAAGTTTACAGTGGATTTTGAGAGAGATCAAAGTTCAGAAGTCAAAAAGTATTCCAC -0.31198276 0.105566 1
23853 AGACAAGATCATACGCCCCTCCCTCCAGACCAAGTTATGGAGACATACTTCCAAATAAAA 0.36399941 0.105597 1
68790 GAAGATGATGGTGACACTTTCTGGGAAGACCTTCCCGGATCTCCAGAGGTACGGAACCGA -0.17763597 0.105648 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.38373099 0.105657 1
52398 CGAGTAACTTGGTGTCTGTTATCGTAGTGTGGTGCCAGGTGACCTATGCATATATCACTA 0.20304756 0.105675 1
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.63640957 0.105749 1
100191037 AGATGTAGCCTCCCAACTTGTCCCTTGTGACTTGATCTCTCCTCCTGCTTCCTAGGAGGC -0.15876004 0.105777 1
225280 GCAGACTGACTGCACTTGTGACCTTGTTTCCTGGAAACAAACATTTCTGCTGTCAATCTG -0.2443573 0.105784 1
74252 CCCTTCTGTGCCTTTTTTATTTTGCCAACCATGTTTTATGGAAAAGACATTAGCAATTAC -0.14283285 0.105791 1
100043407 AAAGTGGATTCAAATGCTAAACGGAACCAAGCAGACCGAAGACTGCAGAAAGGAAGGTCT -0.27719167 0.105807 1
327900 TCAATAGGTCGATGTAAGATTGGATCAATACTTGATGTGTATCATTTTAGTATGTAGGGG -0.20601834 0.105838 1
20295 TTTGGAGACGCCAGGGCTGCTGTCCATGGTTTCAACATAAAGCGGCCTGTGACCAGCAGA 0.84208735 0.105871 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.17366608 0.105873 1
108654 GATCTGAGAAGTTACATTGTTACAATTTGACATCAGTTGTGTCATAAAAATGCTGTTGCC -0.20756265 0.105935 1
72124 CCTTCACTGAGCTCAAATATTCCAAATCTTCAAAATTCATTAAATGGAACTTCTGCTAGC -0.24822296 0.105956 1
12035 GAGCAGGACACTTTGTTTCTTTTGCTGGTGAGGTTCTTTTGTTTTTTGTTTTGGTTGTTT -0.25288595 0.105991 1
20743 TCACTGGGGACAAAAGAGTGTTCCCACAACCTTCTCTTCTGCTATTTAATTCAACTGGTG -0.31233808 0.106014 1
14560 CTACACGTGCTTTTATACATGCAGTATGCACATGTAATCACGGTTGATTTCTTCTTTTAA -0.36484013 0.106024 1
17305 ATAGAAGGGTTTCTGGAATACATTCCCAGCCCAAGACCCCATCTTCCTACTATGAATGTG 0.47544418 0.106052 1
433198 CTCTTCATGATGGATTGATTGTACCACTTTGTAACCTTAAACTGGAATAAACACCTTTTC -0.27471924 0.106055 1
236930 TGGTAATGACTATGAGAGTCTTGTAGCTCGTGGGAAAGAACTGAAAGAGTGCGGGAAGAT 0.20592601 0.106106 1
NA 0.66687492 0.106111 1
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.65900593 0.106117 1
66169 ACTGCTTTCCTGGGACTTTCTGTATTTTGTTTTGGCCTTTAAATAAAACTGTTTAGCATC -0.18657058 0.106157 1
12035 ACGATGGAGAATGGCCCCAAGCTTGCAAGTCGAATCCTGGGAAAGCTGACTGATATCCAG -0.25451178 0.106217 1
666794 ACTTCCTACAATGGATAATTTTTATGGACTCTCTCCATTGTCACTGGATTTAAGTATTCC -0.27380866 0.106221 1
320377 CCTGATTGATCAGGAGCTCACGACCCTGAGAATCAGCTGAAAATTTATAAAAATAAAAAA 0.9014551 0.106235 1
69149 CAAATACAGGGACCCATGGTATTCAAATCATTTCTAAAAGTAATATTTGCATGAGAGCTC -0.18322052 0.106251 1
14429 TGGAGTATGGAGCCCAGAGGGGATGCCTTGCGCGGTGGAGAGACTAGACTAACCCTGTCC -0.29181209 0.106258 1
252967 CATTGATACTTGTTTAATGTTGAAGCCATGCTTAGGAGAAACCTTGGCGCCAAATACAGC 0.3185037 0.106311 1
76561 GTGGAATATTAAATTTTTCAATATGTTGCAAAGACTTGGTTTTAATAAAATCTTTAATAA -0.22841471 0.106326 1
232969 GAACCCACTGAGACTGGAGGCTACGCCAGCTTGGAGGAAGATGATGAAGACCTTTCCCCA -0.18172036 0.106352 1
16164 TAAGTGGTCCTGTCAATTCTGTGTTTTATTGAGAGGGAGACAAATGGAGCTCCAACTATT 0.33719556 0.106369 1
320165 ATTTCCCTTTTTATATGTCAGGTAAATATTTGTAAAAGTTATACTCACACAAAAGAAATT -0.2081686 0.106412 1
232449 TAAATACACTTAAAACTGTGATAAAAATGAGAATGGGTGCTATAGCAAGGGGTTACTCTG 0.25729368 0.106416 1
15260 TTATGCTCGGTACCTTGTGAATGAAGGGTTTGAATACCGCCTCCGTGAAATATGCAAGGA -0.18585545 0.106462 1
18514 CACGATGTAGGTTTTACAGTCTCCTAATTTGTACTGGTAATGCAGATTCCAAATAAATAG -0.23378146 0.106495 1
12193 GAGCAGTTGTTTAGTTTGTATGTAGGTACAGTTGGAGCACCGCGTGTGCACTCTGGACTA 0.333076 0.106563 1
65962 TGCAGTCTGCCTCATAAGCCATAGCGCACGCGCGCCCTCAAATTAAACAGGCCTTGCCTT 0.32408646 0.106574 1
16997 AAATGCACTTCCATACAAGCTAGCTGGGGGTTCAGGAGCATGGGGGAATAAAATGTTCAT 0.3809558 0.106578 1
17067 AGCAGTTACCTGCCGCGCCTCTGATGGATTCTGCATTGCTCAAAACATAGAATTGATTGA 0.88942565 0.106602 1
12386 TCTAAACTTGAACTCTGACTTTGCTAGACATAGAAGGCTCAGTGGTGGAACGTTAGCCGA -0.18352314 0.10662 1
20846 AGTGCCTGCCTTGCACCAGGCACTATTCTAGATGCGTTGAAGGCACTAATAAAAGAAATG 0.80062096 0.106626 1
24058 TTGCCTCTATCCCTGGGCCCCTCAGGAAAGGAGTGTGGCCCCAGGGTGTCACAAAATAAA 0.3933229 0.106653 1
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.29364596 0.106707 1
11846 AACTCTGGGAATTAAGTATTTCTCCATGACTGAAGTAGACAAGCTGGGGATTGGCAAGGT 0.55050687 0.106742 1
28028 AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG -0.19591548 0.106758 1
15900 AACAGACAGGGTCGACAGAGTGTGTGATACATGCAAACAGAATCCTTGGAGTGTGTGATA 1.06420264 0.10677 1
67239 TGACCTGACTGACTACGAGCACTTTCTTATGGTTGTTTACTAAAGAGAATTGCTCTACTT -0.16129877 0.106772 1
14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA 0.97829397 0.106779 1
100042092 GTACAGGGCGTCAATAATAAAAAGAGAGCAGCGTTGGGGGATAATGTCGACATTTCCACT 0.26684355 0.106796 1
76357 CCCAGTAGACTTTATGTAAAGAAGTACAATTTGTAAGAGGTAAACTCTACCACACAGATA -0.2173972 0.106835 1
50778 CCCTTGGATAACCAGTCCAAAAGTATATAGCGCAAATAACAGTTGCTATTATTGACATGA 0.81608856 0.106855 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.37979398 0.106912 1
19652 ATGGCCAGAAAGTGATTTCTGAATGTACCTATGAACAATCCGAGTCAAGATCATGATTGC -0.26158747 0.106929 1
243655 TTGGAGTTTACTATAATGAAACTCGCAGACAGTGGCTGTGGGAAGACCATTCGGTTCTAC 0.38148436 0.106955 1
18730 CAATGTTCTACACTCTGGGAAATAAAGCTGATGACCCAAAGTTTTCTGTCAAAAGAAAAA 0.46494133 0.106963 1
360216 TGATGATGTCACCATCACATTTTTGCCTCTGGTTGACAGTGAAAGGAAGCTCCTCCATGT -0.18182417 0.106964 1
58809 TGCCTTATACTCACATATATCCAATATAACCCATGGTGTTAAGCGCATCCCATCCAAGGG 0.70236055 0.106983 1
28078 CAGCAATCAAAAAGGAGAGTTCAACTTTTTGGTTTGCATAGTTTGTTTTTCTGCTTGAAC -0.22955799 0.106989 1
67922 CCAGATTTGGGGAATAGGGAACACAATGATTTTTGTAATATGTAATGAGGTGTTGCAGTG -0.15630268 0.107014 1
58205 CTGGCAGCCTCTGAAGTTCTAATTAACTGGAAGCATTTAAGCAACACGTTAAGTACCCCC 0.56233399 0.107022 1
229900 GGAGAAGAATAGCTCATTGGGTGCAAAAATCCTTGATGGGTTTGGAGATGTATTAATTTC 1.39552021 0.107041 1
77573 TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT -0.24249009 0.107057 1
65972 GGATGATATGGAGAAGAAACTGGGACCGTGCCTGCAGGTGTATGCTCCTGAGGTGTCACC 1.06956922 0.107112 1
665536 ATGTGACACTCACAAATCTGTCCATGGTGGACTCAATAAAGTGCACGTGCTGTGAAAAAA 0.64370124 0.107126 1
241846 TAAATTTGTTGCATGAGTAAATGTGTCAGATCTTCTCTATAAGCATGCATCCTCTGACTG -0.22310155 0.107146 1
66985 AAGTATGGACAGTGTATTCCTCCTGTGTATGTGCCTGCTATGTACCTCACTGTATGTGTG 0.20745622 0.107152 1
97209 GGAGAGGTGAATATGGTCAAATCACAGTGCATAAAATCCTCAAAGAACAATAAAACTGAT -0.35695032 0.107176 1
13830 TTTGGCACAAACTACCCTCAGGAATGCGCTGGGCACCAAGAACCTGTCTCAAATCCTCTC 0.25824801 0.107187 1
243906 CATACAATAACGTCTGTAATTCTTACTGCCAGTATTGTCAATTCATGTGAAAGGAAGATG -0.17117221 0.107219 1
67872 TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG -0.16253062 0.107257 1
12482 GCTGTGCTTTGAGATTCTTTCCAAATGGCAGAGTAGTTTATTTGGTCTTTCATGATTCAC 0.67029306 0.10726 1
56079 CATGGACCCCCCTGAAAAGAGACCTGTGGAGAGACAATTTGACTATTTCAGCATTAGCAA 0.23008492 0.107274 1
109791 TGAGATCTGTTTGAACAGTATGCAGTGTAAGAGCAGATGCTGCCAACATGACACCATCCT 0.14637642 0.107308 1
13713 GAACTGAAATCCAGTAATGTCCAAGTGATGGGTTTTTATATAAGAATGAACGAAGCCATA 0.41932395 0.10733 1
233812 TTAGAGGAAAGGTCCTTAAGAAGTGTTGGAAACTAACTTTGGATCTGTTCTTAGCTGTTG -0.20183816 0.107337 1
17071 TTTCAAATATGTACTTCCTAGAATGCCATTTTGTGTGGCTTGCTAATCTTGGCCCTGGAG 1.28593616 0.107347 1
100040067 ACTTTCCTGACGATAAATTATAGGACATGTGGGGGAAATAAAGCTCTGCCATGCAATATG -0.13858381 0.107349 1
243961 TTCTCTGACACTTAGCACACCCCTCACACTCATGGCCCTGAACTCTTTCCAAATGTTTAA -0.26192392 0.107352 1
73710 GGCTAAAATCACATAAACCTTTGTGTCCTAACGGTGTCCTCTTTTCTTTCTCTTCCTTTC 0.22751664 0.107372 1
232989 GGTGTGAGCCATTATACCAGCAAGGAGCTTTCTCTTGAAAAGTTTACACACTCGTGGCTA -0.28298124 0.107387 1
22756 GATGAGGGTCGCAAGGATTTGCCTGCATCAGAAGGCTCACAGGGGAAACAAACTCTATAA -0.27609299 0.107403 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.50983474 0.107446 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.92761246 0.107461 1
69794 TGTAAATTTGGCGAAGATAGTCCTGTGAAATAAAACCATCTGTATGGAGAGTTAGACTGG 0.17608796 0.107474 1
380664 CTCCCTGTAAGACAGATGGGAATGTGTATAATAATTAGGTATTTGAAAAGTTCTGCTTTG -0.20269468 0.107484 1
54632 GAAGTTCAGCTTTAGTCCCAGTTAACAAATATTGGCAATAAATCAAAACAGGAAAAACCC -0.14916506 0.107489 1
75458 CCACGTCAACCTTATCAGAAAAAGTCTACTAATGACATCGATGACAGAGAATAATTTTGT 0.27920396 0.107509 1
330788 GGATGAGCAGGAGGGATATGGAAACAAGCCATACGATTCTAGTTCTCTCACAAGTATTCA -0.1887254 0.107535 1
436440 TTGCGTTGAGCATCTTTGCACTTCCACACAGGAAGAACTCACTGGCTGCATCAGCAGAGG 0.19951432 0.107535 1
328594 CCCATACTCTCTTCTCTTTGGGTTGTTTGAGCTGGAGCAAAACTGTCCGTTTCCTTACTT 0.15437447 0.107563 1
74386 GATCCTGCGAATTGGCTTTGCATATGAGTTATTTGTGTTATTGTTTTAAAGAGACTAGAC -0.24506109 0.107578 1
328381 CTACAGGAACCCTGTGGACAGAGGGATAGCCCACCAGACTATCACCTGTTGTTTGAATGA -0.14544098 0.107584 1
66294 AGTAAGCACACCAACAAGTATGAGGGCTGGCCAGAGGCCCTGGAGATGGAAGGCTGTATC -0.14579305 0.107684 1
12176 CCATTAATCAGGATCCAAAGCTGCTTAAATCGGGCGTCCTCCCAGTCTTCTCTTTTCTAT -0.1570044 0.107743 1
75796 GTGTAAGTGGAAATTCTGATAATTTATGTGTATTATATGTAAAGCTAGTTTTGCAAAAAA -0.20131892 0.107821 1
27047 TAAAGATCAGAACTGCGTTTAAGATGTTGGTGAAAATGGCTTTACTTCATAAGCTTAGAG 0.43342745 0.10784 1
20682 ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC 0.27763321 0.107869 1
235459 GACAAATCAAAAGTGGTTGCCTTCATAAGATTATTCTTCAATAAACTCGTTTTAAAACTT -0.17048124 0.107923 1
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.71288442 0.10794 1
329252 TGGAGAAGAGCTCCTGCGACTCCACCCAAGCGCTGGTGGCTTTCTCAGATGTGGATCTTA 0.16205893 0.10795 1
140474 CTAACTTGTCATGGGTACTCCAGCCCAAGACCGTGGCTTGCTTCTGCAGTAAGGAGGAGC -0.25206735 0.10801 1
17261 CAAAAACTACCCAACAACAAAACCCAGATAGTGGACTGAAACCCAAAGCTGGCTTGACGA -0.24823374 0.108026 1
257885 CAATGCTGAATCCTTTCATCTACAGTATAAGGAATAAAGATGTCCACATTGCACTGAAAA -0.23797797 0.108034 1
215493 GCTGGCTCATAAGGGCAGCTGAGCATCCAGTGTAGTAGCCATAAGTGAGATGTTTGAACC -0.16754111 0.108035 1
230734 CTCTACTGTGGTTGACTTATCTGTGCCTGGAAAGTTTGGCATTATTCGCCCAGGCTGTGC -0.19885962 0.10806 1
236428 TTCTACCCGAGTGGATCCTGGCTTGGCATTGGGAAATAATGGGCTGGGATAGGTGCCCTC 0.24165036 0.108061 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.19212846 0.108064 1
105892 GCCCTACTGCGTGCAGAAAGAGTTCAGGGGCTGGAATGCTACCAGTGTTTTGATGTCCCA 1.80099901 0.108101 1
79221 GGTGATCTCTTGTTTTGTGTTGTAAATATATTGTTTGTATGTTGCCCTTTATGCCTTCTG -0.23846003 0.108117 1
15451 GGGGCGCTCTAGGGAGCCCCTTGTGCAGATGCTCTTTAAATAATAAAGGTGGTTTTGATT 0.49025674 0.108132 1
22268 CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG 0.19626855 0.108141 1
12515 TTTTGTCAATTGTTCTCCACCAAAGAATAAGAGTGGCCTTTTCTTTAACTTCCTCCGTGT 0.60989046 0.108146 1
670533 GCTTACTTTAAGTTGTCTTCTGGGTTCCATGTGTTCTCAATAAATCTGCATTTGTTCTTC -0.18041533 0.108193 1
14190 AAATACTATGTGTTCATCCTGAGTGTGTCTTTCTCAGGGTAACAATGAATCCATGTAAAT 1.17238347 0.108193 1
104418 CTGGTCTTCCTCCTCATGTATCCAGCCATTTCATTTCGGACTGTATGGCCTGGGGTGGGG -0.34255333 0.108201 1
68815 GGTGGTTTACTGTCCAGTCTGCCTTATCCTTAATCTGTTCATATATTTATTTACTAATGC -0.18479372 0.108208 1
68682 TATGCCCAGCCCTGTGCTTATGTAATTGCATTCCGGCCAGTTAATAAAGTGCCTCTTGTA 0.24646248 0.108277 1
70750 AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC -0.14644915 0.108278 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.14275932 0.108287 1
406217 CAAGTGGGGGTATTTTTTCTGTAAACTTTTGGTGTTTCCACTTAACGGTTTCTATGTAAA -0.20190607 0.108289 1
338346 AGGATGAGTAATGTGAGCACGGAATATTACTTTATAGAGTTTTGAAATGAAGCAACTGTG -0.33424077 0.108294 1
240476 TGTTCTCAACATTGTAAAATAGCCCCATTCCTCAAAGGCAAAATTGTTCTTGTTGTTTTC -0.17416031 0.108294 1
210789 CCATCAGGTTCCTGTAACGTCTAGAATTATTTCCAATAAATATGTTGCTGCCATTTCCTG 0.3069336 0.108295 1
12469 GGTGGAGCTACCGAAATTGAATTGGCTAAACAAATCACATCATATGGAGAGACGTGTCCT 0.27230342 0.108338 1
21335 AAATTGATGAGCTGACCCGGATCTGTGATGACCTCATCTCTAAGATGGAGAAGATCTGAG 0.15872878 0.108411 1
12962 TTTGAGAACCCAGCCTTCAGTGGGCGCAAGATGGAGATCGTAGATGACGATGTGCCCAGC -0.14036487 0.108424 1
18074 ACAGTGGAAAAGGAATTGGCCATTATGAGTTCTTGGCACACAAGTGAGCATTTTCAGTGC 0.26600727 0.108449 1
16069 CTGTACTAGTCTTTCTCTTAACCTCTCACTGTGTAGAGAAAACAGCCAATGAACACAGGA 2.1475712 0.108464 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.36656516 0.108479 1
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.25214159 0.108522 1
58188 ATAAACTGTATTGTATATTGCTGAACAATAGTTGTATTAAAAAGAAAACCTTTTAAATAG -0.23944552 0.108523 1
67138 GACTTAACTTTGGATGAAAAGAAAAAATTCCTCTTGTTTCTTACAGGATGTGATAGGCTG 0.58505969 0.108612 1
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.1796847 0.108623 1
66165 TCAAGTCCTCTACAAAAAGTAGGGTTCTGTTCCATGTGTCTGTGACACATTTACAAAATG -0.14875014 0.108653 1
83410 GTACAGAGTTTTCATTCCTAGGCTATTTTCCATCGACTTAGTTTTTTGTGCTAGTGTTAA -0.198358 0.108653 1
14343 TATTCCCTTCCAAGAGCAACTTCTATTCTTCTCAGGGAGTTTCCGGGCACTTTTTCCCAA 0.38254368 0.108722 1
114142 GGAGACTGTATTCATAGTAAATTGAGCATGTTGTTTTAAGCTAACAGATGCTGAGAGTTT 0.1676095 0.108724 1
259045 ACCAAACAGATCAGAGATAGTATCATTAAATTCTTTCACGGTGAAAAAGGTTCAAGGTGA 0.19677428 0.108767 1
58245 CAGTCAGCAAAATGGCAAAGTAATACAGTCTAGCCCGTGATTAAAACATTTCTATAGGTT -0.13518491 0.108769 1
75998 CAAATCACTCAGTATTTTGGGAATACGATGAATTTGTAGCACCTCCAGGTATATAAAGTA -0.32430191 0.108784 1
67826 ATATCTGCCAAGATGCCAGAGGTCATTCCCATCTTAGAAGTGCAGTTCAGCAGCAAGATT -0.22759202 0.108878 1
668101 CTCTGCATATGTATTGCTATCCCAGAACTTTAAAGCTGTGCATATTGAATTGTATTCTTG 1.26970248 0.108916 1
279029 TCCAGTATTAATTTCGTACCCCATGGTGACTAATAAAAGAAGCCCTAGGCTGTTTCTGGC 0.77358736 0.108919 1
14961 TAGTAAACCAATGTATGCTTATCCCCACCTAGATTACAAATAAACGAGACTCAGACTCTG 2.06408293 0.108919 1
442799 AAGGCACACTATATACAAATTTGTTATTTTATCTAGCTAAGACAGTAATTGATGGGAAAT -0.35450653 0.108965 1
211496 GGAGCATGGATTTCGGAGTGGTGTTTCTGTTGCTCGAAGAGGAACATCCAGAGTTTTTAA 0.31681699 0.109001 1
14894 AGGCCAAACAATAACTGGATAGCAGCTAAGGGGACAGACTCTGGATGTGAGTCTTAGTTT -0.1484381 0.109035 1
384763 AAGCAAATCCAAGAAGGAACATTCAGGCAAGAAATCTTTAAAGTGTAATCTTTGTGGGAA -0.38397966 0.109036 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.19648364 0.109039 1
66236 GCTTTACTGTGTATTCTTTTTGTGTTTTAACTTAACAGCCTGCACTAATGTGAATACCAC -0.2194591 0.109086 1
226751 TTTTAACCACATAGCACACATGGGTCCTGGAGATGGAATACAGATCCTAAAAGACCTGCC -0.23997964 0.109089 1
114716 CACTATATTTTTCAGGGTGCATTTTAAATACTATTGATTCAAACAGTGGTGGCTTGCGTT -0.26721824 0.109093 1
66361 TTTTTTGGTATCATGTAATTGCACTGGATATGTTTCTGGTAAGGAGTTTTCTCTAGTAGG -0.16106292 0.109122 1
26372 AAGTTGGGGTTTTACTAACTTCCTCTGTAAGAATCTTCCATTCCCCAGCTCCCCTAAGGA -0.2259418 0.109142 1
74114 ACTTTCTAATTGCCAGAGGGATAAAGCACACGGTTAGAAGCTAATTTCTCTGACATCAGT 0.15791738 0.109177 1
60532 TGCCCTGTGACTCCAGTATATCTCACCTGTACTGACCAAACCTAAATAAACATTTTTATT -0.20010044 0.109183 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.13955305 0.109192 1
20451 ATTGAAGCCGTGTGATTTAGACTTGATTGGGAAAAGGTTATATTGCATTTGGAAGTATGC -0.3013652 0.109211 1
78244 AAGAATTAGAAAATAGGCCCCAAGAAAATACCTGTATTACAGAGACCACAGAAGCCTGTG -0.18234512 0.109222 1
67973 AATAAAATTCCTGAGCCCTCTCTTAGTTTGTTTCCTGTTGTTTTAATAAAGACCATCACC -0.19924186 0.109229 1
74589 TTTCTAAGACAGGCCATCAGAAGGAACACGATGCTCCTTTGTGATGGCAGTTGCATTGAT 0.33061388 0.10924 1
108037 CGATGCCTGGATTTGATGAACGTTGAGGACAGTTGAGGACACCTGGCGGTCGGTCAGAAG 0.19895345 0.109266 1
28000 GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT -0.18511905 0.109276 1
232023 GCAGACTTGTGCATGCTCTTTCTTGGCAACACTTGGCTCATATTTCTTGTTCTCTTTTGA -0.22377915 0.109351 1
194268 CCACCCAGCTAAGGATGGAGACTTTTAAAAAGAAAGTGGCTTTGTTTTCTTACTATATTT -0.19457116 0.109421 1
403187 GAGCCTTTATTACATCTCTGAAGACCCTTTTTCTAAATGGAGACACACAGGCCCCAGGAT -0.19605443 0.109453 1
20973 GGATGGCCCTGCCCTCAGATTCTATAGACTAGTTTGGAGATGGAATAAACGGTTTTTCTC 0.77406583 0.109475 1
94047 CACTGGATTTAGGACAGGAAGGCTGACATTTCCTTGGTACATCAAGAGACATGGTCACAT -0.34779434 0.109481 1
320557 GTTACCTTGTTGTCTGTGACAGAAGTTAAAGTTTGTATAGATCATAGAGGAAAAGTTAGG -0.27303714 0.109518 1
270150 GCCAAGCTGAGAGTGGTCAAGCCTCACTGGGATGCAAATGTGCTGAGACTCCACACCAGA -0.43964172 0.109545 1
106512 CCACCCTGCTGCTGAGTCTGTCTGATGTTTTGGTTGTATGAATAAACATAATTCCCCTCT 0.80061361 0.109549 1
20724 CCAAGTCTCAGGGAACTTGTCTGTAGTCGCAGAGCTCTGTAAACTTTGTATCCAGACAAT 0.18641653 0.109549 1
386454 TGTTTGTACCACCAGTGTTGGGAAACAGTCCTAATTTACCTCCAATCCCAAAAGGCTCAG -0.4308159 0.109569 1
207686 CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT -0.25769124 0.109576 1
666244 AGTCCTGATCCAGAGGTAACTGTGGACATAACTGCTGGCCTGAAGGGAGCCTTGGAACCG -0.18984497 0.109673 1
72512 GCTGTATACAATCACAGTGGGCTGGCCTGTCAACTGCCTTCTTAATAAACATATCTATTC 0.72024326 0.109674 1
93689 CAATGACATTGGAAGCCAAATGGAACTAGTTTTACATATATAAATATATAATTTCCTCTT 0.21281855 0.109678 1
28042 TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA -0.20760103 0.109731 1
319229 TAGTTCTTCTAAGAAGAGCACTTCAGCGGCCCCAGAAGGGGCAGAGAAATAAAATGACAT 0.56283229 0.109777 1
75131 TTATGGTACCATGGGAATTTTCCTATGACCCATTGATAGAGCAAGAAAAGACACAACCCC 0.17885653 0.109798 1
67178 GGTACGACATGTTCCGAGATGCAGCTGCCATCTTGCTGGATGAACAGAACAAGCGGCCCT -0.16442066 0.109825 1
330177 CATTTTTCAGGTCCCAAGGAAGAGCATGATTAACTGTCAGGGCTTTTAATTATATTTGTA -0.22769308 0.10983 1
13078 ACTACATTAAGCAGATAGATCACCATGTATGCTAATTAGTATGCTTTTCGCTGTGACACA 0.68001263 0.109856 1
668572 AGAATCCATACAGGAGAGAAACCTTAAAAATGCAAAGAATGTGGCAAGTCTTTTGCTGAG -0.18412013 0.109859 1
227292 GAGAAAACGAACTCCCACAAGTTGTCCTCTGACCTCCTCACATGCACCATGGCACGAGCT 0.18472987 0.109864 1
66712 TCAAGACCATTTCATCTCTAGCTGCACCACGTGAGGCTCTCTCAGCTTTTGAAGAACATT 0.17541037 0.10987 1
17260 AGAGGAATAGTATGTCTCCTGGTGTAACACATAGACCTCCAAGTGCAGGTAACACAGGTA -0.37837419 0.109917 1
97112 ATCCAGAAGACATCGGAAATGAATACAGATAAACAGTATTTTTGCCGAACTCACTTGGGA -0.23697792 0.109945 1
639527 TCAACATTCCAAAATATGAGGAAGGAGGTGACATGATTCAGCCCAAGCCCTCCTTAAGCA -0.15448412 0.109997 1
233912 CTGGGAGAGGACCCAAGGGATGAGTTGGCTGTAAAGGAGGCTTCTCTCAGCCTGAGAGAA 0.18835837 0.110017 1
210962 CAGCAGTCCGGTCTTTCTGACCAGAAATCCAGTGACCCAGGTCAAAGTGGAATAAAAATT 0.23556093 0.110021 1
55951 GCTGCCTTATCAATGCTAAACCTTATTTGTCTTCATCAAGAGTAGTTCAAAATATGCAAC 0.28475738 0.110024 1
56378 GCAGCACCATCACGTGGAGACACATCATAGGACACACAGGCCGATGTGTCTGTTCATACC -0.15584334 0.110041 1
19188 AGAAGGGCATTAATAACTCACTTAAAGAAATACAGGACGAGGCTCGAGAGCTGCCAAGTG 0.59760181 0.11005 1
68152 TCGGCTTCAGACAGCAAGGATGGTTCAAAAAAGAAAAAGAAGTCCAAGGATGTAACTGAA -0.17136562 0.110085 1
276950 ATTAATTGCTATGCAAATGACTAACAAGAGTGAGCATCCTGTGGAGATGGGACAGGACTT 0.47659297 0.1101 1
272347 AGCCCACAAGTTCCGAAACCTACAGTAATTATATCTGTTACATAAAGGAATTTGAGATCT -0.14289166 0.110119 1
639826 GGTAAAATGTGTATTCTTTCTTCACTAACTGCCACTCTCACACATACTTGCTATTCTATT 0.15346477 0.110135 1
233812 CCTTTGGCACCACAATGGATTGCCGTTGCATTACTGCACCAAGAAGCCAATAGATCAAAA -0.16767542 0.110193 1
56693 TGACTTCCCCTTGTTCACACTCAGTATTCACGCTTGTCTTCATGGTTACACGTCTTCATG 0.27580272 0.110202 1
14991 CCTTCTCGATAAAAGCTGTACTTCATGCTGTTAAAAGTGTAAGATTTGTACATTGGAAAG 0.984685 0.11026 1
14263 ACAGAAAATAGCTAAGTTCCGGCATGTGGCACATGCTGAATAAATGCTCGTTGATATGTA 0.32846978 0.110263 1
214642 TCTGGAAACTGCCAAAAAGTATGGCTATGAAGTAGTAGACACATTCACTATCACAATGGG 0.25392211 0.110287 1
12725 TCGTTTGTTGAATAGCACAATTCTTTAATCTGCGGGACTCGTCCACTTTTTTCTTCTTTC -0.15028445 0.110289 1
18198 ATCCTGCAGCGCATGTGCGAGAGAGCAGAGGGAACGACAGATGGCAGAGCCCATTTCTTT -0.18757479 0.11032 1
15980 CAGGAAAAAGAAGTGCACGTGTTTCTTCTTTTCTTGTCCCTTACCACGTCGCCTTCTTTG 0.3634238 0.110351 1
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.64218968 0.110375 1
73754 TCGCCGTTGAGACTTAAATATTGCAGTTTCTGTTCACACTGTGGATTGTGTTCTGTGAGA -0.14896611 0.110399 1
70397 AAAGTGTAAGGGCTGAGGACACAGCAATTGGCACTGTGTTTGCTGATGTGAGGCCCTAGA -0.17171957 0.110408 1
70626 CCGACTCTCCAAATACTGAGATTAAAGGTGTGTGGTTCCACATCTGGCCTCAAAGTGTTA -0.2626349 0.110494 1
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 1.05966152 0.110549 1
68001 AACTCCCCGTGGGCTGACAACACGGCTTTGAAAAGACATTTTCATGGCGTAAAAGACATA 0.25494673 0.110549 1
66315 ACTCAGCACTTAACATTTGATTAAATGTTCAGGTAACAATTGTACTGAACTTGTGTGTCG -0.2307005 0.110684 1
675759 ACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAG 0.25666404 0.110684 1
101604 AGAGATATTCCAGGAGTGTGGGGGATGGTCTTAAAGGCACCAACATAGAGGGTGAAATAT -0.15523986 0.110702 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.13868189 0.110749 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.51992699 0.110763 1
21414 TTTTTTCATTCTCGCTGTAGATAGCCTGAATCCAAAGAAAACCAAAAGGGGTTATCCAAG 0.39348879 0.110772 1
14961 AATGTATGCTTATCCCCACCTAGATTACAAATAAACGAGACCCAGACTCTGGTTATTTGA 2.13397748 0.110779 1
70891 ATGGCAAACCAAATGCAAGAGAACGAAAACGGGACTGTTACCCAGTTGTACAATGGCCTT 0.18418802 0.110871 1
20371 ATTATGTGTTGGAGTGTGCCTGAACAGCTCTGCCTAGTAGTGAGCATAAAGTCCCTGTGT 0.325601 0.110911 1
27027 CCTACCATGGCTTGGATAGAAAAGGCAGATACTCCCTGACACCACCAAGATCCCATGGTT 0.36487436 0.110933 1
68394 ATCGCACTGTGCAGCCAGTCCTTCTCCCTGGCTAATTCAAAATAAAGTAGCTTCATTCTC 0.4830555 0.11094 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.51423504 0.110967 1
66880 CCTAGGTTTCTCAATAACAGGTACACCAAATACAGATGCTTGAATTGTAACAAATTTGCA -0.17943118 0.110985 1
80907 CCCAAATACATAAACCCTTTAAGGATACATTTCGTTCCCAAATACATAAACCCTTTAAGG -0.13264782 0.111008 1
21940 TGTCATGGTCATCAGAACCCTTTCCTGTGAATACTCAACAAACTGCCCTTCTGAGACCAA 0.2122197 0.111024 1
15410 TATTGTATTCTAGACAAGAGCTGTAGATTTATGTTAAACTCGTACATATGAGGAATTGTA 0.79792175 0.111031 1
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.24297281 0.111033 1
258258 TGGCAATGATGAGAGTACTTAGACAGATAATGGGTTACAGACAAATTATTAAACACTTGC 0.35466508 0.111077 1
56485 AGGCCATTTGCGAAGACACACTGAGCGTGGATTATTAACTGTAAGCGATACTACTTTGTA -0.34831545 0.11109 1
27056 CAGAGTCGGGGTAACAAGAACATAGAAGAGAGGCCTGAGGTTTCATTTCCCCTAAACATT 0.6456921 0.111134 1
242653 TTGACTGCTGTCTCCTGGTATGCTACCCTGGTAACACAGGAATTCTTCAACCCCAGCACT -0.31776445 0.111144 1
50934 TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT -0.34297716 0.11117 1
19340 CGCTACCGGACAATCACCACGGCCTACTATCGCGGAGCTATGGGTTTCCTGCTCATGTAT -0.20714307 0.111173 1
239114 GCGAACTCCAGCATGGACAAGCTGCTGCTGGGGCCCGCCGACAGGCCTGCGGGGCGCTGA -0.18107978 0.111195 1
14167 TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT -0.17527026 0.111198 1
215859 GGGTACCTATTATAACTCAGCCATGAACCCTTTGATTTATGCTTTCTTTTTTCCTTGGTT 0.2155132 0.111207 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.22436386 0.111266 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.2660006 0.111292 1
236451 TATTAAAACTCCATCAGCATAGAGCAGAAGCTGTCCTGTGCATTGCTTGCTGTTACCCTG 1.10958602 0.111304 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.53489124 0.111306 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.20005953 0.111346 1
78285 TAAGACAGATGATGATCCCAGAGCTACTAATAAAACAAAAAGGGGGAGATGCGGGAAGCA 0.47470883 0.111372 1
77583 GTCCCTCCCAGCCCCCACTGATCATGTTCGTTTGTATTATTTTATAAAGTGACTTTTTTA 0.16319335 0.111445 1
66268 TCTTTTGTAGCTGAAAAATACTTTTCAATAAAATGTCTTATGGGAGAGGAACACGACCAG -0.15527219 0.111469 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.14620302 0.111479 1
234362 CCCACCACACTTCTGGGTAACAGAAAGGTGTTTGTAGTTAATTTGAAGCTTTTAATTATA -0.13967929 0.11148 1
20849 AGAAGGAAGCAGATGAAACTGGAGAGTGTTCTTTACCATAGATCACAATTTATTTCTTCG 0.93509439 0.111484 1
17313 GCCGAGGAGCCAGATATTAGCGCGAAGAAACAGTCATTTGGTTGTGGAGTTTCGTTTTAT 0.58485318 0.11149 1
20361 TCCCTTATCTCTTCTCAATGCACTTTAATAATGTAACATATTACTAATAAACAAGCTATT -0.2367082 0.111497 1
66176 TTGTGAGCTTTGCAGTTTGCAAACTACGGCGCTTAGACGGCCGAGGAACCACGCAAAGGG -0.19423016 0.111503 1
64009 GATTGATGACATTGTGTGTTGTGTATCTGACTTACAGATTCAAAGTCAATATTGTGTGCA -0.31288074 0.111545 1
239408 GAGTCTGCAAAACTCTATGGTTCTTTCAACTTCAGGATGAAAACTAGTACTAATGAAGAC -0.35083374 0.111556 1
258156 TGGTATTAGAACAAAGAAAATTAGAGAGTACGTTCTTAGTTTTCTTAGAGTAAAATTTTC 0.17091722 0.111607 1
21780 CCTCTGAATTTAAAGCTGGTGTTAGCATACGGATGTACAGTAGCTAGAAAGCCTTCCTGG -0.14758941 0.111626 1
383103 CAGATCACTTCAGTCTTAAAAGTAGAAAAGCTCACAGTAGGTAATAAAATGTCTACACTG 0.22837586 0.111719 1
17155 AATGTGAATGCTGAAGTTTCTGTTTTTGAAGTCAACATACGCTTCGTCGGTGGACTGCTG -0.19359647 0.11172 1
14960 TTTGGCCAATTGGCAAGCTTTGACCCCCAAGGTGGACTGCAAAACATAGCTGTAGTAAAA 2.24388153 0.111742 1
74648 AAGGACATTTATCTCAGCAAAGTCATTGCTCATATAGAAGATCCAGGGGACTCTAACCAA -0.14140587 0.111747 1
70750 AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC -0.14824899 0.111848 1
494468 GGCCATTTTATGGATGCTAGTCATCTTGAAAGATTGAATACTTGCTGGTTTTTATTGTGC -0.27068169 0.111849 1
333050 TTACCAAGCTCATGGACATGCTAGAGAAACTGCCAAAGCGAAACCGCCGCCTGTCGCACC -0.18118913 0.11185 1
171395 AACTTTCTATCCTAGAAAACCAATGGAAGAGAGCACTAGAGTCAAGGGCAGGTGACAGTC 0.4048106 0.111872 1
327959 CCTTCAACCCTTGCATTTATGGACTCTGGAAATCGAAGATCCACAGTGAGTAAAGATGTT 1.19543103 0.111954 1
98256 GCTTCTGTCTTCTCCAAGCTGGCTGACTGGGACCCTTAGAAGTTCTTTTCATTGTCAATT 0.37237075 0.111955 1
16796 CCTCCTTCCTGGCCTTGTCCTTGGGATCATTTCTTTCTGGCCTGTTATGATTTTGAACAT 0.1647215 0.111971 1
57230 TATTTGTGTGACCTGGGGACTGACACGCTGCCCATGAAATCTCTAAAATGAAAACCCAGT -0.1560824 0.112049 1
16371 CTTTGTTTCTTTTTTCCCCTTTCTGTATATAGCGTGATTTCAGATTGTAAATAGCGCGTC -0.41461158 0.112059 1
240817 TCTTGCATTTTAGTAGCCCAAGAGTTGAATAGCATTAATTGGCAGTTGGTACTCATCACC -0.16823467 0.112096 1
320633 GTGTGTGGGTTTGTACTTTAAACACTAACTGCCCATTGAAATTTTCTTAAAACCCAGAAT -0.1672455 0.112098 1
70699 GGACATCTTTTCTGTAAACCTCTCTCATTTCTCCCTCACTTGTGAACAATAAAATACTTT -0.17980995 0.112103 1
18724 GCTGGGAACTAATCTAAAGAAAAAAGAATGCATCTTCAATGTTCTACACTCTGGGAAATA 0.42471225 0.11213 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.12095239 0.112186 1
241175 GGGAGTGTTGAGATATTAGGTTACAAAGAAAAGTTTGTAAAGTTGATAAGCTGTGTGAGT -0.24764706 0.112187 1
55960 TGTTTGCTGTAGAGAAGTTATTTCAGGAGGAATATACCTGACAAGTACCTCTCAAGCTAG -0.19445698 0.11228 1
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.26661782 0.112326 1
66687 GTTAAACGTGTGGATAAAGAACTGTTTCAACCTTAGCAACTGGATTGGCAGTCTGGGTTT -0.13166101 0.112346 1
66143 TCTCGCTGGTTTTGTCACATTCAACATTACCCAGACATCAGGCAACATCTGTCCAGTATT -0.18088338 0.112371 1
677296 CCCAAGAATCCAACTTTACAGCTCTTTTACACTTTCTACAAGAACAACCATGTCATTCAA 0.17127992 0.1124 1
19188 CCCGAAGGGTGAAGAAAAGCCATCGATGTACTGAGCTAAGGATTAGAAGGAAAATAAATG 0.60536722 0.112449 1
14455 ATAGAAGATGGTGTCAGATATATTGTGTTAAAATTTTACCATTAAAGTGTATTATAACAT -0.70255872 0.112457 1
19933 CCTTAGACTGTAGTGTGGGGTTTGCTCATTGGCTTTCTTGTTCAGATTTTACTAACTGTT -0.30650922 0.112467 1
629203 AATGGGATAACTTCTTGGTACTGTACTATGAAGACCATGAAAAAGGACACAAAGGGAACC 0.3076865 0.112521 1
16601 GAGCAAACAATTTTAACTTCATGAATTTGTTTGAATTCCCCCATGCTTTCTGATAACGCC -0.26739372 0.112527 1
11840 GACGACCTCTACTTTTTTCTTTTGTATTTTGATAAACACTGAAGAAGCTGGAGCTGTTAA -0.19775094 0.112555 1
12798 ATTGGAGTACACTAGGCTTTAAAATACTGCAGGCATTCTGAGGGACTAAGTTTGCTTTCC 0.53635279 0.112557 1
207474 CACAAATACATACGACCAATACTAAATGGACAGCAGAGTGTATTTCTTTAAACACATGTG 0.2088933 0.1126 1
381287 AAATACTAATGTGGAAAAGGCGTGGTGTGCTGTGACGGGATTTGAAAGACTCAGTGAGGA 0.41723024 0.112628 1
71750 GTTTGTTTGTTTGTTTGGGGAGTTACTTGGGGGGAGGTTGGTTTTGTTTATAAATATAAA -0.21183288 0.112681 1
22589 TTAATCATGACTCCTTCTAACTACCAGCAGATTGATATGAGAGGAATGTATCAGTCAGTG -0.17240162 0.112727 1
320435 AACGAACGGATGGGAACAAGAGAGACGGGAGATGCTGGGCTACTCCAGGAAAGCTTCTCC 0.68935639 0.112731 1
276952 GTGGAGGCCTTCAGGATCTGACTGACCCCTTATCCCAACACTAGGTTGACCCTATGCCCT -0.21749922 0.112746 1
11428 GCTGGGGGAGGGGTTGCTTTGTCTCTCTTAACGTTTTATCTTTTCTTTCCTTCTTTTCTT -0.16434695 0.112772 1
70925 GTGTGGAAAACACTAACATAAGTGAGTTGTAAAAAACACTGTCAAGTTTCTTCTGTTGTG -0.21380581 0.112782 1
225583 CTAAAATGCCTTCTAAGTACTTGCAAGAGAATCTGTCTGTGCATTGTGAACGTCCGCATT -0.28510544 0.112837 1
16545 GCAGTTATTATAACATAGCATGCAAACTATCCAGCTCTTATTTTGATTATGATTTGGGGG -0.17019517 0.112889 1
217143 CCCCGTATTACTGTTATAAATAGCCACCTAGGAAAATAATAAAGAATGCTTGTTCTCGGC 0.26807148 0.112894 1
436240 GGCTTATTACAGCAGATACAAAACTGTTTATGTTTAATTGCAAAGGCTGCATAATTCAGC 0.16819436 0.112914 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.32089109 0.112948 1
212281 CATTATTAGTTTCTAAACACAAGAGAGTTCATACAGGAGAGAATCCCTATAACAGTCAAG -0.17357044 0.112951 1
11980 GTAGGAGAGCAGCTGTTTGAGTTTTTTGGTGTGTGTGTGTTTGTTTTTGTTTTTTGTATT -0.18941138 0.112957 1
12310 TATTGTGCATCGTGTTGTATGTGACTCTGTATCCAATAAACATGACAGCATGGTTCTGGC 0.30496315 0.113053 1
75669 TTGTGAAGGTGTGGAAATAAGTCCTGCCGACTTGTATAAAATGCTGTAAAATTCGAAATG -0.1553565 0.113086 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.3518282 0.113107 1
20682 ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC 0.28315936 0.113108 1
68441 TTCCCTAGTCTTAGTATTGGACGCTATTTACTCAGCTATCAAGTAGAGATCTTCAAGACG -0.1849823 0.113169 1
52673 GTTTCTTGTAGCCATCTGGTGTTTGTTTGCAGCTTTCTTAATAAAAGTGTTAAAAAGACG 0.73974681 0.113196 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.15071378 0.1132 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.18589994 0.113227 1
68092 TCTGGTTTTCCTCTGAAATATTAAAAGACAGAATCCAAAGAACGCCTTTAACTCTAGTCT -0.21247156 0.11326 1
234290 CCATGTACTAAGGGAGAGTTGTTTTGGAATAAATTAACTGTCACGAAAAACTGTTAGGAG -0.53028107 0.113321 1
67889 TTAAACAATGTCTATGATTTGTACCAATTCTTACCCCTCTATGTGAATAAACGCAAGACG -0.19399755 0.11336 1
18115 GGAGGGACCAACATTGTTCTGATGTGGAGGATTTTCATATTTGGTGATGATATTAAATAA -0.29403056 0.11338 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.30467022 0.113435 1
14761 AGACGGAGAAGAGGCTGTGCAAGATGTTCTACGCCATCACGCTGCTCTTCCTGCTCCTCT -0.20882315 0.113454 1
14860 GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA -0.23670795 0.113484 1
666938 CTAGAAGGCCACATGTTCTGTTGGGGGTAAAATTGCACAATAAATGTCAAGTTACCTGTT -0.29312287 0.113496 1
257939 CTGGCATTGTCTGGACTATCAGCCTGACTAACACCAGCGTGCACACAGGCCTGATGTTGC -0.2381325 0.113519 1
211484 TGAAAAGCTGTAAGTCTCCTAAGTCAACCACAGCACATGCTATTCTTCGTCGGGTAGAGA -0.14836892 0.113546 1
66421 TACTATGACAGACATCTCCATGAACGTATTTATGTTAACGAACTAATGAGTGTCGCCTCA -0.20278661 0.113584 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.31183409 0.113593 1
210044 ATCCTGCAGACGCTTGGCTACACGTGTACATGTCGAGGTATCATCAACGTGAAGGGGAAA -0.25820112 0.113647 1
14077 TTTATTTTTTAAAACTGTATCCAAAGGGTGCTCCAAGGTCAATAAAGCAGAACCAAGGCC -0.18771208 0.113703 1
110876 ACACACGGAAAGGGTATACTTCTCATTTCAGGATGTTTTTAGATTTTTTGAGGTGCTTAA -0.20136583 0.113797 1
381286 ATTTTAATCTAGGTTCTTCTAATCTAGCATGTATCTGTGCCCTGTGTCAAGTGAGCTAGA -0.24522913 0.113797 1
68276 GTGCTACATAATGGCCTTATAGACTTGGTGTTCCTGTACCAGAATTTCTACGCGCACCTG -0.17611287 0.1138 1
13557 CCTGTTCCAGCTGTGATCTTACCACTTCAAATGGATGTAATTTGAATAAATTTTGTATGG -0.20709603 0.113805 1
232236 GCTGTGACTCATTTGGGGTTCCAGGTGTGTAAATTATAAATGCTAATCTGAGAAATACTG -0.14362681 0.113849 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.20387208 0.113916 1
69944 CCCTGTGTGCAGGGGCATGCAGGAAATAAACTTTGTGTAAAATATTTTATGATTTACATT -0.18795266 0.113949 1
20844 GCCCAGCATATTTATAGCTCTTTCACTCTTCAGTTTACTTGAGTTTAAAGTATGTCACTA -0.17012051 0.113961 1
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 1.04889447 0.113961 1
29877 ACTGTGTCTAATGTTTTGTGTGGCACCTATCACGTTGTTAGAGTTCAATAAACATTCAAC -0.2212746 0.113974 1
72472 GCCAACCTAAACCTTGAGTCTGTTAAATGACTTAAGCTATGAAATTAGGAGGTTCTTACA 0.26060795 0.114003 1
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.25393109 0.114005 1
69136 AACCCACCTTTTAAGTGTGTTTTGTAAATTGCTGACTTGGATAGCCCATGAAGTACTACC -0.17500124 0.114029 1
27377 GCATACACATATGGAAAAACATCGGTGTTTTATCTAACCTGACTTCAGACATTTTTACAG -0.17228751 0.114056 1
243725 AAAGGGGCCTGAGTATACGCTGTTGCAAGCTGTATACTTCATTTCCTTCGGCTGGTTTAT -0.23657643 0.11411 1
238690 AAAGTGGAGCTGTTAGACTCTGTGTTTGTCCTTGAAGACTTGGAGCTGATAGTCCTTGCT -0.19972661 0.114114 1
21942 CGCGCACCTCATCCAAGTCTCTTCTAACGCTAACATATTTGTCTTTACCTTTTTTAAATC 0.25294224 0.114126 1
78512 ATAATCAGGAAGGGGTTTGAGATAGCTGCCTTGTGTTTCCAGGCCAGTCCATCTCAAAAT 0.2970589 0.114129 1
66112 GGTAGTGAATGGTAGGTCGGCCCACCTTGAGAAAAATTTAAAAAGGGGAAAAACAAAACA -0.26184099 0.114196 1
217154 ATGACGGGTCTGCGGGGGCGTTGCTGAGCCCCCAGGCCCATAATTAAATGTTTCTTGTCT 0.5945788 0.11421 1
237782 TAGAGCACTGCGGATGTGATCATGTCCCACAGGCATTGTGCGCAAAAGCTTAGAATAAAT -0.13275054 0.114213 1
16443 AAGCCAGAAACGGACAACTGGGATACATGGGCGGCTCAGCCTTCTCTGACCGTACCTAGT 0.25648713 0.11422 1
16408 ACTTGAGAGCCCTGGCTCTGACCAGCTTCAGTCACATGCCACCGTGTATCCTGTCCTTCA 0.76591808 0.114277 1
67222 CTTTTCACAGATCTCTAAATTTATTTCATAAGAATGCTTGCCCCAAATTATTTCTTACAT -0.15302341 0.114335 1
19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG 1.23289067 0.11434 1
626870 GAAATCACCATAGCAAACTCAGGGTAAGTGTGGGCTTTTGTTTCTTACATTCCTCTGCAA -0.21501873 0.11436 1
21743 CGAATCGCCTTCCCTGGGAAAGTTATAGCAATCATTTGTAAAGCCTTGCTCCACAGCTTT -0.66882101 0.11437 1
71834 TGAGCAGAATACAACTGAGGCTAACTAAAAATAGGGTCTGGCCCTTGAGTGGCATGCATA -0.14189253 0.114434 1
72865 AAGTGACAAGCTGCGTGCTCAGCTGACGCAGCAAAGAGAAGCAGACCCTTAGAAGAGCGC -0.17681858 0.11444 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.35888699 0.1145 1
56086 GGTTTTCACTGGAAGGAAAAAGATGCTCATTTTAAATGTTGAAGTGTACAAGTTGCTTTG -0.1809918 0.114547 1
675812 CTCGTTACAAAGCAAAGGACACATTCAGGAATCTTTTTATGTATGGAATGTGGTAGAATT -0.218365 0.114554 1
12363 CTAAGCAACACAGTGGGATTCTGTTCCATAGACAAGCAAACAAGCAAAAATAAAACAAAA 1.0911005 0.114574 1
20349 CCTCCACCCAATACTGCACAAAGTCTGTATTATTGAATGGAATTTCTATTTCATTTGACT -0.43614535 0.114575 1
28071 CATGAGCAAGATGAAGAAAGGGTAAATGTGGTTCTTGCTAGTTGAAAATCTCTAGTTAAC -0.17961352 0.114577 1
171171 TGCAGCGAGAGAACCTCTACAAGTACTTCTATGCCATCTCCAATATCGAAGTCATTGGCA -0.18005669 0.114617 1
56448 TCTGTGTCTACCATGCACCACTTTGGCCTGGGCAAGAAGTCACTGGAGCAGTGGGTGACT 0.19314138 0.114638 1
545156 ACTGTCTTTGTACTTGAACTTAAATCCAATGGAGAACCTTAACACGGGCATTTGCATGAC -0.34563052 0.114713 1
13095 GAGTTTCCCAACCCAGAGATGTTTGACCCTGGGCACTTTCTAAATGCGAATGGAAACTTT 0.50270525 0.114767 1
71678 TTTGGTGGACACTGTGTTTTTAACATGGTTTTCTTCAGTATCCTATCGGAATGGCTTGGC -0.20751154 0.114847 1
69397 CTGGAACGTTTTGGACTCTCATGATTCACTTCTGCATCTTCTCTCCGGGTTTGCTATGTA 0.20625296 0.114868 1
22637 AACATCACCAGTGGGCTGAGAGGATGTGTGCTCCCAAAGTCTACTTCCGCTGTTTCTGAG 0.4911263 0.11487 1
209776 CCTCTACGGAGCACCCATCCAGAACCCTTGGCTGGTCCACATCATGTTGGATGTTGCCAA 0.68439292 0.114929 1
69573 GTCCTAAAGGACTCTTTTGGACCTAAGTATCTTCTGTTGGTTTACCATTGAGTCTCTTCC -0.14661919 0.11495 1
12995 GTGAGGATAGCCAAGGTTCTGGGAACAGAAGATTTATATGACTATATTGACAAGTACAAC -0.17700929 0.114953 1
70829 AGGAAAATTCATTTCAGTTCTCTAGACGGATGTTGTCTTTCTCCTACTTGTTTCATTTCG 0.1535247 0.114966 1
235041 CACGGTACATCCATGAAGACAGTGTTACACGTAAATGAAGTATTCTTTTCTTGTAATCAT 0.28888827 0.114999 1
215890 GTCTAAATGATTGTCTTAACAATGTTCCTTTACTTAAGTTGCCATTGTAACCCCTATCTG -0.30030448 0.115024 1
22592 CCGGATTGATTCCTTTTTTAGACTAGCTCAGCAGGAAAAACAAGATGCCAAACTCATAAA -0.15518584 0.115089 1
18616 TTGTTACCATCGTTCTTTCTCATGGAGTCTCCTTAGTATTTCTGAGCTTTCCATTTAGTG -0.16201307 0.11515 1
56534 ATCCTCTGTCATGATGGAATCTTGGTGGTGGAAGTCAAAGATTCACTAGGGACCAAGTGA -0.40588066 0.115156 1
212772 GTGGTCAGAAAGGTACCTGTTAAATGTTACTAACGAAACAAATGCTCTTCAGACTACTTT -0.18066562 0.115164 1
67920 CACAAAGGCAAAGCACCCTTGAAAGGACCTTTACGGAAAAAACGGGCCTATGTGGAAATA -0.14544957 0.115167 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.33861145 0.115213 1
68404 ACGTGGGAATCAGCCGGTGAATAATCATGCTCACGTCTTTCTTCCACAGTACCTTGTTTT -0.32668647 0.115307 1
71740 GACTTATGGACCCCAAGGATCTGGGGTCTTAGTATGTATATTTCATGTAAATATATGTAT 0.25807893 0.11532 1
93673 GGCATAAGAGACTTCCAGAATTGTTAAGGAAAGGCCCAGAGGGACATCAAATCACAGATG -0.17311438 0.115335 1
12945 CTTTCTCCATCTGTAGTGTCGATGTCAGCTTTTTCTTACAATACTGCAATACTGAATATA -0.33464316 0.115384 1
51801 AGACGCTATGGTGTGACTGGGGAAAGACCATACAGAGCTATGGGGAGCTCACTTACTGCA -0.16382529 0.115388 1
100043074 ACAGGTTGCATTAATATGGCAATGGCTGGAGTTGAACAATAAACTATTCACTGTATGACT -0.21346797 0.115396 1
66870 GGACAATGGAAAAAGGGATTTGTTCTGCATAAATCAAAAAGTGAAGAGGCTCATGCTGAA -0.15647848 0.115453 1
245026 GCTAAAAAAGGTGAAGAAAAGGATCGTTCGGAACATCTGTACCTCAGGTGGTGAGAGCAA 0.25656874 0.115475 1
383787 TACCCATAAAGCGTGTTCCTCTTGTAAAATATTAAATCCGGATACTTGAAGTCACTTCAC -0.34421278 0.115476 1
17888 GCACGACGAGGAATAACCTCTCCAGCAGACCCTCGCTGTGGCCAATACACAATAAACATA -0.39619034 0.115476 1
69982 AACTTATGACCCAGGCGACTTTTGCATCGCTTTATTTCATTGGAATAAAATGAGCATTGA 0.18930126 0.115505 1
381059 AGAGGAGGCAGAACTCAGCACCACACTCTTCCCCACCCCAGCCAAAAATCCATGAAAAAA 0.16240475 0.115554 1
100039220 GAGAAAGTTTAAAAACTCCTAGTTTTTTGATGTACTGCTCTTTTGTGGTCATTTCCCAGA 0.19622824 0.115573 1
57028 CCACTCTCTGGGATCTCTAGTGCTCTGTCCCTAGAGATTGTTGGCCAATCAGAGATCTAG -0.18881634 0.115589 1
75516 AGCTTATTGAGATTTTAACTCAAGATCCTTAAATCTGCATTTGATTGGCTCTAAGATGGG -0.14463674 0.115622 1
228005 CTGCTTCTCTTATCATTAGTCTAGTAAATGTTGAACTGTTTTCTGCAGATGGCATTTTAC -0.24125679 0.115628 1
53975 CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG -0.15819724 0.115631 1
100043899 AACTGCAACAGCAACATGTGCTTCTCTGGGCTCAAATCCAACAGGCTCCCATGGGTCTGA 0.17213099 0.115654 1
16622 TAAAAATGCCTGAATATCACATTGTCCCATGTTCTCAATAAAGCCCACCATGCAGCAAAT 0.31169593 0.115657 1
107823 GTCTTCAGCACTTGGGTTTAACAAAAGTTCATCTCCTTCTGCATCCTTAACTGAGCATGA -0.27163701 0.11567 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.14288285 0.115719 1
12843 ACCAAGAATTCCGTGTGGAGGTTGGCCCCGTCTGTTTCAAATAAGTGAACTCAACCTAAA 0.63393997 0.115722 1
211556 ATCCGATAGGGTGAAACCGTGACCTTACTTACCAAATGTTTAAAAACCAACCAGAATGTA -0.28384261 0.115813 1
353165 AAGACATTCTTATATCTTGCTATGGGGAAACAAGAGGATCAAACAGGCCTTTGTGTTGGC 0.25103254 0.115816 1
192651 AGTGTTAGGTGAAGGTTGGCTTTATTGCTGCGTTTCATATTTGATTGTTGAAATAGAGAG -0.20576623 0.115832 1
68713 TGTGACACTCACAAATCTGTCCATGGTGGACTCAATAAAGTGCACGTGCTGTGACTTTCT 0.60070169 0.115872 1
18706 AGATTTTGGGCACTTTTTGGATCACAAGAAGAAAAAATTTGGCTATAAGCGGGAACGTGT -0.15082707 0.115935 1
70719 GTAAAGGAGCTTTCCACATGAACTCACAATTTTCTTGAAATAAACTTCTTAACCAACTGC 0.82889955 0.115984 1
67143 GTTGAGAAAAGTTGACCATGCACTATTTATAGTACTTTGCCATAACAGGCAATGTTCTAA -0.18614415 0.116042 1
546282 CTTTCCCATCTTCAGACTAATGAAGCATACATATTTCTCCCTTGCTGGTACATTGTAACC 0.27794252 0.116065 1
110862 AACTGGAGCGGTCTCCAAGTGGCTTCAGCATCTCACAAGACAGAGATGATTATGTATTTG -0.39305253 0.116082 1
77031 CGGGCTCGCCGAAGGAGCAAGAAAGACGTCAACCTCAGCAAGACTGAGAAGATGGGTAAT -0.21002595 0.116091 1
107321 CTCTGCATTTTGCTTTTTAAGCGGAAGTGTATTTTTACTGACACATGTGATGAATAAAGC 0.72663962 0.116138 1
257913 TAGTGTCTACATTTTATACCATTGGGATTCCCATGCTCAACCCCATCATCTACAGTCTGA 0.20032066 0.116212 1
433759 TATAAAATACATTAACTATAACGTCCCCAGGGACCAGAGTACAGGGCAGTGGTGCTAGGA 0.39646714 0.116342 1
74570 GAACTTTGATTTGACCAGCCTCTGAAGAGTCCAGATGTTTAGTAGATGTTCAATAAATAA -0.19753819 0.116352 1
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.28319796 0.116362 1
110962 CCACTGCTTTTCTATGGGAGACACTCTTAATTTAACAGATGAGAATATTTTGAAACTCTG 0.35631871 0.116365 1
53975 CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG -0.15083944 0.116369 1
20454 CTTCCAAATCATCTAAGTGTTATTTAAGGCACTCTGCTGTTTGTATGAGATGGCTCATAG -0.1600454 0.116395 1
231147 ATTTTGCTGAGGGTTGGGGGGAACTGAAGGACCAAACAGTAGTAAATATTTTTCAGCAAC 0.52645101 0.116421 1
22160 ATGGTAACAATCAGAGGAATTTTAACACCTTTAGAAATAAAAACGCTGGGATCAAACTGG -0.30720874 0.116429 1
100505024 AGCCAGTGCCACCTTTGCTACACACTCCTATGCCTCTCGTCTCAGAAAACGCCAAGTAGG -0.23784812 0.116511 1
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.26323187 0.116545 1
13120 CTGTCTTGAGAAACTTCATTTATTTCTCATAACTGCATTTATTTAGCCATCTCAGTGTGC -0.21692248 0.116563 1
229488 TCTCTCTCTGCTGAGAACAGCATGGTGGCCAATCACATTGTGGAAAATACCTACTTCTGT 0.17107051 0.116565 1
15001 GTGTTGACCTCGAGTGGCATCAACCTCTGTTCACCAAATCCCAGGAGAACATTGTGGGCG 1.9358044 0.116615 1
80289 AAATGAGTAAGCAAGACTTTTACACTAGCAGTAGACGGGTTGCTTTATTCGGCACTCTGT -0.17008305 0.116765 1
229801 GCCTCTAAATCCTGTCAGAATAGTTAACAGACCAACATCGTATTTAGTTTAGATTGTTAC -0.28111508 0.116767 1
67580 GTAGCTTATGGCAAAATACATGAAGACCAATCAGCTAACAGAAATAAACGACTCTGAAGA 0.22977303 0.116795 1
240038 AGTGATGTAGGATTAGGAGAGTTGGCACCAGTGTTCTAAAGAGAATGCATTTGTGTTAAA -0.15699667 0.116848 1
232174 GTTCGTGTGTCTCGTTGTGGTAGCATTAATGGGTGATGTAGTCTCACATTCCTAACTATT 0.22903735 0.116863 1
16477 AGGGCTTTGCGGACGGTTTTGTCAAAGCCCTGGACGACCTGCACAAGATGAACCACGTGA -0.22218378 0.116957 1
26904 ATGGAGTTAGAGCTGAATGTTTATGAGAACACTGATGAGGAGTATGTGGACGTCTTGCCT 0.32448512 0.117019 1
70726 CGTGGTGGGGCGTACTCTCTGAAGAAAGCTGTTATGTTGACCCGGCTTGTGCGCTTGTGA -0.20350579 0.11702 1
75778 ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT 0.26726001 0.117036 1
78634 AGAGCTCCATGCCACCCATCTTAGGGAATGCACACACTCACTGTTACTGGTTCTTAAAAA -0.1784368 0.11707 1
271424 TTAGGGAAATAAATTTGTTAATAAAATTGCTGAGGTCACCAGTGATTACTGGTGCGCCTT 0.39231468 0.117079 1
70028 GGGCTGCAGGCTCTTATCTGTCGGGAACTTGTTCTGTAGGTTGGCCTTGAACTCAGAGAT 0.34092179 0.117108 1
76293 ATATGTGGGGCTGGAAGTGGGTGGGTAGCAGAGGTCTCAATAAACTTCAGGATCTGATGG -0.1979372 0.117151 1
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.8276152 0.117161 1
21374 GCCAAGAGTGAAGAACAATCCAGACTAGCAGCAAGAAAATATGCTAGAGTTGTGCAGAAG -0.16402932 0.11718 1
53975 CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG -0.16817827 0.11718 1
240058 TCACCCTGCTTTCCTTTGCGGTAGAGTCAGAGAGTACCTTCCTGGATTACATCAAAGGAG -0.20595769 0.117208 1
235606 GGTGGAATCAGACAGCTTCATGAACACTGTGCTTTGGCTACACACACACTTGGGCAGCTG 0.22568124 0.11721 1
75125 GGCGTCAAGATGAAACACACAAGGATGTTAACAACACTGATTTGGTTTACATTTCATCAC -0.21191942 0.117227 1
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.54672572 0.117246 1
15182 TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC -0.27330546 0.117349 1
320209 CTAGGACATACATAATATTGAAAGAGCTGACATGAATTTTGACTTTTGTGAAGGACCATC 0.19044452 0.117395 1
268706 GGAAGAGGCTGTTTTAAAGGGAAATGCTTCGTCTACATTAAATGTGTCTCAGAAGTGCAG -0.17196848 0.117488 1
102115 GGTCAAGCAGGGAGTACAAGCCAGCCCCAGCGTGCTGCATGAATAAAATAAGTTATTTTT -0.12947027 0.117494 1
75710 CTGGACATACTTGCTTTGTTATAGGGTCAAAGCTTTGTCTGAAACCTTCATTTTCTTTTA -0.18085364 0.117519 1
68275 CTTCATTATCCACATAGTGGGGTCAGTTACTTGAGACGCAATCCCTGTTTGAAGATAGCA -0.17305797 0.117541 1
54215 GCAATTGTGAACTTCCAACATGGTGGATGTATTCATGTCACCAGCTCAGCATCCCAGAAA 0.34972137 0.11755 1
77634 ACAAGGGGTTGTTAATGGCGTTTTACTTAAGTTGTTTATGTTACTGAGATGTAGAAATGC -0.24079594 0.117558 1
626410 TTTGTGTCCCTGGGAAGATGTATTATTAATGACTTCTATGAGAGACAAGGTTCATGGTTT -0.17072824 0.117594 1
227721 CACTGAAGTCTTGTTTAGCTCAGCATCTCCGAAATTTACCTGACCATAGGAGCCTTCTCT -0.17660148 0.117601 1
83431 CTAGGATATCAGCACTAAACATCGTGGGAGATCTCTTGCGGAAAGTAGGGGCTTTAGAAT -0.23760548 0.117612 1
211577 GACAGAAAGGACCTTCTGTCACCATGGGTAGCTGACTGCTTTTCTGACCCCACCCACCCA 0.17234453 0.117656 1
234199 ATCAAACCTCTTCAGAGCCTGGCAGAATTCTCTGTTTATTGTGACATGTCTGATGGAGGG 0.38870942 0.117732 1
239719 AGAGATTTCCTTCCCAATAAAAGAAGAGCCTTCTCCAATTTCCAAGATGAAACCAGTGAC -0.21104174 0.117787 1
19716 AAGGATAGGCCCAGGAGTAATGGAGTCCAAAGATCAAGGCGTGAAAAATCTCAACATGGA -0.2631482 0.117788 1
258988 GGGGCATGGCAGAAATTATTAGGGAAATTCTCTGGGTTTGCATCAAAATTGGCCACTTGA -0.16739056 0.11785 1
67095 AGCGACGTCAGCAACGTGGTCCTCGATAACAAAACCAACAGCATCCTCCTGGAGACCGAG -0.46163646 0.117879 1
14159 TTCTTCCTGCCCAAATTCCTCTCTTAGGCAGAAAAATAAAACAAGTTGTGTTCATCGGGA 0.67761331 0.117982 1
69297 CTGGGAAGGAGTCAGCCCCTAAAGCTACCTCCTCAACTCAGACTGCCTCTACTACCAAGA -0.18362984 0.118053 1
77619 TTGGAAACTTTTGCTAGTACGTTCTTAAGACAAGGAGCCCAGAAGGGAATTAGAATAATG 0.49559586 0.118091 1
319615 CTTTACCAAGATAACTTCAGGGATACACATGTTAAGTCATCAGATGTAAACAGACATGAA -0.1471853 0.118095 1
53951 CTACTTGCGAGAAGAGCACCTGTATTGCATTTGGTGTGGGACAGCCTATGAAGATAAAGA -0.1495636 0.118103 1
108723 AAGAAGCACGAAACATGCGTCCCAGGCTGGGGAGACAGGACTCCTCCTATGCCGTTCTTT 0.99605654 0.118129 1
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.52710022 0.118136 1
20320 CTAACTGTAGATGCATGTACTTGTGTTCTGTGTAATTATTGAAGTGCAATGGTGTACAAA -0.27426766 0.118182 1
17874 GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC 0.49242595 0.118192 1
20028 GTCAATGTTTAGATCATTGTAAAAATCCCTTTCAAGTTCCGTGTTAGATTTTTGCTCCTC -0.14024181 0.118199 1
258468 CAGTTGTCACTCCTATGTTGAATCCCTTAATATACACCTTGAGAAATTCAGAGATAAAAC -0.24849153 0.118213 1
21408 AGGACCCTTAAAAATACATTTGCAGGTGTAAAAGCCTTAAACCAAAGCTCTTCAGAGAAT -0.21284448 0.118237 1
54006 ATGCCACGTGTACATACCTGTCTTATCTGTTAATAAACATGTAAATAAAACTCCCACCCC -0.21600167 0.118239 1
27053 AGCCATCAGTCACCCAGGCTTACTTAGGCATGAAAAGAAATAAAAGTTTCACATCTGAAA -0.21857539 0.11827 1
333467 TTCAAAGAGCTTTTGGCCAGAAGAAGAAGAAGAAGTGAGAAAGGCACCCAGAACTCTGGA 0.38185272 0.118302 1
14918 TGGACATCCTTAGCTATGCAGGCAACTTTCGGATGAGGCATGCACCCGATGTACCCATCC 0.23020478 0.118311 1
107305 ACTAAAGGATGCTCTACCTTATTTACCACGGTCGGGTCGTAGGAAGGAACAGTTACGAAA -0.17761132 0.118328 1
14132 GCTGGAGGTTAAACGTGGAGATGAGCACCATTATCAATGTCAAGTGGAGCATGAGGGGCT 0.37339718 0.11835 1
27007 AAGCAAGGCACTATATTTGAAAGTATATAGCTTGTTTCACTTTACAAGTCAGAAAGGTGG 0.32153368 0.11836 1
70456 CGGATTTGGAGATATAACCAAGAACTCAAATCTAAAGGGATCCAGTAAGAGAGTTCCTGA -0.14574832 0.118373 1
432450 GGGCAAACACTGTGTGCAAAAGGACTGTATGTTGATGTGGAATGTGTGTGGGCATTTTTT -0.22065527 0.118389 1
111970 TCCTGATAGTCTCACAAAGATGAGAGTCTGGTCCGGGCCAGCGGGTTATCTCGTGGCACT -0.24772337 0.11839 1
72795 CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA -0.30269251 0.118404 1
100929 TATATGTAAGACCCTGTCTCAAACAAAGCTCCCATGTAGACTTCCTGAAGGACAGGGTAG -0.23171983 0.11844 1
110616 AGTCCTAACAAGTGTAGAGCTATGATATGTGACCTTAATTAAGAAAAACCAGATTGGATC -0.15925301 0.118465 1
212032 AAGATCTGGGGCTGACTCTGACATCTGATGACGCCTTGATGGTCCTGGAAGTGTGCCAGG 0.73247491 0.118479 1
432450 CTCAGGGTGTTTTCTGGACTACCAATACATAGAAGTGGCTCATAGTTCCCTCCAGATTGT -0.1600184 0.118546 1
19744 ATATCAGTGTTTATTTCATTGTGTTAAATGTATACTTGTAAATAAAATAGCTGCAAACCT -0.16195295 0.118574 1
67923 CTGAAATTGCACTGGAACTGCTGATGGCTGCAAACTTCCTAGATTGTTAAATAAAATAAA -0.16332835 0.118634 1
319583 ACAGTGTTTACAGAACTTGTCTCCTATCGATGATCCATTGCGTAGCTGTCCATACAGTGA -0.23538617 0.118653 1
98733 CTGCTGGTAGATGGTGACTAGAGGACTGAAACACACCAAGCAGGTGCCCTTGGACAATTT 0.25660116 0.118678 1
244608 AGCAGCCGGCAGCTTATAGACCAAGAAGTGACCCATTAAAGTTCTCTATTATTTTCCGTT -0.2932673 0.118765 1
116871 CTGCGGCAGGCAGCGAGACGGCCGTTTGTTGCTATTAATTATGCTGCCATTAGGGCAGAA 0.14142702 0.118782 1
69469 CGGTCAATTCAGAAAATAGTGATGTTTGTGATCACACTCTACCAACTTTACAAGAAGGGC 0.24668504 0.118784 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.30554691 0.118796 1
100040220 GGGGGTAAGGAGGTACTTTTTAAAATCGTTCATAGACTTCTGTAAAATGCAAGATTAAAG -0.16369934 0.118824 1
54123 GCATAAGGTGTACGAACTTAGCCGGGAGCTTGGATCTACTGTGGGCCCAGCCACGGAAAA 1.20762161 0.118878 1
22268 CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG 0.20477495 0.118904 1
630322 ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT 0.35761505 0.118915 1
380928 CAAAGGAGCCGCCATGATCATCGAGACCCTGGGTCTTTCTTATCATTTACATTGTTTTAA -0.24222575 0.11893 1
77305 TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA -0.13540626 0.118932 1
117150 GTGGGTGGGACCTGCTGAGTCTCCCATCCCTCAAGCAACCTTTCCCCTGTTGAATGCAAT -0.20460384 0.118983 1
403180 GCTTGTCAATGTGCCTTATCATCTACTTTTAACATTGTTGGCGAATATATATACTTTGCC -0.23672607 0.11901 1
108645 ATCAGAACCTGTATAGCCTGATGCCTACTTCATAGCACTGTGTGGCAAACACTTGAGAGA -0.19033494 0.119043 1
233726 CTATGCGCCCTTATTGATATGGAACAAATACCACAGGTTTTAAATCAGGTTTCAGGACAG -0.15527267 0.119048 1
67861 CATGTTCAACTAGAAGCAGACTGTCACAGGAAGATGCATCTCAGCAAAGGGCAATGTTTG 0.22315188 0.119057 1
241846 GTTTTGGTATTTTGCAAAAAGGTTTCTATAGGCAAAGGCTCAATCCTCACTTTGTAACTT -0.21327688 0.119092 1
21935 TAGATAATGAGCTTCCTAACTGGTGTGAAGCTGCTTTGAGAACCTTCTGTCAGGAGAGCT 0.26613649 0.119113 1
67467 ATGGTGTGTACAAGGTTGAAAGGTTGTATACTCCTTGTAGCCGTTTCATTTAGGAAAGGC -0.14182876 0.119126 1
14049 GGCAAGGGTACTCGGCCATGATGGATAAAGGCATTCAATAAAAACCACGTTTACATTTTA 0.39437786 0.119206 1
17524 CTCAGGCTCCTAAAGGGGTGAAGCTTTCCTACTATCTACATTTCAAAATGATCTCTGGAA -0.13634465 0.119207 1
16952 GCCCCATAAGCAAGTCACTTTGGTACCATTCCTGAGAAAGAAGTTTACATATAATAAAAT 0.53763187 0.119231 1
12501 TCTCCATGAATACACCAGCCCCCTCTCTGCTAATGCAAAAGGCAATAAAGTGTATTGGCT 0.48531768 0.119256 1
192174 CCATCAAGTAAGAAAAAAGAGAAGAAAGAACAACTTTCCAAAGCTCAGAAACGCAAGCTG -0.1461902 0.119257 1
19821 TTGATAGAAGGAAGAGACTTCCGGTACCATTGTAACTAAAGTGTCAGTCATTTTAACTAT -0.21271573 0.119277 1
118449 CACAAATGCGCAGGCTTCTTCTGTGTACTCGGTACCAGCTTATACCTCTCAGCCCAACTT 0.14538591 0.119336 1
16453 ACGTGTGGAGCTTCGGAGTGGTGTTGTACGAGCTCTTCACCTACTGCGACAAGAGCTGCA 0.46293953 0.119364 1
18127 GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA 0.17289271 0.119379 1
234915 CACAGTGCAAAGAAAATACTGATGAGCTGTGATAGTCACTACTTAGTGGAATCATTATTT -0.2542755 0.11938 1
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.90110693 0.119396 1
56088 CCTGTTCCAGGGGGCAGTCACTGATGTTTTGTATTTTATTCTGGCTTGGGATGTTTTGAG 0.22687965 0.119398 1
28000 GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT -0.17503775 0.119416 1
237256 TACTCGGTTCATTTAGGCCACGGTTCCATGCTTCGAATCAATGCATTGCAAATTGATAGT 0.32584678 0.119423 1
233274 ACAACAGTTAAATTCCCTTGCAGAGACATCCTCCAAAGTTGAAGAGGCTTTGACTTAGTT 0.34602086 0.119425 1
353169 GGTAAATCCTCACGGTTTTAAAGCCGTCTACTTCTACCTCTGGTTTTTTAAAAATAATCT -0.20576024 0.119434 1
243983 CCTGTTACTGAGCAATTTGGCAAGCAGCTTTTAAAAACATATGAAAATATTTTCCCCAAG -0.1477271 0.119467 1
109349 ATGGGACTTGCCAGGGACCCACACAGCACCCTGAAAAAGCAAAAGCCAATAAATTTGTTT -0.21003714 0.119616 1
24047 TTCTTGCGCACACAGTCTCTCAGGCTCACTCACTCTCTGTGGCCTGCCTCAGATTATCTG 0.61775261 0.119661 1
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.18215034 0.119699 1
21780 CTCTGAGCATTAAGATGGAAGACGGAGTTGTCATTGGGATTAGGCCCAAGAAACCAGTTA -0.15950889 0.119753 1
110006 TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT 0.49534869 0.119768 1
12257 GAAAGAGCTGGGAGGTTTCACAGAGGACGCTATGGTTCCCTTGGGTCTCTACACTGGTCA 0.9017987 0.119792 1
109050 CAGGCACTGTCTCATGAGTCCAAGTAGGCGTGCCCAACCAGCATGGTATTTCATAAAGCA -0.26486726 0.119797 1
12826 TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA 0.51422686 0.119819 1
17385 GCACAGGTACCCTCTAAGCCATGTACATGTGTATACAGTGTATAAAGACTTTTTTAAAAA 0.2433167 0.119846 1
216965 GGCTGCCGGGGTTTTTGTGGTTGGCTTTTTGTTTTTGTTTAACTTTTGGAAAATTTTTAA -0.16714439 0.119865 1
100039042 AATCCAGATGAAGCAAGAAGTCTGAAGGCCTATGGAGAACTTCCAGAACATGCCAAAATC -0.18757729 0.119866 1
69306 ACAGGAGTATCCTGTGACACACGAGTGAGCATGGATAATTAAAATGAACATGGCCACAAT 0.18575518 0.119949 1
66352 ATAAGCACCAACTCATATTGGTGTGGAGAACAACAGGAGACACTAGCTTGCTAATATGAT -0.15073927 0.11997 1
12774 AAAGTTTCTGCCTAACAAGAGGTGTTACTGGTTTTTCTCAAGCTCCGATTGTGAAACCAG 0.34825102 0.119983 1
107071 AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT -0.19123566 0.120005 1
27384 TGTGTGGACAGTGATGCTGGCAATATGACCAAGATGGACTGTTGGATGGACTTGTCATTT 0.63245694 0.120032 1
260305 CATAATATATTTTAATTTGCCATGTATTTTATTATACTGGGATTCTTTTGTATCTTTTTT -0.24486333 0.120121 1
279185 GGAAGTCCTGCAGCCTGATATTTTCATTTATCACCACCATTAGCATTATAATTTGTCATA 0.19811523 0.120127 1
11298 AGAGGGGGTTTGTCTCCGCATTTCCTCCTCTGCCTGCTCTGTTTACTGTGCTCCAGTGCA -0.28567537 0.120128 1
234967 AACTCTACATGCATAACAAGTGGTTTGTAATCATGGGAGAAGAGCGGTGAACCCTCTCCT -0.14490034 0.120158 1
225215 TAATTTCTGACAGTTGCATAATGGCAGCACACAACACAGCACAGCTTAGTTTTGTTGGGC -0.16026849 0.120167 1
14824 TCCACTGTTCAGCCAGGGGAACCAAGTGTTTGCGAAAGAAGATTCCTCGCTGGGACATGT 0.53333187 0.120205 1
20111 CTCAGCTGGTAACTCAGGGTTCATCTGTCCAAGGCCTTTCTAATAAACTTACAATCCAGT 0.5420935 0.120282 1
74718 AGGAACTATAGTCACTGCTGCTTTCAATGTCTTTTATCCAGCATTGTATTTACTACATTG -0.16900404 0.120313 1
12182 AACCAGACGGTAATCCAGTTGTATTTACACTCATGATTCAAGAAACAAGGCATTCATCTA 0.94878844 0.120318 1
69694 CAGAAGCATCAAGATGACTTACAAGATGTCATAGAGAGAGCTATCCAGATTGGTGTTAAA -0.15519308 0.12036 1
211666 AGATTCCTGAACGAATACCTGGACTTTCATGTTGCCAAGAAACTGAGGAAGCCCTTCTAA 0.73166009 0.120371 1
75973 TCCTAAAAGATGTGGAGCAAAAAGAGCAAAAACTACAGCTCCTGACAGAAGAGGCTGAGC -0.196959 0.120378 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.8630617 0.120411 1
93871 AAGTTAACTCGGTATTACAGTCCCTATAAGCAATGATTTACATGGATCTCTTTAAAGGTC 0.27700485 0.12043 1
52009 TTAGTGTCAGCTTCTTATAAATACCTGTGCATTGCTTCAACGCTTAGAAAAGTGCTACTC 0.20970502 0.120558 1
244178 GAATCCAGAATGAGATACATCAACAGCTACCACTACTGTTGCATCTTCAGACAGCCATGG 0.22314176 0.120563 1
71885 TCTGCACCCTGATGGGAAATACCGTCACCCAAGAACTCAGGCCATGGAGACACAGGGTTT -0.1526666 0.120567 1
56220 GCTTGAGTCCCAACAACCATCAATGTAATCTTCCAAAGAAGCTTTTCAATTGTGATAATT -0.18288404 0.120575 1
11637 GGAGGGGCTCCTCGAGAGAAGATTGGAACAGTGGCAGTGTTATAATTAGTAAGGTTTTTT 0.32384855 0.120602 1
71986 CTGGATGACCACAAGATTCAACATCTAAGGCTGCAAGGGCAAATGCCGGCCTCAATGAGG -0.16827191 0.120603 1
67511 GGAAGGGCGCTGTATTTCCACATCGGAGAAACAGAAAAGAAGTGCTTCATTGAGGAGATT -0.19979578 0.120619 1
67011 AGACAGTTCTTTGGTGTGCATACAGACTGACCACTTATTAAAGACTAAAGCAGACGTGCA -0.15132435 0.120658 1
230157 GGCGTTTAACATGTAGTTTAGCCAGTCAAAAGTATGCATGTAGAGTTTAAAGACTATGTT -0.17779896 0.120687 1
66498 AGAGTACCCGTCAGAACAGATCATTGTGACAGAAAAGACGAACATACTTCTGCGGTACCT -0.21476418 0.120691 1
236312 ATGTGGAGGCTGAAATGCAGGCTGAATGCAGTTGTGGAGACTAATGTCTTCAGAAGTGAT 0.59397561 0.120704 1
72508 ATAGTACTTTTCTCATGTGACTCAACACTATAGCACAAGTATTATTTCCCTGGATTCTCT -0.18709516 0.12072 1
68591 AACTTTGGTGTGTACCTGATGCATTCGTACTTGGATTTATCGTCTCCATGTTTCCTGTCA 0.4129036 0.120727 1
271887 TAGCACCCCTGAGCCTCTGGAGCTCACATCCCACACATAAAGAAATAACATCTTCCACAG -0.29384304 0.120727 1
67872 TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG -0.14021332 0.120831 1
110074 TTTGTTGTTGTTGTATTATTTAAATTATAGCCTTCCAAAAACTGTTTTTGATCATAATTG -0.18287184 0.120833 1
69259 TTTGCACAATTTGCATGGGCTCTGTTCATCTGATACGACATTGGAGCTGCTAAGGTTCCT -0.17381204 0.120854 1
382097 TTAAGTTCTGCTGATTCCTTGCTCCTGTATCTTCAGTGAAATGTGCCTTGTGCTCCCACA 0.14694858 0.120912 1
245381 CTGAGCAGTCTCATAGAGTCTAATATATCATGAATGAGTTCTTAAGTACATTAAAGGGGA -0.13036605 0.120926 1
233335 GTTACTACGGCTGTGGCTCGTCATCTCTTATACTGTCAGAGATGTGCGGACTTATTTTTT -0.24176224 0.12093 1
22209 GATTCACGGAAGGGAGTGTATCTTGCAAACTTTTCCCATTCAAATCCTGAGTTAATGCTG -0.2511774 0.12095 1
217449 GGGTTCCCTTGGTTTGTTCATGGAAGCTAACTTGTTCTTTGGTCACTTCTGAATACTCGT -0.18078159 0.120969 1
69656 GCCATTCTTGATTTCAGAAATGCAAAAAATGGTTTTGAGGGGGCCAGAACCTGGAAGTCA -0.1454541 0.120984 1
217473 GACATACAAAGCCGTAATGAGGAACAATCTTTGGTCTTAAAGCTTTGCCATAGTTGAGCC -0.17919493 0.120992 1
16974 CAAAGGAAACAGGAAAAGAAAGGCATCACTGACCAGGAGTGTCTGGGTTTTAACGATACC 0.15250001 0.120993 1
66874 ATACTTTGGAAGAAGGCAAAGAAAGGAGTGTCATTATTTTGAATGGTACCAATTGTATGG -0.14145176 0.121017 1
72096 TTAGTAAGTACCCAGGCTACACAGACTGAATAGGAATAATGGGTTGATGGGAAGCCACAC -0.15728563 0.121028 1
26410 CAGAACTGTGTAAACCACATAATTTCTGTACATCCCAAAGGATGAGAAGTGTGACCTTCA 0.29024485 0.121031 1
56692 TAAAAATAATTAAGTACAATCACTAACGCCCCTCTCTCTGTGTTCTCGGTGAGGATGAGT -0.14694263 0.121074 1
234779 GTGCCTTTTGAACTTCCCTGTTCTCAGCCTCATTGAATAAAGACAACAGTTTCATGCCAA 0.57984785 0.121147 1
235386 TCTTAAGAAAGTCTACATGATGAACCCTTGCCTAGTATGCAAAGCCCGGGTTCAACCTCA 0.25848175 0.121189 1
194388 CCCTGAAAGGTGGACCTGGGTTCCAAGACAAGTTGTGGAATCCTGTGAAGGTGGAGGAGG -0.18611957 0.121212 1
327959 TCTGTATTTCTGGACCACAGTCACTCATTTGGCTCCAAAATAAACTTATCTCTGCATCCT 0.23022351 0.121257 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.10913311 0.121271 1
74603 AACTGGCTGTAACTGTTCTCATCGTAGGATTTGCTTTTTTCCAGAAGAGAAATTATTTCA -0.17513767 0.121278 1
50794 GGCTGCGAGAAAGTTTACGGGAAATCTTCGCACCTCAAGGCGCACCTGAGAACTCACACA -0.20085476 0.121321 1
243880 AGAACAAGGATGGAAATTCTGGTGCAAGAACCATGGGTGTATTGGACCTCAAACAACCTC -0.25902474 0.121349 1
70484 GAAAACTTTTTGTTGTTGAAACATCTCTTTGTCTTTGTAAGAGTCAATCAGTTTTGAATG 0.35417757 0.121356 1
76022 AGACCAAACAGCTGCCAGTTCTGGTGAGGTGCTGTGAAGAGATCCAGCCACATCAGTGGA -0.20349067 0.121415 1
238393 CCTTCATCACCCAAATTGAAAGGGCAGGAGCTAATGATCAATAAACATATAACTGCATTG 0.64074579 0.12142 1
12116 GACTGCTATTCTGTCTGCTTCTATTCCATTTCATTAATAAAAATGTGCTGGTTGAAAACC -0.43662098 0.121445 1
67574 TCATGGAGCAGTCTACTATCCAGTAATGACAGATCCCTATGGGTCTCCTTTGTTGGGATT 0.2332656 0.1215 1
72795 CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA -0.29701407 0.121504 1
212555 ATCTACCTACCTCAATCTGACTGTACTCTTGGTTACATCATAGTCAGGGGACCTAGGGTT 0.21231903 0.121532 1
58244 ACCTCAGATGTGCTCATGAATGTGGGATTTCTTATAATGTCCCAAATGCATAGCCTGGTA -0.15962877 0.121544 1
109246 TAAAACCCCTCTGACCACCTTGAATAACAGTGATGACCAGGATGTGGAACTTTCAGTACG 0.22766704 0.121587 1
26556 TGATAGCCGGGCAAACACTGTTTATGGACTGGGATTCTCCTCTGAGCATCATCTTTCAAA -0.28799959 0.121654 1
14255 CGTGGATCTTCTCTCAAGCCTCATTTCCTTGTGAACAGAGAGGCCTGGAGGATGGGTACA 0.24437753 0.121659 1
229504 AATTAATTCTAGGTCAGTGAGACCCTGTCCTAACATAAAAAGAGGGCCAGGGGTAAAGCC -0.1480297 0.121687 1
219144 ATCAACTGTTCTTCAAGTAACAATAGTCAGAGGGAATATAAAAATTCTCACAATACCCCG 0.368147 0.121704 1
74205 ATTGTCTTGTATGCATTTGAGAGAAATAAATATACTCAGACTTATGTTTTAAGAAATTTC -0.15052082 0.121751 1
30956 TATTGTGCTTCCTTTTCCCCGAGAACATATTATCAGCAAGTGCAGTTGTACTACTTCCTT -0.18607221 0.121772 1
67705 TTCATAGTGAACCCCCTAAGAGAAGTGTGGTGCAAATGTGTGGTAAAGTGAGTCTCTCTG 0.13685225 0.121818 1
209357 CCTGGGACTCTCTGTTCAGATGATCCTCTGTCAGCGCTTATGGCGGATGCTGGGTCTTCT -0.13334761 0.121864 1
73835 CACCACGAGATCACATGCTCTGGTCTGTCTTCAGCACGATGTACCTGAATCTGTGCTGCC -0.15293371 0.121893 1
229776 CACCAGGAAGGGGATGTATATATTATAGAGATTATATAGCACAGAGATTCTCCACTTATA 0.15882755 0.121928 1
70408 AAGGGGTCCGATAACCAGGAAAAACTGGTCTATCAAATCATAGAGGATGCAGGGAATAAA -0.20224153 0.121929 1
384281 TGAACTCCTATTATGGAGAGTTCAGTTTACAATGCCAGATCTGAATTGTAAGAACTCCGA -0.15578067 0.122021 1
12121 AAGTTTTGAGGGTATCTTTAATTTTTTAAAATTGCAGTTGAGTAGATAGATATATTGGTG -0.16623992 0.122047 1
73412 CAGTGTGCAAGATCCATGAAAACGAAGAGTATTTTGATAATCTTATAGGGCACATGACCA -0.25488627 0.12205 1
226041 AAACCCATCCTGGTATTAGAGATATGGCCTTACAGGTATTAATCACATTCTGAATTTGGC 0.32637606 0.12211 1
217125 CAGGGCCCTATGTTTGTGCTCAGTCACCTTCACTGGAAGAGGGGGCCTCATAGGGAAAAC 0.54403048 0.122174 1
74666 TATCCTTCCCCCATGCTCTCTGTTACATTTGGGAAGGTGGGGAATAAATGATGCAGTCAT -0.20265988 0.122183 1
66488 GCCAAATGCCATTTTTGCCTGGGTGGTTTTTATTTTTTATTTTCTTTGCAGTGCAGTGTT -0.16177375 0.122194 1
110380 CCACTTATCAACAGATCCTCTTGCTTGACTTTAACAAAATAAATAGTGTCTCTTCAGATG -0.19649929 0.122207 1
624784 TTACTACATTAAGCTGAAGGACTTGAGAGACCAGCTGAAAGGCATTGAACGCAACACCGA -0.20184818 0.122228 1
24044 GCCGAGCCTTCTTTCTGAGGGTTCTTCCCACAATGGAGTCTAGGTCCCTTTCTACTTGTC 0.38087709 0.122237 1
69962 AATGGAGATGACTTTTAAGCACCCCAGTTAATATGCACCGAATGGCGTAATGAAATAAAA -0.15361294 0.122283 1
99681 GGGAAATGTATGAACAGAGGACAAATTTCTAGAGGTCTCTTTATTATACTTAGATGCTCA -0.25240629 0.122358 1
223732 AAACAATTACCAGGGGTTTCTGGCTGAGCTCCGCAGAACCTACAAGTCCCCGCTGAGGCA -0.14319777 0.122372 1
18549 GACACAAGCAATCCCAGCCTGGTCTCAAGCTTTGCTCGCTGTCAATGATTATTTTCACTA -0.26537134 0.122376 1
14255 AGATGCTGTCTGCCATTACTCCAAAGTGACTTCTATAAAATCAAACCTCTCCTCGCACAG 0.21113151 0.12238 1
319748 GGCGCCTGCGGCAAGACCTTCCGCTACCGCTCCAACCTGCTGGAGCATCAGCGGCTGCAC -0.20636195 0.122411 1
16918 GCTTTTTTGCAAAGTGGTGTTAACTGTTTTTGTATAAGAAAAACAAAAAACAAAAACCCT -0.21696197 0.122423 1
258914 TTGAGAAACAAGGAAGTCAAAGCAGCTCTCAGGAAATTTTTTCCTTTCCTCAGAAATTAA 0.14300064 0.122439 1
56175 GACTGTATCTTGATTACTCTTGATTTCCAAGCTTTCAGATCTTTTCTACTTCAGAGAGAA 0.53148111 0.122446 1
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.65129206 0.122446 1
268859 AGGCCTGAGTGTTGCATCACATGCAGTAGGACATCATGTTAGCAACTCAAAGAAACAACT -0.22400627 0.122458 1
224111 GCAGGTAGTGATTTGGTGGGAAAACCAAAACTTGATAAACTGCTTATAAAACCATTTCTA -0.13535993 0.122505 1
219249 CGATAGAGCAAAATATCTTTACAAGTGGAAAACTTCTTCTGCCATCAATAAAAGCATTGC -0.25812289 0.122517 1
216739 ATCGTCGATAAACCCCACAAGGCAACACTTCTGCTGGAACACGTGGAGAGGAAGGAGACT -0.14699871 0.122534 1
232947 GAGTGGCTTCCTGGACTTGAGAGCATATTTATGTGTCTGCCACTCCCCAGGGTGGGGCTT -0.16920675 0.122552 1
320946 GTTAGCTAAACATTGATATTTCTGATGATAATAAAGACCCAGAACCTGAATTTGGGAACC -0.16482134 0.122563 1
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA 0.17623218 0.122568 1
56445 AGAATTCATAGCCTGTATCTATCATTTAGATGCATAGAAAAATGGGCTTTGCACACAATG -0.18003329 0.122571 1
71952 TGGTTGTGCTTACCTTTAGGATTTTTTCAGTGTCGCAGACTTCAGGCTGGAGAAGAACCT -0.20119369 0.122579 1
360220 ACGAACAGGAGGAGAACAGCAATCTTGAGACTCCAGAATATCAGGTCTCAGAAACTGCAA -0.14542935 0.122597 1
329217 TTTCAGGAAGACCTGCCTTTGCTTTTTCCTCTGCTGCTAATTTGAAGCAAGAGTCCTCTG -0.27531771 0.12261 1
64293 GAGACATTTTAATGTATGGTAAGGTTTTACACTTTTCAAATAACTGCATTGTACCACCCC 0.2478186 0.122712 1
14167 TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT -0.18185615 0.122751 1
23825 GTGCTAAAGAAAGATGAAGACCTCTTCCGAGAATGGCTGAAGGATACATGTGGTGCCAAT -0.14453684 0.122843 1
319586 AAGTTTGCCGACACGGATAAAGAGCGGACATTGCGGCGTATGCAGCAGATGGTTGGCCAG -0.255772 0.122905 1
244334 TTGGCCTTAGGCATAAGATTGGAACTTGTGGATCTCCTTTCAAATGCTGCAAGTGATAAT -0.18144587 0.122923 1
67972 CAGATCCACGGATGCATTACGGAAAATACAGGAGAGCTATGGAGATGTCTATGGCATTTG -0.33267006 0.122982 1
52626 TGATGGGATTGAAGTGGAAGACCTGCCACAGTTTACAACCAGAAGCGAACTAATGAGAAA -0.22376661 0.122993 1
56620 GTCTTGCCCTGGTTTCTTTCTATGAACTGCTGTTACTTGAAAGTATAAGATGAATAAACA 0.62578162 0.122998 1
497114 ATCGTTGAGAGATCTGATATGCTATTGTAGAACAAGAGGCTGCAAAAGAAGAGAACGCCT 0.15478781 0.122998 1
278676 CAAGATGAGAAGACAATGTCGGATATGGAAAAAATGACCCAGTCAATAAGTGATACCATT 0.19224201 0.123013 1
71709 CTGTGTGGAATGGATATGTGGAACTCTTTCAGGGACCATAGAGTGGGATAGGATTTTCCA 0.22945319 0.123073 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.36149042 0.123135 1
234582 TTTCACCTATCACACCCCTGTGAAGGGGGAGCCTGTTGGATATGTATATTGTATATATGC 0.38565214 0.123138 1
77296 GAAGAAGCTGCATTGGCTGCACAGTCCAAGTCTAAATGATGCTTTAGGCTAAACTGTGTC 0.15133154 0.123207 1
12447 ATAAAAACACTTTTACAGCTTATTGGGATTTCAGCCTTATTTATTGCTTCAAAACTTGAG -0.20023033 0.123227 1
20293 CCTGAAGTTCCCCACGGGCAGTGTGATATTTATTATGATATCTAAAAAGAGATGTTTTTA 1.37223384 0.123235 1
216134 GTCTCCATCCCTGTGAAAAGCTGTAACGTCTGCCTTAGAGCCATGACTGAAACTCGACAT -0.16546648 0.123257 1
75339 GAAAACGTTCAATGTTCTGCTTAGTTTATTTCCACAATGTGGAACAGTACGTGTAAGAAA -0.16283502 0.123356 1
378937 AGGAGCTCCGTGATGACCATGGACACGAGATGTTCGTCATTGACCGATCCAAGCCCCTGT -0.18860118 0.123357 1
269630 AAGTAGGGGATAGGCTCCCCACCCCCGCCCTTTAAATTCAGACCTTAGAATTAAAACATT 0.17139117 0.123357 1
227210 ATAAAAGATTTGCATCCTACAACTATGTGCATTCTATTTCTTCTCACATCTAACCTTGGG -0.13923522 0.12337 1
277333 TTTGTAAAGCTCATTTCCTGGCATGACAATGAATATGGCTACAGCAACAGCGTGGTGGAC -0.13836397 0.123372 1
68870 CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT -0.24394865 0.123391 1
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.37627422 0.123403 1
245578 TTCTCCAATCATAGAGGAACACCCCTTGTAAAGCCTATATGGATACTTCACATTTTAAAA -0.2092251 0.123473 1
213012 GCCATCTAGATACAACAAGGAAGGCTATTTCAGAATCCCGTACAGTTTCATTAAAGAAGC -0.21734416 0.123487 1
70382 GTCATAGCTAAAAGTGGTGGTGTGTTTGTGGTTGTCTCTTGAACATGCGCTGATAGGTGA -0.18340789 0.123511 1
259081 TTATTTATTCCATCAAAACTAAGGAGATTCGTCGAAGGCTTCACAAAATCCTGCTGGGGA 0.19847921 0.123524 1
434017 CTGGGTGGACTTCATCATCTCAACCATATCAGTTCTGTTGTGGAGGTATGACACAGTCAT 0.37403557 0.123545 1
100038914 CCTAGCACTCATACACGAGAAAAACATTATCAGGATGAATATGTTTCTGAAATGGATTGA -0.2207516 0.123553 1
94281 GAGGGGTATAGGAACACGTTTATCTCCTGTTTGGAAATCTTTGGCCCCTTAAAGAGCACT -0.34134124 0.123629 1
75202 ACTAAGGACGTTACGTACTTCCGTGATATGCCGGGGGCTCACGGGTACCTGGCACGAATA -0.26409658 0.123631 1
640793 ATATGAAAAAGGAAATTCCAAAGTACATCTCCGCATTTGCAAACACCCAGGGAGGCTATC 0.33291919 0.123645 1
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.15832996 0.123741 1
11890 CATGGCTCTATGGTCTCATACCTTAGGAAGACTGAGAATCCCCCCTTCTGCACAATTTAT 0.60539782 0.12376 1
109910 AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC -0.18806612 0.123799 1
28000 GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT -0.16019211 0.123867 1
17152 ACATGCATCTGTTTCCTTAAAATCTGATCCAAACTTGTCAACTGCTTCAACGGCTAAGCA -0.18377023 0.123917 1
22670 AGTGGCTCCCTCACCACTCTTTGTTCTAGAGTTAATCATCTTCATTTCCTGTGTCTTTAT 0.17980556 0.123918 1
100033459 GCTGATGTGCCACCTAACTTCTCTGTTTTCTTCTGTAATATAAATCTGATATTCAGTTTG 0.18525166 0.12395 1
319513 GGGCCGGGGTGTTCTTGTCCATTGCTGATATCAATAAAAGCATGGAAGGACAGAGTGACA 0.16997587 0.123997 1
100039954 CATGATTTCTGGCATGGATGCTTCATCTAGTTTGAGTTGTTATTATGTATGTGTCCATAT -0.45216405 0.124027 1
80879 GTGGTCTGTTCACCCTGAGTCCCACCCTTTGTTAAATAACAAACTGCTGATTCTTAAAAA 0.48924553 0.12403 1
20845 TTGAAGTCTTAAGCCTTCACTGATATTTATTGCTCACCTCGGTGCTTTAAGGTGAGCGAG -0.18194816 0.124082 1
229279 CCCCAAATATCTGAACTCAAATTCGGAATGTCTTAAATAACCAAAGAAGAACACATGGTT -0.18686156 0.124087 1
22764 GACATTTTGCTGCATTTTACAACTTTTTAGGAGGTCAAAGTTAAGTTTGCCCTATGGATT -0.15715936 0.124132 1
215090 GCCATAATGCACACATATATCTTGACTGAGAAATCCTACTCTAAGGAAATAACTCAAAAG -0.19307057 0.124157 1
74018 CGAAATCAAATCACAGATACTTAGGCCTCTTCTCAGTTTAGAAAATTTGGGCACAGTGAC -0.17799704 0.124161 1
224833 CCTGGATGGTCCAGGGTTATATCAGTGAACTGGAATATATGTGTATATATTCTAATATGC 0.32453002 0.124204 1
226527 TGTACTGGGGTCGCTACCAACACCAGGACTTTGCAGTGTTTTCCAAGAGCATGTCCACAG 0.42825097 0.124218 1
26414 TCTACAAGGAGGTAATGAACTCAGAAGAGAAGACTAAGAATGGCGTAGTCAAAGGCCAGC -0.30658903 0.12423 1
433078 CTTCCTGAACAACCAAATACAGTAAAGAGAAAACCTAGGGAAAATTGTGATGATGTTCAT 0.13709225 0.124267 1
12769 CAGGCAAGAGGCACTTGCTGCAGGTTCTCCCATCTCTTTGCCAGTGACATGGCCTTTCCT 0.24699313 0.124294 1
14000 GAATGAAGTGTGCCCATTGAAATAAAACTCAAACCACACTGCGGTTGTTGTCTTAATGAT -0.19093589 0.124296 1
16535 AATTTCGTAGTATGATCTTGATTGAGAGACTTTTCCAAATAAAGTTGGGACGTCCCAGGT 0.70942924 0.12434 1
70750 AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC -0.15631165 0.124343 1
209200 GAAAGGGTTGGGCAAGGAGAGAGCTCGCTTACACAATACCAAGTTTGCCGACAACTTTAA 0.4292068 0.124371 1
66146 TGCATGTTGTCGCCATTTGCATTTTGAGTCATCTTGTGTAAATGTCACCATGAAAGTGTT -0.14593167 0.124372 1
226652 TGGGGCTACAGGCCACCATTTAGCAATGGTGGGTATTTGATAATAAAAGCTGAATTTTTT 0.7401801 0.124383 1
75934 TCTTTGCTGAACCATTGTATTGAACTTCTGAATTTATCGTTACGTCTGAGCAAAGCTTTG -0.17514002 0.124392 1
76850 AAAGCGGAAGTTAAGGTCATCATACTAATACTGCATCAACTCCAGGAATTAAAGGAAAGA -0.24643031 0.124425 1
109032 ATGGCAAAGTGCATGAATACTAGACAGTAAAAATAAAGCTGTTGGTGTCTCTGTGCGTTT 1.09886429 0.124463 1
229534 CTTGAATGACCTTCACAGAAGAGAGCAACGCACTTGGCCCTGCACTGGTACCACTTTTGC 0.40375157 0.12449 1
668727 CAACATCTCTCCACTAACTTAGTTTTTCTACCCCTCCTGAATAAAAGCATTAATCAGAAA -0.28501873 0.124511 1
108946 GTGTTTGTTTCTGTTTGGAATGAAAGCTTTCATATGCTTTCCAGAATGATGTGAGTTACA -0.19412226 0.124541 1
14130 ACTTCTGTGAGTCCTGAAACCAACAGACACTACGAGATTGGTTCCCAATGGTTGACTGTA 0.8294462 0.124545 1
63954 TTGTCATTGGAAAGATGTCACACAGCCTGTATGAGAAACTGTTTGATTTCAGGACAGTTT -0.29422562 0.124577 1
192164 TGTGTTAGGCTCTGCAGAGGACACATGTCAGAGAGAAAGGCAGGTAGAACATTTGAAAGA -0.27913027 0.124586 1
106583 GGAGACAGACAAAGCTATGACATTTTATGCAAGGACTGGCTGTAGATTCTTGAGGAGCAT 0.23300578 0.124639 1
14687 CGCGGTCTACATCCAACGTCAGTTCGAGGACCTCAACCGCAACAAGGAGACCAAGGAGAT -0.24715123 0.124641 1
26361 GACTTCTTGCAGTGATGGCGCATGACCTGTGAATTATAAGATGAAATAAATACTTTCCTC -0.33806811 0.124671 1
238252 GAAGAAGGGTACAGGACTAGAAACATGGATGCTTTTTTGCCTAGCCAAGGCCTAGGTTTT -0.24743661 0.124693 1
378700 TTCAGAAAGCACATAGCACCTTGGTTCAATCCCAGCTTTAATAAACTGATCCTTGGTCTT -0.16089981 0.124773 1
272382 CCATGTGGTCAAGGCTAAACTGTACTAAATAAAATTATTTCTCATCACCACTATACATGC 0.65178543 0.124802 1
69684 TGCTGAGGAGTGAGGGGCCAGGACGTCGTCCCTGTGACCAACAGTAAAATATTGTGACTC -0.17786987 0.124827 1
71664 ACCCCAATACAGTACTTCTAAGGAGGGGTCAGGTAAAGCATGAGAGAGACTCTCAGCGCC 0.20994107 0.124879 1
15163 CCTAGAGGGGAGGCTCTCACAGGGCTGCCTGATTCGCCCTGTTGTGCTTTTGCTCATTTT 0.85761025 0.124893 1
13808 CTTTCACAGGAAAGACACAGGCCTTCAAGCCCTTCTCCCAGAAATAAACACTGCCAAACC 0.19976441 0.125002 1
269252 CTTTGGAACACAGGTATTCTTCTGTGGGCTTAAAGAGGAGATGTGCACTGTCAATTGACT -0.15076189 0.125068 1
245474 TAAAATGGTATAGAACCTTCTGTGAGAGAAAAAATGTAATTGAACTATGTTCACTGGGGG -0.16127023 0.125085 1
14738 GAAGCAATGACATCTTTTAGACACGTATTGACAGTGGAAATCATCTTACCAGTGTTTTTT -0.31747468 0.125105 1
67861 TCTTCACTGATATGCAACCCGCTCCTACTGACTCCTATTTTTGCCAAGCCTATTGGATAT 0.230586 0.125129 1
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 1.06780402 0.125158 1
11614 GAGTGTGGTACTAGGCTAACAAGCTAATTTCATAAAAATAACATCTCTTTCCATTAACCC -0.14186123 0.125163 1
74782 CACTGTTCTTTAAGAGCAACTCTTCTGATATATATGACCTATGGTGTAAGAGACAAATAC -0.36380677 0.125211 1
70357 TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA -0.14892531 0.125222 1
70357 TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA -0.14524926 0.125239 1
109264 TTTTGTAAAATCTCTGATCTACACTCCAGACTATGACTCCTTCTCACTAGACACCTACAG -0.49520566 0.125258 1
53323 GCTCATAGGTTTGGAATGTTTTGTCCGAGTTCTTCACTTTGTAAGTAGTAATGTAAAAAG -0.20139469 0.125265 1
74760 CTATTTCCTTCCAATGGAATGTAACGCGATCTCTATTTAATAAAGGAAGGCTTTGTTGGT 0.42080244 0.125266 1
14265 TGAGCGTCTACGATCTGTTAATCCCAACAAACCTGCTACAAAAGATACTTTCCATAAGAT -0.15690852 0.125287 1
230779 AGAGACCCGGAAGATGATCAGCACTTGGACCTCAGTGTGGGTGAAGATCTGTGCCAGCTG -0.24989061 0.125296 1
20908 ATCGCCATGCTGGTGGAAAATCAGGGGGAGATGTTAGATAACATAGAGTTGAATGTCATG 0.2324024 0.12537 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.2697704 0.125387 1
15353 CTGCGCCTTTCATCACTCAATCTGGACTTTTAAATAAGTGTTGAATAAAAACAAATGGGT 0.15160601 0.12545 1
16504 TGAGGACTCCTAATATTGCCAAAGGATTCAACTTATTTAACAACCCCTATTATCCCCGCC -0.186161 0.125531 1
68612 ACCTGCAAGAAACCTATTCAAAGCAGGTCTCCAGCCAAGATCCCTGATGCAAGCTGGCCG 0.34145078 0.125533 1
73341 CCTTTCAGTTTCCCCTCTGTTATGTCCCTTCTTATAGGAGCTCAGATTTTCTAAACTTGT 0.26718463 0.125545 1
101883 ACTTGGCTGAGTCAGAGTTTGCTGGGGCTTACTACTCCATCAATAAAGTTTCCCTTGAAG 0.44122105 0.125549 1
18983 GTGCATTGTGCAAATTGTTCAACAGGAATAACAGAAAAAGACAAGGAACTACTGAAGAGC -0.48485042 0.125649 1
259098 TACTTAATGGTGCCACCAGTGCTCAACCCAATCATCTATAGTGTGAAGACCAAGCAGATC -0.14272999 0.125736 1
140709 TCTCCACCAGGAGGTGATCAGAGACCTGTGATGTTATTTCAAATAAAGGTGCTCTCTCCA 0.26148836 0.125737 1
50781 GCCTGTAAATCGCATCTGAAGATACCACAGTAAAGAGATGTAAACATTTAGGAAAACAAT -0.26389342 0.125809 1
240754 TATGGGGATGTTGGGGATAAAAAGGCACATAGCACTTAGAGTGGAAGCATGACGTGATAG 0.4222578 0.12582 1
75291 AATTTGCACTTGGTCCTAAAAATTAACATCTGGGGAGCATGAACTGATGCCAGGCCTGCT -0.15372182 0.125822 1
77647 TGGATGCCAACGTTTCTCAGATCAATATGGTAGAAAGTTTCCCACCAGATAACCAGGTAG 0.53642889 0.125841 1
207785 CTCCAACTTTCTTAGCCCTTAGATTTGGATTTTCATTAAGAAACGTAAAGACTAGCCAAC -0.2194866 0.125864 1
68910 ATCCACACAGAACAAGCTGAAGCTCCTTGTATGGGCAGCCAGGCCAGTACCCCACAGAAG -0.22859404 0.125871 1
11513 ACACTTCCTGACAAAGTGATTGTTACTGTGTACTTCATAGATGACAGGTCAATGCTCCGA 0.87427485 0.125886 1
12505 ACAGATTTCTTCGACCCAATCTCACATCCAATGGGACAAGGTCATCAAACAGAAAGCAAG 0.18705865 0.125904 1
13728 GTTTGTTTTTGATTTATGACAATTCCACTCTTGGCCCCAGTTGTCGTCCTGTCACTCCCT -0.19306453 0.125951 1
218952 GTGGTTGGGTGTGAATAGGAAAACTTGTAATAAAACTCCACAGCCATAACAATATTTAAC -0.17940013 0.125962 1
277562 CTGAATCCAGCCATCTACACACTGAGAAATAAAGATATTAAAAATGCCATAAAGAAGCTG -0.19851323 0.12598 1
73673 CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC 0.35149831 0.125998 1
110006 TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT 0.48316216 0.126065 1
14762 CTCACTAAGAGTCAGCCATTACCTTTACACTTGACACTGGGACTTGCAGTGGTGACTATT 0.21434354 0.126077 1
66780 CTGGGACAATTACCTTCATTGCTTGTATTATACAGACATCAGCCAGCTATGACTAGACAT -0.21414842 0.126082 1
227522 AGTTTAGAGACTGAACCCTCGGAAAGCCAGGACAACGAGATTTTGGACACGTCATTTGAT -0.13868667 0.126098 1
56523 AAGTTATGCTTTGCTGAGTTTTGTCTACCTCCTGAAGTAGAGTTGTAAGACCCCACTCCC 0.48441085 0.126112 1
57776 CTCTAAATATGCTGCCCAGAGACTGTGAATCACCAGCTATGTGAAAATAATAATAAACAA -0.17253378 0.126152 1
72899 TCTCCACCCCACAAGAAGAGCAAAGCAAAGAAACCAGAAAGTTCTAAAGACTCCAGTGAA -0.21472785 0.126162 1
74735 AATTTACCTCAAAGGTTACACAATTGATTTTCCCGGTGCTTGGTCTAGAACCAGTGGCCT 0.69410626 0.126172 1
57014 GAAGGCAAAAATCAAGCCAAATGGCTCAACGGTATCTTGAAAAGTACAAAATAGATGATG 0.18157605 0.126189 1
18439 TTCACTTCTCTCTTTAAAGGGAACCATCTTCTAAACTCTTCCTAATTTCGTGTAAGGGTT 0.42295825 0.126217 1
74069 CTGGTCTCAGACCTGCATAGGAACACATCCATGGCACTAGTGAATTTCCTCAACTTTCAA -0.1675809 0.126226 1
14419 TGTTGATGTGCCCCTGCCTGAGAGCAACATTGTCCGCACTATAATGGAGTTTCTCAGTTT -0.19144358 0.126246 1
432450 CCTCTAGGCTTTAATGCTCTCATATTGTAACAATAAAGAACCCTCAATTTAGCAGGAGAC -0.23539558 0.126274 1
328795 GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC 0.33598633 0.126346 1
30947 AGGATACAGCCGTTTGCGTCCTGGATCAGAAACCCACCCGACTACCACCAATTTAAATGA -0.13297283 0.126352 1
258466 GAAGTCAAAAGGGTTATGAAGAAGCTCTGGGGTCGAATGAGGAAAGCTGGTGACATGTAA -0.14115473 0.126355 1
22718 ACTACTGTTAATTGCATAAGCTTAATTCACCAAACACAATTCAGCTCACTTAGGAAGAAC -0.18542519 0.126358 1
50930 TTAGAACAGATTGTGCCAGGCCTGTTGGATTCCTGGAGTTGATGGGATCGTGGGAAGGCA 0.42402725 0.126371 1
64661 GCTACAATAATTACCCTACCGCAACAGAGGGCCTTAACAATGAGTTCCTGAACTTTAAGA -0.24501134 0.126378 1
77305 TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA -0.1421954 0.126409 1
235047 CAGTATCTGACTGGACTGGCAATTTGAGTGAGAATGGTCCTCATAGACCAACATGGACTT -0.15374518 0.12649 1
12182 GAATAAAAGAAAATAACCCCAAGGAGAGTGCAGTTCTCTCTGAATAGGGACTTCACAGCT 0.33194261 0.126527 1
258498 CTTGACCTCTTTAACCTTTCAATTAGTCTACTGTGCATCCAACCAAGTGGACTATTTCTT -0.19626788 0.126535 1
12663 TAATATGAGAGATTCCTCAGGAGTGAGCCGAAGCTCATACTGTGGCTTACCTTCCAATGT 0.15914463 0.126545 1
329514 CATCTTGGGGATAAATGAGAAAAGAAAGGTTCTAATTAAAAAGTGATAAGTTGGGCCTTG -0.3052064 0.126562 1
70461 CGGCCTTTTGTTAAGCAATATTGAAAGATCGGACTTTGTATAAAGTAGCTTCCAAGTTTT 0.1769158 0.126575 1
68597 TGTGGACAACAGCAGCCCAGCACAGAGCCACATGAGCAGTAAAAATATGTTTAATGATCC -0.18427401 0.126576 1
432591 TTGTTTGTCATCTGTGGCACAATAAGGCACTTCTATTTCAAACGGACATATCTACTGCAT -0.22818139 0.126716 1
68870 CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT -0.27418797 0.126725 1
14687 TCATCTGCCCGTCACACCAGCCCACGTTTGAGCATCCCTCGTTGTGACCATTCTGTTTGG -0.22085988 0.126742 1
228796 AAGACGCTGCCAACTGCCTTCATCCGCCGTTGTTCTGAACCAGCAGAGGAGTCCAGATGT 0.1627902 0.126784 1
207686 TGTCCTTCTTTTCAGTACGTTAGACAGCATTTGGTGCTGCATTTTGGGATGTTATGATTC -0.23803847 0.126813 1
100041107 ACCTCCACATTTGTCCTTTATCCTCAGTTGCAACCACTGCTTACTGGAGACTTTTCATGA 0.63238834 0.12684 1
22323 TGCCATGGTCACACCCACGCTGGCTGCTGATTGGATAAGGAGGTCCCACCCCTTTGTTTT 0.43727135 0.126865 1
20926 TATGGATGAGAACCAGGGGAAGGGCATCCGAGTCCTAGGCATTGCTTTCTCCTCTGCCAG -0.18299082 0.126866 1
19114 CCATGTTTTGTGGTTCAATTTGTAAGACTTTCCCCTAATATACAAGTCACATGTATTCAC 0.21703908 0.126873 1
65106 CTATCACTTGGGCACCTGTTTGATGTGCAGTGGAAACTGGGTCAGCCAGTTGTTTATATT -0.16043283 0.126911 1
16562 TTGTTTTTGAGACAGAGCCTCTCTGTATAGCCCTAGCTGACCTGGAATCTGCTATGTAGA -0.15977424 0.12693 1
228413 AAAGATTTGCTTGTTCAGCTTCTTATGACACATTGCAAGGAATAAAGGAATGATGCATAC 0.30394156 0.126983 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.36070259 0.126986 1
17156 CCTGCACTGGTTATTTTTGTTGTTGATACTGCTCTATATTTTGGCAGAAAAAAGGGTAAA -0.20246425 0.126994 1
381175 GAAAAAATTGCGTTTAGAAAGCAAACTGTTCCAGCTTAAATCCAACGCTGCAAATCCAAA 0.7881372 0.127031 1
22630 TAGATTGAATGAGAAAGCGCTTAATGCATCTGGGCTTGGGGTCACAGATCGAAATGTCTC -0.13747173 0.127041 1
17387 GGACAGCGAGTACCCTAAAAACATCAAAGTCTGGGAAGGAATCCCTGAATCTCCCAGGGG 0.24304381 0.127068 1
12928 GAATGATGAAGAAGATCTTCCCTTTAAGAAAGGAGACATCCTGAGAATCCGGGATAAGCC -0.18414495 0.127102 1
320632 GGAGTGGAGAGTGTTTTTGACATCATGGAGATGGAGGATGAAGAACGGAATCCATTGCTT -0.15122147 0.12714 1
270152 AAAGCATCCAGTTTGGTCCGCTCTTCAGTCAGATCCAAGTAATGTGGTTGAAAAGAAAAA 1.39439571 0.127158 1
216227 TTGGATTTTCCCATACCAAAGGAGTGGCTATCTCCTTCCTGGTGCTTGCTGTAGGATTTA -0.20657319 0.127172 1
70122 GCAGCCAGTGTGGTACTCATTTCTTCTTAAAAACAAAACAAAAACAGGACTCAGAATTTT -0.17205739 0.127237 1
71770 TGTAGTTCCCAAAAGAAGATGTGTCAGGGCAAGCAGAAAGGGAAGTTTAGGCCAGAATGT -0.2227006 0.127249 1
224585 TGGCACTGCCCAAAGTGGTCTATGTCCTCATATATCAGTAATTAATAAAGAAAATACTTG -0.16025665 0.127268 1
16952 TGACATGAATGAAATCAAAGTATTTTACCAGAAGAAGTATGGAATCTCTCTTTGCCAAGC 0.40517329 0.12729 1
16528 GGTTGCCAAATGCCACCGCTCTTCCCTGGCTGGTTCTTCACATCCAATCATTTCCAAAGC -0.30306667 0.127355 1
100038538 TCCTCTTACAGCTATAGTAAGGCTGTCACTTGCTTCAGAACAATCATTCTTGAAATATTT -0.2422157 0.127356 1
101602 ATGGCCTATCGAGAACTGAGTTTGTTCCAATATGGGAATGAAGATTTTTTCCCAGAGAAA 0.68182097 0.127412 1
217057 GTTGGGGTGCTAGGCTCATATAGTACACTGTATACTTGTATGAAAATTTCAGCAAATAAA -0.15415136 0.127431 1
224630 AGTCCTTTATATTGTGAAAAAGCGCCTCTTTCCATTTTTGTAAGCGAGAGCTGCCAGCTT -0.18468867 0.127489 1
17122 AGCCACCCACAATCTGTTCTCAGATTCCTAATCATTCCAGAAGTATTAAATATCATTTCT -0.30824748 0.12752 1
76602 GCAAGAGTCGGGCTTAATGTATATAAAGCTTGCCTATTTATTATTATTACTGTGTCCTAG -0.2288447 0.127544 1
18784 AGATACACAAATGGCCTAGTCATCTGCGAACACGACTCCTTCTGTCCAATGAGGCTCTGT 0.27418304 0.127568 1
69770 CTGTAAGGGACAAGAGCATCCTCTGATAAGGTGTGATGGAGCAGGGGGCCTGAGGATCTC 0.17781376 0.12757 1
232855 CTCATCAAAGAAGAACATGGATCAAGATGAGGATTAGTGCCATCTTATTCCTAAGAAGTT -0.18533919 0.127581 1
100040320 AGGATATTGCTGCCTACAGAGCTAAAGGAAAACCTGATGCAGAGAAAAAGGGGTGGTCAT -0.20755345 0.127585 1
53324 CATCTGGTGCCAAAAGTTCATTTGCAGCTTCTACAACAATCCCCACAAAAGATGAACAGC -0.1992791 0.127627 1
83453 CACAGGACATGTACCCAAATATGGTACTTATTTATGTAGTCACTGTGTTTCTGGAATTTT 0.39917891 0.127631 1
74252 TCTTCATGAACGATATTTGACATGTGCTTTGGTACCCTTCTCTGAAAGTTGAAAACCTAC -0.1477112 0.12764 1
68695 GACACAGATACTACCCTGGATGAGGTAGAGCTGCACTTTGGAGCACAGGTTCGACGCTTG -0.85197465 0.127659 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.29319648 0.12766 1
270163 TACCTGTATACAATCAAGATGGAGGGGCTACAGGCAAAGGAAGAAGTACAAAGAACAAAG -0.22142252 0.127702 1
71834 TGAGCAGAATACAACTGAGGCTAACTAAAAATAGGGTCTGGCCCTTGAGTGGCATGCATA -0.13002891 0.12772 1
329165 TATTTAAGTAGCCTTTTGTTGAACAAGCTTAGTTGACTAATAAGACGTTTGGAAACCCAG -0.24451775 0.127729 1
216821 GGAAGTCTGACTGAGCAGTGGAGTATGGATAGGAGCCAATGCTACTTTCTGAGGGGTGTG -0.15282533 0.127754 1
213208 TCCCTCACCCCAGGGACTTCATTCCTCTGTTACCTAAGCTCAGAATAAAGAATTACCCCG -0.23897913 0.127798 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.29867356 0.127808 1
27220 AAACGCATTCCGATCTACGAGAAGAAGTACGGCCAAGTCCCCATGTGTGACGCTGGAGAG -0.37814959 0.127811 1
268395 CATGGGTCAGTGTGGTAGACAGAGTGGCTGAACAGATGGATCAGCCTCAGCAAACAGCCT -0.15644693 0.127886 1
14792 TGCCTCTTCACATGGGACAAATGGCTTAAGGTGTACAGATCCATCTATTTCCTTGGACAT 0.20035624 0.127982 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.31093976 0.12799 1
629557 AAAGCTCATATCCTGGTATGACAATGAATACAGCTACAGCAGCAGGGTGGTGGACTTCAT -0.15232411 0.127992 1
67750 CTAGTAAGGCCAATAAAGGAAAGAAAGCCAAAGCTAAGAAGTAGGAGGCTGGTGACTACC -0.24296634 0.128015 1
28042 TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA -0.21889397 0.128015 1
12570 GGCTACTTAAGGACAAATGATAAAGAGACAGAAGTCTCCCTTTCTGTGAGGTGACCCTTG -0.2563948 0.128022 1
105377 TTAAGAGTGAGAAATATAAAAACTGTACACATCTTATAGCTGAACGACTGTGCAAGAGTG -0.16366977 0.128068 1
21408 GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT -0.19100715 0.128154 1
79263 TGCCCACTTAGCTGCTGAGGTGGAGGGCAAGTGCTTACAGTCAGGCTTCGAGATGCTTAA -0.16459894 0.128157 1
101100 GCTGCGAGGCTAGAGAAACCACTGCTCTGATCTTCACTGGCCTATTCTGGATCCAGCATC 0.31987764 0.128188 1
16531 TGGGTGGGCAGTCAATGTATACATGTAAATTCAAAAGTCCTGTGAGTGGAAGTATTTTTT -0.23627293 0.128201 1
15950 CACAATTGCTTTCTGATCTGTACTGACAGTTTGCATCTAATAAAGTTTCACTGGTTCTAT 0.57896163 0.128215 1
67972 ACTAGCTGCATTGTAAAGAAACAAATCGAAACTGAGTCTTTTCACATATTGTGACGGACA -0.38184361 0.12823 1
30795 CGGACATCAGCAAACATAAAAATGAGCTGTGGCTAATTAGAGCTTGTAAGGGAAGAGTCA -0.15476241 0.128235 1
107607 CTCAAAGCAAAGCATGGCACATACCCACCACCATACCATGGTGCGCATGGGATGGGACAG 0.71522272 0.128245 1
26912 TCAGCCCAGATCAGAGGCTGTGACTCAACCCAGACTTCTAGAGCCTGGTTGAAAATGGGC -0.14712244 0.12827 1
20918 GTGCCATGTGAAGGAACAAGCTGGTCTTTTGGTTTTCTTTCCCCCTCCAGTTTCAATGTT -0.17663319 0.128309 1
333050 CTGACCCCCTCCTACTAAGCATCTTAAAGTTTCTCTTTTCTCTTTAATTGCATCAGGACC -0.17479154 0.128341 1
664883 ACCCAGCCCACTCCCAAAACAGTAAATGTATCTATTTCTGTGGAAATCATTTCTCATTGA -0.19731756 0.128375 1
63986 CCTTTGAGCCAGGGATTTGGAATCCTTACTTCTGAAGGCTCAGATTGATAGGATATGAAC 1.00164818 0.128396 1
18717 ATTCCAGCAGTGAATGGGCGCGGGGAGCGACTGCTCCTCCACATCGGGATCATTGATATT -0.1413606 0.128399 1
70369 GTTTTAATGGGGTGGGGTTTTTGTTTGGATGGTCTGTTTTATCATAAACATTTTTGCTTG -0.25105071 0.128432 1
209448 GGAAAGAAAGGGGGATAATCAAACAGAGAGGGTCTGTAACCTTGTAGAGCACAGTTAGCA -0.33899812 0.128472 1
75602 CCACGAATAGTGACGGTGTTTACAGCATGTATATTTTCAATATCTCATGAATACTAACAG -0.16175427 0.128474 1
28077 ACATAACTGTTTTCATGGGTTTCAACTAGACATAATAAAGTCCAAAGTTTTACATTGCTC -0.20105453 0.128494 1
14810 TTTGCAAAACCAAAAAGACACAGTGCTGCCGCGACGCGCTATTGAGAGGGAGGAGGGCCA -0.31459418 0.128507 1
20621 CCTTTTTAAGTGTATACCAGAGCCGTACACTCCAATGGTTAGTAAGTCATAACTTCTCTT -0.26405753 0.128589 1
654818 GTATGTAACAATGTTGAGATAGTCCTGGTTATAGTCGTTTGGTTTTTAACGCAAAGACAA 1.18100051 0.128659 1
NA GGTGGGAAATATTTGCTGGGAAGTATCTCTTCAGAGCCAAGCCACTTGTCTTGGTTTTTT -0.14550564 0.128675 1
13489 ATCCTGAATATACACTGTGACTGCAACATCCCACCAGTCCTCTACAGCGCCTTCACATGG -0.17593111 0.128678 1
20641 GGGTTTGATTTCTTTGAGTCCATTATTTGGGCCTCTTTTGAGATGAAATAAATTCTTGGC -0.2175875 0.128688 1
20682 ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC 0.23176765 0.128709 1
73728 CCTTCTTTGGTGGGCCCTACCCTTTGTACAGCCTCCACCCTCATTAAAACTGCTCTGAAT -0.28280585 0.128725 1
50934 TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT -0.30562113 0.128728 1
269152 ATGACCCAGAATGATGGATTAAGTGCCTTGCAAATCTTTATGATTATCCAAACATTGTGT -0.21478349 0.128732 1
319579 GTAGAAGGCTACTGTAGGAAGAAATGCAGATTAGTGGAGATATCTGAGATGGGATGCCTG 0.24088376 0.128747 1
226090 GCCTCCTACCTTTAAAGGTTATCTGATCACTTGTGTAATTCACTTCTCAAAAGATAGTTT -0.15268933 0.128769 1
56516 GAAGAGCTTTACTTTTGCTCACGTGAACCTTTCTTTTTTAAATAAAACACAAAAGCCTCC 0.25977257 0.128819 1
21928 AGCTCTTCTCGGCACTGGCCCAGCCTTGACTTGTCATGATTCGAGGCTGGGATTTGAAGC 0.95280591 0.128889 1
74487 ACTTGGCGTTTTCTGAGACGAAAGGCAGCGGAGTGTGTAGCAAAGGTGGCGCTGGCTCTT -0.17516565 0.128902 1
239102 TTTGGTCCTCAGTTACAGGGGGCATACTTCCAACAGCTTTACGGCATGAAGAAGGGGCTA -0.22608186 0.128905 1
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.16768454 0.128909 1
228139 ATTTGCTTCCCTGGGTCCCAAGCATCCATCCATTTCCAAAGGATAGAGAAAATGGTAGCT -0.17980016 0.128953 1
56224 TTGGAGCTGATGATTGGAACCTAAATATTTACTTCAATTGCACAGATTCCAATGCAAGCC -0.19812563 0.128968 1
110829 TTGGAGCTGAAGAAAAGACTTAAGAAACTATCTGAGACCTTAGGAAGGAAATAACTTTTG 0.17837898 0.128969 1
100502936 GGTTCACTCCTCCACAGAAAGATGGGTAAATAGTAGAGCATCATGTATTTGGTATTTGTA -0.19854531 0.128982 1
219103 TGGCCGAGTTAGAGTGAAGGACAAAGACGGTAATGTGCTAATGGACACAGAAATGTGAAG 0.399535 0.12902 1
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.29745503 0.129099 1
16773 CCCGACTACCTAATAAAGATAGTTCAATCCTGAGGAGAATTCATCAAAACAAGTATATCA 0.35924922 0.129159 1
18111 TGGATATATTCAACCAGTAATTGAATCCCACCTTTACCAAAACACGTTCTCTAACCCCCG 0.34714599 0.129165 1
75015 AAGATGAAGACCTTTTCTCAGGAGACTGTTTGTTCTCAGGTCCCATTACTGGGTCCAGAA 0.16900564 0.129174 1
72123 GAGTTTCAAGCTTATGACTGTTAATGTAAGGATTTGTATGGCTTTGAATTTCATGAGCTC -0.19001061 0.129195 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.25437455 0.129244 1
71268 CTCAAGGATGTCATTGAAGAGCAGGAGGAGCAGATGGCAGAGTTTTATAGAGAGAACGAA -0.15175425 0.129263 1
28042 TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA -0.19214616 0.129271 1
17758 GCCATTACCCATGTCTGTAATTGTTGTACTGATTTAAACAATAAAGCTGCCTGACATCCC -0.16838395 0.129275 1
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.8855848 0.129275 1
18127 GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA 0.22397967 0.12928 1
14860 GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA -0.23890585 0.129296 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.07363705 0.1293 1
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.63649591 0.129304 1
74252 GGTGTTCAAGGACTCTCAGAGATCTCAAGGCAACTATAATGGCAGTTTTTGAAATATATT -0.1763699 0.129308 1
20656 GGCTGGTTTATAGTAGTGTAGAGCATTGCAGCACTATGACTGGGGTGCTGTAGTCTTTAT -0.1383289 0.129322 1
98985 TTCCAAGGACTTCCGGCGGGAATGTAGAGATGAACGAATCCGTGAGTATTTCTATGGATT -0.17853405 0.129356 1
54364 TGTGGATTTAGTCTGTATAACTGTAACAGAGAAATTACCATTTTACTTCAAAAGACCCCC -0.17571268 0.129404 1
380664 CATGTAAGAGGGTGCACATGTACTTACATTGGCTTTTGTATATATGTATAAATGCTGATG -0.22096332 0.129421 1
67542 TCGTGGGTTTATTGATGCTCTTACAAGAGAAGGGCCAGGAGGTACACCTAGGCCCATTGA -0.18194985 0.129433 1
69638 TCCTCCCACTGTTTGTTGGGTAATAAATGGAACTATGGCTTGCCCCGAGATTTCTTTTTT -0.13269332 0.129443 1
434794 GTCTAGTGCAGGGAGACTATAGTCATGGCTTCCAAAATCAAGGGCAGACCTCCCAAGCAA 0.63468379 0.129443 1
54170 CACTGGTTTGCATTCTTAGGGAAGAGAGCTTTGAACGAAAAGGGTTGATAGACTACAACT -0.14946473 0.129512 1
66898 GCTTATCAGATTCTCAGATCTCACCGAGAAATTATCCCCAAATTGGTCCGGGTCTATGTA -1.37284721 0.129519 1
670940 TCTATCACAGCACCAAAGGCAAGACTATGGTTGCCGTGGAAGTTTTCTCTATTTTGGCGT -0.13519799 0.129584 1
21885 CAGAAACAACATCAAGAAACCTGAAGAAACCTGTTTCCAAATCTTGACACAGAACTGCTT -0.27756004 0.129611 1
69748 AAGTGCTTGGAACGTTTCTCTCAGATTTCCCATGGCTTCTAATAAACTGAGTGACTTTAA 0.33632293 0.129684 1
76633 GGAAGACTATAAGAGATACAGGTGCTTTGTTCTGCACAAGCTGCCCAAGTTGAAGTTTCT 0.50482395 0.129689 1
258533 TATACACTGAGAAACAAGGATGTAAAGGGCGCACTGAAGAGGCTTGTGACTACGAAATAA -0.18797178 0.129695 1
78255 GCACTAATTTCAGGGAATGAAGTGAGATGTTCCCAGAGAAAAACGATGGAGTTGCAAAGC -0.19752073 0.129734 1
223648 CAGTTGGAGGAGGCAGAAAACGCTGAAGACGACACAGAAACTGTCTTGGAGCAAGCCTGA -0.16414544 0.129814 1
75504 GAAAAATGATGGTGGCTTCTTCTCCACCTAGTGGTGACAACCAGGCTAATTTCAACATGG -0.1662044 0.129819 1
212772 GTGGTCAGAAAGGTACCTGTTAAATGTTACTAACGAAACAAATGCTCTTCAGACTACTTT -0.16595586 0.129829 1
72167 GACAGAGAACAGCTGGTTAAGATTTTGAAAAGACTTGATGTAAAAAACTACTTCTTCCCA -0.14096864 0.129878 1
207686 CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT -0.24768641 0.129882 1
11629 GAGCTTCTGATGACAGCAGCATGGAAAAAAGAAACAGTCGTGAGCCAGAGTCAGACTAAA 0.88101529 0.12995 1
20646 CAAGATGGGAGAATCTTCATTGGCACCTTCAAGGCTTTTGACAAGCATATGAATTTGATC -0.24497939 0.129967 1
16392 CCCCCAAAGATGTGTATAGTTATTGGTTAAAATGACTGTTTTCGCTCTTTCTGGAAATAA -0.20671634 0.12997 1
232314 GTGTTATGTTTCCTGGAAACTCACCAAACTATACTGACAGGTCTAATATAAACGGGCCTG -0.16784221 0.129987 1
11928 AAAGGAAAACCTGGAAAGACTGAAAGATTACGTTTTATATCTGGATTTTTACAAATAAAG -0.22974899 0.130003 1
69399 GTTGAATCCATCTGTCCAATGAAAACACATGTGTTGAAAGAGGAAACATCATTAGAGTAT -0.20243081 0.130017 1
12306 GTCTGTGACATGAGACACTTCCTCTTATGTACTGTGTCGTGAATAAACCGTTTTTACTTT 0.59961175 0.130022 1
29818 GGCCTAGGTAGACTGCCTCAGGGAAGCCAGAGAGATAGCCATGACTGTTACCTTCCTTGT 0.21714812 0.13008 1
19291 TTCTGTCGGTATGCAGATGAAATGAAAGAGATCCAGGAGCGACAGAGGGATAAGCTTTAC -0.18081381 0.130094 1
14964 CAGTTCTCTTTACACAACATTGTCTGATGTTCCCTGTGAGCTTGGGTTCAGTGTGAAGAA 1.64005019 0.130099 1
545366 AAATGGTCAAGACATAATGACATGTACAGAGAATGGCTGGTCCCCTCCTCCCAAATGCAT 0.37790003 0.130126 1
64697 CTGGAGAAGTAGCCCGTCATCTAAAAAGATGTTTTCAAAAATGATTCTTTCTCACGCCAC 1.04870721 0.13022 1
17714 GTGGAGGTGGCAGACATTTTGGAGAAGACTGCCAAGTGCTGTTCAGAAGGGGCAGAACCT -0.13875366 0.130221 1
100340 CACTGACTTGGTTCATCTTTCTCCTGGTAAAATTGGGCAACGTTACCCAATGGAGAGAGA 0.25013201 0.130236 1
14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA 0.93922039 0.130269 1
74775 GAGGAGGCGGCTGCACCCACGAGCAATAAAATTGATCCCAGGGTTTTCTTGGTTCTTTTG 0.23480236 0.130346 1
54393 AAGAGAAGTCCCGACTGTTGGAGAAGGAAAACCGTGAATTGGAAAAGATCATCGCCGAGG -0.22152812 0.13039 1
109910 AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC -0.17965113 0.130392 1
194604 CCTTCTCTTCATGGGGAGAGTGCTGAATCCCACTAGAGTCATCACGGATGCTGTACATCG 0.16259306 0.130393 1
22110 ACTGAGACTGAATATTCGTAACAGTTTTCGATATTACTCCAAATTCTTAGAAACGGCTTG -0.18393101 0.130403 1
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.29200403 0.130455 1
277939 GGACAGGCTATTTTTGCCATAAATATTGGAAGAAACATGGAATAAGTATGTACATAGCTG -0.18570806 0.130476 1
330004 GTCTCTGATGGGAAAGGTGACCCTGAGGTGTCCCTGTCACCAAGTCTTTCTCCAAGCTGA 0.20669291 0.13049 1
230233 ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT -0.15555986 0.130542 1
75533 AAGTTACCTTACTGTAAGAAGCCGCTCCCCATGTTCTTTACATTAAAAGCATATATGTGT -0.15528147 0.130588 1
52637 AGACTGGCGACAACGTAGGACCTCTGATCATCAAGAAAAAGGAAACCTAATGGACAGTTG -0.13661584 0.130606 1
18073 TGGAACTGATCGGAGAACTGAGCTTCTATGATCGTACGGACATCACGTCGGTCTATGTGA 0.21038609 0.130631 1
212880 TAAATATCTGGAAGACATTGGAATTTTGTACTGAATGCTGTAATAAAGTCTGTCAGGCAC -0.16391917 0.130646 1
230752 TGGGAAAAGAATGCCAGCTCCCACCTTCTCCCGATAATAATGACCAATGAAAGGTAGTCT 0.35251221 0.130667 1
74352 GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC -0.14849094 0.130695 1
74203 CTTATACATACAGCTGTACATAAAGTAACTATCAGTTAGGCTTGTGTCAACTGTTTGGAT -0.15507441 0.130709 1
258722 TACTGTCAACAGTATCTTTGGACTCTTTGTGGTGCTCTCTACCTTGGGACTTGACTTCCT -0.20459093 0.130725 1
240690 AGATGTGCCTCTATGTAAAAGTACACATGAACTTTAGTGTGGGCTTAATTTTCTGTGCTA -0.2273201 0.130741 1
74385 AACTGTGTTTAGGATGCCAGTAGACTTAAGACTGTAGTAACTTCAGAAGATGAGCATAAT -0.14335332 0.130777 1
239611 GCATGGTTATCATTGTTTTGTTATTGATGCTGGCTGGAAAATAAACGCCATGGTGCAAGG 0.28843778 0.130782 1
260305 CCCCTCGACTCTCAGGCTGTGACTGTCCAGAACAAACTGTTTTATAAATGGTTTCCAATG -0.24365899 0.130819 1
434484 TGTAGGAACCTGCTCCCAGTGGATAGAGTCGTGTACGACATCCTCAGCAATGTACAGAAG 1.10136707 0.130868 1
432989 ACCCTTCTCCTGCGAGATCTCAAACTTTCAGAGATGAGAGACTTTTATCATGGACCCAAG -0.15188361 0.130894 1
70062 ACTGTTGTTATCAGTCAGTGTTACTGGAGGAGTGAATATTGAAAATCAGATACTGAAAAC 0.206758 0.130923 1
72333 AAAGGAAGACGCTGGGTGGTACACTGTGTCCGCCAAGAACGAAGCAGGCATTGTGTCCTG 0.18995957 0.130949 1
50913 AAGAACAACATCAAAAAGTTGCTGTGAATATAGTTTGAGCTTTTTGGGAGGGGGTATTCT 0.3138017 0.131045 1
74131 AACTCCACAGGATCAGGAGATTATCACAACTATTACTGGGGTACCCTTGACTCCAATAGC 0.76030734 0.131135 1
240754 TATGGGGATGTTGGGGATAAAAAGGCACATAGCACTTAGAGTGGAAGCATGACGTGATAG 0.33838339 0.13125 1
192185 CGTATCCCCCTGAGATTCCCAGGTCAGGAATTCCCATAAATCAGTCTGTTGAAATTCTGA 0.18316361 0.131279 1
14566 ACAGATTTGTTAGCATAAGTCTCGAGTAGAATGTAGCTGTGAACATGTCAGAGTGCTGTG -0.15999704 0.131289 1
353170 ACCTCTTTCAGACTGTAGATGGAAATAACTGTGAAAAAATGATGCAGATATAGTTTGTGC -0.1911131 0.131332 1
18108 CTATTTAGTGATGCCTGGAAATGTCATTCCAAAGAAGAATAAAAGCACAAGTTGAGTGAA -0.14127468 0.131428 1
76894 AAAGGAAGCATGTAGAACTGCTCTAACAACCCTCATAGAAAATCTGAGGTCCAGAACTTC -0.15795161 0.131432 1
13929 TGCCCTTCAGATAGGATTAGGTGAAGCTAGACGGCAAACAAATAAATACTTTGAAAATCA -0.23334829 0.13144 1
69821 AAACCAACCTGTAATGATCCACTGGAGATACAGGTAGATAAACCAAACCAAATGAGGGGT -0.13640483 0.131447 1
67897 CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT -0.25917264 0.131476 1
12140 TGAAGCACTGGTCACTAATTATAAGTTTGTCTTCGGTGTGGAGGTAGAAAATTATAATTC 0.22313342 0.131479 1
70533 AGAGAGTATATCTAGAACTGAGAAAATGTGTGTCCTGGTCCAGATTCAGGCTCTCTGTTG -0.20310596 0.13155 1
100087 ATACCCTGAGTGTGTAGTTAGCATAAGCTGAGGCATTGAGTGGTAGCTCCAAAAACACCA -0.18944385 0.131569 1
17925 ACGGAGCCAGGGACTTGGAACCTTTAGGAACAATCAGTGCATCCGGTGACAGCCTGGGTT 0.33052889 0.131627 1
18099 GGTCACTTTGTACAATGTAGATTTGAAGTACAGTGGTGAGAACATTAAACGTGACATTTG -0.21242825 0.13164 1
213438 ATCCAATTCCTGTTGGTGCCTTCCTTCTAAATTCTCTCTTTTGCACTCTTGATACAAATG 0.17328516 0.131678 1
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA 0.16963647 0.131706 1
13204 CTCGTCGAAGTACTGATTTCACAAGCAGGGACTATTATATTAATATAAGAAAAGCTTTGG -0.22710325 0.131812 1
231805 ACAACAGAAGGCATACAGTTTTGGCAGTCAATTCCTGGGACCCAACTCAATGTGACCAAT 0.39036931 0.131816 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.37090972 0.131871 1
11433 CTTTCTTGGGAACGGGCTTTCCTTTCAGTCAAGTCTTACTGTCACTGCTATTCAATAAAA 1.12605536 0.131875 1
74365 AGAGATACTAATGTTACTGCATTCTTTCACTGACTTGAGGTCTCATTTCAAATGGTTCAG -0.16963 0.131924 1
238161 TAACCTGCAAAGAGAAGCTCGTAAGCTTTCATGAAGATCGACATAGTAACATGCATAGGT -0.23400996 0.131954 1
329795 CTGTGAATACAGAACTTAAGGACTCAGTATAATATGGCCAAGACTTGATGTTGCTATATT -0.2425796 0.131965 1
66409 CTGTGGGTGCCTCTGAATTTAATATTTCTATTGTACAAACTAGGGGTTTGAGACAATAAA -0.15557078 0.132034 1
18168 TTATAATGTGGTTAATTCCGTCACTTGTGCAGAGTCCATGTCGATCTAAGGAAATTTCTG -0.24046037 0.132089 1
11988 TTTTTTACTGTGGACAAAAAAGACACAGATGGAGGGGTATAGGAAAATGCCCTTAGTCCA 0.39590108 0.132109 1
20604 AAGACATTCACATCCTGTTAGCTTTAATATTGTTGTCCTAGCCAGACCTCTGATCCCTCT -0.20506094 0.132131 1
26372 ACTAAAATTCCAGCTAACAGCCTTTGAAGCATTAAATCCCACCACAGGGGGACAGCTTCT -0.21288273 0.132135 1
269881 ACTCACTCTATTTATTGGGGAAGGGGGGAGGGGAGGACACTTAATTTATTCCTTTGTACC -0.27931055 0.132141 1
230787 GTGACTGAATGTAGGGATCTGCCTCCAAGAATAAAATCCTAGGTAGGACACTAGTACTCC 0.7661993 0.132153 1
93692 TGTTGCTGGTTTTCTGCTACTGTTCGTCAGCTGAAGTCATTTTGCAGAAGTCCACTTTCT 0.23125289 0.132166 1
16538 CTGAGCCGTCAGACATAGGGGCCACAGATCTTTCTTGAAAAGCTCAGGCAGGATAGCACA -0.18306029 0.132198 1
78255 GCACTAATTTCAGGGAATGAAGTGAGATGTTCCCAGAGAAAAACGATGGAGTTGCAAAGC -0.16606519 0.132217 1
68468 GGCTTACCAGACCCTCTGCTTGTCCCCTTCTATCTTGAGAAATAAACATCAGTGTCTAAT -0.21926704 0.132231 1
83925 TTGTTTTCATAGTGCATGTTCATTTCGACTCACAACATGTTCTTGGTGTATTTCTTATGC -0.17467427 0.132285 1
16573 CCTGTTATACTAAATCATACACTATAATTTGTTTAGTTAGAAATAGTAAACTGTTTGCAA -1.20732222 0.132339 1
15191 GGATTGATGAGATGCCTGAGGCTGCAGTGAAGTCAACAGCCAACAAATACCAAGTCTTTT -0.17604254 0.13235 1
18810 ATAAACCTGTACTTGAAACCAGTTAGAAGGACCGGCTGGAACTCAGAATCCGACCTGTTT 0.34807019 0.132379 1
13982 TTTTTTGTAGACGTTTCAAACTACCGTGTCATGTATGCAGTTATTAATGCCTAAAGCCTT -0.22409958 0.132398 1
170756 TTGTTTGTTTTTTGTTTTTGTTTTTTGTTGTTTCCAAAAATAAAAGATGAGTTATTTCAC 0.34338479 0.132441 1
235106 ATGAAATTCCGAGAATCACAGCCAATGAGACAGAAATTCGAGGGAGGAGGACAAAGCATA -0.2429154 0.132513 1
268782 TAAAAGACATGACCGACTATCTATCTACTGACCGTATTTGTCAACGGAGCCCCCATTCTC -0.14708517 0.132535 1
66922 CTAAGCTGAAGTCATAGGTTGGAAAGTAATTTTTAACTTCTGGAATCATGTTGCCTACTG -0.15338962 0.132546 1
99035 GGAAAGGCCAGCGGGAAGTGGGTATGATCAAAATGCACAGTTTACACTTAGGAAAATTTC -0.22736649 0.132619 1
67770 GGTTGGATACCCTGGATATTTCTTTTAGTTAATGTCTGTAAACTTGGTATCTTAAAAGCC -0.13606703 0.132645 1
320560 CAGACAAACTGACATGGGTTTTCAGGTTTTGGAGTACATTTAAATATGACTTTTCATGCT -0.21716636 0.132664 1
16638 TCCTCATTGACTCTCCAATGAGTGTAAAAGTGCAAAGAGAGAGACAATCTGGAAGATTTT 0.45483648 0.132677 1
270627 CATCAAGTTGGGGCAGTGAGACTGGAATTCAAACAATGTTAATTAATCAGAGAACTCTAA -0.1533832 0.1327 1
107022 GGTCCTCTGCCAAGAACTTACAGCTAACATAGTGAAATTGGAAAAGATACAAAACAACTT 0.1971793 0.132705 1
100048702 CCAGAGAGAAATTCTACCCAAAAGATCAAAGAGAGAAATTCTACCCAAAAGATCAGGGAA 0.16853084 0.132756 1
16835 CTGCTTTGAAACCCTTGTTCAGATGTTTTTATAGGCTGAAAATATCATACTGTGATGGAT -0.36798704 0.132783 1
18111 CGCACAAGATCCTACCATGAAGATCGAACAGCCCATCAACCAGCAGAATGGACATTCTGA 0.34641555 0.13282 1
11799 TGATTTGGCCCAGTGTTTTTTCTGCTTTAAGGAATTGGAAGGCTGGGAACCCGATGACAA 0.32507326 0.132842 1
22042 TCCTGCTAGATGGAACATAGATTCTTCATGTAAGCTGGAACTTTCACAGAATCAAAATGT -0.28216338 0.132854 1
72014 TCATCCGGACTCCCAGTTAACCTCTGGATTGAGAAATAAGGCTAGGCCTGGATGGCGCAG -0.22520133 0.132872 1
74091 TTATCAACTATGTGATCAAGCTAGGTTTTGGAGTGTCGCAAACCAAAGCCATCATGACGC 0.2140228 0.13289 1
56637 GATCCTGATACAGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTGGTCCGA -0.18672828 0.132897 1
213539 TGAATTTTTAGGTGTGCGTGGAAGCATGACAAATGTGAGGAGCCCACCTTCATTTTACCA -0.18349913 0.132921 1
211446 GCTAGTTTACCCGTTATATTTGCTTTAAGATGACTCTAAACTTAACAGTTGAGATTCCTC -0.23364488 0.132971 1
72555 TAAGAAGCGGCGACTGAACCAGAGCACCTGTACCAACTACGACACGCCACTCTGGCTTAA -0.24765135 0.132981 1
269470 AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG -0.13898752 0.13299 1
258397 CCCAGTTATCTACACATTCAGAAATAAAGAGATGAAGGTAGCAATAAGGAGAGTTTTCAA -0.16332974 0.133046 1
382236 TGCCTTTCAAGTGCTGGGATTAAAGTTGTGTGCCATATGACCAGCTATATTACTTTTTAG -0.15801402 0.13306 1
58520 TATCTACAGGTGGATGAAGGTTGGAAGAGTCTGGGCTGTTTTTAGACCTTTTGGTCAATT -0.16047965 0.133092 1
19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG 1.15374634 0.133099 1
215654 ATTCCCCCCTTTGACTGAAAACTTCCTATGGATCAAATTACTTGGCCTTCATTCTTTTAT -0.25679447 0.13311 1
22601 GGCTGTAGTAGGTAGCATACAGGTAAGAACTTAACTGGTTATTCTTGAATTTCTTTTACA 0.18848352 0.133147 1
68119 AATACAAAAACAATGTAACAAATGGTCTTTTCTGTAACCTAAGAGGCCCCATGAATAAGG 0.41036501 0.133171 1
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.60324277 0.133172 1
13196 GGACATAGGAAAACTAGGTAGACATTCCTTTGGCAATCTTGTTAAGTTTAAATCTGACCT -0.23828489 0.133192 1
68750 CAGTGGCACTAATGTGACTGTTCATGGAATACAGCAAAAGCATGTGAAAATTAAAAAGTA 0.26156925 0.133195 1
67222 ACTTGCTGCCTCTTTGCAAGCGTTCTGTCAAAATTTTTGGTTTTGTTTTTAACTAACTTG -0.13317778 0.133224 1
19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG 1.22491272 0.133237 1
208618 AACAAGTTTGCACAGTTAGGGTGGTTTTGTAGATAACTGTATTTGTATAACACAGCCATG -0.20931134 0.133244 1
241514 GAATAGTTTGAGAATCAATATAATATATGCTGTATATTAAAATGATGTCTTAAGAGTATG -0.24073757 0.13325 1
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.66343677 0.13329 1
50875 TCTTTTAAGAATTATAATGGAGAACAGTGTTTACCTTGATCTTTACAAGTCTGGCACCTC 0.21247713 0.133305 1
12283 GTACAGCAGAGGAATGTTATTGTAGTAGTATGTAACTATTACCTGAGTTTTGCAACAAAC -0.18412358 0.133312 1
620078 GACTCTGAATCCTTATCTCTGGTACTGTTGTTCTCTGCTAAAATAAACTGTTATGCCAGC 0.29072123 0.133317 1
259110 GAGGAACAAAGAGGTGAAGAAAGCACTGTTTAAACTCAAAGATAAAGTAGCATTTTCTCA -0.49614038 0.133332 1
218639 AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA -0.37402463 0.133341 1
223838 ATCTTCTTTTTTCCCAGACACTATCTGGAAAGGCAGTTCCATTTGCTACAGCTGGGGACT -0.19677494 0.133349 1
269295 CCTGCCTGGCAACATTTTCCGAGGCTTGGTCAGCCTACAGTACCTCTACCTCCAGGAGAA -0.20570404 0.133365 1
104681 ACTATATTATAAAGTGACATCCAGCCCAAGTCACAGAAATTAATTGGCCATTCCAAAACG 0.22634289 0.133377 1
623503 GATGTCACCGGACCTGGCCTGCGGTGCCGGCTAAGCTGCTTCCCACTGGATGGAAGTGCC -0.16768843 0.133386 1
80908 TGATACAGTCTCTAGTAGTTCAAGCTGGTTTCAGCCTTACTATGATGGTCTTATGCTCCT 0.24679515 0.133389 1
227612 TGCACTTCTAAAATAATTTCATGGAGGCTAATTTCAGGTCTAAAGAGGCCTGTACACTCA 0.55638746 0.133407 1
74117 TTAGTGCCAGTCCCTGACATATCATGAAAAGTTGGTTTTCTTTGCATTTTCAAATATCTG -0.225363 0.133427 1
268973 ACTATGATATTAGCGCTATTAAAGGCACCTTTAAACTAGTGACTGCTTAATGCACCCGTG 0.28278789 0.133477 1
76007 CATCTTCAAAAAATGAAGAACTACAAGGAAACGATCCCAAAATTCTTCCTTCATCGAAAG -0.15882107 0.133479 1
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.24379131 0.133589 1
270160 ACAATGAAGACAGATTTTCTTGAGTTCTTTCTTGTTATTTCTGTGTGGAGATACCAGAAG 0.16148706 0.133632 1
244058 AAGGGCGCGTGGGACAGCTCTCCCCTCTTGATTTGTGCACGCAACAAGGTTGTGGTGATT 0.24438904 0.133668 1
20400 GGATTGGAAAACTGAATCCCTTAGGGTATTTTTAGTTGCCGTATTTACAAATGAGAAACA 0.63846592 0.133681 1
17380 AACACTGTAGCTTTCTGCCATCATCATATAACTGCTAGGCATACATTATCCAGATCTCCA -0.15857562 0.133824 1
13831 TTGGCACTGTAAGAATTTCTATTCTCTGTAATGTTTTTCAAAATAAAACTCTTCAAACTG -0.20189289 0.133824 1
27998 ATAACCCTCCCTTCATCAGGATACCATTAAAAAGGGCTCCCCCGTGTTGGGTGAGTGAGT 0.19403976 0.133826 1
217473 CTACAGGGTGATGGATTTGATCTGTGAGAAATGCATGAAACAGAGAGACATGAATGAAGT -0.22641345 0.133849 1
14167 TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT -0.18645964 0.133856 1
11440 TCCCACGAGCCCTTCTCTAGCTCACTGCATGGAGATGAAATAAAATCGATATGAAATTTT -0.464332 0.133871 1
13653 ACTGAAAATGTAAATTTATACATCTATTCAGGAGTTGGAGTGTTGTGGTTACCTACTGAG -0.61660826 0.133898 1
76642 AGAGAATTCAGATTCTCCTTGGGAATCTCAGACCTTCTGCCCCATTACATCCCACCCCTT 0.215845 0.133906 1
232970 GGTGGAAGGAACTATTTATTGGTGCTCCTCTGATATCGAATTAAACATGGTGAAAAAACA 0.50626431 0.133946 1
100042198 ATCGTTAGTTTGGCTTCAAAGGATCCAGCACCCTTTACAAGGTCAGACTAGCTCCAAAGA 0.31707199 0.13395 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.20084231 0.133977 1
76500 GAGCATCAGTTCTACGAGACCCTCCCAGCTGAGATGCGCAGATTCACTCCCCAGTACAAA -0.20908254 0.133998 1
77252 TTCTCCAGCTGAAGTTATCAGGGACAGAACCCCATTTATATTAAAATGGAAATTGTGGAC 0.15474178 0.134024 1
16648 CAAGGAGGTACTTACAATTTTGACCCAACAGCCAACCTTCAAACAAAAGAATTTAATTTC -0.16499032 0.134025 1
16154 GTCATGACCCTAATCTGGTACGAGAGCTCCTTCTGGAACTGGGCAAGCTCTTTGAGACCC 0.74520819 0.134074 1
30951 AATTATCTCTAGAGTTCTATTTTCTATTAGATGTAAATATGTTATTTAAGAGAAAAATAT -0.13163315 0.134134 1
546943 TCTAGACTGTATTTGTACAGTCTGTAACATTTCTTTTGTGGACTCTCGGGTCTGGTTGAG 0.20937168 0.134165 1
67988 GAGCTGAAGCGATCATTTATGTTGTTTCTGTTTATTCAGTTTTATTGCCCATGATGTTTC -0.13663981 0.134199 1
13205 GTCTCCTTTGTTGTTGTCAATTGTGGTTTACTTTTAGAGGTGAAAATAAAGTTGTGCTCT -0.15667983 0.134243 1
71929 AGGAAATGGACCATGGAATTAGACTAGTTTCAAATGAGGGCTGCTGAGAAAGCCACACTT 0.47796207 0.134268 1
232337 TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT -0.13785828 0.134274 1
230145 TTGAAAACTTTAAAAATGTCTCCTGGCATCCTGCTTTCTGAGGGCAATCCTAAGATGTTG 0.27967808 0.134363 1
68194 ACTAAGTTCGGCAAGGATGACTATTCTTGCATAAATAAATCTCCTATTAATTAATCACCG -0.13745207 0.134365 1
623131 TAGGGCTGGGGGGCAGGTATCCCGCACTCCCAGTCACCTCAATAAAACATCTTCTTTGTA 0.20425384 0.134405 1
18751 TATCTAAGAGCCAAGTCTATGGCATTAGCTGTGAGAAGTAGTTACCACTGTAATTCACCT -0.30040617 0.134442 1
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.1606694 0.134453 1
66631 GTTTTTCCGAATCCCATAGGAATGCGCACATCAAATTCCTTTCTAAAATATGAGGGTTAG -0.14604902 0.134469 1
545030 TGCATGGGAAATTTCTACGTGGCTCACTTCACCAAGGCTTATTGCACTGGGAAAAGAAGA 1.02647069 0.134492 1
243547 GAGGACAGACAGGGCCCTAAGAAGCCATTCCTTTCCCTAGTTTCCTTCTTGGCTGAGTAA -0.21159113 0.134558 1
244183 CTAAATACAAACCACTATAGACTCATTTCCTTGATCCAATTCTTTCTCTGTTTACAGTGC -0.14719844 0.134593 1
74438 GAACACTGGATTGTATTGCCTTTGTCAGTAAGTTCCTCTGTTTAATAAATACTGAAGAAC -0.2169656 0.134614 1
12212 TAGAAATGGTTTTACTCTGCTCTTAAAGAAAATGCAATTAATAGCACTGGTTTCCTCCTG -0.17626251 0.134638 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.05731133 0.134667 1
224648 ACCCCGAGTGTACTGGTTCTGTGAACCACCTGAAAAGCAAATTAAATACTATTAAACAGC 0.25102282 0.134697 1
76927 GTTCTCTCCCTGGCTTATGTTGCAAACTGTTACTAAATCACCTGCCCCAATTCCATAAAT 0.13404051 0.134741 1
70456 CGGATTTGGAGATATAACCAAGAACTCAAATCTAAAGGGATCCAGTAAGAGAGTTCCTGA -0.13813974 0.134744 1
16189 GTCCAAGTCCACATCACTGAAAGACTTCCTGGAAAGCCTAAAGAGCATCATGCAAATGGA 0.22504978 0.134798 1
14939 CCCCGAGAATGTTATCTAATGCTAGTCATCATTAATAGCTCCCTACAGAACTTTCATACA 0.29645751 0.134821 1
239405 CCTTAGGTCAGTTTGTCCTTAGATTATGAATTGGCAGGTTCTAATTGCATTATTTCCCTG 0.17390234 0.134854 1
54375 ACAGGCATTAACGCTTCCTTAGATCTGAAGTCGCAGGTTAAGCTTGTCTGGTCTACATTC -0.17836912 0.134926 1
68347 AGAACCTGTTCTGAAGGGGCCTTAAAATAAATCCTTTCCAGCCCACTGTGGGCTATCTAT 0.17130002 0.135104 1
66326 TTGGTTCAGCCATGTCTCTGGGTGGTCATCGGGGAAGTGCAAACATGAAATGCTGTGAAC 0.16525092 0.135139 1
67168 CTCCGTGTTCAACTGTGAAAACTGTGTTCTTGGGAACTATCTCTCCGGCTCCAACAAAAA 0.44152206 0.135174 1
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.36666514 0.135187 1
225215 ATGCCATGAAGAGAGTTGAAGAGATCAAACAGAAGCGCCAGGCCAAATTTATAATGAACA -0.19936514 0.135188 1
75841 GAGGTATTTGTTTAAAATTCAGTTCATCCAAAATGGAGTAATATGCTTCACGTCAGTGTG -0.13790697 0.135197 1
20409 CCTTGCCAATAAGTGAAGAGATACTTTGTTGTATAAAATACATATATGCTCACCAGGGTA 0.37326751 0.135207 1
22370 GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA 0.29154139 0.13526 1
114584 GATAGTGGACAAGGGTAAGATTTTTATTTTGGGATGGGGTGGGTAGGACAACGCATTTCA 0.68892075 0.135265 1
72000 TGAGGGCCTCACGAACTCTTCACCCCACAGAGACCCGGGATATCTTGCCACTCCTAAGTT 0.17608139 0.135285 1
227707 GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGGAGAAGAAGAAGAAAGAAGGAAAGAA 0.17237184 0.13532 1
319229 CTGGCCATCTCCTTCTTCTCAGAAAGGAAGTGCCTGCAGGCATTTGTGCTCTTCGGATGG 0.2366678 0.135339 1
56176 TATCGAGGTCTTCATTTGCGGCTCTCAAAACAACAAGGTTCGGGCTAAATGGATGCTTCA 0.19681188 0.135379 1
54201 AACTGCGGCCGGCGCTTCTCGCAGAGCTCGCACCTCCTCACGCACATGAAGACGCACCGC -0.1656969 0.135408 1
320226 TACAAAAAACTCTACAGGAGATCCTGGAGAAGCACGAACAAGAGAAGACAGAGCTGGAGT -0.44475366 0.135416 1
110006 TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT 0.45922211 0.135423 1
15500 GTATTGCAGTATGGGAGGAATATGATGCTTCTGACCTTAATGTGTTTTAATGTTCTTTGT -0.18265557 0.135463 1
69726 TATTCATTTTATGATCTGGAGTCCAATATTAGCAAACTCACTGAAGATAAGAAAGAGGGC -0.16785558 0.13548 1
27393 GACAGAGAACACCGAATCCACCCAGTAGTGTTCTAAAATTTAAACTTGTAGAGTAAATTA 0.254361 0.135495 1
14526 GTCACAACACCTGGATTATACTAACAGAAGACATGACCACCTGGTAACCGTAGTGGTAAA -0.20470416 0.135495 1
13798 CTGCTTACGACCGTGTATATATTTAATTTCAGGTAAGGAAAACAAATATGTGTAGCGATC -0.19848852 0.135512 1
72607 CCGAGTTTGAAGAGGACAGTGACTTTGTGATCGAGATGGAGAACAATGCAAATGCCAACA -0.1516674 0.135547 1
18108 ATAGAGCTCTCACTGCAAAGAGAAAAGTGGGACTGTCTCTGTGATCCAAACAGAAATGGC -0.17862474 0.135601 1
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 0.94564501 0.135617 1
20608 TTGTTGGGCTTCCTACCCCCGGTTCTGGCCATCGGATTATGCTACCTGCTTATTGTGGGC -0.20758961 0.135651 1
210973 GCTGGCATGTTCAACTGCATAATGCTCTGGCACTGTATTTTGAATGACATTAATTTATTA -0.14753722 0.13566 1
18802 AAAGGTTGAGGAAGAATGCCTGACTCAAAACTGTGACTCTAGAGAACAATGCACAGCCCT 0.32825976 0.135713 1
17939 ACTGAAGTCAACTTCACTGTGATCATCAATCCTTCGGGGGTTGTGATGTGGTACCTCTAT 0.25606808 0.135718 1
18707 AGCTGGAAAACCAAAGTCAACTGGCTGGCGCACAATGTGTCCAAGGATAACCGACAGTAG 0.17285902 0.135721 1
15945 TTCCTAGTGTCTAGAAGTGGAGCAGTTATTATACCTGTCACGGGTAAAGCTGCCAAATGC 0.45734363 0.135733 1
27224 TTTTTCCTATTGCAGGTTCGATTGTGTATGATTTAATTCCCTTTAGGAATTTGTAGGCCT -0.17709904 0.135741 1
26362 TTGAGTGTCTGAGATTCTAAAGGTCCACAGTCTAGAGTATTAGGTACGACTCCAAGGGTG 0.51429241 0.135762 1
68861 CAGCAGTGATCTTTACATTTTCTTTGCTGAAAAAGCACTGACAAAACTAAACCACCAAAA -0.32020324 0.135764 1
69890 TGTGTGCGGAAAGCGCTTCCGATTCAATTCCATCTTGGCTTTGCACCTGAGAGCCCACCC -0.14807068 0.135767 1
209018 AACCAAGATCTCCATTGGTCACTGTGTAACCTGAGAGCATCAGTATCCAGAGGACTCAAT -0.16970271 0.135853 1
106585 GCAGGGTAGACTTTGAAGCACTGGTTTTTTGTTGTTTGTTTTTGTTTTTGTGAAGTTATG -0.19570369 0.135876 1
408189 CTGTTTGGAAACATACAGGAGGACGTATTTGATATCTTCAGAAATGCTTACAACTTTTTC 0.16965856 0.135963 1
20856 AAGCAGTGAGTGGGAAGATGAACAGTCTGAGTATTCCGACATCCGGAGGTGAAATGAAAA 0.33284074 0.13603 1
216169 TCTCTCCTCATGGAAGCAAAGAGAAGGAAAGAGGGAAACTAATTAAAGGATTAAGATTTT -0.15992505 0.136048 1
27403 AGACAGAGGATCTCTGTACCATACGCTGGCTCCCAGAAAGCCTTGGGCTCTGGGGGAAAT 0.24921319 0.136066 1
93761 TAAGGCAGTGTGTACGGAATGCTCCCCAGTTTAGATTTGACTGGTTCATCAAGTCGAGAA -0.26112979 0.136111 1
381337 CTGCCTGGTTTCTAAAGTCTCAGAGGAAGAACTAAAAATACAATTCACTAATGAGTTCTT 0.24832637 0.136167 1
107569 CTAGCTTTGAAATTGGGGTGGAGTATGGAGACATCATCTTCTGAAATTGTTTTATTTGTT -0.12486997 0.136179 1
18950 CTCTACTCTGTTTCCTTGATGAAGTCACTAGTCTCTGTTCTTAGATCCTAGCAGAAAGGA 0.35844349 0.136193 1
58523 AAGATGCCTGGATGTACCTCTGTGCGTTCCAAATTAAGAACATTTTTTAAATTTGTGCCC -0.16305134 0.136202 1
101187 CGAATTAAAAGGATTCAAAGGATCCAAAACTTAGACTTATGGGAGTTCTTTTGCAGGTAA 0.18137896 0.136228 1
217700 CAAGCCAGTAGCTTTCACTTCTCTTTTCTCTGAGCGGTAGGCTAAGAACTCTTGCATCTT -0.14366262 0.136236 1
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.58523925 0.136348 1
408068 TTCAAACTTCACTCCTCAAATGTATGCAGTTGTCCTCAGCACTACATCTGGATTTCTGAC -0.14970845 0.136382 1
14815 CACATCACACATAAATCTGCTTTCAGTTCCAACCAGCTTGGCTTTCAAAAATAGAGCTCC -0.20235883 0.136385 1
100036521 TGTTTATGAATGAGGTCAGACAAACCACTAGGGAAAATTGAAACCTCTTCGAAACACCAG -0.20523137 0.136389 1
17330 AAATATTTCAACGCTGTCAATAATTGTCTTTAACCTCCAAGTAGGTCTTGCAGAATCGTC -0.17253371 0.136398 1
217109 AAACAAGTTTGTATACTAAAGAGATGGATGTATATGTTTATTACATAAAGAATTGTTTGT -0.28842383 0.136412 1
70979 GTTAACCTAACTTTGATGTGCATGTGCGAAAATGATTACCTTATCATAGAAATAAGCCAG -0.14741786 0.136446 1
52589 CATTGTCTGGAACATGAGATTTTCCTTAATAAACTGCCCCTAGCAGACTGTGTCTTAGGG -0.27005054 0.136598 1
26931 CTCTCCAGGGAAGAAAATATCTTACTAAACAGTGTATTTCTTTTTGGTTGAGAAGTGTGT -0.2446051 0.136602 1
330483 CTAGTCTTAGCGCCGAGCTGTGGGAGAGCTGCCAAGTCCATAAATGTCCCAATGAACGCA 0.41080726 0.136621 1
80898 ATGCAGAGTGCATTCAGATCTGTATCAGAAATATCTCGTTTTAAGATATACTTGTGAGTC 0.36426016 0.136632 1
259055 GAGTTAGAACCAAGCAGATCAGAGACAGAGTTACCCAAGCATTTTGTGGAAAAGGCTCAT 0.39974775 0.136657 1
78925 AGAGGAATCTTGTCTTAACACTATACTCTACTTCATTCCCTGAAACTCGTTATTTACTTG -0.17445579 0.13669 1
330401 ATCCTGTTCAGTATTGTGAAGTAGCCCTTAATCCTAACTTTTAAGCAAAATCCCTTGGCC -0.14518249 0.136787 1
15370 CTCTTCCGCTCTCCTTCCATGTGTACATAACTGTCACTCAAGAAGGTGATTGACAGATTC -0.36842279 0.136798 1
230233 ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT -0.14793277 0.136802 1
16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT 1.17631997 0.136811 1
67343 AAACATGAAATTCAGGAACGTGAATCTACAGCAAGCAGAAGCCTGTGGGATCTATGCTGG 0.1762277 0.13685 1
228765 CTGGGTATTGCAGGGATGTGTCCCAGGTGATGTATATTGAGTCTGTCATTGCCGATTTTA 0.31309613 0.136869 1
67897 CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT -0.27373867 0.136883 1
66943 AGTGGTGATTACCTCCAAAATAAATGCCATTGAAGGCAGCCCTGGCTGCTGAATAAACTG -0.15130508 0.136959 1
68106 TTTCCGATTTTGACATGACCCTGAGCAGATTTGCTTACAATGGACAGCGATGCCCTTCTT -0.14624471 0.136963 1
76952 AGTAGCAATGAGCGCCCGGACATTAGTTCCATCCAGAGACGGATTAAGAAAGTAACTCAT -0.19238159 0.136971 1
231042 CCCATACTCCTCCCTAACTATGGCTTCTGAGATTGACTTGAATACGTTTATATATATATA -0.14127076 0.137074 1
223650 GTCGGTGTATTACAACTCAGGGTATTACAACTTTTCGTGTCTTCATGTCTTTTGATAATA -0.29973853 0.137122 1
68270 ATGTCCCCAAGGTAGAATGAGTGGGCTTTACACACCAGACACATCTGCTCTGCCCACATA -0.13295894 0.137125 1
13386 TACACATATTGTCTTGTGTTGCTGGTGCCATGCTACCACGCTATCTAAGAACCCCTTCCT 0.53638462 0.137136 1
69702 GTGGAAGTTCTTCTGAGTGCTTACATAAAGATGAATCAAAGGAAGTGTACTGAAAACAAA -0.14842734 0.137246 1
623223 CCCACTCTGGGACCAACTGTACATTTTTTAACACAGTTCTATTTTTGTAATCTTTCCCAT -0.19936265 0.137261 1
20195 ATAGCATGCCATGATTCTTTCATCCAAACTTCCCAGAAGCGAATCTAATCCTCTCAGTTC 0.37585477 0.137282 1
50996 GGACATGATCAGTCATATGACATGTTATGGTTTTTGTTTTGCCTTATTCTGGGTTTTGTT -0.14873699 0.137295 1
11907 TGTTTATAAGAATCACCAAGAAGACCCAAGTGAGGAGGCTGGTGTGCTGGAGTATGCAAA -0.16321597 0.137302 1
58801 GTAGATATCTTGCCCAATGGGTATTTATGGTCTGTGACTATATTTATATGTATGCTTCTG 0.52261356 0.137353 1
241431 GGAAACCATGAAAACAACAAAAATGTACACCTTTTCTTCTCTAACACTGTGAAAATCACC 0.21254897 0.137426 1
114142 ACTGTGGACGAAGTCGAATACCAGAAGCGAAGGTCACAAAAGATAACAGGAAGTCCAACT -0.31624005 0.13746 1
24132 CACAAACACACTTTTGGTTTGATCCCAGACTATCAATTGGGAAGGCAATTCTAGAGTGTT -0.1692397 0.137516 1
83768 AGACTAAAGCAACCAGCAATGCCACGGTGGCTTGGGCCTAAGAAGCAGCACCCTTCCAGA 0.25077358 0.137558 1
56708 GTTCAGCCAAGGACTTCAACCGGCTTAAGAAGAAGATGCAGCCTCCAGCAGCTTCAGTCA 0.21202587 0.137589 1
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.17597068 0.137638 1
53883 TCCGGAAGGCTATGGGAACCCCGACTTCTGCTGGCTCTCTGTCTATGATACCCTCATCTG -0.2010861 0.137655 1
53975 CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG -0.13443595 0.137671 1
75219 GTATGTTTACCCAGTATGAGTTGAGTTGATGAGTTGATGTGACAACAGCCTTAAGATAGC -0.14875601 0.137674 1
74589 TTCCACTGCAGCTGGCTTGTCATGCTGTGGTAACAGTGAACAATAAACTGTATGTCATCG 0.25960124 0.137702 1
214424 TGCGTAGCTGTGTGTGAGGTCATCGATCATCCAGATGTCAAGTGCCAAATCAAGAAGAAG -0.42234775 0.137726 1
75565 TTATTACCGGACAAAGCTTCGAGGCCTCTACACAACCGCCAAGACTGATGCGGAGGCCGA -0.17040277 0.137738 1
319211 GCTGTGGTTGAAGATTTCTTTGACATCATCTATTCCATGCATGTGGAGACAGGGCCGAAT -0.19829423 0.137778 1
224671 GTTCATGTGTGTACAAGGTCATGACGGGCTCACCATAGAAATAAAGCAGTGTCTTCGATA -0.2119812 0.137808 1
14696 TCTTAGATGATGGACAAATCATTACAAGTTCGGGAGACACGACTTGTGCTTTGTGGGACA -0.27780954 0.13785 1
280662 AGAATGGAATAGAAGGTTTTTCCGTAACCCTTTCTTGAATCATGTTCCTACAAAAGGCAA 0.1585655 0.137871 1
75040 GATGGAAAAAATGTGGTCAATGTTTTAGTGGCATTGTAGCTCAAGATAATAAATGGTCCT -0.24478724 0.137871 1
71950 CCATGATGAACCGATGCCAGCTGGACTAGTTTAAACAAAATAAAACACTAATTTTACCTT 0.20525955 0.137882 1
12394 TGTGCATCGTGTCACTGTAAATGTAATGGTACTGTTGTTACAGTGGAGGACTTGGTCAAA 0.7358393 0.137883 1
11858 TGAATGTTCCTCCCGATCTTCTGAGCGCAGTGTCCGGGATGTCTTCCATGTGGCCACAGT -0.19652746 0.137897 1
385658 GGCTGTCATGAAATATATGCCGAAATCAGACGTGAAACCAGATCAGAAGTTAATAAAATT -0.16569499 0.137926 1
14262 GCAGTGGGCATAAGTCCCTTTCTCTTTAAGTTCCACCAACAATTTGTAAGGAGAATGGTA 0.25231199 0.13794 1
211347 GTCCTTAGACTGTTCAAATGGAATATGGTTAGAGTGAGTGACATTCTATGCTCTTTCTCT -0.20036292 0.137949 1
18854 AGTGTTTGTGACTTATGGGCTTATTTTACAGACAAGATGAGAGTTACCACTCTAAGAAAA 0.23409974 0.137967 1
17528 GAGATGTAAAGTTTCATTCCAACCTTCCTTTCCAAGTCTTGTACTCCTCCTTCGCCTTTA -0.16351238 0.137975 1
75552 TTTGCCTGGGACTAGTCATCAGGAAGTTCCTGAACAGCACCGAATTCTGCAGTAAAAAGT -0.17198071 0.137986 1
230767 ATAGCGAATAGCGTGTACCCCCTCCTCATAGAATATTAAATAAAGGTTGCATAATAAAAC 0.23950394 0.138002 1
22390 ACCAGAATGACTTCTGACTATTCCAAGTTTTCCACAAAATACATTTTACCTGTGAATAGC -0.15520262 0.138035 1
56469 AAGAAAGTCGAGGTCATTGACCTAACCATTGACAGCTCGTCAGATGAAGAGGAGGAAGAA -0.15084446 0.138106 1
22631 CTTACTCCTCAACAATTGAAGTGGACTTTTATGGGGTGGGGGGTGATTGGCAAAAGGTAA -0.20831821 0.138139 1
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 1.12200969 0.138184 1
77305 TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA -0.1492261 0.138187 1
276891 ACTTCTTTTCACATTCAAGTTTCTTTAAAGTTGACTATAGTGCCTTCTGAACTCTTGCAG 0.48564042 0.13822 1
28042 TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA -0.20292236 0.138239 1
71989 GGAAAGATGGCTTGGATGAACATGTATCAAGGAGCCAGGGATTTTGTCAACTAGAGTATG -0.15206037 0.138244 1
207818 CCACTGTTCCCCAATCAGCCTCAAACTTCTACTGTTTTTATCCTAATTAAACTTATGAAA 0.4702437 0.138253 1
69718 ATGGCTTCTGTATAAGAAAAGGTGCGATTGCCGCCAGTATTCAGAAGGTAGAGAAGATTC -0.14118495 0.138277 1
240058 TTACCCTCCAGCTCGGGGCTTGTTTACTTCTGATGACTTCATGGTAAATTAGAGCTGACT -0.30273235 0.138286 1
18762 TGATGAGGACGTCATAAAGAGGATCGACCAGTCCGAGTTTGAAGGCTTTGAGTACATCAA -0.14425236 0.138287 1
545975 AAGGGTTCAGTACCATGCGAGGTGACTTTGTAAAGTTCTAAGCCATACTGACTTTCAATA -0.17307078 0.138378 1
12830 GACAGTATTTGCTTAGTCTTCTCCCTTCAATTAGAAAAAGCCAATGGACTTTTAAAACCT 0.27603697 0.13843 1
73182 TCAGGGTCACATGCACAGCTCAAGCTGCACTCCGATGTGCTTTCCCCTGTTGCTAGATTA 0.20292287 0.138504 1
210126 AAGAAAATATTCTCTGTCCACATTAAATCTGTCCTCAATCTAGAAACCCTTTCAAATGCC 0.17398404 0.138509 1
56196 ACTCCCAGTTACTGTTCTGATTAGTGGTAGTTATTTGCTGGGAACTGACAAAGTTCATCT -0.14136998 0.138577 1
13196 GGATGAAGAAGTGAACTGTACAGTTTTAAACTTGATTGCCATTAAAGCAGAAGTTACAAG -0.23971207 0.138635 1
67621 AGGGCTGTAAAGCATCAGAGTAGCCTGTCGGGACCACAATACGAACTGTTATTTTTACCA -0.22481346 0.138694 1
71723 ACCCCAACTGAGGTACTAAGACATCGAAGGCAGCATGTCTGAGCCAGCACTGCTCCTGGA 0.15203738 0.138734 1
546336 TTCCTCCAATAGTATGATTTTCAAACCTCCACCTACATTGCTTATATGTGGAATCCTTGA -0.2140242 0.138745 1
277666 GTGACTCATTAGAGGCATAGAACATATGTATTCAAGCATTTTTGGATGTACTTTGGAAAG 0.66729201 0.138748 1
73124 CAATTGTGTATGTATGCATAGGAAATGTTCCGCTCAAATTTAGTTTGGATTTCCAGTAAC 0.12476486 0.138749 1
19243 ATCCATGGTGTATTCCTTCAGTCATTTCAAACACTGCAGGGCTTCTCTCGTTATCTGCCT -0.12793696 0.138773 1
14114 TTTTTTAACCAACGGGGCTCTTTGTGTTTCAAGTTGATGGCTGCTGTAGAGTGGCACATA 0.30805866 0.138774 1
218397 GTATTTTTGTGTGAAGTATTCACAAGGGTTAAGTTAAAATAAACTAAGGGATAGCTTGCA -0.2061267 0.138814 1
14450 AAGAATCTGATTGAAACCATACAAACGAATGGGTCATTGGTGGCAAATGGCTTCCTGAAA 0.22941584 0.138823 1
19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG 1.14232045 0.13889 1
22689 TCCTGTCATTTACACCAGGACATGTCACAGACTTTATAAGCTACCAGTGCTATCTTTGTA -0.17097893 0.138898 1
100504093 CTTTTAGATCTCTTTCGAAAGCAGTTTTGGGAATATAGACATGATAGAGCAGACTATGAA 0.54613683 0.13891 1
18549 CCCTGAGTCTGATGCAAGAGACAGTCATTTATTTTAAAAACTGAAAAGCAAGTGAATAAC -0.27575075 0.138917 1
70527 TTTAAAAGGTCAGGGTGTTATTTTCTTCTATAATAAAACAGCTCACTTGTGTTGTGCTCC -0.14104304 0.138958 1
628431 CTTGTTGGTGCTCAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGTTTTTGTTTTT -0.16597724 0.139012 1
21813 TCTAGCGGGGAATTTACAGAATGCTGGTCCACTAGTGGGATTTCTAGGGTTCAAAAGTGA 0.67842561 0.139068 1
56451 CATCATACTGATTGGTGAAATTGGTGGTCACGCTGAAGAAAATGCTGCCGCGTTTCTGAA -0.13794126 0.139087 1
27424 CATCTTCCTTCCCTGTTGAGACTGGACAGATCTTCTCTGATACCCCAAAGCTTGGATAAA 0.64599184 0.139162 1
53859 GAAACAGCTGCTTAGGACTCATTGTAGCATTAAGTTCACTGTGAATCATTTGTTGGGAGG 0.33995074 0.139182 1
627626 AATAGCCATTCTTGTATGTTGATCTTGAGTGTAAGAGCTATGTCCATTCTGTAATTATCC -0.20921949 0.139184 1
77929 GCAAAGAAACCTGGAAAATGGTTTGTGGATGTTATATGTGCCAATAAATCCATTAGAAAG -0.13141044 0.139211 1
69228 TGGTTTAGGGAAGGAAAGGTTTTGAGATCTTACCCTCTGAAAAGATTTGTGCCACACCCA -0.17163198 0.139215 1
64011 AGCCAAGTCCGTGCCCTTTTTAGCTCTTCAGTCTAACGTGGTCTCCTTTTGCCTTTTCTC -0.26128436 0.13923 1
66072 CTATGCAACCTATAGTCATGCTTATAATGGTGTTTTACAAAATTATAGTCATAAGTTTTC -0.15500125 0.139242 1
16153 GGAAAACCTCGTTTGTACCTCTCTCCGAAATATTTATTACCTCTGATACCTCAGTTCCCA 0.14234665 0.139265 1
74044 TGCCATTGTACCACATTGTGTTATCATTGGTATGGTCTTAATAAACGCCTTCGGCCGTGC 0.57798984 0.139272 1
171259 CTCATCCTCTTTTGGATATTTAATTCCCTGATAAGCTCCAACTTGCTTCACTATATCACA -0.18116881 0.139278 1
72754 TATGATCTGTACATAATGGGTCTCTGGGAGATGCTGGAATAAAAGGCAAGTTATATGTGG -0.17700434 0.139368 1
69944 AAAGAATGTAGCAAAGCATTTAGTGTCAAGTCCTATCTCACTATCCATCAGAAAACTCAC -0.17088354 0.139422 1
12235 AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA 0.21355822 0.139423 1
100040216 CAGCAGAATCCGGTTATCTAAGAAGCTCTACATCTCCTGACAATTGCAATCTCACTTTCC -0.30976831 0.139466 1
218613 GCATGCCTGATGTGACATTCATAAATTGTACCACTATGACTTTATCCATGTAAAATAGCT -0.13677664 0.139468 1
66586 GGATGTTTGATACTGGAACCAGTGCTCATATGTCATGTAAATAGGATGAAACTTTCTATT -0.19657642 0.139473 1
17716 GCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTCTATATCC -0.17619849 0.139486 1
208869 AGATTATATCACCAAGCACCCAGGAGACGCTGAGAAGATCTCCCAGCTCAAAGAACTAAT