Detailed Information

>>> Option 1: Click the button below to Download all the analysis

>>> Option 2: View all the result online

Basic Information

The table below details the source and basic information of this item.

Title Content
iBAD ID iBAD_0000172
Karyotype Trisomy 21
Type DNA microarray
Diseases Down syndrome
Organism Mus musculus
Tissue Brain
Cell Line Hippocampus
Platform GPL13912
Accession GSE68074
GEO Title Lentiviral vector-based microRNA sponges identifies miR-155 and miR-802 target genes in the hippocampus of Ts65Dn mice
PMID 26546125
Article Title GeNme-wide miR-155 and miR-802 target gene identification in the hippocampus of Ts65Dn Down syndrome mouse model by miRNA sponges
Author Bofill-De Ros X, Santos M, Dierssen M, Fillat C
GEO Link https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE68074
Pub Link https://www.ncbi.nlm.nih.gov/pubmed/26546125
FTP Download ftp://ftp.ncbi.nlm.nih.gov/geo/series/GSE68nnn/GSE68074/
SRA Run Selector -
SRP -

Differentially Expressed Genes

The gene expression matrix, up- and down-regulated gene list are provided. Click the three following options to download the corresponding list.

Gene Symbol Gene Title logFC P-value P-adj
70544 TTTCGAAGTAAGATGCAATCCATATTCCCACCAATTCCCAAGAACCATGAGTCAGCCGAG 1.30582885 3.61e-08 0.00228
70544 TGCCTGGTGTGGAGTTGGTGTGATCAGCTTTGCAGTGTGGAAAGCCTTAGGAGTTCACAG 1.29747356 3.15e-07 0.00993
55951 CAGTGATAACAAGTATCGGTGTTTTCCATATGTAACTCAGATCTGTAACTTAATGGCAAT 0.66667349 6.72e-07 0.0141
106489 GGACCTGTGAAGCAACTGAAGAAAATGTTTGAAACAACAAGATTGCTTGCAACAATTATT 0.76516454 9.65e-07 0.0152
74112 CTGTGATAACAAAAAGTGCTTTCTCTGGAAATACACCTATGGCTTTTATACTGGCTATTA 0.55971861 5.42e-06 0.04388
68001 AACTCCCCGTGGGCTGACAACACGGCTTTGAAAAGACATTTTCATGGCGTAAAAGACATA 0.53040247 6.14e-06 0.04388
11957 CCAGTCCTGAGGAACATATAAAATCCATGTGGTAATTTGTCATGAATTAGTTGTACAACT 0.57909067 6.84e-06 0.04388
56088 ACAGAAATTCTGAAGAAGTTGATGACCACAAATGAGATTCAGAGCAACATTTACACATGA 0.49352192 6.97e-06 0.04388
55951 GCTGCCTTATCAATGCTAAACCTTATTTGTCTTCATCAAGAGTAGTTCAAAATATGCAAC 0.65187472 8.27e-06 0.0452
56176 CTGTGTATAAACATCCTAAAACCAGTCATTTACAGTTGTGGGCTGAATAATTTTGAGCAT 0.64634906 8.61e-06 0.0452
75296 GACAGGTTCTGCATGTAATAAATGTCTCTTTGAACAGTGGATTAAAATGTTGGCCGGCAG 0.56928663 1.00e-05 0.04739
15975 CCTCACTACTACCTTGTATCTCAGTCTCCTCAACAGAGAGAGAATGCAGATTGATTTTCG 0.51366887 1.17e-05 0.04739
53858 TGAAGGTAATTTTGATGGTTCGACTTGCTAGGGATTTCCCACACTCTTCTGCCTTCACTA 0.606107 1.20e-05 0.04739
74112 AGTTCTGTGCTTACTCTGACTGGGTGGTAGTGCTTGACACATCAATAAACTGATATTCCC 0.51996442 1.38e-05 0.04835
77975 GAGTCAGTAGAATTCTTGGTAATCATATAAAATGCACACGGTTCTCTTAATAAAGGTCTC 0.57495175 1.78e-05 0.04935
14390 AAGGGAGGAGAATTTTTGCATACATTTTTACTCTTTAAATAAAGACACTTATACTATCAT 0.53442911 1.87e-05 0.04935
66609 TGCACAGCTCTGTATTATCTTTCTCAACTCTCTCCTGGAAAGTCTGTGCTGATCATGGAC 0.53318151 1.89e-05 0.04935
100040563 GGTGGAAACAGCTCTACTTTCTGAAATGATTCAGATACACTAACTTTCCATACTTTATTC 0.67247552 1.91e-05 0.04935
22129 GCCTGTGAACATGCCTTACACTTGTCCAGTAACTGTCAATAAAGAACATTATAAAAGGTC 0.49493915 1.94e-05 0.04935
11820 CAGGATGATTGTACAGAATCATTGCTTATGCCATGATAGCTTTCTACACTGTATTACATA 0.53540429 1.96e-05 0.04935
60364 CCATGTCAACTTACTACTTAGTATGCTTACAGGTAATCTGTGTTTGCATGTGTGTATAAA 0.68181643 1.96e-05 0.04935
56088 CCTGTTCCAGGGGGCAGTCACTGATGTTTTGTATTTTATTCTGGCTTGGGATGTTTTGAG 0.50194211 2.49e-05 0.0583
11820 CAGGATGATTGTACAGAATCATTGCTTATGCCATGATAGCTTTCTACACTGTATTACATA 0.52774125 2.59e-05 0.0583
20655 CCTGTGTGGTCTGAGTCTCAGACTCATCTGCTACCCTCAAACCATTAAACTGTAATCTGA 0.55692208 2.90e-05 0.06291
121022 CTGCTAGGTTGTTGTCTAGGATACTTTAGCCCATGACCATTTTGCTGCAGGAGGTAGAAA 0.60635288 3.19e-05 0.06704
68842 GTCCAGGAAGTATTCTAGAAGGGAGTAATGGTTTGCATTCAAAATGATGTAATTTTCCAA 0.61922514 3.33e-05 0.06759
106583 GGAGACAGACAAAGCTATGACATTTTATGCAAGGACTGGCTGTAGATTCTTGAGGAGCAT 0.4580672 4.17e-05 0.08199
12469 GGTGGAGCTACCGAAATTGAATTGGCTAAACAAATCACATCATATGGAGAGACGTGTCCT 0.56226011 5.05e-05 0.09629
20658 CCAGCCGCTATTTTGTTGACTGAGGAAGTTTATGTTAATTTTTTAGGGTCTGATAGAATA 0.67414643 5.47e-05 0.10126
67367 GTCTATCCTGTTTTGAATCCCACATATGTGAGTTATATATGCAATAAAGAACATGCCTTG 0.65190006 5.79e-05 0.1041
21844 CTCCTCCCCATTTCACAATGTCCATTCCTTAAGAAGGGTTTAAATAATATGAAAACTTTG 0.49704131 6.19e-05 0.10823
28080 AATTGGGGAGAAGTACCTTGTTATGTCTGCAAAGAGCAAGATTCAGAAGCTCAGCAAGGC 0.47929669 6.95e-05 0.11051
67367 AATTTTTGCCGATATCTTGTACATTTAGCAGATACAATTTACAGGAACAGTATTGGGTGC 0.65050347 7.16e-05 0.11051
380608 TAGATGCAAAGGGTGTCTGCGTACATCCCTTCATGCATGCACTTCTGTATGTTGTTTTTT 0.58269479 7.41e-05 0.11051
78913 TTACTGCTTACCATCAACTAGTCAAAATGACTGTTATTGAAATAGTCTGAAAGTGGACAG 0.55226616 7.50e-05 0.11051
338467 TTTACTGTATTATGAATGTAAGTGTTTTTTAGCCTGGAGTTAATCATAAATGGGCCTGGG 0.51025659 7.55e-05 0.11051
12408 GATAAAAAAGTTGAACCATGGTGAACCCAACTCTCACCTCCCACCCCCTTGTATCCAGAC 0.57698602 7.77e-05 0.11114
70028 ACAGTCCTGAAGTGCTGTTCAGGTATTTTCTGTTCAGCGGCCAAACATGTCTCCCTTAAA 0.52907706 7.98e-05 0.11114
14390 TGAAGACTCTTATTGGATACAGTGCAGCAGAACTGAACCGTCTGGTCATAGAGTGTGAAC 0.51533047 8.12e-05 0.11114
16443 GGGCTCTCAGTGCCACATCACCAAGACAATCCAGGACACGCTAAACCCCAAGTGGAATTC 0.51495968 8.47e-05 0.11349
67374 TTCGTGATTTCTGTATGTGGCCTTGGCACATGCTATGCTCAGAGGAAAGGCTACTTTTCA 0.66398271 9.46e-05 0.12412
15976 GTCCTTAGAGACTTACTTCCAAAGACAAACTACTGTGTATCTCTTTATTTTGATGATGAC 0.86668741 9.86e-05 0.12674
12443 TTAATCTGTTAGGTTCTAGTGTTCCGTCTTGTTTTGTGTTAATTACAGCATTGTGCTAAT -0.78547304 1.04e-04 0.12767
252903 GGGGAACAGCTTACATGGCTTTTAGTGGAAAACCATTATGTGTGTTTTCTTTATTATCAT 0.63691717 1.04e-04 0.12767
12013 TCCTAGATGGTGATTCTAGACTGACGGTTAAATAAAGTTCCTAACATGGCTTTCAGTCGA 0.54405829 1.10e-04 0.12767
252903 CTAAATGTACTACTTACATTCTGGATAATTCCATAGTTGATCTTGTCTAGGTTGCACAAG 0.58280595 1.11e-04 0.12767
20295 TTTGGAGACGCCAGGGCTGCTGTCCATGGTTTCAACATAAAGCGGCCTGTGACCAGCAGA 1.48079981 1.12e-04 0.12767
100040631 ATGCAGAAGAACGGTGCTGGGTTACACTCCGCAAGTTCCTGCTTCTGGGACAGCTCCACA 0.62449459 1.18e-04 0.13073
228576 ATCTTCACCATTGAGTATTTGCTGAATGACCTCGAGCAAATAAAAGATTGTTGGACAGTG 0.46034462 1.52e-04 0.16494
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.64705452 1.57e-04 0.1676
239985 ATGACATCCGTGAAGGCACACATGTGTGAGTGAACATTAGAGGGTCACATATAACTGGCT 0.4589633 1.75e-04 0.18107
60364 TAGTTTGGATATCACAGGGCCTGTCATGCCTCATGCATTGCATTCTATGAGCATGCTACT 0.58335771 1.80e-04 0.18233
385668 GCTCAGGTCTAATTCTAACAGTATTCTGTTGGGACTATAAAGGGTCTGTATTCCCAGTCT 0.56105736 1.90e-04 0.18741
93871 CTCTGGTCGTTGTGCTACAAATGTTTTGCCTACAGAGGATGTGGACTCTAGTTCGTTGTT 0.48283847 1.90e-04 0.18741
67374 CCATGAAGACCTGTCTGTCTGCTGTTTTCTGTGACTTGAACTCTAACAATGTGTCAAAAT 0.4449304 2.15e-04 0.20639
16010 GAGAAGAGAAACCTCATTCTTGGAGTGAGAGAGAAAGAAAGTGGTGAACATTGAACGCCC -0.47008464 2.16e-04 0.20639
110749 TATGCACTTGCGTCAGAGGAGGCAAGGCCAAAGCTCGAAGGCTGGTGATGGTGGCCAAAT 0.61715089 2.44e-04 0.22261
72536 GACAGTTTATTACTTGCTGATGTTATATCCTTTGCCTCAAATAAAAATCCGCCAAGAACA 0.801991 2.52e-04 0.22716
20658 CGGAGCTTGGAAATTAATGAGAATAGCTGGCCATTGCCTGAAAGGAACTTCTTTCGCATC 0.38142332 2.59e-04 0.23
93871 AAGTTAACTCGGTATTACAGTCCCTATAAGCAATGATTTACATGGATCTCTTTAAAGGTC 0.663186 2.70e-04 0.23286
93961 AGACGCTGCTTACATTCTGCTTCAGGGAAATATCAGAGGAGGAGAGCTGACTCATTTCAC 0.55038851 2.80e-04 0.23845
14450 AAGAATCTGATTGAAACCATACAAACGAATGGGTCATTGGTGGCAAATGGCTTCCTGAAA 0.46917579 2.86e-04 0.23984
15312 AATAAAAATTGGAATGTCTGTACTCTGCTCCTCGACCAATAAAATCTGTTGTGAAAGAGT 0.61879329 2.97e-04 0.24308
93871 CCTAGAAAAACAATGCATCGGGTCTATAAATAGGTTCATTCAACACCACTAGAGGGTTAC 0.47437748 3.03e-04 0.24472
13185 AGGGAAACTGAGAAGACTTAGCTGAGTCACCTGACAGTGAGTTCCCAGAGAATGTACTTT 0.52261642 3.12e-04 0.24791
13548 TTTCTGCTAATACAGGTCCTGCACATTACATGACTGAAGGACATCTGGCGATGAGACAAG 0.44766961 3.15e-04 0.24791
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.59794832 3.45e-04 0.2682
624086 ATCGGAGCAGAGGGATAATTGCGGGTTTTAGGATCCAGACGTGGTACGGGTGAAAATGCT 0.45719556 3.66e-04 0.28145
16443 AAGCCAGAAACGGACAACTGGGATACATGGGCGGCTCAGCCTTCTCTGACCGTACCTAGT 0.34626602 3.75e-04 0.28442
100037283 TCTGGGAAAACTAGCTTGAGTCCAGTCGCCATAAGTAGAACTGTTAAATTTGGTAGAAGT 0.51813451 3.89e-04 0.29137
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.60668749 4.11e-04 0.30064
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.60660968 4.40e-04 0.31454
27393 GACAGAGAACACCGAATCCACCCAGTAGTGTTCTAAAATTTAAACTTGTAGAGTAAATTA 0.51681812 4.59e-04 0.32384
NA TCTCAGGCGCGGTTTCTGATTGAATGCAGAGGTCACACGCATGCCTCCCTGTATTACCTG 0.46236275 4.63e-04 0.32384
378431 ATAGTTCCTTGTGTTCAAACTTGGCTGTACTAATCATAACAACTCATAAGATCTGAAAGC -0.71170351 5.01e-04 0.34343
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.57186628 5.02e-04 0.34343
66616 GTGCAACCATGAGTACAAAGGCTTTCTCGGCTGCTTCCCGGACATCATTGGTGCCCACAA 0.33678367 5.14e-04 0.34453
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.55399596 5.67e-04 0.37214
321007 CTACAGTTAAACATTGGTTTAAAAATAAGGCTATTCCAACTGTTGTCCTGTTCCCCACCC 0.44039942 6.01e-04 0.38646
20511 AACCCAGTTTCCAGCATTCAGACATCAGTAAATATCCTTTGGTTAAAATCCCTATTCCCC -0.42705071 6.09e-04 0.38646
20975 ATTCAAAGCCCATCATTGACCGTTTTGTGGAGTCCTTCAAAGCCATGTGGTCTCTGAATG 0.46707607 6.12e-04 0.38646
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.62113667 6.14e-04 0.38646
15312 TCTGAAGAAGAGAAAGAAGCTAAGTCCGACTAAGCATCCATCACGTCTGACAGTGGTCCC 0.64390689 6.39e-04 0.39847
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.5899325 6.76e-04 0.40949
13548 AACAGAGTCCTGTAGCTAGCTCGTGACTACATTGAAACTTGAGTTTGTTTCTTGTGTGTT 0.47673812 7.12e-04 0.42694
66467 GCTCCCTCCCACACAAATACGGAAATATAAGAAAATGAAATCATAAATGTTTTTCCTACC 0.42723289 7.39e-04 0.43505
245305 GAGCTCTTCCATTCCTCTTCAAATATGTGAAAAATCTCATAGAGAAAAAGGATGCTACAA 0.38892014 7.73e-04 0.45065
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.40998912 8.34e-04 0.48166
14527 AGTGTTCCCATGTGTGTTGACATGGTCCCTGTACCCAGATATGTCCTTCAGTAAAAAGCT 0.56058004 8.55e-04 0.48965
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.55053155 9.29e-04 0.51789
67547 GTGATGAGAATTAGTAATAGAAGCCAAGTTATCTCAGGAATTATGTTTTCCTATAAGCCC 0.43034207 9.29e-04 0.51789
192199 CCGTGGTACACGTCACGGATGACCTGACTTGGAAACTGCTTAAAGGTTTATTTCAAATTA 1.26298551 9.67e-04 0.52958
66609 GGGACATTCCAAAAGCTTCTTTTAGTTATTGTATCTGTACACTTTGCCTCTGCTATAAAA 0.44809331 9.84e-04 0.53103
67768 ATTGAATCCATTCCACTGAACATGTAGCCATGAAACAAGGCACTGTGTAGATCCTGCACC 0.52223622 9.95e-04 0.53103
207932 TTCCAGCAAGAAAGCTAAGAGGACTTTATTCAGCTGACCAACAAGTAAGCCCTTATAGTC 0.50045474 1.02e-03 0.53386
22129 TGAAGAAATTACAACATCTTGAGTTGATGGAAGACATTGTGGATTTGGCAAAGAAAGTTG 0.51042275 1.02e-03 0.53386
69540 TGGGGGACCTCAGCCAGCCGAAGAGTGAAGTACAATAGGAGCCTGAGCTGTTCCAAGGTA -0.3130971 1.03e-03 0.53386
16443 TGGAAGACTTATTCCAGAGAAACAGATACTCAGTGACCAGTTAAAACAAGTCCAGCAGAA 0.31277306 1.06e-03 0.54915
246738 CTGAAGAAGTTGTAATGAGATTTAACCAACTGTGGTCTCCAAATGAAAATTCAAAACCTC 0.37456352 1.09e-03 0.55927
54720 TGGGAACTGTTGGTTGAGACAGTTTTTCACCCCCATTGAAACGTGAAGATAAACTTGTAA 0.55606226 1.11e-03 0.56331
56012 ATGGGAACAGCCTTCGGGGCATTGTGAAACATCTGGAAGGGATGTCCGACCAGGCCATCA -0.61689385 1.13e-03 0.56443
23829 GTGATCCTGCATCTGGACGCAGGGGATGAGGTCTTCATCAAGCTGGATGGAGGCAAAGCA -0.46867374 1.16e-03 0.57027
207781 CTTGGTTGTTTTTCCCAATAATCTTGTCTTTGAAAGGAACAAAACAATCTGTGTGTATGG 0.48066736 1.27e-03 0.61235
68936 GGACCGCACTCTGGCCTAGACCTTTAACTTAAATGATTGACAGAGTGGATTTTTATATGT 0.55111158 1.27e-03 0.61235
12411 GCACCCACTTTCTGTCTCAATGGATCTCCCTGTTCTGGACTCTTCCTATAAATGGAATCA -0.42928125 1.44e-03 0.6637
21828 TATCATGGCTTTTCTTTTACCAGCCCAAATACGTCAAAACTTTTTATATGAATGTGGAAA -1.42675145 1.49e-03 0.68044
15975 GCTCTACCTCAAGAGACTAAGAGGGTGAACACAGTTTGTACTTTTCATCTTCCTTACAGA 0.62026052 1.58e-03 0.71408
224440 GGAGGATGTACCAGCGGCTGCGTCTTTACTGAGGTTGGAATAAACAGACTTTTATATGAA 0.58265227 1.61e-03 0.7255
238463 CTAGAGGGCATTAGTAAAGTACACTCTCTCACTCATGCACAAAACATTTGTAGATTTTAT 0.2868243 1.64e-03 0.72752
244885 AACTAAAGGAAGAGGTGGATGAACGTGAAGAGGCCTGGGCTGACTGACCAAGCTCGCCTC 0.37447226 1.66e-03 0.72752
19272 AAAGGACTTGATCAGTTTCTGTGACTGTATGAGAGCATCCACATTTCATGCCACCTAATT -0.48337703 1.66e-03 0.72752
77106 GAGCCCGTATGCAGTCATGAGGAGAAGTTACCCATTTTTAATAAAAAGAATTATGTACTT 0.79454213 1.71e-03 0.73579
12265 GCCCCATCTAATGCAAAACAAAACAAAACGAAACAAAACAAAACAAAACAAAACAAAACA 0.56007317 1.72e-03 0.73579
93880 ACCTCTTCCAGAGGTAGCGCGGGATCCCGCCCATGAAGATGAGGACGTGCTTACATTGTA -0.46958941 1.79e-03 0.7622
72690 CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT 0.53322094 1.85e-03 0.77669
71446 ATCACTATGTAGACCAGGCTGACCTGGAATTTATAGGAATCCTCTCGTCTCTGCCTCATA 0.49974054 1.86e-03 0.77669
22371 CAAGTGAGGCCTGTGCAGCTACAGCGGATTCCTACTGATACCCATGCTATGACCTGGCTA 0.76350109 1.90e-03 0.77738
74443 AACGTCAAAGACCCTGCAGGTCCTCTGTCCTACTGCAGACTGAAGTTCTGGCCGACCTCT -0.26638764 1.91e-03 0.77738
66898 GCTTATCAGATTCTCAGATCTCACCGAGAAATTATCCCCAAATTGGTCCGGGTCTATGTA -1.94455364 1.95e-03 0.789
20541 ACTTAAACTGCTGATGGAATCCAGCTTCAAGAACATCCGTACTAGGCCGGAAGTCAGAAA -0.62193818 1.98e-03 0.79612
15975 ATTGATGAGTTTTTCTCTGAGCCGCCTTCAAAAAACCTTGTACTTCTGACGGCTGAGGAG 0.33150578 2.02e-03 0.80425
67426 TCCTTCAGGCTCAGTCAAGCAGAGGGAGGACGTTGAAAGGGAGCCACGGCCTCTATGAAT -0.25791126 2.03e-03 0.80425
224481 TGACCTCGTGACTTTACTATCCAGCTTGGTAAGAAAAGAAATACCAAGTAGATACAGTGC 0.55993408 2.10e-03 0.81444
18508 ATTTCCCGAATTCTGCAGACCCATGCAGATGCAAAAGTCCAGGTGCTGGACAATGAAAAC -0.25235711 2.14e-03 0.82149
60599 AACTCCTGTCCTGGTCTCAGTGAGGCGAGTTGTGGAAATGATGAATATAACTCAAGTGGT -0.27117286 2.16e-03 0.82179
12369 TTCTGAATAATCTTTGGTTACCTCTGGTTCTACAAATGACAATTTAGGCGAAGATCTTAG 0.39326447 2.19e-03 0.82179
16443 GTTGGGCTCTTCCCATCCAATTATGTAAAGCTGACCACAGACATGGACCCCAGCCAGCAA 0.3180007 2.19e-03 0.82179
224454 GACAGACAGCGAGGAAAATTTTCGACACTGGTGGCCAGACTGAAATTGGACCTAATGTTA 0.62276014 2.26e-03 0.83574
192734 CTTGGCTATGTAGTAAGCATCCGTGACATTGCAACATAATAAAGCAAACACACTGTGACA -0.25133362 2.30e-03 0.84216
224432 TTAGCCAAGTGGGAACCATAGACACTGTCTCAGAACTTAATAAGGGGGAGGCCATGGCCC 0.33978582 2.38e-03 0.84861
20975 GAATTTTAAATGGTTGTTCAATCTGTGTGTGTGTGCCATTTGCTTGTTCGTTTTGTGTTT 0.70088843 2.39e-03 0.84861
27275 CTGCTTCTGTGGGCATAAAACCTGCCTGGGAATAATAAAAATTTGACAGCTTGATCAATC -0.30767681 2.40e-03 0.84861
20852 TCTGAAAGGCTGAGACATTGTATAAGACAGCAACCCAGTATCATTTGGGGAGTAACTATG 0.50058833 2.42e-03 0.84861
215798 GCAAACTAGAATTAGTAGTGAGAAACTGCTAAAGCTGATTTGCCATTTTACTGAAATGGA 0.3609312 2.43e-03 0.84861
105243 GGAGTTCATCAGCAAACTGCAGGGACTGCTTGCTTATGTCTATTAAAAACACTTTGAGGC -0.49175058 2.45e-03 0.85407
72388 CTTGTGTAAAACACGGGGACCATAGGAGATCTGTTTTATGTCAATAAAGGACTCCGCCTA 1.03571165 2.48e-03 0.85742
320207 GTAGAGACATGCATGGAACCCAATACAGCAAAGAGCCTGAAGTTTAAATCTGTCAGACCC 0.42124341 2.56e-03 0.87054
98878 CCCAAAGCTTTTTTGGTAGGTGGCAGAATTTAAATTCAATAAAGCTTGTCTTGATTTGTG 0.42730709 2.58e-03 0.87395
18710 TTCTCCAAGACTTGGAATGGTTGGCAGACTTGCTCCAGATGCAATAAAGACATTGCAGTG -0.39048675 2.69e-03 0.89578
100993 AGAGATCTGTTTTCCCTGGCTTGAGGCCCCGAGGGTCAGCTGTAAATAAAATAGGTTTTT -0.36836646 2.74e-03 0.89578
17986 CATAATTGAGCATTAGTCAAGCATGTAGGAATCTACTTGTGGGTGTGCAATAGCTTCAGC -0.35733559 2.75e-03 0.89578
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.37060786 2.79e-03 0.90584
13731 GCTGCGTTATCCAAGAAGCAAGTATTAGGACCAAAACCTGTTACTGTATTTAAAGGAACT -0.35910724 2.81e-03 0.90671
224405 TTCATCTTGGTGACAAAAGCATGTTCAAATCCAGGAGAGGCTGAAAGGCCAGCATCTATG 0.49164361 2.87e-03 0.92198
110749 ATGCCCAAAACCTGGCCCCTGATGACTCTTCCAAGACTGTCTGAGCCTGCTATGCACCTG 0.49782234 2.93e-03 0.9265
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.40945252 2.94e-03 0.9265
16179 AGGGAGGCACTACCAGAGAATCAAGTGTGAGGAGTAGCCCAGGCTTCCAGCCTACAACCA -0.24947559 3.01e-03 0.93776
270672 AGATTGTTGAAGAGGACTATACACTTTCTGATATTCTCAATGATATCACTAAGGAAGACC -0.25960562 3.04e-03 0.93776
629378 ATTGGGAGGTTAGAGAGAGGAAGGAAGATGGTTTCAATCTCGTGCCTCTCCCCACGGGGG -0.33375526 3.04e-03 0.93776
16155 GTAATTTGAGCCCTTTGTGCTCACTAAAACAAGGATCACATTTAACTTGTGACAAACAAA 0.65420643 3.12e-03 0.95082
100037282 CAGAGAGCAGCTCAACATCTGGTCAGTTATAATGCAAGGCAGGCACATGACCCATCCAGG 0.60962175 3.15e-03 0.95082
26411 AGACGCACTAGTGGTCATGACATGACCTTATCTCCCAATAAACTTGACTTTAGTCTTGTC 0.81056087 3.20e-03 0.95082
109857 TCTGCAAACTCAGTCTGAACAATTCGCTGTGTCCACACTCTCAGCTCATCGTGTTTTCAA 0.95445724 3.21e-03 0.95082
74013 AACAGGGGCCTTCATTTAGGTATGAAAGACTGACCTCCAAAAGAACTACAGTAGACTGCC -0.3416958 3.22e-03 0.95082
386400 GAAAACTAACTTTTTTGGTACCCAGGCCGTCTGCACAGAGCTACTCCCTCTAATAAAAAC 0.32307057 3.22e-03 0.95082
268527 GTTATAGCTGTGGACTGAAGAGTTGCCTTCCAAAGGAAAGAGGACCAAATTGCTTACATG 0.87294223 3.23e-03 0.95082
110948 GCTGTTGCAAAGGTTCATTTCTCAGACTTTGTAATATAAGGCTGTTCATCTCTCAGAACC 0.52141565 3.29e-03 0.95899
321007 GCCCGAACTGAATGCTCTTATAAACAATACCAGAGGAATTATTTTTTACAGTGTCCCTCA 0.44173445 3.29e-03 0.95899
71837 AAGTGCTTTGGAAGCCCATGGTTATTTCAGAAACCATGAAGCTGGTTCCTGGTGTGAGTA -0.28559951 3.31e-03 0.96072
14261 GATCTAACTGGCTTTTCAAATGTATGGAGTATAACGTTCCAACTCCTCTAATGTAACAAC 0.39700856 3.42e-03 0.98858
70967 CGTCGCACTGTTTACAGCACACCCTGGAATAAATTGGGAGGAAGCCGTGGTGTCTTGCAA 0.50085498 3.44e-03 0.98962
13711 TGTCTAGTGACCGGCACTGAATAGCAATGCAGGCTGAAGACCTCCAGGTTTAGAATTTAA -0.39500776 3.51e-03 0.99993
66616 AATGGAACACAAGAGAACTCCGAAGTGCTTCATTTACCTGGGGCAATGCGATTCAATTCC 0.33535926 3.58e-03 0.99993
214951 CTGGTGGGTGGTGCTACTTGCCTATGGCACCTTCCTGCTTTTCGCCATCTTCTGGAACGT -0.22879155 3.64e-03 0.99993
54161 AGCATGGAGCTTTCATAAGTCTTTAGATAGTGCTAAGGAAAAGAAAAACAGGGTGCAGGA 0.33674584 3.65e-03 0.99993
30051 TGTCTGTACCCTGCGTTGGGAAGCCAGGGGTGCCCTGGGGATGGATAATAAAGACGTAAG -0.39789654 3.68e-03 0.99993
72388 AACACGGGGACCATAGGAGATCTGTTTTATGTCAATAAAGGACTCCGCCTACTTTTGGAA 1.01399666 3.70e-03 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.32541151 3.70e-03 0.99993
23872 CATGGTGACCTCAGATCAGCAAGTGACATTGATAAAGAGCCGTTATACCATGAGACCACA 0.47279095 3.74e-03 0.99993
12576 ATTAGCCAAGCAACCATAAGACTCTAGTCAAAAGCACTCGTGCAGATATGCTGCATATGA -0.27130888 3.78e-03 0.99993
436440 TAAGTATGGAAGCCTTATGCTTTCTACCTGTTCAACCTTGTGGTGGCTGACCTGCTATTG -0.313292 3.79e-03 0.99993
234407 CCTTTGACTCCCAGTTGGTTGAGAAATAGCCACCCTCCAACCTGTCTGCCGGAGGACACT -0.26457599 3.87e-03 0.99993
192120 ATACGAAGGACAACCTGCCAGGATACTGTTGGCCAGAACGTCGTCGTGGGAGTGTGGTAG 0.37311728 3.88e-03 0.99993
20743 TCACTGGGGACAAAAGAGTGTTCCCACAACCTTCTCTTCTGCTATTTAATTCAACTGGTG -0.29020842 3.89e-03 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.40423223 4.05e-03 0.99993
233011 GACTCTAGAACTCTGGGGTGGGGGAGAAACAATGTGTTCTGTGCTCCAGAACCTCGGCTT -0.35017077 4.06e-03 0.99993
13482 CAAAGCACTGACTTCTAAGTAAAACCACAGCAGTTGAATAGACTCCAAAGAAATGCAAGG 0.47191517 4.06e-03 0.99993
74681 TGGATGAGACAACCTCATGGAACAAAACATTAAAGCCAAGTTTGCCACTAGAGCCAGAGC 0.24218633 4.16e-03 0.99993
243963 GCACACAGGAAATGTTTGCTATTGATGAAGTGTGGATGAGTGTCTAACTATCTAGTACAA 0.23496873 4.28e-03 0.99993
380930 GGCCTAACTCTAATTTTCCATTTCTGTAGGGGAAAATGTCTATAAACATTTCAGCTCAAT -0.26636725 4.30e-03 0.99993
20975 TTAGATCCCCAATGCCTAAATCTGAAGAAAGCAGAAGTGTCAATAAAACAAAGGGAAGCC 0.71795146 4.30e-03 0.99993
665174 GCTGTGACAATGGATGCTGCCCTGAAAGAAAGTTCTGGGATCTTGAAAATAACCGCTTTA -0.29577913 4.30e-03 0.99993
140709 TCTCCACCAGGAGGTGATCAGAGACCTGTGATGTTATTTCAAATAAAGGTGCTCTCTCCA 0.56144978 4.33e-03 0.99993
14683 CTGCACGTCTTTCTTCCTATGACTCTACAAGTAAAAATAACTATTAACGCTCCTGATAAA -0.37623924 4.33e-03 0.99993
27356 CAAACATCACTGGTGATAGAGATGTACAAACTGTCGTAGGAACTATGCTCGCTTAATAAA 0.64182243 4.35e-03 0.99993
624512 GGAATGCTTGGATGTATTTTTGCACCCAAGATTTATATCATTTTAATGAGACCAGACAGA -0.42856639 4.45e-03 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.49166803 4.52e-03 0.99993
219103 TGGCCGAGTTAGAGTGAAGGACAAAGACGGTAATGTGCTAATGGACACAGAAATGTGAAG 0.51185175 4.53e-03 0.99993
54006 GGAGGCCATGAGTGAGTGTACCGGCTGCCACAAGGTTAACTACTGCTCTACGTTCTGCCA -0.3057226 4.58e-03 0.99993
15446 GAATTCATTTTCAAGATTATGACATCTCTCCATTACTCGTAAAAGCTCCATTAACCTCCT -0.55584453 4.67e-03 0.99993
100037283 CTACAAAGACCCAACATTGATGTTCACATTTTGGAAATATTTTGTGTCCCACAAAGTAAG 0.74789556 4.68e-03 0.99993
243914 ATGAGAGGTGGCCCTTCTCCTGGGCGGTGACTAAGGAAATAAATGAGATAATGTCCGAAT -0.42474617 4.82e-03 0.99993
100042894 ACATGGTCGACACTTTCACTTATACATAGACATGATTGAAGTGGCCACAGGAAGTAGAAA -0.32392433 4.85e-03 0.99993
223227 TATATGAGAGATGACCGCCGTTCCTTTTGTTTCATCCCATGTGCAAATCAAAGCAAGACC -0.30389578 4.97e-03 0.99993
17067 AGCAGTTACCTGCCGCGCCTCTGATGGATTCTGCATTGCTCAAAACATAGAATTGATTGA 0.59225391 5.03e-03 0.99993
218311 CCCAGGCTTGCTCAGGAATACTCTTAAATGACTTAATAATAAAGAAAAGTTGTAACTCTC 0.21336075 5.03e-03 0.99993
21946 ATCCAAAGCTGGGAACACTACCGAGAGTGAGAGACCTTGAGACCTAGTGAGAATCCCCCC 0.47392087 5.10e-03 0.99993
70028 GGGCTGCAGGCTCTTATCTGTCGGGAACTTGTTCTGTAGGTTGGCCTTGAACTCAGAGAT 0.37049868 5.18e-03 0.99993
13417 TGAAAAGGACATTCGCTGGGATCAACCAAGACCTTCTGGACATCAGTAACTTACCCATGT -0.4948933 5.19e-03 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.20952635 5.30e-03 0.99993
114565 GCAGGCAGATGTTTAGTGAAATAAATAGGTCTTTCACCACTGTAAATCTTTAGATAGTAG 0.37381251 5.44e-03 0.99993
230145 AAATGTTGAGTTAGAGTTCTCTCAGGGGGATGAGGTGGACACTAGAAATACTGTTGATTT 0.37232643 5.49e-03 0.99993
104015 CTTGGTGGCTTTGAGGACAATTTTGATCTGCAGAGCCAGTCTACAGTAAAAACAAGCAAC 0.46006486 5.50e-03 0.99993
13131 ACTTGAGAGATCTCTTTCAACTCATCTATGAGCTGAAGCAAAGAGAAGAATTGGAAAAAA -0.30422371 5.58e-03 0.99993
243846 ACCACCTAAGCCTCCCACTTTTGGAGAGTTCCTTTCTCAGCACAAAGCTGAAGTCAGCAG -0.37374955 5.77e-03 0.99993
213439 CTTTTGGGTTAACTTCCAAGATACTGTGAAATGTTGTTACTGAAGTTTATTTGCAGCTCT 0.40276448 5.78e-03 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.36114367 5.79e-03 0.99993
239528 ACGAGCCTTCTCTTGTGTGCTGCTCTGTGCTCTGTGGGTTTTTTCTACCCCTGCTGATGG -0.50890862 5.82e-03 0.99993
329919 GTACAGAATTTAATTTGTGGAAGTAAAAGCATTTAAAGAGATGACTGGTGATGGGAGTTG 0.22848434 5.83e-03 0.99993
19219 AAGCACATTGGCTGTCATTCTGATGTGACTCGAGATTGCAGTTGCAACTTGGCAGCTTTT 0.45395075 5.87e-03 0.99993
17858 AAGAGAAAGAGGCTCTCAAAGCTCAGCAAGTAGATGGGTAGAGGAAGCCACTTTGCTAAT 1.04865068 5.93e-03 0.99993
93881 GTATGCATGTCCTCCATTACCAAAGTGTTTACTTAGTTCACAATATCCACTGTACTTAAT -0.34807711 5.95e-03 0.99993
72611 GATCGGCTTTCCATCGGGAGTGCTCATCCCAGCACGGAAACTCCTTTTCCAAGATTGTAA -0.33340588 5.99e-03 0.99993
239691 CTGGGTTTTGGAAGTTGCCCAATGACTGGACACGCACCAATGCCTCCCTAGTCTACCCCT 0.22904577 6.08e-03 0.99993
57738 GGTCAGGGAACGACGTTGGGAATATTAGGACTATGTCATGTGTTCCTAGGAGAAAACGTT -0.46614434 6.08e-03 0.99993
13175 AATGGAACCCCTGGTAGTCAGCTCTCTACTCCACGCTCGGGCAAGTCACCAAGTCCATCA -0.27417345 6.09e-03 0.99993
449000 CCCGGATAATGCAGTGAATGTGATAAAGGCTTTGTTATTGTAGTCTGAAAAGGAATTTTA 0.5796151 6.24e-03 0.99993
625353 ACATGGTCGAAACTTTCACTTATATGTAGACATGCTTGAGGTGGCCACAGGAAGTAAAAA -0.31195058 6.31e-03 0.99993
15446 AAGCTCCTTTACAATGGAAATATTTAGTAATAAAAGCTTGTCCGGGACCTGCAAGCGAAC -0.61206471 6.48e-03 0.99993
629591 GAGCTATGCTCATGTCGTGTTGAGGAAAACAGACATTGGAGAACTCACGGAGGATGGAGT 0.35989869 6.50e-03 0.99993
23856 AGGAAACCACTCCTCCACATGCAGGTGATTCGATTTCACAAACAGTTGTTCCCCTGATTT 0.34136872 6.54e-03 0.99993
545938 TACTACCTCTGGTGGCTGGTGAACTAGAAGGGAGGTTAAAGTGTGTAAAAACCCTTATTA -0.20724021 6.54e-03 0.99993
209837 CCTAGATGAAGCTGTTAGGGTTACCCTGGCGCTAAAAGGGAAGAATAAAGATGCTGAATG 0.48189759 6.54e-03 0.99993
68509 GTCCATATGCCACACCGTGACTGTGTCACACACAGTCAAGGCCATCAAGAACAAGCCTCA 1.15267981 6.57e-03 0.99993
18682 GCCCGGGCAGTCTAGTGATGCTTATTTCAAAATAAAAATGAGGCTGGGAATGTAACCCTG -0.28992886 6.64e-03 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.33901125 6.71e-03 0.99993
384071 CCCAAGTGAGAAAAATTACTCCAGATGAACACTCCTGAACACTCCAATAAAGTTTTATAT 0.54055669 6.73e-03 0.99993
77614 ACACAGAGACTGGAGGAATCATAGACTTAATGGAGATAGCCAAAGGCAAAACAGAGAGAC -0.68844742 6.75e-03 0.99993
100041550 GTTTCATGGTGACCTACATATCTACGTCTATACTCTGGTGTCAAATATCACTTAAATTGA -0.23471671 6.75e-03 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.33796251 6.77e-03 0.99993
65256 CCTGGACACACTGCCGCTTCCCGGCAGGCTAATCAGATACTTGAAATATGAGAATACACA 0.44946898 6.84e-03 0.99993
545156 GAGGTGATGCTCAGTGTCCCCAAGAAAGCCAACGATGCCATGCATGTCAGCATGCTGGAA -0.29033999 6.85e-03 0.99993
433171 CAACACAGTCTTGAGACTTCTCGAAGTTTGTGATACTGCTTTCTAATTTTTGACACAATA 0.23030391 6.87e-03 0.99993
65099 AAGGTATAAAAAGTGTGTTCTTTGTTTGTTCGGGGTCTCTGCTCTTGCCTGTGTGCTGGT -0.2661904 6.91e-03 0.99993
329509 TAATTTGTTCCAGCTAACCTAGTCAACTTGTACAGCCACCCATAGGGTCTGTTTTTATTC 0.41288554 6.96e-03 0.99993
66717 ATGGTATCCTACAGAGTTTTGATTCATTCTGCTGATTCCTACCCATCAGCTATGTAACTG -0.23316395 7.00e-03 0.99993
69310 TCAGATCCTGCCAATCCTGAACATCTTTAAGAACATGAATGTGAACTCCGGGGATGGCAT -0.6237122 7.05e-03 0.99993
68117 GTGAAAAATCACATAATGAACGGGTAACTGACAAAATGTGACTTGAAATTTTTCCACGAC 0.23566595 7.06e-03 0.99993
23970 TTGTTCCTAAGCTACAGAATGACCAAAAGCTGTCAAGTCCTTAATGTTTAGAAACTCCTT 0.28981383 7.15e-03 0.99993
214505 ACTGATAAAAAATAACTCCATGACTTCTGTAAACCATTGCATAAATGCTATTGTAAAAAA 1.02932385 7.17e-03 0.99993
212198 TATGCATCTGTCCTGAAGGAGTGCGAGGAGAAGCAGGGACTCAGAAGCACATAGAAGGAA -0.25750802 7.19e-03 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.30853272 7.29e-03 0.99993
109349 ATGGTTCAAGGCTGTTGATGGAGAAGTGGGCGGATGACAGCCGGGACTGTGGTCATCACT -0.26417781 7.36e-03 0.99993
17926 CAGTAAGACCCTGACCATCCCATTCACGAATCGCTACAAGTACAGCAGTATGATTGACTA -1.46605422 7.43e-03 0.99993
16774 AACTTTAAAACATGTTAAATTGCTACAGTTCATTGGGATTAAATAAATACAATGCACTCT 0.42781171 7.46e-03 0.99993
219140 GAGGGGAAAGAAACATCAGCTTATATAATGTATGTAAATTTGCTAAGCCACCCCATGTAC 0.4244366 7.50e-03 0.99993
17082 GCCATTGACTCCTTGTGTGTTTTCTTCATGTGTGTTTGAAGAGTTCTAGCTTATTAAAAA 0.62059185 7.53e-03 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.38048012 7.69e-03 0.99993
333789 AATTGTCTCTGGAGTAGATACAGGCACTTGTACCCAGACTGAACCCCAAGATTTTGCTCT -0.29191532 7.70e-03 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.30095156 7.72e-03 0.99993
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.68085548 7.75e-03 0.99993
72194 GGTGAGGATTGTTTTCAATAAATAAAATCCAAGGAGGCAGTAGACGATTCTTTTTGCTTT -0.20106257 7.77e-03 0.99993
108160 GGATGGTAGTTGCTATTCCTTGACCTGATGTTATCATTACTGATTTTCCCTTTTACAATA -0.21974419 7.77e-03 0.99993
16426 ACTATATTGTTCCCAGCTTGTTCTGAGTAGCATGTCAGCTGCTGATGAAGTAGAAGGCCT 0.371517 7.79e-03 0.99993
223254 CAAGGCAGGCTGACGTGTAACGACACCAGTGCCGCTCTCTTGATCTCACACATTGTACAG -0.32233243 7.79e-03 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.43876202 7.87e-03 0.99993
98741 ACTGCCAGCACAAACTACAAAGTGTATTGTTTAAGGGGGGAAAAAATCTAAATTTTGTTC -0.22669639 7.92e-03 0.99993
230145 TTGAAAACTTTAAAAATGTCTCCTGGCATCCTGCTTTCTGAGGGCAATCCTAAGATGTTG 0.32965388 7.98e-03 0.99993
381417 GGTGGAGGTGAGGGGAGATATTTTTAAAGTTATATTGGAAACATGTGTGAATTTAAAGAC 0.23523053 8.00e-03 0.99993
13417 TATGTCTCCTGCCTGATAGGTGCTTCATTACCCTCCCTCAATTAAACAGTTGACACTTCT -0.91038728 8.03e-03 0.99993
66832 CAGATGTGGTTTAAGGGCTTCTGCCTTTTTGTGACACAATAAATTATAAACCTGGAAAGA 0.24074219 8.08e-03 0.99993
104776 TCAGGATGAAGTGATAAGTTAGCTTTTAGTTACATGTGCCATTCTTCATGGTTTGCCTCG -0.26863373 8.20e-03 0.99993
15160 CAATCCCAACATGTCTGAGATGTTCGGACTTTTAAATTCATGTAAATATCTCCTCTTCTG 0.73876097 8.26e-03 0.99993
13346 CCCGGGATGGAGAGGTTGTCAGCGAGGCTACACAGCAACAACATGAAGTGCTGTAAGCCA 0.2189332 8.31e-03 0.99993
72154 CTCGCTTTGAACCAATACTGATATGTTCTCTTGGGTTATAATCATGCACATGAATACTTA 0.37550498 8.33e-03 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.30692549 8.38e-03 0.99993
73062 TTGCTTGTGGCACATGGGGCTGATCTGAATGGAAAATCTCTGGTGGACGAGACACCCCTC -0.19985213 8.46e-03 0.99993
67902 ATCCTGCAGACATGTCCCTGAAGAAGAACTGGATCTTATGAGGTCAATAAATCCTTTTTT -0.24041318 8.51e-03 0.99993
50794 GGCTGCGAGAAAGTTTACGGGAAATCTTCGCACCTCAAGGCGCACCTGAGAACTCACACA -0.26319573 8.64e-03 0.99993
71093 TCGTCCAAGGAAATTATGGATGAGGCCCCAACAGCACAAAACCACATCATTGCTGCCCTA -0.27376406 8.73e-03 0.99993
84652 CTTTAGTGAGCACGAGTTTACACTTGCACATTTGCTGCTGAGTGGTAGGACATTGGGAAA -0.23608507 8.73e-03 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.37948004 8.73e-03 0.99993
234290 CCATGTACTAAGGGAGAGTTGTTTTGGAATAAATTAACTGTCACGAAAAACTGTTAGGAG -0.48670778 8.89e-03 0.99993
14862 ATCGCAACACCTATATTTTCAAAGATGGCCCACTGGAGTAACAAGTAGGCCCTTGCTACA -0.25538628 8.96e-03 0.99993
13166 GGTGGTGACTTGTGTTAGTGTATGCCGTGACAACACTGCTTAAATATTCCTTTGCAGAGT -0.62165162 8.96e-03 0.99993
243923 ATTGACGACATGGAAATGAAAGTCAACGTGCCCCGCTGGACTGTACAGGCGCGACAAGCG -0.2009284 8.99e-03 0.99993
239985 GGAAAATCCAACCATGAAGACTTGAATTTAATTCAACAGGAAAGACCATCGAGTCTACCA 0.26144077 9.02e-03 0.99993
67092 CCTCTTTGGTAGACTTATGAATGTCCATATTACTTCTTTTTTCCTAAATGGGACAAAGAC 0.31269363 9.04e-03 0.99993
320566 GCTCATTGGAGAAAACAATATCCCGCAGTATTGTTGGACTCTTTGCATTGTATTATAATA 0.2491824 9.07e-03 0.99993
414095 GCCACCTCTGAATGCTGTGATACAGTGGTAACATGGGAAAATAAAGTCTAGCTATTAGGA 0.44393159 9.20e-03 0.99993
13131 AAGCTGTGTACCAGACCATTTTGGAAGAGGATGTGGAAGATCCCGTGTACCAGGTAATTT -0.2738848 9.23e-03 0.99993
76921 GTTCTCTGCGCAATGTTTCCTATAAGGATAAAGACAATATTAAGATGAAGATGAACCATC -0.27065418 9.25e-03 0.99993
71768 TGATCCCATCAGCGCATACTCTTGACATTGACGTCATGTGACATCCATCCTAGAAGTGTT -0.2170328 9.26e-03 0.99993
216963 TGTCAGAACGTGTGTCATGTACATTTGTATCAAAAATAAATAAGTGACCATGTGCCACTT -0.22546596 9.32e-03 0.99993
380730 GAGTGAAGTAGCCGAAACCCCACGGTGATCTGCTATCATTTATTAATAAATTATTTTTTG -0.25173208 9.36e-03 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.30068977 9.39e-03 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.47518555 9.48e-03 0.99993
12936 AGTTTATCTGATTCAAGGGACAGAGAGGATCAATTGCAGTCTGCAGAGGATTCCTCTGGA -0.25650058 9.51e-03 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.35430284 9.58e-03 0.99993
382045 ATCCACAGCGAGGACAATAGTAGTAACTCTTTGGAAGATTCAATAAAAGAAAGAATTCAC 1.41185165 9.60e-03 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.30365802 9.64e-03 0.99993
16898 CAAGACTTACAGGTACCTGACTCTCGACCTCTGGAAAGAGACTGTGTTCACCAAGTCTCC 0.49379203 9.65e-03 0.99993
16179 TTGGATTTAGAACCTGAAAAGAGCCAGGGACCTGAAGAAAGTGATGAATTCCAGAGCTGA -0.2328625 9.67e-03 0.99993
68278 CTCTTTCTAGGTGACAAATCGATGTCTCTTTTTATTGTTCCAAAGCTTTAGTGATGTAAG 0.1954282 9.72e-03 0.99993
11799 TCTTGAAACTGGACAGACAGAGAGCCAAGAACAAAATTGTATGTATGATTGAGAATAAGG 0.42322694 9.74e-03 0.99993
66832 CAGCATTTTGCAGCCAGTTGAAGAACCTATGAGTTACGGGAACATCATGTATGACAGAAG 0.49880199 9.78e-03 0.99993
74570 GAACTTTGATTTGACCAGCCTCTGAAGAGTCCAGATGTTTAGTAGATGTTCAATAAATAA -0.20588768 9.78e-03 0.99993
216974 TGCCCAACCCCAATCTCAGCTGAGGCAAACAGAGTGAATAATAAATCAAGCCTGTAACTG 0.32468906 9.84e-03 0.99993
252876 TCTGATAAATACAGAGCTCAGTGTTGCTTAAGAGGTACTGGCCATCTCACCTGTGGAGTA 0.19466582 9.88e-03 0.99993
15260 TTATGCTCGGTACCTTGTGAATGAAGGGTTTGAATACCGCCTCCGTGAAATATGCAAGGA -0.25444575 9.88e-03 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.18696313 9.89e-03 0.99993
170677 TGTAATAATCTTGAGGAGGGATATCCTGCAAAGCAGAGGATTTTGGTGTTCTTTTGAGAA 0.35626841 9.90e-03 0.99993
14813 ATTGGTTGGAATTTCTTTTCATAGGAACATTGGGACATTAAAGCAACGTTTTACAACCCA -0.35349983 1.01e-02 0.99993
217124 TATATAATATATATATGTATGTATTGTTCCTGGTTTTGTACGGACCATGCCCTCTGTCAG -0.1858599 1.01e-02 0.99993
239857 CTGTGCTGCAAAGAAGATCCAAATGAAGCATATCGCACAGAAAACAAACACAATTATTAA -0.26166075 1.01e-02 0.99993
104582 GCTCATCAAGTCCGAGAGCATGATCAACTTTCTGATGCAGGAGCGCAGGCCCTCCAAGGA -0.38372085 1.01e-02 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.46481844 1.02e-02 0.99993
223693 AATACTTGAAAATTGTATGATGTATGAGAAGACAGAGCCCCCTAGTTTTGTATTTTGTCC 0.29501718 1.02e-02 0.99993
12578 GGCATGAGAAACTGAGCGAAGGCGGCCGCGAAGGGAATAATGGCTGGATTGTTTAAAAAA -0.34553673 1.02e-02 0.99993
13199 TGAGCGCTTTCTGCCTCCCATTCTTTTGTCCCTAGGATTTTGTGAATAAGCGAGTAGAGA -0.46527355 1.04e-02 0.99993
74626 CTGGCTACCTAGGAAGCTAAGCTAGATTGTATGTGTGCCTCTGATGGTGAAGTGTCAAAA -0.22004057 1.05e-02 0.99993
384752 AAACCTGCTTGAGCATCAGAAGCTGTGTACAAACAGAAGCAGAAAACAAGGGTGGTCATC 0.19829217 1.05e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.48939741 1.05e-02 0.99993
171226 CCCATTTGTGATGAGTCATGATTTTACTGCTTCTAGATGTTGCTTTACCTGGATAAAAAT 0.20459422 1.06e-02 0.99993
228139 ATTTGCTTCCCTGGGTCCCAAGCATCCATCCATTTCCAAAGGATAGAGAAAATGGTAGCT -0.19617886 1.07e-02 0.99993
100041121 ATTGGCTTCCTCATGAAACTGATCCATATCCCTATTAATAACAATTCTGTGGGTGGCTGA -0.2616107 1.08e-02 0.99993
328265 TTGGGTCATTTTTGAGGTTTTTCTTTTTCTCTGGTGTTAAGAATGCCACAGGACTGTTAT 0.25759901 1.08e-02 0.99993
216454 ACATGGGGGACATGGGACCACAGGAATCTGCTATGCTTAAATGATCATTACCATTGTTGG 0.22138883 1.08e-02 0.99993
13537 GTGGGCATCTCGCTGTAATTGGTGCTGAAAAGTTATTTGTGTTCAACTGACATTTAACGC 0.71864384 1.09e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.33934166 1.09e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.43285081 1.10e-02 0.99993
14345 ATGTTAATGAGATATTGGCCAGGCGTCTTAGTATTGTCGGAAGTCTACACTGGGTAGCAG 0.41336875 1.10e-02 0.99993
240754 TATGGGGATGTTGGGGATAAAAAGGCACATAGCACTTAGAGTGGAAGCATGACGTGATAG 0.44117681 1.10e-02 0.99993
54006 CTCTTGCAGGGAAGCTGCTGTGACCCAGGCGAGAATGCAGGTTGATACAGAGAGGAAAGA -0.32633324 1.10e-02 0.99993
402728 TCATCATGACCTTCCATTCCAGTACAAGAACTTTCTGGCCTCAGCTTAGAGTGAACACGT -0.42907779 1.10e-02 0.99993
18682 TAGCCCAGCCCGGGAAGTCTAGTGATGCTTATTTCAAAATAAAAATGAGGCTGGGAATGT -0.42002315 1.11e-02 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.19238186 1.12e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.43095257 1.12e-02 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.36200919 1.13e-02 0.99993
11459 ACATCGACATCAGGAAGGACCTGTACGCCAACAACGTCATGTCAGGGGGCACCACCATGT -0.23713632 1.13e-02 0.99993
66789 TTGTTTGACGAATGGCAACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACT 0.23748848 1.14e-02 0.99993
109801 ATTCTCAGAGGTGATTTGAAGACTCAACAACTGGAGGACAAAACCCAATCTGAGGTCAGA -1.06778414 1.14e-02 0.99993
234384 AGATGAGTTGGCCGATGGATACACTCCCACAGGAGATTACCGAAGCTGGTCAAAAAGCTC -0.21133582 1.15e-02 0.99993
67374 CTAAAGTCTGAAGTCTTAAATTGTTCAAGGCAATCGCTTAACTGTCAACCCTTATGTAAT 0.29362578 1.15e-02 0.99993
12496 AGAAAGGCAAGCACCAGAGACTACAGGCTAGGAGTCAGCTCCATGCCTACTTGTAAAAAA -0.44182917 1.15e-02 0.99993
192216 AAATTTTGCAGCAAACAATGTCCATATGTAACAAGCTTATTCTTCTACACCACAAGCCAT -0.33306004 1.15e-02 0.99993
14559 GACCGCCCCACGCAAAAGCAGGGACTGTTTGTTCATGTTTTATTGGTGACAAAAAGCTTA -0.25262471 1.17e-02 0.99993
214505 GGCCAGCCTTTGTTGTGCCCAAAGATCCAGACAAAATAAAGATTCAAAGTTTTAATTAAT 0.3092703 1.19e-02 0.99993
104015 CTGTACATATCTTGTGAGATGTGCTGTCATATGAAATAAATATGTCTTTATCACCAGCTG 0.38895103 1.19e-02 0.99993
434234 CAGATAGCTTTGGGATACCCTCTAAAGTATATTGTCATGTTCAAAATTCCAATAAATGCC 0.37027526 1.20e-02 0.99993
69239 TAGCATTTCTTTCTGCTGTCCTGAGACACAGGGATCAAATGAATCTATTCCTTATGTTTT 0.96614556 1.20e-02 0.99993
52830 TGTGTTTTCTCAATTAAGTTCAGAGCAAGAGTTCAAGTCAAACATTGAGTATCCTAAAGG -0.300949 1.20e-02 0.99993
13841 TGGCCATCAAAAGAAGATCATGAGCAGCATCCAGACTATGCGGGCACAAATGTTGCATTT -0.51355564 1.20e-02 0.99993
67307 GTTTAGGAAACAAATCCTTTGTATTTTGAACTCAGCTAGGAGTAACAATCAGGACAAACC 0.2666655 1.22e-02 0.99993
20300 GATCTACTATCAGCAAACAGAAAGTGTCTTCTCATACCACTTACTATTTGCTCTCTCTCC 0.19601082 1.22e-02 0.99993
244550 GGGTAGGTGGCCAAGTAGCCCTGGCCTAAGCTCTGAGACTGTGGACTAAGAAAGCTCTCA 0.70474766 1.22e-02 0.99993
114661 GGGGTTGGGCTGCTGTATTGGGGTGTGGCTGTATTTGTCTCAATAAACTGGCAGTAAACG -0.23391977 1.23e-02 0.99993
100042092 CCCAATGACGGTGATGTATAATGCTCAAGTATTCTCCTGCTTTTTTACCACTAACTGGGA -0.30359696 1.23e-02 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.18314671 1.23e-02 0.99993
18783 CCCATTGTGTGTGAATGTTATTCTGAACTAGATTTGTTCATGCCATGTTACAACACTATT 0.4077337 1.23e-02 0.99993
13345 TTATTGAGATATTTTACCAGCTAAGTGACTGCCACGCGGTTGTGTATAACGCTCCACACC -0.69350413 1.23e-02 0.99993
432460 TAACTAGTATGGCTTCCTGTGAGCTAGAGGAGACCCATAGAGAACAAGGCAGATACAGAA 0.21904585 1.24e-02 0.99993
67873 CCACGAACTCATCACAGGTGGCATCATCACTGAACTGGGTGTCTTTGCCCCTGAGGAGCT -0.61119183 1.24e-02 0.99993
71833 CAGTGGGCCTCCACTCAGCCTGACTGGATCGCTATCTGCTACAACAACTGCCTGGAGATA -0.23547214 1.25e-02 0.99993
77647 TGGATGCCAACGTTTCTCAGATCAATATGGTAGAAAGTTTCCCACCAGATAACCAGGTAG 0.34325169 1.25e-02 0.99993
258951 GGCTCTGTGTTCTTCTAGTAGTAATATCATGGGCCTTATCTTTAACCAATGCTCTTGCGC -0.99529158 1.25e-02 0.99993
17355 ACTAAGTGCTGTCTTAGAAAAGGTAATTGACTTGTTCATCTTCACAATCTTTCCTTTCCA 0.26348912 1.25e-02 0.99993
234686 GGACACTGAAGAGTGGACTTGGAGATGACCTGGTGCAGGCACTGGGACTAAGCAAAGCTC 0.42726741 1.25e-02 0.99993
14261 AACTCAGCCATCTTTGATGCTGTCATGGTCTGCACTGGTTTTCTAACTAACCCACATCTG 0.24246811 1.26e-02 0.99993
230935 TAAAAGCAGTTCGATTCTGTAATATTTATTTTTCTTTTTGAGGATGTTTCGTTGCCCCGC -0.18794428 1.26e-02 0.99993
66522 ACAGAACAGCGTAACTTATGTTCCCATTGTTAAGACTTCAGGCCTAACCAACAAGTGTCT -0.3761983 1.26e-02 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.36577445 1.26e-02 0.99993
620376 AATACCGAAGCACTGCAATTTCTTGAGGATTATCCACCTAGGAGGAAATGATACGCTGGC -0.44184688 1.26e-02 0.99993
216558 GATATCATGTCATTAGAAGTTACCTCTCATTACAGCTTCAGTTCTTAACACTCTGTTGCC -0.23554627 1.27e-02 0.99993
15006 ATTCACTGAACACATCTTTACAGAGTTGTAATGTTTGCCTGATTTTTGTGCTTTCCTGTG 0.31391677 1.27e-02 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.30585277 1.28e-02 0.99993
545156 CGCTTTAAAGGAGCCAATTCAGCTCCCCAAAACACCAGCCAAACTGAGGAACAATAGTAA -0.31297298 1.28e-02 0.99993
266645 TAAAAGGAATGTCATCTATACGTTTCCCTTTAGCAGAGCAGGAGGCAGAGTTAACTCTGG -0.17552267 1.28e-02 0.99993
64406 CAGAGCTACAGCATGGTACGTTTCTGTAAAGCGAACAGCAGTTGGCAGCGTGAAAATAAA 0.40024482 1.28e-02 0.99993
56790 AGGAGCAGGGTTCTGAACAAGGGTTAACTGCGCAGGAACAGGCCTTAACTGCTCAGCAAG 0.21164779 1.29e-02 0.99993
75695 ATGACCAACCTCAACCACAAGGACGTGGGCTTCTCCGAGGAGGAGTTCCAGAAGCAGGAA -0.38542749 1.30e-02 0.99993
243961 TTCTCTGACACTTAGCACACCCCTCACACTCATGGCCCTGAACTCTTTCCAAATGTTTAA -0.46941687 1.30e-02 0.99993
15896 GCAGCAGATGCGGGGGACATTTCCTCTCCTTTTTAGCCTCAATACAAATATCTGGATTTC 0.38394654 1.30e-02 0.99993
67382 CTCTGGTAATCATGAACCTTTCTCCTAGGGTGTTTGTTTTGTTTTCATAATAAAAAGGGA -0.17488335 1.31e-02 0.99993
50914 CGTAGCGCAGGCTTATAAAATTCGGTCATTAACGTTCTCATTAAAGTAAGCGGAGTTGGG 0.39519782 1.32e-02 0.99993
228545 TACTGTGGGGAGCTGATGATTCGGTCTATCGACCGGCCCTTCATTGATCCGCAGCGCTAT -0.22819469 1.33e-02 0.99993
21954 GTGGACAAAGTGGATGAAGAGAGATATGACGTGGAAGCAAAAGTCACCAAGAACATCACT 0.47020521 1.34e-02 0.99993
230815 CACCACCCAACTCTCCGGAATGAATACTGTTATATTTTCTTCTAGACCTTTTTCTATAAA -0.3169263 1.34e-02 0.99993
27421 GTGTGCACATATTCCCTAACTCCTTATTTTGAAGTCATTGTAGATTTCAGTCACAGTTTT -0.32617503 1.34e-02 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.34335122 1.35e-02 0.99993
75956 ACTCTCCTGGTCACAAGAGGAAGGAGACACCTAGTCCCCGTTCTAATCGTCACCGCTCCT -0.57988732 1.35e-02 0.99993
12876 AGAGACTCTCAAAAGCTACTGGGAAGATAACAAAAACTCCCTCATCAGCTACCTGGAGCA -0.36131652 1.36e-02 0.99993
620913 TAAAATGCTGTTGGCCAATGAGCAAAAGGCAGGAAGTAATAAATGAGAGTTTCAGTAGGA 0.39552583 1.37e-02 0.99993
14919 TTTGGCATGTTTGACTCTGGCTGTCTTCTGTCATTGACAGAATTCTGTCACCCAGACTCT -0.20636821 1.37e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.50387103 1.37e-02 0.99993
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.22325702 1.38e-02 0.99993
74202 CTGCATACCAAGATACACGTTTGTGCACACACATCTAATAGAGATAAAATGTAAAGTAGA 1.00615059 1.38e-02 0.99993
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.24588348 1.38e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.31893767 1.39e-02 0.99993
625353 GAATCTCTCACAGCACCTTGGGATTAAGGTGAAGTTAGGAAAGTTCAGCCAATATGTTTC -0.35349408 1.39e-02 0.99993
70458 CCAGTAATCTCTTCCCAACAGACCATGCCCCAGGACTGAATAAAGTTCATCCTGGTGTTG 0.51195361 1.39e-02 0.99993
67753 CAGAGAAATATATCTACATTTCTACGTCCTATATCTACATTGTCTGACATCCTAAGGACA 0.49910156 1.39e-02 0.99993
242894 GTGGAGGAACCCTGGCCTTCCCAGCCTATTTTTGTAAATAAAATGTTATAAACTTGAAAT -0.2074453 1.40e-02 0.99993
319615 CTTTACCAAGATAACTTCAGGGATACACATGTTAAGTCATCAGATGTAAACAGACATGAA -0.33244328 1.40e-02 0.99993
75234 GTTAATGGACTTGGCGTCTCAGTAAGAAAGTGTCCTAGAGATGTCCCGGTGCGACTAAAG 0.31353723 1.41e-02 0.99993
13638 CGTTACAGCGCCTTCTCGCTGGGCTATGAATTCCATGCCGGCCAAGAATACTACTACATC -0.2875447 1.42e-02 0.99993
239857 ATTTGCGGGGAAGAAGGATGATTGAATACAACATCCTATGCTAATAACAACACGAGGACA -0.23451503 1.42e-02 0.99993
26426 TGGGCAATGGCTGGACTATGCGATTACATCCATGCAGAGATCTGCAGGCCCCCATGTCCT -0.23554704 1.42e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.44784298 1.42e-02 0.99993
242736 ATCTAAGCCTAGCCATTGCGATCCTCTGTATAATCTGGTTGCAATAAAGAATTTTGGTTC 0.16713387 1.43e-02 0.99993
18508 CCGTCCAAGTTCCCGGGAGTGAACCTGACATGTCTCAGTACTGGCCTCGATTACAGTAAA -0.28768787 1.43e-02 0.99993
381622 ATTTGGACAAAATGCGGTAGAGGGAAAGTTGTGGATTGAAGTTTGTGTGTTCTGCTCCCT -0.21285768 1.43e-02 0.99993
240641 GCACAGCCAAATAAATTGCATTGGGAGACTGTTTCAGTGTAAAGTTTATATTCATTGTCA 0.26409034 1.43e-02 0.99993
29819 CAACACTATTCTAACACAGGAGATAATGTACTTGGTACTGTTTATTCAACTGGGGGAAAA -0.34175965 1.43e-02 0.99993
381838 CCACAAATCTTGAACTCATTCACTTGCTTCATTTCCTCTCACAGAATTAAACTCTCTAAT -0.31512076 1.43e-02 0.99993
12167 ATCATGGCTTTCTGAGGAGGAGAAACTGTTTGGGTAACTTGTTCAAGATATGATGCATGT -0.21060115 1.44e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.25323594 1.44e-02 0.99993
67768 CAGAGGAATTTTTTGTGTTTATCTTCCTACTAAATTGCTCAGTGATCATGGATATCACCA 0.30277271 1.44e-02 0.99993
213084 ATTTTCCCAAATGCGACAGGAAAGAATTCCATTTCCCTGAACTGCCATTCACAGTGCAGG 0.2361212 1.45e-02 0.99993
53318 CCCAGCCATCTGATATGTAAATACCTGGATATTTGGGGGAGTCTACTTGTTTTTCCTTCC 0.56435366 1.45e-02 0.99993
70536 GAACTGTAGAATTCTATGATGCCTTCACTAATTTTCCTCTAGAGATGAGAAAGAAACATG 0.30582472 1.46e-02 0.99993
170442 CTTCGTATTCTGAGACAGAGAGTCACGAATGGGAACTGAATCTCCTGGCCTTAGACTTTA 0.47345848 1.47e-02 0.99993
108995 CCAGCCCCAGGCATGTATCCTCTATTGCTGTGCTATGTGACAATGCTGTTTCCAGCAAGG 0.71951511 1.48e-02 0.99993
26378 GAATAACCCGATCATGCATAGCTGAAACTTGCTTACAGTATCTGAGGAATTCCTATGGTT -0.53448325 1.48e-02 0.99993
14559 AGTCTCTTGTCCTCAACTTCAGCCATCCAGGACTCTATCCCATCCTACCTGGGATACTGA -0.20883592 1.48e-02 0.99993
93878 GTACTAAGCATAGTTCATGTTTTTTCCTCCACCTATGAATGATTTTGGTGATTAGTACTC -0.37884192 1.48e-02 0.99993
228875 TATAGTTGAAATAATGATTTCCTCTCCACAGCCCAGTGTTGCCTAAGGCATGAGAGCAGG -0.18124339 1.48e-02 0.99993
16653 AATCCCGTTTCATGTCTTCATGTTGAAACACTTCTGCATTTTTATTTGAGTGCCAATTTC -0.20331522 1.48e-02 0.99993
22423 GTGGAGACAACTAACAACACACAAGCATCCTTCAGTTCACGGCTTCATGTCCTACACTAA 0.32753534 1.49e-02 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.33594937 1.49e-02 0.99993
80334 TGAGTTCATTGAAAGTTGCCAAAAAGATGAAAACATAATGCGCTCCATGCAGCTCTTTGA -0.2746046 1.49e-02 0.99993
78479 GATGGCTTCCTGTGAAATTCATGCACCATGCGGAACATGCATAGAAGAGTATACTAGTAG 0.22391218 1.50e-02 0.99993
100042092 GTACAGGGCGTCAATAATAAAAAGAGAGCAGCGTTGGGGGATAATGTCGACATTTCCACT -0.29003178 1.50e-02 0.99993
242785 ATGTTAGGACAAAACTTAAGTTATGAGAGAAGTTCTGTGCCTAGTATTGATCTATAAGGG -0.25613369 1.51e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.3575408 1.52e-02 0.99993
64009 GATTGATGACATTGTGTGTTGTGTATCTGACTTACAGATTCAAAGTCAATATTGTGTGCA -0.5113403 1.52e-02 0.99993
56695 AGTTTGCCAAAAACCTTCATTCCCACGTCATTTCCCACTGGATCCCAGGGCCCTCTTGTT -0.23950199 1.52e-02 0.99993
108800 AACTTTAAAAAGAATGTGCCTATGTAATAAAAAGCCTACACACTGGCAATTTCTGCAGAG -0.28146633 1.53e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.30518099 1.56e-02 0.99993
12503 GACCCCAACCAGCTCTACAATGAGCTCAATCTAGGGCGAAGAGAGGAATATGACGTCTTG 0.27282278 1.57e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.38641571 1.57e-02 0.99993
406223 TCTTGAGTGTCAACATATACCTTGATGTGGAAATCACCACTTACAGGAAGCTGCTGGAGG -0.24299512 1.57e-02 0.99993
12322 TTGTTTGTTTTTGTTTGTTTCAAATCTCCCCTGTTGCAAAATAAAAGTCCTGGTCCTATG -0.38479674 1.57e-02 0.99993
105364 CCTGGGGAAAACAATGCTATTCTTACTGAAACAAAAATCACCTTTTCAGTAAAGAGAAAC -0.2765425 1.58e-02 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.29129284 1.58e-02 0.99993
67555 GAGACTACATTATTTATTTTTTAAATTAAGCCTTCAATAATAAAGTGAGTATACAAATTT -0.23120511 1.59e-02 0.99993
224671 TCAGAGTGATCGATCACTCACATTACCTGTGTCGGTCTTGGCAAAAGTTGTATTTCCCAG -1.77337783 1.60e-02 0.99993
73430 ATGAATTAGACAGCTGCTTAGAAGGTTGCCTTTTTCACCCAGTTTACACTATCTATTAGG -0.17243576 1.60e-02 0.99993
20962 AGAATGTTTGCAATGAAACAGATACACGAGCAGTTCATAAAGAGTTTGGAAGATGTGGAA 0.37972995 1.60e-02 0.99993
266781 CTAACACTCCATGGGTTGTTTCTGGCTTTTGAGGAACTCCAGCACTCCATGGGTTGTTTC -0.19973049 1.60e-02 0.99993
170763 TGCCCGGAGTTGTTGGCTCTATTTGGAGAGATTTAGAAGTAGGTCACTAGATGGTGAACT -0.22496767 1.61e-02 0.99993
75740 TGGAATGCAGTGCCAAAAATGGTAGTTGCACCTGCAAATCTGGTTACCAAGGCAACAGAT -0.40785594 1.61e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.38368505 1.62e-02 0.99993
20856 AAGCAGTGAGTGGGAAGATGAACAGTCTGAGTATTCCGACATCCGGAGGTGAAATGAAAA 0.27643589 1.62e-02 0.99993
243374 GTCTTGGACTGCCTAAACCTTTGTATTTGTATTCTTTATAGCCACTCTGATTAAATCTCT 0.78789486 1.62e-02 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.34263459 1.62e-02 0.99993
238317 CAGTGCTCACATGAAGAGTCACGCAGAGCAAGAGAAGAAGGCCGCAGCTCTGAGGCTGAA -0.22660387 1.62e-02 0.99993
223254 TGACTAGTGTCAGAGATTCACATGGATAAGGAGTAAGATGTATCAATCATTTGCCTTACA -0.36001834 1.63e-02 0.99993
21753 CCATCCTTGGGTGTTTTTAATGTTTTCCCTTGTATGCATTCATACATAACTATGCACTAT 0.68356732 1.63e-02 0.99993
58238 AAGGGTCAAGAGTAAGACAGCTTTTACTGTCTCATCTCAGTTCAGCCAAGGTCAGTGTGT -0.26929351 1.64e-02 0.99993
239985 AGCTCTCTGAAAAAGCAGTATATTCAGTACCTGTTCGCCTTTGAGTGCAAAACTGAGCGC 0.34123193 1.64e-02 0.99993
100040044 TTCAGTTCCACTTTTAGCCACTACTCTTTATGTCATGGGGTCACATCAACGCTATGGCTG 0.3140832 1.65e-02 0.99993
11857 AGCTCTCCTTTTGTGGGAGACACTGTAAACAACACCAAAGGAAAAGAATAAAATCGTTGT 0.83051436 1.65e-02 0.99993
233210 ACCGAAAGACACTCAGCAAGCTCAAGAGAAGTGTTGTGCGGGCCCAGGAATTCAAGGTGG -0.17289904 1.65e-02 0.99993
353235 TGTCAACGTGTACCTGATCATCGCCATCTGTGCAGTGTCCAGCCTGTTGGTGCTCACGCT -0.29240256 1.65e-02 0.99993
103551 GTTTTGGAGTTTCCCTTTGCCGGAAGGTTGGATGAAGGAAAGAGACCTCCAGCCTCAGCG -0.32592268 1.65e-02 0.99993
20962 GAAAGTCTCTTCAATCCATGTTATTCTGATGAGTCTTTGAAGAAAGAACTTGAACCTATG 0.50925068 1.65e-02 0.99993
53970 CAGAAGATAAAATTCCTCCTGTCACTTCAAAAGTGAGTGTTATCAAGGGCAGAATTCAAA -0.18754733 1.66e-02 0.99993
239554 CATGGAGAGTCCCAGTATGGGCAACTTAAAAAGATCCTCTCTCAAAGAAACTTTAAAAGG -0.1877682 1.66e-02 0.99993
402757 TCTGTCTGAAGGACTTTCTACTACTGTTGCCTTTGCCGTAGCAAAAACAGATTATTTTTT -0.47087222 1.66e-02 0.99993
20511 AAGCAACTCTAATCAGTGTGTCTATGCCGCACACAACTCTGTCGTAATAGATGAGTGCAA -0.34221238 1.66e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.41652497 1.66e-02 0.99993
503845 TACCCAATGCAGATACCAACCAAGAAGATCAGTGGAGTACTACACAGTTGCCTGTAATCC 0.54554919 1.67e-02 0.99993
231832 GGGCCAACAGTCTGTGATCTTGATCTTTTCTCAATAATTTATAACATGGTAGGGAAAAAA -0.37792698 1.67e-02 0.99993
14260 TGGCTGGTGTCTGAGGAAGCTTCCGAAAAAGGCTTGGGGCCAGAGAAGATCACAGCTCCA -0.29845514 1.67e-02 0.99993
11656 TTTGGGAACATGGGACCCCAATATGTTACCACCTATGCTTAAGGAGCCAGCTGCCTTGGA 0.41204225 1.68e-02 0.99993
26401 CTTCCAGGGCTTAAGGGCTAACTCCTATTAGCACCTTACTATGTAAGCAAATGCTACAAA 0.23343709 1.68e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.40553133 1.69e-02 0.99993
100038601 GACAGCGCAAACGGAAATATACCCAGCCTCCTAAAAGGGTGATTAAACATTTAAAATATC 0.30657363 1.69e-02 0.99993
94254 TCCAGGTAACACATGGTAGCATCTGGGGATGTGTCTTGTCTGAGACACTATTCTTAGAGA -0.20104799 1.69e-02 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.35692031 1.69e-02 0.99993
16847 TTGGGACGATGTTCCAAACCCCAAGAATTGTTCCTGGGCACAAGGACTGAATTTCCAAAA 0.25304808 1.69e-02 0.99993
23972 ATAACTGTTTCAGTGTCCCGCTGGTACCTGTTCTTATTCAATAAATCTCTCAAAAGACCA -0.18099541 1.70e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.23929597 1.70e-02 0.99993
70060 TACCTCGGGACTGGTCATCCATGCCAGGGAGAGGAGTCCCAAACCTTCTCACCTTCTACA -0.2961956 1.70e-02 0.99993
207181 GCTCTCTGTAGATCAGTGGATATTAGGTTTCAATTTCTGTTTTCTTTGATGAAGCTTTCA 0.38731722 1.70e-02 0.99993
76483 GGAGTGGCCACTACCAGAACCCCCATCTAGACACACACGCTGAAATAAAGACCAGAGACC 0.21627979 1.71e-02 0.99993
79059 TGAGGCCGAGCTTCTGTGCTGGGAGGACAGCGCCGGACATTGGCTATATGAGTAGATGTT -0.21876356 1.72e-02 0.99993
71833 CAACTAGATTAGGTAAGACTCTTGCTATCTCTGCCTCCAAGTACGTGTGTACCCACAGTT -0.24042465 1.72e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.29960237 1.73e-02 0.99993
217216 CCAGGGTGACTGTGAGGTGCAGGCTGCTGTACCTGGTTCTGAAATAAAGCGTCCCTTCCT 0.32284413 1.73e-02 0.99993
243529 CACCTACCTCAAGTACTCTATCCGGGCGCTGGTGCAGAACGATACGCTACTGCAGGTGAA -0.21674799 1.74e-02 0.99993
101187 CGAATTAAAAGGATTCAAAGGATCCAAAACTTAGACTTATGGGAGTTCTTTTGCAGGTAA 0.34222704 1.74e-02 0.99993
194227 CCATGATACCTGTGTGGCCCTTCCCATACCTTTCTTTAGGAAAGCAGATAAATAATTGCA 0.38729656 1.74e-02 0.99993
235611 TCTTCAAGATCGCAGGAGCCATTTTGGTTTTCATGCCAGGGGTAATCACAGTGACTATTT -0.28721324 1.75e-02 0.99993
110891 CTTGATGTCCCTTCTCTGTGGTTTCTGTAAAAAACTGCCATAAAACTTTGAAATTCTGCC -0.32313892 1.76e-02 0.99993
98878 CGGGAGGTCTTGACTTTCCTCCTAGTTGTCTTCTGCTTTCTCTGCACAGTTGTCATATAT 0.43731202 1.76e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.39759024 1.77e-02 0.99993
223843 ACCATTTGACGGGAACATACTCCGTGTACATCTAAAAGAACCCTTAGCCAGTAACACTTG -0.36349623 1.78e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.34506785 1.78e-02 0.99993
67454 TCTAAATCATGGCACAGGACTTCATATTGTTGTGCTTTATGGCAAATTCCCAGTATTATA -0.42506781 1.79e-02 0.99993
69698 TTTATTCTTAAAGTAGGGCTGGAGAGATTGTCCAGCTGTTTAAGGCAAAGTCCCATGACC 0.30645659 1.79e-02 0.99993
30878 GTCCTTTGGCATCTGTTCGAATGTCCTCATTTTTCTGGCAGTGTCACTTAAAGGATTTTT 0.56052531 1.80e-02 0.99993
117174 TGAAGTAGGCAGTATGTTGGATAAATCTGGAGGTATGTGTTTTAGAAATATTTCCCTGTT -0.30090349 1.81e-02 0.99993
434215 CCCTGGGACCCGCTCTTTGTATAACTCACATGAATGTATTAAAGTATAATTTTGGAGAAA 0.50416993 1.81e-02 0.99993
110542 ATGAGTAGCTTGTTTGAACTCTCTGTACAGGCCGACATGCGTGTGGCCGACATGCCTACT 0.27632925 1.81e-02 0.99993
328365 CACTCTTAATATAGATTGAACCAGAAAGGTGACCCCTAGCTGTTGACTTATTGTCACCCT -0.22207232 1.81e-02 0.99993
30841 TGTCCAATTTGGGCAAGTGGAAGAGAAACTCCTGCAAAAACTAAGTTAGTTCCAGGACAA -0.20327522 1.81e-02 0.99993
13449 TATAGATGTTTTGTTCCTGGGACAACCCTGGCTTCTGGTTAGCAGCGAGAGTAGCTGTTG 0.67188363 1.82e-02 0.99993
109222 ACATAGCAGATGGATCAACAATTGCTTTGGGAAAAGGTTTCGTCTTTTTTGTTTTGAGTT -0.41381815 1.82e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.31401124 1.83e-02 0.99993
74365 ACAAAAATAGTTCCAGCTCATCTACGTTGTAATCGCGATGTGATATAGATGGTCTCTGTG -0.31684485 1.83e-02 0.99993
236312 ATGTGGAGGCTGAAATGCAGGCTGAATGCAGTTGTGGAGACTAATGTCTTCAGAAGTGAT 0.61278144 1.83e-02 0.99993
230904 GGATCCCGCGCTCCTAGCATTGTGCCTGCCTCAAAGTGGGCACTCAATAAATATTTGTCC -0.26310042 1.83e-02 0.99993
17751 ACACAGCCTATGTAAATAGTGCTGGGTGTCCCTGGTGGGGCACAACTGTTGTCTTCCCCC -0.37632239 1.83e-02 0.99993
216011 CCTATGCTGTATAATGAGAGCCTATCTCAGTGCAACAAAAGCAGACAAAGTAAAAGAAGA -0.28104341 1.84e-02 0.99993
65255 GCTTTGCACTTCTGCACCACACCGAGCTCCATCCTCTGTGCCAAGCAGTTGGTGTTGAGA 0.19226386 1.84e-02 0.99993
625638 CCCAAAGATCTATGTCATCTACTGATCATTGTAAATAAAGTAAATCTGCTTTTTCAGGCC -0.23591711 1.84e-02 0.99993
12962 TTTGAGAACCCAGCCTTCAGTGGGCGCAAGATGGAGATCGTAGATGACGATGTGCCCAGC -0.33120009 1.85e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.38529536 1.86e-02 0.99993
504193 ATAAGCTGGTAGAGGCCTTTGGAGGTGCGAAGAAGGCCGCCTTTGATGTGTGCAAGGGGA -0.47083559 1.86e-02 0.99993
14687 TCATCTGCCCGTCACACCAGCCCACGTTTGAGCATCCCTCGTTGTGACCATTCTGTTTGG -0.21042101 1.86e-02 0.99993
21849 GTTCAAACAGTTCAACAAGCTGACTGAGGACAAGGCAGATGTTCAGTCCATCATCGGCTT -0.17617785 1.86e-02 0.99993
14866 TCTCACCTATGATGTCTTGGATCAGAACCGTATATTTGAGCCCAAGTGTCTGGATGAGTT -0.25783935 1.86e-02 0.99993
56760 CATTCCGTTGGATTGGATTATCACGCCAGAACTCTAAGAAAGACTGGATGTGGGAGGATA 0.26301959 1.87e-02 0.99993
56173 TTTGAAATCGGCCAGGCCCTGTACATGGGCTTCATCTCCTCATCCCTGTCTCTCATCGGG 0.23572981 1.87e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.27603779 1.87e-02 0.99993
271697 GAAGCGCTCGTTCATGATTATTTCAGTGTCTTGCCATCCCAGTTGTACCAGCTTCCTGAT -0.25663083 1.87e-02 0.99993
93709 AACTTTGTAGGTGTTGATGGGGTGCATGCATTTCTACAGACCTATTCCCGTGAGATCTCA -0.22645771 1.88e-02 0.99993
100039220 GAGAAAGTTTAAAAACTCCTAGTTTTTTGATGTACTGCTCTTTTGTGGTCATTTCCCAGA 0.1861434 1.88e-02 0.99993
171256 AACATTCATTGGCCACTGCTATATGCTACCATCCAGACATATCATCAAATGGCTTTTCCT -0.37346719 1.89e-02 0.99993
18591 ACTCCAGGCTGCAGGCTTCTCTTGACTCCAAGAACCTGGAACAAGTGTGCAGGAGCCTTG -0.18039601 1.89e-02 0.99993
170786 GGACATGGTGAGCCTCAATGTTATAGACCTCCCAAATTTTTTGGAGGATTTATAATTTTT 0.57140547 1.89e-02 0.99993
22196 GGGCAACAGATTAACCACTGTATCTACAAATGCTCTAATTAAAACATTTCCACAAACTGC 0.38425742 1.90e-02 0.99993
108143 GACAATATCAACCAAATCTCAAAATGGATTGAGCAGTGGGTCAAAGATCATAACCCTTAA 0.25252487 1.90e-02 0.99993
13617 GGCCCTGGTAACTCTACTGGGCATTTTCCCAGATGTTTACAGACTGTGAGAATGACAAAT -0.40582945 1.90e-02 0.99993
53883 GACTTGTCACTGACTTCCCTTCTAGAGCAGGTGTAGAATAAAGGCTCGAGGAGGCAGGAA -0.17248351 1.91e-02 0.99993
16433 GTAAGATTTTGATATGTGATAACAATGACCAAACATCTCGCTGCAATCAAGGCTGTGTCC 0.33220491 1.92e-02 0.99993
210274 TTCTTTTTAGACTTTATTTATTTAGAAGGAGAGAGAGGAAGAGGGAGAGTGAGGGAGAGT -0.18087419 1.92e-02 0.99993
233649 CTTAGAGTTCAGCTAGATAATACACATCATTATTGGGAGAGATTAAGAGAGTTATTACCC 0.26623542 1.92e-02 0.99993
77627 TGCTCGAGTACTATGACAAATCACTGTCTTCGAAGATTTCCTACAATGACTTCCTGCGTG -0.61275332 1.93e-02 0.99993
13609 AAGATGAAAATGTGTTCCTTTTTTGTCACATGTTCCTTATTCCCATTACAACCACAATGG -0.19078509 1.93e-02 0.99993
103161 GCCTTTATTAAAGAACTATGGTGTCTTGGCGTACAAGAGATAGTAACAAAACAACCAATA 0.51323051 1.93e-02 0.99993
11479 AATTCTCCAGACTCAAACGCACATAGTTCAGTCACTGGAAACGCTTGTCTTTGCACCTGA -0.21322704 1.94e-02 0.99993
66491 TGAAACTCACAACAGTCAGCCTGCCTTTACCTCTTGGATTCTGGGATTAAAGGTGTGTGT -0.43141572 1.94e-02 0.99993
106489 TTAAAAATGTGAAACTTTATATACTTCAAGCTTAAAATTACTTATTAAGTGTAATAAAAA 1.02278921 1.94e-02 0.99993
13972 CACCTATAGCTTGGTAACAGGCATGTTTTAGACCTGGTTGGGTGGCCAGACTAAAGATAT 0.19601219 1.94e-02 0.99993
213006 GTTCATCTCCATCCCAGTCTCCTCAAGAATGAGGCCAGCCACCATGGTGTTCATCAATGT -0.50352916 1.94e-02 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.3169495 1.95e-02 0.99993
14164 CATTCACTCTGCACCCATACTGTATTACACTCTGCACCTTATCAATATTAATAAATGTTG 0.33011995 1.95e-02 0.99993
233549 CTCTGTCTTGGCACTGAAGGGCAGCACTGTACATGTTACCTCAATAAATGAAAGGAGTCT 0.21408458 1.95e-02 0.99993
382056 GCAGACGCTTCTTTGTATTTTTGCGCCCTTTGTAATGAAATGTAATAAAAACCCAATGTT -0.24285322 1.96e-02 0.99993
56176 TATCGAGGTCTTCATTTGCGGCTCTCAAAACAACAAGGTTCGGGCTAAATGGATGCTTCA 0.36570661 1.96e-02 0.99993
224705 GGAACAGTGACATCACCTCGTGGTGGGTCTCACTATGTGGCAATAATAAGTACTAACAGT -0.23158832 1.96e-02 0.99993
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.6655173 1.97e-02 0.99993
20981 GTGAATGTCGACAGACCAATCCTTGATGTCCCCTGAACAGACACACCCTCCAGTGTCCAC -0.20022108 1.98e-02 0.99993
70314 CCCCAAGATATAAGGAAGCAAGGCCAGACTTTTCTGTCATTTATTTTCAATAAATAAGCA 0.24012014 1.98e-02 0.99993
24047 AAGCTCACTTGCACTTGGCTCCTGAACCCCTTCACGCCACAGGAGGACATCTGAGCGATT 0.49603673 1.98e-02 0.99993
99031 TTGCAAACTCACGTTTGTCAAGGTGAATTACTGGAACTCCAACGTGAATGAAGTCCAGGG -0.22904893 1.98e-02 0.99993
621628 CTTTCCACTACCTGGCAGCCAAAGAACAGGCGAGCACATAACTTGAAGGATTACATGTAA 0.35051556 1.99e-02 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.26049697 1.99e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.30351958 1.99e-02 0.99993
109979 CAAAAATCCCAAAGCTATATACTTTTTGATCGGATTCAATAAAAACTTTAAGTTTACTAA 0.40040996 2.00e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.42310349 2.00e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.50247013 2.01e-02 0.99993
114868 CTTAATATGAAATGCTGAGGTTGAACTTGAACAAACATGCTTATCCCCTCATAAACAGTC 0.25481529 2.01e-02 0.99993
74343 TCCAGTGGACATGGGCAACAGCCTTACCACCGCCCAATAAATGACTTCAGCTTGGGGAAT -0.20014837 2.01e-02 0.99993
19415 TAGGAGCCTTTGGTTAGGGCCCAGTCTTGTACTGACCAAACCTCACTTTCTTCTCTGAGC -0.4034417 2.02e-02 0.99993
13131 CCATGGCTCTTTGATCTTTACATACCACAAGACTTTTTTGATAACTCGTATCCATCCCAG -0.26860534 2.02e-02 0.99993
258264 GGACATGAAACTTGCTCTGAGGAAAGTTCTGTTAGGAATGAGAATTGTCAAAAATATATG 0.19578133 2.02e-02 0.99993
381560 TCTATGTGGAAGAACATATATGCATGTGTTTAACAGTATTAAAGCCTCATGAGATTCTCC 0.34872766 2.03e-02 0.99993
74114 ACTTTCTAATTGCCAGAGGGATAAAGCACACGGTTAGAAGCTAATTTCTCTGACATCAGT 0.17925952 2.03e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.24346641 2.03e-02 0.99993
18793 CCCTCGTGTTGTCTTCTTTGGACCTCAGTTTTTCCATGAACCAGAAGAGAATTGGAACAA 0.33057496 2.03e-02 0.99993
108686 TAATCTGTAAAATGGAGAACGAAATCTTCACTCCCCTTCTGGAGCAGTTCATGACCAGCC -0.22270775 2.03e-02 0.99993
270084 CCATGTCTGCATACTCTTGCTATCACTTACATTTGAGGTTTTGAATAAAGAACCGATTTA 0.63423771 2.04e-02 0.99993
69634 ATCAAGGAAAAATGATCTGTTAAATGAAGCCCTCCTCAGGCGGGCTGAATGGATACTGTG -0.23761058 2.05e-02 0.99993
16428 ACTGCAGGTATGTCTTACCCTCTGTGGGGGCCACAAGTCAATCATTGCTTATGGAAAAAA 0.74740826 2.05e-02 0.99993
83815 TCTTCTGAAGGACTTGGATGTTCTTCATGATTCAGCCCCAGTGAAGAATGTGTCAGCATT 0.17471826 2.05e-02 0.99993
328789 GTGTGGCTACTACACCTAACCTTGTATAATTTCTTTATCGTCTTTTAGCTTCCAAAATGA 0.24079453 2.05e-02 0.99993
19652 ATGGCCAGAAAGTGATTTCTGAATGTACCTATGAACAATCCGAGTCAAGATCATGATTGC -0.5145532 2.05e-02 0.99993
66773 CTGTGCGGCTAAAAGTGCAGAAATCTGTTTGGTTTTTGTTCTTTGAGTATTGATATGTTA -0.23135896 2.06e-02 0.99993
321019 GTTCCAGCCCTAAAATTTCTCCAGTACAGTATCTCACTTGGCAATGATATCAATTTATAT 0.29223605 2.06e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.33237008 2.06e-02 0.99993
107221 ACAACATGTCGCTGTTCAGGAACGAATGGAGGAAGATTTTTTGCTGCTTCTTTTTTCCAG 0.33698879 2.06e-02 0.99993
171250 ACTGCTATTTAATGCAAGAAAGTCAGGAAATAAAATGGATTTTTCTCCCTCTTATGGTCC -0.2044794 2.07e-02 0.99993
67393 TGGAGAGATGAAAATTCTATTCATTTGTTGATCCACTGAGATCTGGAGAGCCCACATCTC -0.23907702 2.07e-02 0.99993
230099 TTGAATGCTGGGATTACAGGAATGCACCATCATGCTTGGTCATCCCAATTATTTAAAAAA 0.6367855 2.07e-02 0.99993
229715 AAACCTCAGAGCCCATGGGCTCTATAACTAGACAATGACCATTAAACCTGGCTTGAGTCT -0.19377135 2.07e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.33015823 2.09e-02 0.99993
20491 GAGTGAGGGTTATCCAGGTGCTCTTATTCCCATGGATCTACAAGGAATACAAGGCTTGTT 0.52474312 2.09e-02 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.31961787 2.10e-02 0.99993
18725 CCATTTTTCCATTCTGTGTGACTACTTACATTATTGTGCCTAATGTCATTTCACTGTGAA 0.62131665 2.10e-02 0.99993
269642 ACAGTGGTAGGTCTCACTGTTGTGGTTTGTTTCTGAATTTGTACTGTGAGCCCATGATGG -0.19215317 2.10e-02 0.99993
192786 TAAGGGTATCATTTATTACCACATCTCCTAATACATCGGAACCAATAAAGAACATGCATC 0.22512596 2.11e-02 0.99993
269713 TGGAGTGGGCTTGCACCTGGTAGGTGTGCAAGAAGCCATTTCCCCATAAGCACTGGCCTT -0.20034161 2.11e-02 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.27996795 2.11e-02 0.99993
71472 CCTTTGTGGTGGGAAACAACTCTGGGCTCTGAGCCTCAGTGTATGTATCTGGTGGGAGAC -0.20278099 2.11e-02 0.99993
232201 GAGGCTGAACTGTTGGAATCCAGGATCAAACAATATTTATGAAAGCAAAATGAGTGAGAA 0.44394142 2.11e-02 0.99993
170770 TGGGAGCGGGGAGGGACGGCCCAGCCTGTAAGATACTGTACATGCACTGCTGTAGATATA -0.43556356 2.11e-02 0.99993
22349 TACGTGAAGTCCAATCAGAAGCCAATAGGTGATTTTCTCTTAAAACTGGTTATCCAGTGT 0.32745842 2.12e-02 0.99993
85031 TCTAACGCTTTACATAAATGCCCTTTTAGCTTCTCTATTTCGACACAACTGTGATTACCT 0.76488387 2.12e-02 0.99993
83815 TCTTCTGAAGGACTTGGATGTTCTTCATGATTCAGCCCCAGTGAAGAATGTGTCAGCATT 0.18682499 2.12e-02 0.99993
16179 TATGCTTTCCTAATGCTTTATATCTCTGGGCTCTTAAGTGTCCACCCAAAACTCAGGCCC -0.18460899 2.13e-02 0.99993
329581 CAGCTGTGCCCTATCTGCAGGGTGCCTATCTGTAGCTGTGTACGCACATTCCTGTCCTAA -0.37869566 2.13e-02 0.99993
67916 GATTATAAACTGTGTCTCGACCTGTGTTATTTACATTAGCTGCTTAAAGGAGCATTGAGT -0.29422139 2.13e-02 0.99993
233079 GGGACCAAGATGGACAGGGGTGGAAGTCAAGCAGAAGGGGTACAGAGTTCTGAATTTGTC 0.33566539 2.14e-02 0.99993
66643 GCCCTATTCCAATGTCCTAAAAAGGTGATGGTGTGTAGTGTTAGATGATTTCATTTTAAA -0.37077611 2.14e-02 0.99993
12982 TCATAAAATCCAACGTGCCTTCATGATCAAAGTTCGATAGTCAGTAGTACTAGAAGAATC 0.36536808 2.16e-02 0.99993
98314 TTGTTCTTAAAGACCTGTCTGGTTCTAAGAAGATGTGGAGGGCTATGATTGCCTGCAGAG -0.16600866 2.16e-02 0.99993
668110 CAGGCCGCATCTCTGAATACGATGGAAGACTTGCTGGAGACAGTGAAAAAGCTACAGAAA -0.22830916 2.16e-02 0.99993
73167 AGACTGGAGATGCCCCCTTCCAATCTAGGCATCTGTGTACCTGTTTGTCTTATGAACTTA 0.28221117 2.17e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.47718381 2.17e-02 0.99993
16581 CTATCTAGCAGAGACAACCCTTTCTGGAGTAACCTAATTAAAGCTGTGGGTTTTCAGCAA -0.21713528 2.17e-02 0.99993
23882 ACTTAGCCGACTGCACTGCTCTTTCAAAAAACGGATCCCGGGCAATGCTTTCATTTTCTA -0.39841389 2.17e-02 0.99993
74446 AATCCTTGAACAGAGTGAGGTGACATTCCCTTTGAAAGTTGAGCTCTCGAACTTCCATCA 0.27828505 2.18e-02 0.99993
223337 ATCTTCTACTGATGCACCCGAGTTAGTACCTCACTACTTTTGGCCCTGTTTTCCTCTTAT -0.23287808 2.18e-02 0.99993
26905 GAACAATACCACCAATAAGGGGTCTCTGCTGGTTGCTGGGGTTGTAACCTACTTCTAATA -0.19071923 2.18e-02 0.99993
68861 GCCCATTAATAGACGCAGTGAAATATTTTTGAATCAAAACATTTGGGGTTTGTATGTGCA -0.27293384 2.19e-02 0.99993
234814 TGTGTGTGTGGGAAACCTGCCCTTCACTACTCGTGTGCGTGAGCTGAAGAGAGTCCTCCA -0.70110596 2.19e-02 0.99993
320784 GGTTCTGTGCTGTTCTAGCTAGTGCATAGTGTCTCTAAATAAACATGCTAAATGATCAGG -0.47370026 2.20e-02 0.99993
66965 GACCCTCATAAGAACAGGACCCACCTTTGGAAATTCCAGGTAAAGCGCAGTGTAATGTCG 0.34990968 2.20e-02 0.99993
545047 GAAAACAAATAACTGTGGTACCTGGAAGTAAGGAGGAGGCTGCTGTGTCAAATCCATGTG -0.24592262 2.22e-02 0.99993
319480 GTTTCATCTGAACAATGTCATCTGTTCCCCTATGCGGTACTACCTTTACTGTCAGAAATA -0.40574861 2.22e-02 0.99993
791306 TGGACGTTCCAACCCTTTCAGTGTAACTATTTCTTACCATTATAAATTATTTTCATGCCC 0.37074245 2.22e-02 0.99993
108124 CTATCGACCTGAAGCTGCAGCTGGCCCAAAAAGGACAATAAAACCTGCCACTTTTGCATG -0.16610541 2.22e-02 0.99993
12159 CAACCACCTACACATACCACACAAACTGCTTCCCTATAGCTGGACTTTTATCTTAAAAAA -0.35448142 2.22e-02 0.99993
56175 GACTGTATCTTGATTACTCTTGATTTCCAAGCTTTCAGATCTTTTCTACTTCAGAGAGAA 0.59202086 2.23e-02 0.99993
19933 CCTTAGACTGTAGTGTGGGGTTTGCTCATTGGCTTTCTTGTTCAGATTTTACTAACTGTT -0.35245273 2.23e-02 0.99993
14406 GGAAAAAATTAGAATACCTCCCGTATCTGTGAAGAATCACAATAGAAAAGCCTAGATTAG -0.22449142 2.23e-02 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.68194359 2.23e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.32303996 2.24e-02 0.99993
270109 CTCTACTGTACGTGAGCACATTTGCACAGACCTTTGTTTTAGGGATTAAAATGTTTACAG -0.20638407 2.24e-02 0.99993
16846 AGTTTGGATCTTGGGTTTTCTGTTAAGAGATGGTTAGCTTATACCTAAAACCATAATGGC -0.21044899 2.24e-02 0.99993
328699 GAGGACTTCTCTGCTTGTTGACTTTTTCCTTTCTTTGCAGTACTCAGGGTGTTACACATG -0.18941824 2.25e-02 0.99993
654801 AAGGGTCCCTAATTTTCTCATGGAGATGTGTTGCTAGTTCAGTCCTTGTCATCCAGCATC -0.18986476 2.25e-02 0.99993
69551 ACATCATGATGAAGTATGTTCATTATTCTTCTCTGAAGCACATTCTTTGGCTGAAGCCGC -0.3535285 2.25e-02 0.99993
258296 TGGTATGTCTCTTCCACCATCCCAAACATGTTGGTCAATATTCTCTCTGAGAATAAGACC -0.36793904 2.26e-02 0.99993
226751 ATTTTGTTAATTTAGTGGCCGCGTTTATTTCCAGGCAAGTTCAGCTGCCTTGTGTGGGTC -0.18902059 2.26e-02 0.99993
18508 CCGTCCAAGTTCCCGGGAGTGAACCTGACATGTCTCAGTACTGGCCTCGATTACAGTAAA -0.30551429 2.27e-02 0.99993
171469 GGTCTATGCCTTCTGTACACTCCCTGAGAACGTCTGCAATATCGTGGTGGCTTACCTCTC -0.28278096 2.27e-02 0.99993
67280 CACCAGGAGGGATAAAGTGGAAGGACACTACTGTACACATTATGTGTACCAGGACATAAT -0.26931443 2.28e-02 0.99993
18591 GTTCCTTCTGCTTCCTTCAGTTTGTAAAGTTGGTGATTATATTTTTGGGGGCTTTCTTTT -0.33272731 2.28e-02 0.99993
57754 CTGAAAGATAAGTGATGGAGTGCGCTAGCCCTGTGGGGACATTAAAGGGCATGGCTGTCT -0.15424271 2.28e-02 0.99993
21871 TCCGGACACAGAAATTTCGTTGGTTTTTATTATGAGCAAATATAAGTTAATGCCAACGCT 0.19874399 2.29e-02 0.99993
14184 TAGACCGCATCCTCACTGTGACATCAACCGACGAGTACTTGGACCTCTCCGTGCCGTTTG -0.24753342 2.29e-02 0.99993
67912 GATACTACCTAATCAGGTCAAGACAGAGTCATAACAAGTGGTAACTTTGTTATATTCAAG -0.16345858 2.30e-02 0.99993
435965 TCAGCTCATCGCACAGGGCCTCATCCCACCGGTTGAGGATTTTCCTGTCTACAGTGCATC -0.2195649 2.32e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.33624775 2.32e-02 0.99993
13363 CCATGGGTGTTCCTTACAATCCGCCACACATTTGTGGCCAAAATAAAGATTCTAGAGTGA 0.28992268 2.32e-02 0.99993
100177 GTTAGCAAAGGAGAAAGAGTAGTATCCGTATTGCTTATCATCAGAGTGTATAATTTTGTG 0.20854499 2.33e-02 0.99993
258350 TGGTTGGAATGTTCTATGGAGCTGCCACTTTCATGTATGTCCTACCCAGTTCATTGCACA -0.18595864 2.33e-02 0.99993
21853 ATTAAAAGACATGTCCTGAACTGAGCTTGGTAGTGTGAGCTAATCCCATCGTGTGGGAGA 0.23841872 2.33e-02 0.99993
224619 AAGCAGCACCTAGAGTTCCTGAAGTCCGTGAACTACAAGTTCCGACCTGCCCCGGGACTT 0.35447846 2.33e-02 0.99993
12476 ACCTGCTGCTTGTACCGAAGCCTCAAGCTGGAACACTACTGACCACGATGATGTCAGGCC 0.21867069 2.34e-02 0.99993
18577 TTGATCAATTGGTCCGTCGATTGACAATCAGTCCTCCAGTCTTGTCCCTGATTAAAGCGA -0.20336344 2.35e-02 0.99993
213006 GATTTCTAGGATGGTATATAAACCCACAAGGAAGTTTCCAGTTTAAGAAGAAAAGTCTAG -0.40806173 2.36e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.49013585 2.37e-02 0.99993
404195 ATCATTGGATGTTACAATTCCTCGGGACTTTATTGATTATTTCCTAATTAAAGGAGCCCA -0.17272251 2.37e-02 0.99993
15979 ATGGAACATGTTGGTGGAAGCTTGTACAATAGAACACATTGGTGGGAGCTTGTACATACT 0.25569986 2.38e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.26108124 2.38e-02 0.99993
53881 GGCTTCAGTTTCAAAGAAAATAGAATTTGATATAAGCCAGGTTACTTCCATCTTGAAAGG 0.30220504 2.38e-02 0.99993
219189 AGCATTGTCCTTCTGACTCTTAGACGCTGATAGTCCCTAATCTGCTGTAGACACTACTAA -0.20178158 2.40e-02 0.99993
209550 GAATGATTTACTTGTTGCTTTGTATAAGTGTTTTCCTCCAGCTGCAGATTTTGTGTTGTA -0.24638461 2.40e-02 0.99993
233189 ACCTTCCATGGGCGGGTATGTGAATTGAGGTTGCCTGGGAAACTGCCGTGGGAGCAGTTA -0.17759087 2.41e-02 0.99993
627085 TCTTTTCCTTGCTCAAAAAAGGCTATGAGTTCCACAGTCAGTTTCATAAAGGGCATATAA 0.19764026 2.42e-02 0.99993
73176 GTCTTGGTCACATCCTGACTTGTAATGCTTCATCGTGGTTTTCACTATTTTAATAAAGAT 0.21915586 2.42e-02 0.99993
78816 CAGATCAGTAGATCCTTGGGGACTACCCGAGTCTCTGACCTCTGAGACGGGTGTCTTGAC 0.3896093 2.42e-02 0.99993
207818 CCACTGTTCCCCAATCAGCCTCAAACTTCTACTGTTTTTATCCTAATTAAACTTATGAAA 0.42729675 2.43e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.47029188 2.43e-02 0.99993
108912 TTAGACAGCAGGGGATTTGAATGTCCATCCTCCAAAGAAGAGACCATATCCTCAGGACAA 0.21349037 2.43e-02 0.99993
14654 ACAGTTTCGGTTCCATCGCTGAGACAACCATAGACTATAGGGTCAACATCTTCCTGAGGC 0.21667425 2.43e-02 0.99993
12517 ATGGCCCGGAGCCAGCCAGGCAGTTTTATTGAAATATTTTTAAATACTTTGCACGTGTTA 0.88463578 2.44e-02 0.99993
214669 ACTGTGGCAGGGAATTGACCAAGTAGCGGGCTCGAGAGATTTGGGTTTGGGCCTTGACCT -0.21697501 2.45e-02 0.99993
216618 TTGGAGGCCAGCCTAGTTTACATGATGAGTCTGTCTCAAATAACCACAATAAATAAATTT -0.19304272 2.46e-02 0.99993
22778 AGGAAGCTCATGTGCATCTGGTGCTATGGCACTCACTGTGAATAAGTGTGACCAGATATT 0.3404482 2.46e-02 0.99993
170707 TGCTCCATTTGACCAGAATTTGTCAATTGATGGAAAGATTTTAAACGACGACTGTGCCAC 0.29581901 2.47e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.26160027 2.47e-02 0.99993
18227 AAAGACCATGTGACTTTCAATAATGGGGGTTTGAACCGACCCAACTACCTGTCTAAACTG -0.46875852 2.47e-02 0.99993
625580 ACATGGTCGACACTCTCACTTATATGTAGACATGATTGAGTTGGCCACAGGAAGAAGAAA -0.22447446 2.49e-02 0.99993
100503859 AATTACCATAGAAACAGCTTACTATAATGGCTCATGCAGTATAAAACTAAAGAAAAGCCA 0.20870707 2.49e-02 0.99993
17122 AAATATCATTTCTACAAATCTCGGCAGGATCCGTGTAGGGGCCTTAATGACCACCATAGG -0.2565255 2.50e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.19877844 2.50e-02 0.99993
100039436 GACCTAGGTTGATATAGAGAGAAAGGAGTGTCTTAGCTGCGTAGTTCTAATTTGTATAAG -0.28033921 2.50e-02 0.99993
11688 GAGTTCATTCCAAGTTGCCTGGTGATTTTCATATTACAGGCATCAAAGTTTTGGATCTTC -0.20786583 2.51e-02 0.99993
16974 ATCGAGCGCACGTCACGGGAGCCTCCTCAAGCAGTTCTTCCAGTACCAAAGGCACTTACT -0.18636382 2.52e-02 0.99993
277899 AGTAACTCTAAGTTCAAAGACTTATTCAGGAGAATGATCTGTCTACAGAAGGAAGAGTGA 0.24165526 2.52e-02 0.99993
67929 CTAATTTGTCTCTTTGCCATGAAAGAGATAATAAAGTCCTGAAGAGAGGTTTGACAAAGC 0.21641627 2.52e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.36973756 2.53e-02 0.99993
27376 TTCCTGGAGCAGCTTCGGAAGCACTTTGGCATCAAAGTGCCAACCACCTGACATGGCCAG -0.1886786 2.53e-02 0.99993
207175 CTTGGTGTCTAATCTGTGCCAGAAGTTATATGTCCCTACCAATGTCATTAAATCTGTAGT -0.37811909 2.53e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.30841716 2.54e-02 0.99993
54378 TATGAGTATTCCTGGTCCTTAGGCTGTGGTGTAGGCGCTGGTCTAATCCTGCTGCTGGGG -0.614211 2.54e-02 0.99993
54006 ATGCCACGTGTACATACCTGTCTTATCTGTTAATAAACATGTAAATAAAACTCCCACCCC -0.2316325 2.54e-02 0.99993
319996 GCAGCCTAGACATTTTATAAACTGAGGAATCTTGGACCAATTGATAATATTTCTGACTGT -0.29609663 2.55e-02 0.99993
12041 GTCGGGAGGAAAGCTTCAGAATCTAATGGTGGATTTTGGCCGGCTAGCCTGCCACACTCC -0.15463943 2.55e-02 0.99993
22654 TGCTTCCACTTAGAAGCCTGAGAGAGAGCAGTGAGAACACCCAGGGAAGCTGGGACAACC -0.21213868 2.56e-02 0.99993
11614 GAGTGTGGTACTAGGCTAACAAGCTAATTTCATAAAAATAACATCTCTTTCCATTAACCC 0.17143503 2.56e-02 0.99993
106014 GATGTTACAGCATATTTCCCCCTTGTTTTACAGTATCCAATTTTTGTGTTGATTCAGCTA -0.18541446 2.56e-02 0.99993
16797 AAGAGGAAGGGGTGGATGGAGAGGAAGCTCCCGACTATGAGAATCTACAGGAGCTTAACT 0.70498587 2.57e-02 0.99993
66789 TTGTTTGACGAATGGCAACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACT 0.17438643 2.58e-02 0.99993
212281 GAAGTGTGTGGCAAGGACTTCCATGTTTCATCATCACTATCTAAACACGGGATAATTCAT -0.20022611 2.58e-02 0.99993
66294 AGTAAGCACACCAACAAGTATGAGGGCTGGCCAGAGGCCCTGGAGATGGAAGGCTGTATC -0.14288297 2.58e-02 0.99993
101351 CAGACTTGATATATGTGTTTGTTAACTGTAATGTGATCTTGATTCCAGAGTGTCATGGCT 0.44069536 2.58e-02 0.99993
75607 AAGAAAGGCACCTTCACGGACGACCTGCACAAGTTGGTGGACGAGTGGACAACGAAGACC -0.14627498 2.60e-02 0.99993
19301 TTCATCAACATCAACTATGTGCCCCTGCAGTTCCGGGTGCTCTTTGCCAACATGGCAGCT -0.27710403 2.60e-02 0.99993
230935 TAAAAGCAGTTCGATTCTGTAATATTTATTTTTCTTTTTGAGGATGTTTCGTTGCCCCGC -0.17012204 2.60e-02 0.99993
76947 TAGAGGACTACTTAAAGAAAATCCAGCGAGTAGACTTTGATATATTCCATCCGTCTTTAC 0.18332687 2.61e-02 0.99993
213084 TACTTTCTATCCTGGGCTGTTTTCTGTTGCTAAATAATATAGACTGGGTAGTTAGTTAAC 0.26827973 2.62e-02 0.99993
17153 GGGTGACTAAGAGGAATTGCCCAAGGTTTCTCAATGTTTCAGATTTTTAATCATTAAAAG 0.58732199 2.62e-02 0.99993
26459 AACACCTACAAGCTGGTAAAGTCACGACTGGTGCGTGAGGGTTTTGATGTGGGGATCATT -0.3528126 2.62e-02 0.99993
240023 AGCATAGTCACCACCTGGGCCATGATTGCATTTCTCCTGGGAAGACCCATGCCCTGAGAG -0.23097532 2.62e-02 0.99993
230279 CTCATGTTCAATTGTTCCAGCACCTCAGGGGTGTGTATACAAATAAAGAGTTGTCAAATC 0.27093166 2.62e-02 0.99993
13587 GTCCTCGTGAAACCTGTCACTTACTCCCTTTAATTTTGCTGAATAGATCTTTTCTAATTA 1.09329536 2.63e-02 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.32253524 2.63e-02 0.99993
14051 GGTTACCCTTTCCCCAATGCTATGGTGGCAAAATATGGTTGGAATATTTTAATACTAATA -0.32870171 2.64e-02 0.99993
70591 TGAATCATTACGCTCTGTTTAAATGTTACATGTTCCTTAAGAACTGTGGCAGTGGAGATA -0.24207689 2.65e-02 0.99993
15289 CTTGTTGGTGCACAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGTTTTTTGTTTT -0.19923477 2.66e-02 0.99993
380836 ACTTTCTGGGGAAAAAAGACAACTGGTGTTTAAATTATGTCTGACTAAAAATACTGTGGC 0.19801484 2.66e-02 0.99993
65086 GTTTTCGGTGTAAGACGTTTAGAGTGTATCTGACAAAGTAAGAATAACTTCAAGGCAGGC 0.39000919 2.67e-02 0.99993
12981 TCTGAAAACGCTGACTCAGCTTGGACAGCGGCAAGACAAACGAGAGATATTTTCTACTGA 0.2256177 2.67e-02 0.99993
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.55017926 2.68e-02 0.99993
242481 TGCAGTGACCATATTCCATAAAACAGTCTTTCTGACATAGGGGGGCTGTCATAATACCCC -0.22941426 2.69e-02 0.99993
17067 TATTATAGTATCACCATCCACACATAAGTATCTGGGGTCCTGCAGGGTTCCCATGTATGC 0.88335646 2.69e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.48209624 2.69e-02 0.99993
100041799 CCTTATGATAGGATCCCAAAAGATGGGAGCCAAGTCTTTCATTTCATTTCTGGGAAAAAA -1.44498294 2.70e-02 0.99993
109082 TTTGTGGTAGTGCTGAATTTATAGCCTGCTCGTTTGCAGTGTCCAGATGGCAACAGAGTT 0.2776243 2.70e-02 0.99993
67418 CTCACACAGATGAACCTAAAACATGGTCTAGAAGAATGAGCAGGGACAGGCTGGAAGCAA -0.37964075 2.71e-02 0.99993
67045 AAATCGAGTTTGGAAGCAGCCAGCTTTTGGGGAGACTAATAGATTTCTGATATGTATTAT 0.19218677 2.71e-02 0.99993
229474 GCCAGTTTTTATATATCAAAGACTTATTTTTTAATATTATAAAAATAAAAAAGATGTTTT -0.222457 2.72e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.36491409 2.72e-02 0.99993
574402 GCTGGGGTGTAAATCTTACTGCTAGACTGATGTCACCACACAGACAAATAATCTCTGATG -0.3814092 2.73e-02 0.99993
100041585 CAACGATTACAATTTTGTTTTTACCAGTTTTGCTAAGAAACAGCAACAACAGCAGAGTTG 0.44278685 2.74e-02 0.99993
15289 GTTCTTGTTGGTGCACAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGCTTTTTCT -0.23055531 2.74e-02 0.99993
56486 TAATTTCCGAGAACTGCAGAACTAAATCTCATGACTGCCACTGGGTACCAGTTTCGTCCT 0.19596733 2.74e-02 0.99993
234814 AGCGTCTATTAGCATTGTCCTTTGTCCCAAAAGGGCAGGCCTCGCTCATATTAAAGGAAA -1.35379706 2.75e-02 0.99993
76585 AAGACTTCAGACAAATAGTGCAGGAGGAGCACATGCTCAGAAGATTCTCCATTGCCCAAT -0.1564262 2.75e-02 0.99993
241634 AGAGACACCTGGCAAGGCTTATACAAGGATTTCCTGAAGCTGCAGAAGGATTTCATCCTA -0.19260376 2.75e-02 0.99993
78785 CTGAAGCGCTGAGCTTCTCTGAATATATATATATATATGTGCTAGATGAAAAATAAGGCC 0.4207147 2.76e-02 0.99993
56695 AGAGGAACGCGCCTACAACCCATTCCTGAGAACCCATTGCCTGGAACTACAGGAGGCTCT -0.21513687 2.76e-02 0.99993
223664 ATGGCAACCCTTTGTCTATGGCAGGACTTAAAGAACTGCTTCGGGACTCTGTGGTACAGG -0.19410533 2.76e-02 0.99993
338368 TGTTTGTTCCCTAGATCTGTAGGGGAAGCCCGCTGTCCACTGCACCCATTGTACCAATGT -0.17955869 2.76e-02 0.99993
76612 TGAAAGTGGAGATGACCTTGAACAAAGACCATCCATTTCCATCTTTCACTGGAAACCTTT 0.24082378 2.77e-02 0.99993
78376 GCTTGTCTGCACAGTCTGATTCACAAGGAGTTGTCAAAGCATCGGAAAGGAGTCACCCAG -0.5700242 2.77e-02 0.99993
20981 ACTCTGAGCAGCTTCACAAAGGGTGGCAAAGGATTGTCAGAGAAAGAGAATTCAGAGTGA -0.21959244 2.77e-02 0.99993
320438 TTTCACAGGAAAGCTGTTTCTTTAGTCTCTGATGAAAATTAAAGCCACTTTACGACTAGC -0.17206797 2.77e-02 0.99993
70977 GTACTCTTCTTAGGCAGTTGGTTAGCAACTCAAGGACGCATATCTTCATTCTTTTCTGAT -0.20542277 2.78e-02 0.99993
268288 AGTCCCCAGTTTCCCTCTTTGAAAGAAAAGGAAATCAGATCTCAACCTCCAATCACTTAA 0.49408549 2.78e-02 0.99993
12227 TTAAATCTTCAATTCTTTACTGTCCTTGTTCACTTTAGAAATGACAAACCCTAGAGCTGG -0.3105882 2.78e-02 0.99993
258988 GGGGCATGGCAGAAATTATTAGGGAAATTCTCTGGGTTTGCATCAAAATTGGCCACTTGA -0.22233123 2.78e-02 0.99993
330369 GGGGTGGACAGGAACTTATGGTTTTAGTTTTGTTTCTAAAGTGGTGCCTGTACCTCCAGC -0.20030603 2.79e-02 0.99993
23968 ATGTTTGTCTCACCTTGGAGGATGTAGCAAGAATGAAATAAACACAGCATTTAGAAAAGC -0.39745801 2.79e-02 0.99993
104110 GCATCAAGGTCAAAGGCAAAGGGGAACTCTGTACCTACTTCCTGAACACAGACCTGACGC 0.32495637 2.80e-02 0.99993
236082 TGACCCCCATATTCCAACCTTAGCCACTTTTTGGCCGCTGTGACGCCTGTGACCTCGTGT 0.23317155 2.80e-02 0.99993
93874 ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC -0.24670853 2.80e-02 0.99993
170441 CTTCTTTGGGGGCGTTGTAAAGGTCAGTCAACTGGAGACAAGCAAGAGCCTCAGGTCAGA -0.17729293 2.80e-02 0.99993
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.20248209 2.80e-02 0.99993
232989 GGTGTGAGCCATTATACCAGCAAGGAGCTTTCTCTTGAAAAGTTTACACACTCGTGGCTA -0.22450885 2.80e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.25202769 2.81e-02 0.99993
328695 AGCCCTAGATCAGCAAGTTAATGTCTTGTCATTTCCCTTGCCTGAAGAATGCTTTTCTTT -0.17428127 2.81e-02 0.99993
100041745 GGTGATCCCAAAGGAAGATTACTTATTACTTTTGGACTTTGATGATGAAGAAGATGACAT -0.15779736 2.81e-02 0.99993
170656 CTGTGGAGGCTGTGGATACGGCTCAAGATATGGCTATGGCTGTGGATACGGCTCAGGCTA -0.17861066 2.81e-02 0.99993
14479 CCCGAATGTAAATCCTTTATCAGATTTTAACTTGTGCAGTACTTGAAGTGAAACACAATG 0.20684489 2.81e-02 0.99993
252972 TTTGTATGGGTTAAGAGCCACGTCGTCGGAAGGTTTTATACAGTGATTTGTTACCTAGGA -0.1728907 2.81e-02 0.99993
16542 CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG 0.26825115 2.82e-02 0.99993
245666 CTTTTTCCCTCCTTGTATATAAGAATGTATATTTGATGCCTCATAAAAGACCTTGTGCTC -0.31716583 2.82e-02 0.99993
210146 CAGGTGTAAATGACTACATATGTTGCCCATACAATCTTTTGTTAGGATTTTCAGGCTTTT -0.18347464 2.83e-02 0.99993
14043 AAATCAAGGTGTACATCTACCCCCTAAAAAAGTATGTGGATGATGCCGGTGTTCCGGTGA -0.1633258 2.83e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.48447117 2.83e-02 0.99993
72097 GAGAAGGAGAGGAAGGGACGTGGCAGGGTTTGTCAATTCATAGACTGTTTCCAAAAAGAA -0.24731982 2.83e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.26193512 2.83e-02 0.99993
227358 TGTGTCATATTGCTAGGCAGAATATATTTATGTAATGGATCACACAAAGCCCTAACAATG 0.25480823 2.83e-02 0.99993
66789 TTGTTTGACGAATGGCAACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACT 0.16495498 2.84e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.24525111 2.85e-02 0.99993
100045995 CTCATTAGGAACTTGTATTGTGTGCTTCTGAAAGGCGTAGGGGAGAGTGAACAAATATAG -0.3754011 2.85e-02 0.99993
63872 GAAATGGGCAGGCACTTTAGTCTTTTCTCTGTGTGAATAAACCATCTCCTTTTTATTCTT 0.27375641 2.85e-02 0.99993
233107 TGTTCTGTGTTTGTGTGAACACACCGCGTTCCCGGTTCATGCCATAAAGAACGCTATAAA -0.40573604 2.87e-02 0.99993
19283 GAAGAAAGGGTGTAGGACATCCCTCATCCATGCATTGTCTCTTTCTAAAATTAGAAAAAA -0.39317675 2.87e-02 0.99993
67811 AGCTCTCAACCCATAATTGCTGCAGAACTCTAAACCTCTCCCTACTGTGAAATTCTTTTT -0.17469955 2.89e-02 0.99993
100039062 AACCTCAAATCTGAATTGAATGAGCCATGTGAAGATTTTGGTGAAGTGATTCAGAAGTGG -0.21445264 2.90e-02 0.99993
619665 GTCACTTGAGTAAGCAAATTGCTTTCCCCTGTTTTATAGATTAAAACGCTGATGCTTAAA -0.32627909 2.90e-02 0.99993
67120 CTGTAATGACGATTTTCCCAAAGGTTTAAAGGAGATGCTGATTTATATACCTGAATGGTA 0.25624862 2.91e-02 0.99993
214572 CACAGGCCTCTTGTCAATGATGGCAGTTACTGCAGGGGCTGACTTCTGCTATGCTATCGA -0.19757478 2.93e-02 0.99993
653016 TGAGTACTTTCAAAGCTTGGTACGCAGCAGGTAGTCAATAAACGAGGACAGTGTGTTGTT -0.29742863 2.93e-02 0.99993
621677 AATATCCTTCAGCTTAGACTGACTTCATTTCGTGATATCCTTTACCCAGAGTCCTTTTTT 0.1811315 2.93e-02 0.99993
27411 CCAACATCCAATCATAGTGTCAACAAATGTCTTTGCTTATGTAATCTTCAAAATCAGTCC 0.18013226 2.94e-02 0.99993
77798 AGGGAAGAGAAGATGTTTACATAGAAATGTGACATTTGGCGTTATTTCACATTTGTGCAA -0.28856159 2.96e-02 0.99993
242248 AAGATGGAGACTCATAGCATTCTCTGAAAATCCATTCATTTTTACCACAACTTTTGCCAC 0.24493606 2.97e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.33220982 2.97e-02 0.99993
23856 GTAAGAAGGCTGGCTAACGTATCTGACTGTGCAAATATGTTTGATAGTTCCTTTTATATT -0.23153365 2.97e-02 0.99993
331046 GTGGAGCTTGATCCAGTGACATCCTACCGTTCTAAGGGCTGGCAGGTGAAGATTGCCAAA -0.19254383 2.98e-02 0.99993
71691 CTTGGTGCTAGAAGGGCTGTGTCGGTACCTCATGATGCACCTGCTTCAACATCCAGGCCT -0.30930673 2.98e-02 0.99993
75695 CCAGACCACATTAATTTCAGTTAACAGGCTTTCTAAGCTGAACACTTCGCCACTATCATA -0.29756241 2.98e-02 0.99993
20779 CATGAACAAGGGGAGTCTGCTGGACTTTCTCAAGGGGGAAACGGGCAAATATTTGCGGCT -0.20863273 2.98e-02 0.99993
74190 CACATCCACACTGTAGTGCGAAGCTGAGGATTCTAAAAATAAATGTGAATTAAAATAGTG 0.63893576 2.98e-02 0.99993
107522 TAAAACAGTGCCAGTGGGATCAAGCCCATGTGAACCAATACAGTGTGAGTCCAACTAAAT 0.2616475 2.98e-02 0.99993
13175 CCTCTTCTTTGCAGCCATACCTGACTGTACTTTTGTTTCCATTTAAAAACACTGAATTCC -0.25066699 2.99e-02 0.99993
18209 TGACCACAGATTTTCCTTGACAGACCTGACTCAGTTCAGAAATAGTGCTCTGGCCTTCTT -0.45650746 2.99e-02 0.99993
100039631 ATATTAATTGTTGTGAAGACATCTAAGATTGACCCTCTTGCTGGGTGTGGTGGTCCGTGC -0.3567183 2.99e-02 0.99993
17172 CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA -0.31606027 2.99e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.24399306 3.00e-02 0.99993
218314 GAAACCGTACAAGTGTGAAGTATGTGGGAAGGCCTTTCATGTTCCATCATCACTTTCTGA -0.20562262 3.00e-02 0.99993
78785 GGGATATAATGTATGTGCTTATGTATGCTACATGTACAAGCTAGGTGTTTTCTTTTGTGT 0.3312735 3.00e-02 0.99993
64297 CATCCAAGGATGCAGCGACCATGTGAGCTGATGAGAGCCCTTGGCAGGTGCTTTATTCAT -0.35147445 3.01e-02 0.99993
56219 TGAATGGAGTTAAAGACTACGGATAAAATGTCCAGCTAGAGGGTCACTGGTGTGTGCAGA -0.37544974 3.01e-02 0.99993
319164 TAAAACTTGACAGTATGTGAACAGCTGAAGTCTCAGCCGAGGCCAGCATGGCTTTTATTC -0.18807223 3.01e-02 0.99993
20677 TTTTCTGCAATGAAGACAGAAAGAAGGCTCTGGGGTGATGCGTTTGGCATTTGTGTTGAG -0.33416456 3.02e-02 0.99993
78369 CTGGAGCGCTTCACCGGTTCAGATTTGGCTAATGTCACTTTGACCTACGTGATGCGGGCC -0.31867216 3.02e-02 0.99993
100121 GGCTCTGACTGTTGTGGAGGATTGAAAAGAATATGCTTTGTTTGATGAAAGATATTTAAC 0.16789344 3.03e-02 0.99993
320139 GCTCCTGGATGTGCTAAGTGACACAAGTCCTCCATGAAAACCCCGAGGAGTTGGAGGAGT 0.88128448 3.04e-02 0.99993
64214 TGCTTGAACGATGAAGATGGCATACTTTCACACAAGCATTTATGTCTCATATTTGGAATT 0.20419413 3.05e-02 0.99993
56699 CACACACACCCCTCTCCTAAATCTACCTGGTTGGTTCTAAACTCTAAACTTTATATTTTT -0.2834818 3.05e-02 0.99993
170767 AATGGATCAGTTGGTTGATTCCTAAACTGAAATATATCTGATGTTAAACTCGTAGCTACG -0.20679846 3.05e-02 0.99993
22756 GATGAGGGTCGCAAGGATTTGCCTGCATCAGAAGGCTCACAGGGGAAACAAACTCTATAA -0.35412237 3.07e-02 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.21706939 3.07e-02 0.99993
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.19844677 3.07e-02 0.99993
19046 TTTTTTGTTTGTTTAGAGACAGAGTCAAGTCCAGGTTGGCTTCCAGCTCTAGTCTCCTGC -0.16560081 3.08e-02 0.99993
74558 CTCTTTGGATCATTGACATAGCTAGTCTTCAACATCCTCATACAAATTGAAGTTGCATTA 1.27422651 3.09e-02 0.99993
24001 GATTTAGTTGGTCAGAATCTGTAAAGTACTAGCACCTATCCCTTTGGAGCAGCAATCAAA 0.953486 3.10e-02 0.99993
93725 ATACCAAGCTAAAAGATCATTGGAGTACTACACAGTTGCCTGTGACCCCAGAACTCCACA 0.40776699 3.10e-02 0.99993
17527 AACTCCCTATGTCTCAAGCTCCAGGAGATCTGATGTTCTCTTCTGGCCTCTGAAGCACCT -0.17948224 3.10e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.37563483 3.10e-02 0.99993
72016 CCTGTATGACACTAGAACTCCTTTAGGAAGTGTAAGTATTTAAATTATATCATAGCAGGG -0.19921291 3.10e-02 0.99993
67922 CTGGTGAATCTGCTGAGACCAGGTTTTCTGAGACTTGATTAAAGTCAGGGTGTCCTTTCA 0.54514714 3.11e-02 0.99993
66578 GGAAGAAGTCCTGACAGCCCTGCAAAAGAAGCTACGGGAAGTTGAATCTAAACTGTCCTT 0.33206359 3.12e-02 0.99993
244886 GGGTGGTGCTCCTGGCTGGGGTTTTGGGTTTTTGTTTTATTTGTTGTATTGTTTTGTTTT -0.16321047 3.12e-02 0.99993
76915 CAGCTAACTAATGTTACCCAGTTATCATCTATCTGCTAATTGTTTACCGTTTTGAAGCTT -0.22561016 3.12e-02 0.99993
258987 CATTTGTGGAGAGTGTCATTGTAATGGCCAATAGTGGTTTAATTGCTCTGTGTTCCTTCC -0.27194539 3.12e-02 0.99993
13340 GGATTCGACTGTCTATGGAAGAGTAAGGCGATGGCCTTCATCGCCTTCCTTGTAGGTGCT -0.19984645 3.13e-02 0.99993
625580 ATTGTGTTCTACAAGGGCTCAGTTACTGCATTCTACTGTATCCTGGGATATTTGGCCTGC -0.22845743 3.13e-02 0.99993
54215 GCAATTGTGAACTTCCAACATGGTGGATGTATTCATGTCACCAGCTCAGCATCCCAGAAA 0.2513684 3.13e-02 0.99993
75124 ATGCAAGATGCTCTTTCCTACAGGAAATTTCTTTGATAAATTGACCTATGGAGGTGATAC 0.22359822 3.14e-02 0.99993
73316 AACTATAGTCATCCTCACTCTGCATGCTGAGTGGCCCAGCTGCAACTCTAATAATACACA 0.16691561 3.14e-02 0.99993
12984 TAAAATTGGGCAGGCTCTTGTTGCTCCAAGAATAGACATGGTCCTCTATGGTTGTCTGAA 0.42906155 3.15e-02 0.99993
234366 GTGGAAATCCTCCATCTTTAGAAATCATTTGGACATGTGGGAGTTGAGAGTTTTGGAAAA -0.65094881 3.16e-02 0.99993
78425 GGCTCAATTAGGTTGTGAATACAAAAACCTGGTCTTTGTGTTACTTCAGTTCAATATGAA -0.23813376 3.16e-02 0.99993
70057 ACTAGGAGAGGCCGCGAGAATGCCTGTACAATTCCTCATTAAATCGTTTTCAAAACCTTG -0.20597631 3.17e-02 0.99993
23945 CTTTATGAAGGAGGGAGTATATTTTCTACACAGAGACTGTGTGGAAATATCCTTTGAATT -0.2048183 3.17e-02 0.99993
258358 CTGTCCTGTACTGATACCAAAGTTAATGTCGTTTATGGGCTCTTCATCATCCTATCAGTC -0.17603001 3.17e-02 0.99993
56277 TCTGGTCTCAAGAACACTTGTCTGAGGCTGACTCCATGCTGTTTGTACTTCCAGTTTTGT 0.2702809 3.17e-02 0.99993
634825 AAAGGCTGTTGAGCTGAATGTGGAATCTGGGTTGAGATGACCATTTGCTTTTGGTCCACA -0.15529181 3.18e-02 0.99993
79043 GGGTGCCCTGTGAAGGGGTTTTGTCTTGTCCCTCTATGTTATATCATTAAAAGAGCCTTC 0.24140989 3.19e-02 0.99993
56429 TATAACTTGAGCTTCAGATTCAGCTTCGTGAACTTGGAGAGAAAGAAGGAGCTTGAGAGA 0.17140686 3.19e-02 0.99993
622554 AAACCAGTAAGAACGAGGCTAGAGAGATGGTAGTTGAGTGCACACTGATAGTGCAGAGGG 0.39245363 3.19e-02 0.99993
72058 GCCAGCATCATGAAAGAACTGGAGAGAGACATATACTATTTAATAAACAAATGAAAAGCC 0.5292674 3.19e-02 0.99993
51791 GGAGGTGGGCCTAGTTCCTTGGCATAAGCATAGTGAACACAAATGGGTGACTTTGGCAGT -0.32862678 3.20e-02 0.99993
13688 ACCGGGCCATTTTCCACATCTGCATCAGAAGAGATGCCTCCCATGTTAGTATCTGATAAT -0.15325412 3.20e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.32073953 3.20e-02 0.99993
66578 CTTAAGAGTAGAGAGAAAAATCTTGTTTTACCCTTGAAAATTAGTGCTTAAGCCTCTCTG 0.35004556 3.21e-02 0.99993
13112 AAGGCACCTCCCACGTATGATACTGTGATGGAGATGGAATACCTGGATATGGTGCTTAAT -0.34382914 3.21e-02 0.99993
109342 ACCAGTGGGAAGACAGGCGCTTCAAGTTCTCAGGACCACCTTCCTTCCTGGGTTGGACAT -0.22281551 3.21e-02 0.99993
74186 TTTCATCACTCATGTTTCCAAACTGGAATTAAGCTCAACCTAACTTTGTGGAGTCTTAAC -0.60826544 3.22e-02 0.99993
16706 ATGAGAACGTGGTGCTCTTCATGGGGGCCTGCATGAACCCACCTCACCTGGCCATTATCA -0.34969601 3.23e-02 0.99993
67952 GTGTTTGTGAAAGCTGCGCATTAAAACCTTACAGAGACCGTTTCTCGTTTACTTAAAAAA 0.16422495 3.23e-02 0.99993
14864 AACCAGGTTATGGACACCCGCATACAGCTCATGATAGTTTGCTGCAGTCCCGATTTTGAG -0.22726521 3.23e-02 0.99993
435565 GATTATGTATCCACATTACCTAGAGCAAGGTGATCAGATATGTGTAAATAAAGTGATAGC 0.16101768 3.23e-02 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.15471307 3.24e-02 0.99993
58916 GAACCAGAAACTTTTGAAACACCACTAATGCTTGCAATAAGTTTATGGGTATTGCTTAAC 0.19275044 3.24e-02 0.99993
20273 TTCATCCTGGAGATGTTGCTCAAATGGACAGCCTATGGCTTCGTCAAGTTCTTCACCAAT -0.25416923 3.24e-02 0.99993
12778 TGGACATGTGTACAGTAGAATCTTCTGTGTTTCTTCAAGTTTTTACTTGGTGACTTTTTG -0.33399508 3.25e-02 0.99993
50708 TACACTTGCTTTGCCTTATTTTGATCAGCATAGTTGTAGATTAACTTTGTTTTGCCTCAG 0.38059414 3.25e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.47674488 3.26e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.46927077 3.26e-02 0.99993
23834 TTAAGAACCAGATTAAGTTTCCATAGTGTCAGGTATCGCTATGGAAAGAACATAGACTCA 0.22144274 3.26e-02 0.99993
12517 TGAGTGGATGGATGGCCCGGAGCCAGCCAGGCAGTTTTATTGAAATATTTTTAAATACTT 0.87694722 3.27e-02 0.99993
108961 TGTTGCAGTCTGTCTTTTTGTAGAGTTTACAACCCTCCTCAATCAAGTCTATGGAAAAAA 0.20438068 3.27e-02 0.99993
22121 AAGGAAAAGTCCAAGATGCACTATCGGAAGAAGAAGCAGCTCTTGAGGTTACGGAAACAG 0.14849703 3.28e-02 0.99993
80879 CTGGGCAGTGGTCTGTTCACCCTGAGTCCCACCCTTTGTTAAATAACAAACTGCTGATTC 0.54446254 3.30e-02 0.99993
230866 GGGAAGTGACCTACCTTTTCTAGAACTCCCGGTATTTCACCTTTAACCTTTACCATATCA -0.17701074 3.30e-02 0.99993
67342 GTTTTCCTCAGAAACTTTCTAGAATTCCATCTCCTGGATCTTGGGCAACACTTATGTTTC -0.31921583 3.30e-02 0.99993
22029 GGTCAGACATTAATGTGAATTTAACCTGCCCTGGACTGAGTTCCTATGTTAACAGACACG 0.84072098 3.30e-02 0.99993
57780 AAGAAGGTGAAGTGCAGGAAGGCGGATTCCAGGTCTGAGAGCCCAACATGCAAATCCTGT -0.3536853 3.31e-02 0.99993
74616 TTTGTACCACACATTTCACCACTGTTGGATACAAAATCACCAACATTTGAACCTGAAAGG 0.20273678 3.31e-02 0.99993
23989 TCGAAGCTGATGCGACTCCTGAGCTCCAGTGACGATGATGCCAACATCCTGTCAAGTCCC -0.13977466 3.32e-02 0.99993
435965 GTGATTTTGGGGGAGGACAGTAGTCCCACTTAGGGATTTCTGGGTTCTCTTGGATCGCTG -0.15664102 3.32e-02 0.99993
16992 AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC -0.22922385 3.33e-02 0.99993
625605 TCCAGTGCAGGGATCCTTGGATGTATTTTCGTACCCAAGATTTATATCATTATAATGAGA -0.25981731 3.33e-02 0.99993
56349 ATCAAGTGAAACCAAGCCATATTGTTTGAGCCAATTAAGAAAAGTGCAGTTTTTACAGTG -0.52642805 3.34e-02 0.99993
192161 TACACCTTGCCCAGTGGCCGAAGTGGGAATGGAAAGTCATTCTGTTGGAGGAGACGTGCC -0.38741492 3.35e-02 0.99993
104776 TAATCATAATCAACAGATTTGACCAGCTACTTGTGCTCAAAAGGGTTTCTTGTTTCTTAG -0.24287244 3.37e-02 0.99993
213989 TGGGGACCTAGAGAGGTGGGGACATGAAGGCCTCAGAGTGAATCCCTCTCTCTTGGAGAT 0.28330938 3.37e-02 0.99993
408058 CTCGTCTGAACCTGTTGTGTTCTGTAGAGGGCCTCATTCTCTGTACAAGTTTGTGGTTAT -0.17438433 3.37e-02 0.99993
78245 GCAAGATGACATTAAAAAGTTCCTTCCCAAATATTGTTTTGTAGTATGCACATGCGCTTT 0.27379592 3.37e-02 0.99993
13885 GGAGTTTAATGCTTGGTAGGTTTTCTGAGTCATTTGGAATTCCCTGTTAAGTAGCCTCAA 0.20574222 3.38e-02 0.99993
16193 CTGTTACCTAGCCAGATGGTTTCTTGGAATGTATAAGTTTACCTCAATGAATTGCTAATT 0.48743113 3.39e-02 0.99993
14011 CCTGTTGTAGTCTCATGGTGTTTCTGGTTTCGTTTTTTGTTTTTGTTTTTTAAGAACATG 0.38029915 3.40e-02 0.99993
230654 TGAGTTCAGAGGCTTTGGGCCACTTACTCAGTACTCTGGGAACCCCAGGCCAGGAGGTTA -0.15089203 3.40e-02 0.99993
72039 AGAAACTTTGGGAAAGCCTTCCTCTGTTTCATGTCCAGATACTGGTATTGTGTGAAAAAA -0.41742161 3.40e-02 0.99993
78926 TGATCAAGGTCTCCGAGGGGAAGTACCGAGTGGGAGACTCCAGCTTGCTCATCTTCGTGA -0.17359605 3.40e-02 0.99993
78016 TGGCCTGTTTCTACGTTAGAAGACCATGATGTGTGCTGAAGGTTTTGGGCTTTGTCCTTT 0.20558198 3.41e-02 0.99993
67529 TCCACACTAGTTATGGGAATCCAGCAAGAAAACAGACAAATCAGAGAATTACAACAAGAA -0.3616635 3.41e-02 0.99993
18600 AGAAGTGTTTGGGGAAGAGCCAAAATAAAGAGCAATAAAATAAGCCGTCCACGGGAAGCT -0.43400266 3.42e-02 0.99993
15903 TCCGCATCTCCCGATCCAGACAGCTGAGCTCACTCCGGAACTTGTGATCTCCAAGGACAA -0.3601974 3.42e-02 0.99993
213760 CTTCTGTTTGCCCTTTACACTGTCCAAGTAAGTAAATAACTGCCCAATTATAAAGCATTT -0.1712569 3.43e-02 0.99993
19663 CTCTCCTGCTCCTCAAAAAGGAGCTATGTATTATTATGTTGACCTCAGAATTCCCAGCTG 0.18561784 3.44e-02 0.99993
72515 CCTGAGTGCCCCAGACTTTAACTGTGTAAATAAGAGTGTTTCATTCAAATGTTAATAAAC 0.13842176 3.46e-02 0.99993
16443 TTTAACTAGACTGTGGGGTTGCTACAGATTAATATGAAATGGCGCTCCTGGTCCGTGTGT 0.26493995 3.46e-02 0.99993
53859 GAAACAGCTGCTTAGGACTCATTGTAGCATTAAGTTCACTGTGAATCATTTGTTGGGAGG 0.21557451 3.47e-02 0.99993
225049 ATACTATTGGCTGGCCTTGGAGGTCAATCTTGGCAGTGGGAAAGACAGCAAATGTGTGGA 0.38494788 3.47e-02 0.99993
67134 AAAGGCCCTGTTCAGAGCCCTGAAGACAAGGGGTAACACACCAAAATATGGACTCATTTT -0.14715658 3.48e-02 0.99993
228410 GGTCTTTCACAAGCTGATGATTGTTGCATTTTGGAGTTGCAACAACATTAAAACAGTTTC 0.15360336 3.49e-02 0.99993
14088 CTGCTCACCACAAGCAAGAATACCTTGCTATAGTATCAATTATTTCATTCTTTTGATGTG -0.1957762 3.49e-02 0.99993
14609 CTACACATTAACTCAGAACTTGTATTCTGAGTTTAACAGTCTTTTAGATTGACGAGCAAC -0.34823218 3.49e-02 0.99993
22035 GGGAAATGTTAAACTTTGTAAACTCTGAAACGCACAAAGTGTTGCTTTGAATTTCACCTT 0.96569426 3.50e-02 0.99993
66552 GAGCAGATTGTACAACAGTAATTACGTGGACTTACAATGATGTGTTATTGATTTCCTACA 0.25919127 3.50e-02 0.99993
228139 ATTTGCTTCCCTGGGTCCCAAGCATCCATCCATTTCCAAAGGATAGAGAAAATGGTAGCT -0.17048785 3.50e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.24376878 3.50e-02 0.99993
228357 AACCATTAGTCTTGTTGTCATTAGCTAGGCCCAGATATATGTCTGCACACAGAGCCAGAG -0.21886044 3.51e-02 0.99993
408189 CTGTTTGGAAACATACAGGAGGACGTATTTGATATCTTCAGAAATGCTTACAACTTTTTC 0.16990982 3.51e-02 0.99993
100047702 GTACTGAGTGCTGCCCTGTTTGTTCACACCCACCTCGGCCTCCTGAGTTTCTTACATTAG -0.19379832 3.51e-02 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.20225021 3.51e-02 0.99993
233877 GCCATCTTTCTCTTACCATCTGATTCCCTTTCTGTTTTGTTAATACATTGAACACACGTG -0.17352987 3.52e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.24056238 3.52e-02 0.99993
66832 TAAAAATGACACTTTTTCATTTATTTAACATCGTTCAAGGGCCATGTTGTCTTACTAATA 0.25527271 3.52e-02 0.99993
72792 AGCCTAACCCTATTCCCTCTCAGTCTCAAGTAGAAACTGTGAAGTCGAAAGAGACAGTGT -0.45723946 3.53e-02 0.99993
19218 ACCAGATCTTGGATCCCTGGGTTTATCTGCTGCTAAGAAAGATCCTTCTTCGGAAGTTCT -0.17190598 3.53e-02 0.99993
381236 GTGTGAACACATACACATGTGATAAGTTCCTTTTATTCCAAGTTTGTGTAGAACATTCAC 0.39570271 3.53e-02 0.99993
240261 TCTGCCTTCTCAAAGCAAAGCAGAAGATAGTCCAAAGCAGAGAGAGGAACAGAGGAAGAA -0.2609544 3.54e-02 0.99993
22173 TACTCTGCTACCTAGCATGTATATATAAATCTACCCAACAAATGTTCATTACAGCTGACA 0.16243033 3.55e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.21936992 3.56e-02 0.99993
27416 GCTCTTTGAACATGGTATCTTTAAATATATATTTCATTTTCAATAAAAGTACACTGCTTC 0.17478181 3.56e-02 0.99993
114663 CCTGATTGTTTTTCCAGAATGCAAATCTCAGGTGATACAGCTTTAGAACGGGCTCTCAGG 0.4173689 3.56e-02 0.99993
13805 TACAGAACTGCCCAATCCAGGGGCTCTGGGATATGGCTGCCCGGGATTACAGAAAGACAC 0.37950361 3.57e-02 0.99993
21960 ATATTCAGACTATCTGAAGGAAGCAGGGATCAGTTAGGCACCATCTGCTCCTAGTTTCTG -0.36198806 3.57e-02 0.99993
12151 TGGTGAATTTAACTCATTTTTCTAGACTTTTCTCGAGGTTTTCATGGTGTTACCTAAGAC -0.14938538 3.57e-02 0.99993
75766 TGATATTGATGGAGTCTTACCTCTCTGAAACCTTAAGCCCAAATAAATCCTTCCTTCTAT 0.30566904 3.57e-02 0.99993
229459 ATATGCAGGTGCCTGGCATTCCAAAAGACACGTCTTTTGTTTTTCCACCCCCTTTGATCA 0.17459386 3.57e-02 0.99993
18016 AACTGCTCTCTGACTTTCTTCCTCTCTGTACACTTGATTTAACAATGGCTGTGGGACACG -0.17524248 3.58e-02 0.99993
67230 TTTAATTGCTGAGGAAAGGCAATCCCTAGGGATTACCTAGGGATAACAAATGGAAGGGCG -0.17393205 3.59e-02 0.99993
545417 ATGATCAATCCTTTTATCTACAGCTTAAGGAACAAAGACATGAAGGGAGCTTTGTGGAAA -0.16774689 3.59e-02 0.99993
66789 TTGTTTGACGAATGGCAACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACT 0.16681456 3.60e-02 0.99993
381077 GTCTCCCAGAAAAATCTCAAAAGAAATCTCTTTACAGCCAGCATGGAACCCTCTGGACAC 0.14608155 3.61e-02 0.99993
93670 TCCTTTTACCTCTGCATGTGTCATGGCATATGTTACACAAAATAAAAAGACAGTTTGGAA 0.1909571 3.61e-02 0.99993
258371 TTCGAAACAAGGAAGTCAAGGAAGCCTTCCAGCGCACTTGGCATCGATTCTGCTGCCCGG -0.16327197 3.62e-02 0.99993
270058 AGGTTGGTGCTGTGGCTCCATGTGCAAAGCTAGATCCCGTGCTTAAGTGAGCCACCGTGT -0.42457422 3.62e-02 0.99993
15186 TTGATCATAACCTCACAGGGTCTTCGTGATCCACAACAGATTGTAACTGGGAAGTTTAAG 0.31707238 3.62e-02 0.99993
234515 CGGCATTTCAGATTTGAGGAAAGTTGCATTTAAAATAACTGAAGCCACGTCCAATGATGT 0.33335204 3.62e-02 0.99993
240832 CACCATAACTGCTTTTTGCATTCATTTCCATAGTGATGATGTTGAATGTGCCTTATTCAA 0.23337391 3.63e-02 0.99993
268395 GCTAGGACCAGAGTTTTTTGACCAGCCAGCAGTCACCCTAGCCCGTGCATTTCTGGGACA -0.21355061 3.63e-02 0.99993
13038 CATTTCAGTCTTCCACTGAGATGCACAAATCTATTCGTGATTCTTTGACAAATTTACATG 0.52488284 3.64e-02 0.99993
110962 CCACTGCTTTTCTATGGGAGACACTCTTAATTTAACAGATGAGAATATTTTGAAACTCTG 0.35254038 3.64e-02 0.99993
66989 GCTGCTCCCATAAGACCATGTATAGCATAACTACTTGATGGCAATAAAATCAGGTTTTGG 0.19375648 3.64e-02 0.99993
26459 TGTCCGGGTTCCAGATGCCCATGGCCCAGTAGTACTTAGAGAATAAACTTGAATGTGTAT -0.34462983 3.65e-02 0.99993
110596 CTGGAGGGGTCTCATTTTGATTTGGCAAGGACTAGTGAGAGTCCAACAGAACTGAAGATA -0.34626939 3.65e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.36712387 3.66e-02 0.99993
72097 CAGACCTGCCCGTCAACCAGGAAGAGAAACCTGGGTCGAGGATCCTAAAGACAGAAACTG -0.26820843 3.66e-02 0.99993
100502942 CCTGGGCTCTCAAATTTGAAAAGTTTCAAGTTATCTAGACTTTCGGTTCCTATCTAATAA 0.22819026 3.67e-02 0.99993
100041781 GTGAGCTGGAAACCAATTACTGGGTTTGAAGCATATGAGATATTGTTAAGCTATCTTAAT 0.24048369 3.67e-02 0.99993
211922 CTGTCAGAAACTCCTAGTGACTGTGGCTTTTAGAAAAATGCTATGATGAAAGCAACCTCA -0.25822496 3.67e-02 0.99993
228730 CCCGATGATTTTGATGATTTTTATGACACATGAGCTGTTGCATGCTTAGAAATAAAGTCT 0.21641156 3.68e-02 0.99993
100043911 ACCTGGTGCCTATCTTCAGTGGCTTCTTGAAGGATCTGGTCAAAGACAAGAGGAGAGTGC -0.14642029 3.70e-02 0.99993
110948 TCATAAACGAGTACCATCTTTATCCAGCTTCTGTAGTCAGGGCCAACTCCAGAAACCAGA 0.36945666 3.70e-02 0.99993
93886 GGGATAACCAGTGAATTTAAGTTTCTAAGTCCAATTGCCTCTAACTTCCTAACCGAAAGC -0.33356341 3.70e-02 0.99993
71831 GATGTTGACAAGTTAGTTCATCATTGATAAGTAAGTTTGGATGAGCGGTCTTTATCTTCC 0.18730851 3.71e-02 0.99993
67143 TGTATTGTGTAATAAGTAGCTTACTCTGAAGAGAGCCTGGCAAAACAATAAAACATTGTC -0.18335151 3.71e-02 0.99993
216558 GGATCACTGAAATAAGCACTTTCAGATACACTTTCTACTAATTATGGGCTAAAGAGTTTC -0.13481381 3.72e-02 0.99993
20849 AGAAGGAAGCAGATGAAACTGGAGAGTGTTCTTTACCATAGATCACAATTTATTTCTTCG 0.79588677 3.73e-02 0.99993
215929 TTACTGCTACAAAGGAAACACAGAGCAGGATTTAAGTTATGCATAGCTCTTCAACATGGC 0.30259418 3.73e-02 0.99993
13614 CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC 0.28727004 3.73e-02 0.99993
12942 GTTTTAGTGTCTCTTGTGGAAAGCGGCCAAGCTCCAAAGTCCTTTTCACAGGCATCAGGT -0.28390591 3.73e-02 0.99993
57811 GTCCCTTAGTGTAAGATGAGATGACAGAAATGATGATTTGACTATACAAATTGGACAAGA -0.18778879 3.74e-02 0.99993
258792 CTATACTGTGATCATCCCTATGTTGAACCCTCTGATCTACAGCTTGAGAAATAAAGATGT 0.18965538 3.74e-02 0.99993
73447 CCAAAGCCAAGCGACTAGTAGTGCATGAAGGCAGCCCTGTAACCAGCATTTCTGCCCGGT -0.18444843 3.75e-02 0.99993
70458 ACCCAATGATGATTCAGAGAATGACCCTGGCAGCGCAGAGTCCACTCCTGCCAAGGAGAG 0.39806314 3.75e-02 0.99993
280645 GATCCCTCATAAAACTGTGCTTTGAAAATATGAAGCTGGATTTCTATCTCACTGATAAGA -0.35737331 3.76e-02 0.99993
217151 CCCACTCCTCTGAAATGTCAAGGATCTATAGGACCTACTTATTTTGTCTTTGTGTCATGA 0.46639642 3.76e-02 0.99993
75338 TGTAAGGTTCATTGACAAGAACAACTATCGAGAGATCTGGGAAAATGACTGGCTAAAAAA -0.17094787 3.77e-02 0.99993
544922 AAGTACACAGTGTTACAGAGTTTGAGTAGAGAGATTCCATTTATCTTTATGCGGATAGAG -0.19390151 3.77e-02 0.99993
24050 CCTCTTTTAGCCTCTATGAGCATGGTGTACATACATACACATAGACAAGCACTCATACGC -0.20035953 3.78e-02 0.99993
231932 ACCTTCGTGAGGAAGCAGAGAAGAACATATTCAACCAGATTATTGAAGAAGTTAAGAAAG 0.45669085 3.78e-02 0.99993
109349 ATGGGACTTGCCAGGGACCCACACAGCACCCTGAAAAAGCAAAAGCCAATAAATTTGTTT -0.42061991 3.79e-02 0.99993
14312 CCAGTTGGCCCCAAGACTGTCTTTTCTTTCTTGAGTCTAACATGTAAATAAAGAAAATAT -0.17845033 3.79e-02 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.32725967 3.79e-02 0.99993
100678 GGAAAAATTTCACTTTAAGAAAATAATCATGATTGGAGATGGAGCTACGGACATGGAAGC -0.14703644 3.79e-02 0.99993
219151 TCTTGAATACACTGGCAAAAAGGGATGCTGGGAAAGGCCTGCATTTCCTTGACTCATTTT -0.2816983 3.80e-02 0.99993
50774 GCTCCAGCTGCTGCAAGCCTGTGTGTTGCTGTAAGCCTGTGTGCTGTTGTGTTCCTGTCT -0.18997753 3.80e-02 0.99993
73490 AGTTTAACCATGCCCTTAGTACCTATGAAGAAGCCTTAAAAAACAGAGAGAGCGTTGTCT 0.15865025 3.80e-02 0.99993
238055 TCTAGTGCCTTGGGACCACAGATGTCTGCTACTGTTCACCTAGACTCAAAAAAGAAACAA -0.3713748 3.80e-02 0.99993
16193 CTGTTACCTAGCCAGATGGTTTCTTGGAATGTATAAGTTTACCTCAATGAATTGCTAATT 0.42836289 3.81e-02 0.99993
13586 ATAACTGTCTGTAACATCACCAGTCGGGCAACAAATTATACCCAATGCAGATACCAATCA 0.46903158 3.81e-02 0.99993
15425 CCTCCTGTATAAATCCGACCTCTGGATCCGTTCTCGAATATTTAATAAAACTGATATTAT 0.23133608 3.82e-02 0.99993
30054 CTGTTAGATTTGTACCACTTCAGGTTTGATTTTAACTTGTTCTGCAGTGGTATCAGTTTT 0.34757929 3.82e-02 0.99993
53886 GTCCTTATTGATATCTGAAGATCATATTTTGTTAGACCTTGGTGAGGAACTAAAGAAGTC -0.18929595 3.84e-02 0.99993
12286 TTTATCATCTCGATTGAATCTTTCGTTTTCCCGGTGAATGAAACCGAGGTGGCTGCAAGC -0.35824425 3.85e-02 0.99993
18227 AAGGGACACATAGTGTTTGTAACACCGCCCAACATTCCTTGTTTGTAAGTGTTGTATGTA -0.4894848 3.85e-02 0.99993
18389 ATTGCCAAGGATGTAGGCCTTGGTTGCAAGACCTCTGAGACAGTACCACGGCCGGCATGA -0.23115183 3.87e-02 0.99993
98999 CTCAGGTCCTTTCTAATGTTGTCTAGGAAAGCCCCTTTCTTATTGTATGCATTTCCTTTT 0.41455602 3.87e-02 0.99993
790911 CAGTTCTGGTTGTTCTGGTGCGATTCAAACTCAAGAGCCATTACATTAGAAGTATAGCTG -0.17131447 3.87e-02 0.99993
23943 CAGAGATAGACCTTTCCCAGGGTGCAGCCCAGTGGTATGACCTGATGGATGACAGAGATA 0.42009493 3.87e-02 0.99993
382051 GGCAGGAGCTCCTTGACCTGCATATGGAAATGGGGCTGAGCATTGAAGAAGCATTGATGT -0.22941565 3.88e-02 0.99993
226470 TGGTTGAAGTCTTGGTGAAAGAAAATAGGATTTACAGCAGCGCTTCACAGATTAAGTTTA -0.1551786 3.90e-02 0.99993
94118 TTCCACCGATGGAGTAAAAGGTAGGCACGAGGTCTGTGCTGACTGCAGAGAGGAGCGGTT -0.19160181 3.90e-02 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.56028653 3.90e-02 0.99993
23863 AACAAACTATGGCAGGCAAGCAGGAAGCAGCTGCTAGGAAAACCTGGCCCCAACCAGAGG -0.18630526 3.90e-02 0.99993
224530 TGGTCCTTGGAGGATGTTGACCTGTTTGAAATCAATGAAGCCTATGCAGCTCTCTCTGTT -0.44733256 3.90e-02 0.99993
15531 ACATACGACTCTGTATTTGGGTTATTATTATCACATCTCATCTCCTCTTTGGGAAAAGAC -0.13432996 3.90e-02 0.99993
29876 TAACATTAGCTTTCGTAGCAGTTTATACCATAAGATGTTCTGACTGGTTTGTACACTAGG 0.45973819 3.90e-02 0.99993
66387 GAGCCTTAGGCCCAACCTTGAGGAGGTGGATGAAGTATTTGAGATGTCTCTGGCCCACTT -0.14711659 3.91e-02 0.99993
13731 GGTGGCCTTTGCCTTCACTTTCATCAGCGGCCTCATGTACATGATCCTGAGGAAGCGTAA -0.17990157 3.91e-02 0.99993
14998 GGAAGTGAGCCCGAAGCTTGAAGGTCAAATCCCAGTGTCCAGAGGTTTGCCTGTGGCAGA 0.85253431 3.91e-02 0.99993
109959 GCTGAGGACCCATTTATTGCAATCCATGCTGACTCAAAATTGTAAGAATCTATATTAAAG 0.24998375 3.91e-02 0.99993
22287 TGAAGCTCACTGGATTTCAGAGATATTCTACTGCTAAAGCCTTGTCACTGCCCTGTGTCT 0.18011498 3.91e-02 0.99993
56013 TGGTTTTTCTAGCCGAGTGTTGGGGCTTTAATAAAACTTGTTTCTTTTTTCTCTCCTGGA -0.1646027 3.91e-02 0.99993
100041654 AACCATGACCTGAGGAAGTTATCTTTCCTGTCCTTCCTGAATTATATCAGAACACTGAGA 0.72118609 3.92e-02 0.99993
73728 TATGCAGCACTGCTTCGAGTCAAGATGAAGGCAGCCAGCGAGGAGCTGGACACCATAGAG -0.21223807 3.93e-02 0.99993
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.69674288 3.94e-02 0.99993
268878 TGTGTGGACATCAGGTGAGAACAAAAGCTGAGGTAGCATTTGGCATTGGAAAAAATTGAG -0.29721634 3.95e-02 0.99993
212980 TATGTGATAAATCAGAGTATAATGTTTATGGTGATGAAATTAAAAGCTTCGTATATGTTT 0.4566668 3.95e-02 0.99993
16648 ATGAGCAAATACAGATGGTTATTGATTCAGGGGTTGTACCCTTCCTCGTACCCCTTCTGA -0.18419395 3.95e-02 0.99993
330483 CTAGTCTTAGCGCCGAGCTGTGGGAGAGCTGCCAAGTCCATAAATGTCCCAATGAACGCA 0.53138384 3.95e-02 0.99993
382090 TTTGATACTGGCTGCCTCGGCAGCTGGTGATTCGGTAGATAGAAATACAGTGGAGTTTAT -0.15394836 3.96e-02 0.99993
100039027 GGAAAGTTATGGACCTCTTGGGATGACTGGAATATCCATGGGAGGACATGTGAGTTTCTA 0.20409711 3.96e-02 0.99993
213054 GATCATGCCCTTTTCTGGCATGTGTGTATATCCACACACATACATTTATATATACATATC -0.14330118 3.96e-02 0.99993
108067 TCCGCTGCTATGTCCACATCATGAAAGAAGGACTTTGCTCTCGAGTAAGCACACTGGGAC -0.20638914 3.96e-02 0.99993
272359 TTCATGCAGGGCGAGATCGCTACTATTCTTGCTGGTGACATCAAGGTCAAGAAAGAAAGA -0.21785172 3.96e-02 0.99993
75369 CTTCCTGCATTAACAGACCGTGACCTGGAATTATAAGCAGAAATAAACTCTTCCCTTTTC 0.52948942 3.96e-02 0.99993
13601 GTCCAAGGAAGAATGAGTCACCCTGAGCCTCAGAGGATTAGATGGGGGAACTCCGCCCTA 0.30318858 3.97e-02 0.99993
68176 AACAGGGGCCGCAGTCGGCAGCCCCTGGTGCTAGGGGATAACTGTTTTGCTGATTTAGTT -0.25064979 3.98e-02 0.99993
50794 TTTTAGCTTTGAAAGATACAGCTTCCAGAACGGACAGATGGAAACTTTGGACAGAAAAAA -0.25825347 3.98e-02 0.99993
232440 ATTTCATTCCCAGTATTGGTATGACGTCTACACCACGTGCTAGTAACTGAGGGTACAGCT -0.25671521 3.98e-02 0.99993
104174 CACTAATGTGCCTGATCTGTCACAGCATAAGTGTCCTCCTTTCACTGTGCGGACTTTTTT -0.25026158 3.99e-02 0.99993
69834 GTTGCCTTCCTGGATATGTCAGAGACAGTGTACAATTCAACCATTAAACATTTCTGTATT 0.2742732 4.00e-02 0.99993
71768 TGATCCCATCAGCGCATACTCTTGACATTGACGTCATGTGACATCCATCCTAGAAGTGTT -0.28871374 4.00e-02 0.99993
50524 TGAGATGTAGTATTTACTCTTAACATAGGATCCTGTGGAACAGGTGTTCTGAGAAGACTG -0.16756205 4.00e-02 0.99993
71770 TGTAGTTCCCAAAAGAAGATGTGTCAGGGCAAGCAGAAAGGGAAGTTTAGGCCAGAATGT -0.30527794 4.00e-02 0.99993
18212 TTCTCACCAGCTTAATTTTAGCCGATGCATATATGAACTCACAAACAAATAAGAAGTAGC -0.29234724 4.01e-02 0.99993
258291 GTTGATATGCTTAGTCATATCTATTGCTAGTGAATTTTCTAGTGTCCTGATCACTTTAGC -0.1766514 4.01e-02 0.99993
60534 AACAAGGCTCCGACTGTGAGCAGAAGTGTAGGTCTGACGTGGCACTGAAACAGCTGCGAG -0.16950158 4.01e-02 0.99993
66171 GACTATGCCAGGAAACTGAGACAGGCCTTGCAAGGAGACGCTGTCCCTGTGTTTGACCTG -0.17968769 4.01e-02 0.99993
672553 CCAGATGTTCATCATTTTTATCTGATTCTCAGAGGGAATTTCAATGGCTGTATTAACAAC -0.37766313 4.02e-02 0.99993
74525 AACATCCTAACTTCTTCCTAGAAGTGTGAATCGCTTCCCTGCTGAATGCAATGCAAACTC -0.18101241 4.03e-02 0.99993
258289 GACATGAAAAGGGCACTGAGAAGGCTGCTCAGCCAAAAAAGCTTGATTTGTAGTTGGTGA 0.20360303 4.04e-02 0.99993
13143 CAAGCTCGTGAGTAAAGACTCTCTAGAGGGAGGGACCAATCCTGTGACTTACCAGAATCC 0.436265 4.04e-02 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.36260616 4.04e-02 0.99993
69029 CCAGAGTCCTGTGCTTTGGGAGGCTCCCTCACGGCTGTCCACAGAGTACTGGAAATAACA 0.1762994 4.04e-02 0.99993
20556 ACAGAGGAATGGGTGAAACTCCAGATGAATGCCCCATCAGGTTGAAGGGGGATTAATAAT 0.92333595 4.04e-02 0.99993
20840 CTGACATGTTTAAATGTGACTTTGGGATTATTGTTGCTTCAATTTATTTTGCCACTGAGC -0.775404 4.04e-02 0.99993
216848 CTGTCCCAATCCCTTCTTCTGTATCAGGTTATCGGTTGTACATATAAATTATACTTTCCT -0.21699066 4.05e-02 0.99993
19719 CAGTTTCATGAGCACAGCAGAGCGCGTTCGGCTGCCTGATGACTGCACTGTGGGATACAT -0.1665389 4.05e-02 0.99993
14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA 0.8075861 4.05e-02 0.99993
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.29411386 4.06e-02 0.99993
20602 GAAATGGACTTGATGCGTATTCTGTGGCCGCTCTCTGTGCACGGCGGCATTCTGTCATTT -0.31812048 4.06e-02 0.99993
76808 GAGTACTTTCAGGGATAGCAATGTGTGAATGGCACTTAGAAGATAACATGTGAAAGCCAT -0.47877623 4.06e-02 0.99993
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.16944891 4.07e-02 0.99993
208198 ACCCCATCCAGTGATGTCCCAGAAGGCGCAGTCTCCAGTTTGGGGTTCCACTTCCTCATA -0.13743995 4.07e-02 0.99993
320799 CCTCGGCGGTACTTCCAATCTTTTAACTGTTCCTAAATAAAAATGTACAGACACTTCTTA -0.19006499 4.07e-02 0.99993
234595 AGCATCCAGACTTGCTGAATTGTTGTTCTCCCATCCATCCCTGGTACTTCTGGTCCCGCT -0.1708133 4.08e-02 0.99993
112405 ACTAACTCAACATAGTTACAAGAGGAAACAAGCCACAGGAGAGGGTTGTCTCTTCAGTTA -0.23000485 4.08e-02 0.99993
69748 AAGTGCTTGGAACGTTTCTCTCAGATTTCCCATGGCTTCTAATAAACTGAGTGACTTTAA 0.25118055 4.08e-02 0.99993
545288 AACACAGTCCCAGAAATTCCATCTATATTCCTTCTTATCCCAGCTTCTGTTCTCTAATTG -0.99617105 4.09e-02 0.99993
71146 TGGAGGGAGACCTTTTGTTTTATTCTGTTCCCAATAAAAGGACTTGCCAGCTTGAGGCTC -0.19415485 4.10e-02 0.99993
68394 ATCGCACTGTGCAGCCAGTCCTTCTCCCTGGCTAATTCAAAATAAAGTAGCTTCATTCTC 0.38994244 4.10e-02 0.99993
545156 ACTGTCTTTGTACTTGAACTTAAATCCAATGGAGAACCTTAACACGGGCATTTGCATGAC -0.39472459 4.10e-02 0.99993
103978 ACTGAGTCTATGGCACTCCCTCTGATGGGGACACTGATGTTTCTTCCCTGGCTTTGGTAA -0.21047801 4.11e-02 0.99993
18124 AGAATCAGCCTTTTTGGAGCTGTTTGTTCTTAGACTTTCCATCAGGTCAAACACTGCTGA -0.24207744 4.11e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.2915552 4.12e-02 0.99993
12614 GTGTATTTATTACTGTTCAGCACTGGATGGCAACACAGGTGAGATGATGCATCTATAATA -0.22346936 4.13e-02 0.99993
330921 GAATGTCATTTTTACTTCTTTTTGAGGAATTCCCAATTTGGACTCTTAGAACCGGGATGG 0.19618007 4.13e-02 0.99993
231004 GTGGGGAGAAAAATCATTTGTCATTAAGCCAAAGACTTTACCAATTCAGAGAAAGGTCAG -0.15981566 4.13e-02 0.99993
105387 GTCGGTTTTCTGAAACATGATCTCATATGTTTATAGGTAAACGAGTCAGACTTACAAAAG 0.49587477 4.13e-02 0.99993
26405 CTCTCTTACTGCACTTTCCTTTTTTATAAAAAAGAGAGATGGGGAGAAAAAGACAAGAGG -0.21765181 4.13e-02 0.99993
14260 TTCTTCCTGGCCTCTCAAGTCAAGTTTGAAGACCTCCTAAAGGATTTGAGGAAGCTGAAG -0.32678665 4.14e-02 0.99993
66412 CATCAGAGTGGACTACTCCTTAGCTGTAATCCAAGCTTCTTGAATCATTAAAAATACATA -0.28437917 4.14e-02 0.99993
66789 TTGTTTGACGAATGGCAACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACT 0.15165472 4.15e-02 0.99993
214239 AGACACTCTGGGAACAGTAGCCTGATGCTCTGAAAACATGAATAAATGAAGTGGGCGTTG -0.43191209 4.15e-02 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.19591677 4.15e-02 0.99993
18104 TAGGTCATTTATGCAATATTCGCCATTTTCTTCGGGCTAGTCCCAGTTAGATGGCATCCA -0.294582 4.15e-02 0.99993
17183 TCTCCGGACTTTAGCACCATGACGCACCTGCTGGAGAATCTCAAAGGCAGCATTTGCCCA -0.2970759 4.16e-02 0.99993
109593 GAAGCTGCAGCGACTCAGGCACGCCTCAGTCAACTCATGCAGAAACAAGAGAAAAGTTTT -0.2159812 4.17e-02 0.99993
57441 TTGTCAGTGTCAGATATAAACTGTATATTAAATAAACTTCAATTTCCTGTTGAACATTGT 0.50832192 4.17e-02 0.99993
16418 GTGACTCTACATGGTTTCTCATTTACATTAATCTCTGATAATAAAACATCCTGGTCTTTT -0.31306355 4.17e-02 0.99993
12831 CCTGACCTTCAAAAGATGTTCTGAGGTGGTCTTGTAAAGGTCGCCAAAGCCTCCATTTTT 0.31456743 4.18e-02 0.99993
74654 TAAAGATGAGAATGGGTCAGGTGTATCAGTGAGGGAAGCAAAGCCATAGCCCTTACTTCC 0.18216088 4.18e-02 0.99993
12870 GCTTGCAGTGTCTATATGTACTAGAGATAAGAGACAATGAAAGAATCTCCTTTAGTGATA 0.29698375 4.18e-02 0.99993
100040320 AGGATATTGCTGCCTACAGAGCTAAAGGAAAACCTGATGCAGAGAAAAAGGGGTGGTCAT -0.22475331 4.19e-02 0.99993
22229 CAATGTTTTAGGAGAGATTCTGTCCAGAGAAGTAGTTTGAGGAAAATGCAGTTTGTAGTG 0.17557607 4.19e-02 0.99993
74164 AGTACTTTACAGAAGATAGTGAAGGAGGCCGTGATTGACTACTTTGATGTCCAGGATTGA 0.22952362 4.19e-02 0.99993
212528 CCAGGAGAGAAGGACTCAGAGAAAATAGCTGTGGACTTGTCTGATCAAGAAGAGGAAACA -0.31804117 4.19e-02 0.99993
11551 CTGATTTCACGAGAGAAAAACTAAATGTCAGCACTTGTTGCTCGTGACGGTGGATTTTTT -0.33099189 4.20e-02 0.99993
15019 GACATGGACATCTACACTAGGCTGGTTCCCCCAGTTTCTAGAACTTTCCAAAGAATACAG 2.16350319 4.20e-02 0.99993
11855 ATCGAGAGTTTCTGTCTACCACTAAAATCCATCAATCTGTCGTTGAAACATTTATTCAAC -0.22381016 4.20e-02 0.99993
20887 GATGCCCACTATGCCAAGATAATGACAGGTTGTGACTTCACGTTCCGCTGTCAAATATGA 0.29086574 4.20e-02 0.99993
241627 GCTTATACTTCTCTGAGACCGATACAGATTACAACTTTAAGGAAAACAGCTAAGGTTTAT 0.16106552 4.20e-02 0.99993
17766 GAAATGTCACCAATACACCAATGTTTGAATTCTTCGTCCCCACATACTGGTCCTGTTTTA 0.25728593 4.22e-02 0.99993
327762 AACTACCAACTTCGGGTCTGATTCCCAAATCATACAAGTTACATTTAAACAGTCAGACAG 0.25067438 4.22e-02 0.99993
331535 TTACTGCAGAAAGGATGGGTTGAATTGTTTGTTCCAAAGTTTTCTATTTCTGCCACATAT 0.17058736 4.22e-02 0.99993
20557 CCCAAAAATATTATCTGTCGGCCAAGGCAGTAAAGGACTTAGAAAAAGCTCTCGTTGAAA 0.21661332 4.22e-02 0.99993
11717 ACTTCTGTTCTATGTTATTATCTAGGACTCAACGAGTCATCTCAAACCATATTCTGTGAA 0.1909036 4.23e-02 0.99993
105785 ACTGCTTCATGACTTCAAGCCAAGACTTGGGACTTCATGTTAGAGTGACTGGTGTGAATT 0.32631807 4.23e-02 0.99993
245269 GGATGAATTGCTGTTGTGCTCATGTGAGATGACGCTAATGCTCTGATAAACACCCAGTTC -0.39380986 4.23e-02 0.99993
66498 TATCTGGACCCAGACCAGAGAGGACCTGGACCTCCTAGAGGCCTCATTCTGGGAGAACTA -0.16966955 4.23e-02 0.99993
238055 ATTTGTTGGTGAGTCCACAAGATTGATTGACCTGTCCATTCAAAACTACCACGTGTTTCT -0.1676406 4.23e-02 0.99993
69185 GCTTCGGGAGTTATTACAAGTTGAACTGAGAACAAGAAAAACTTGCTTTTGGCGCCATCA -0.18178049 4.24e-02 0.99993
317757 ATTAATTTCACTCTCATTTGATTCCCATGGATCAGACATGCCAGGGAATCTTCTTTTAAA 0.53774652 4.24e-02 0.99993
76400 TTACCAGGCAGAATGGGACAGCTATGTACCAAAGCTGTACAAACAGCTGTCTGGGAAATA -0.1788227 4.24e-02 0.99993
19668 CTTAAGGGAACAGTGTTGCCCCCTGGAGGATCAAAAGTCATAGAATGCAGAAAAAATGAT -0.1664513 4.25e-02 0.99993
71929 AGGAAATGGACCATGGAATTAGACTAGTTTCAAATGAGGGCTGCTGAGAAAGCCACACTT 0.36094523 4.25e-02 0.99993
258671 ACTTTATCCTTTTGTGCTTCTCGAGCCATTGACCACTTTTACTGTGATACTCGACCAGTT -0.18362219 4.26e-02 0.99993
751865 GGTCCCAGTGGTGACCAGAGCTGTTCTGGGACTGACACATGAACCACATAGTACCCCAAT 0.44641004 4.27e-02 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.25056181 4.27e-02 0.99993
666244 GAAAGAACATAAAATGATACTCTCCTTTCAAGAGCAACATCAATATTGCCTGACAGTCAT -0.15500803 4.27e-02 0.99993
224756 ACCATTCCCTTCTTGGCTATTGTTATTGCTTTGGTACTTGGAGCACTCCTTATGGGAGCA 0.1968398 4.29e-02 0.99993
65255 GTCATAGTGTTGCAATGTTTCCCTTAGTCTAGTGTGGAATATGTAGCCACTTGTTTTGAA 0.32282035 4.29e-02 0.99993
320145 TGCAACAAACGCTTCATGCGCAGCGACCACCTGAGCAAGCACGTGAAGACACACAGTGGT -0.20872502 4.29e-02 0.99993
209692 CCATTTGCTAAGAAGGCAGATGATTCGGAACTTCAGAAAACCTCTCATTGTTGCATCTCC -0.20614132 4.29e-02 0.99993
75829 CGAGCTTCAAGAATCTGATGTAAGAATTCGTACGTTATAGACGATTAAAGTTAGAAACTG -0.24686447 4.30e-02 0.99993
69634 ACAACCAATGAATTTAATCCCCTTTGTGGAGACTGCAATGGGTTTGCTCAATTTTAAGGC -0.186656 4.30e-02 0.99993
231863 ATTCTCTCTGTCACTCTCATGAGTACAGTGACAAGAAGTAATCTGGTGAGCCATGGACGA -0.21733129 4.32e-02 0.99993
231713 CCAGAACTTCCTCACAAATGCATGAAGGACTTTGATCGTGAATTAATTTTTGAGGTATTA 0.15595651 4.32e-02 0.99993
17766 AGGTGGACTCATTCTAATACAGAAGTCTGGCTGGTTCTGGCCACTCAGGATGCTACACAG 0.28174758 4.32e-02 0.99993
633640 ACACGTGGAAACGCTTCACTGTCCATTGTATCTGTCGCCGTCACGGGCGCTCTTTCACAC -0.36818834 4.33e-02 0.99993
65973 ACTGGTAAATGGCTGAAATCAGTTTCTCTGAACTTCTGTATGTAATCTGTTTCAAAACTC -0.36924608 4.34e-02 0.99993
65115 CTCCTTCCTAGGTTAGGCTGAATAAGCAGCAATGTATCTTTTCTGTACTCAAAATAAATG -0.19166067 4.35e-02 0.99993
667772 AGAGGCCGCAGAATCGCAAGTCAATAAACTCAGAGCTAAAGCAAAGGAACTTGAGAAAAA -0.25591829 4.36e-02 0.99993
19283 TCTGGACAGTAATGGTGCAGCTTTGCCTGATGGAGATATAGCTGAAGCCTGGAATCTTTA -0.35174147 4.36e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.23419312 4.36e-02 0.99993
67261 AGAGGCTGATTTCAGGATATCCTCTTTAATCCTCTCTCAAACCTTTTTGTTGTTATTTTG -0.26015353 4.36e-02 0.99993
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.22135452 4.36e-02 0.99993
66789 TTGTTTGACGAATGGCAACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACT 0.16414764 4.37e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.17466221 4.37e-02 0.99993
72508 ATAGTACTTTTCTCATGTGACTCAACACTATAGCACAAGTATTATTTCCCTGGATTCTCT -0.2522338 4.38e-02 0.99993
70226 AACTTAATGCATGCAGCAGCATGCCTGATATACTCATTAAGCTTTGTGCTAATTTGATAT 0.15959657 4.38e-02 0.99993
545934 TATGGTTGAGGCATGTCAATGAAATTTTGGCTGCAAGTTTCCCCACCCTTTCTCCCTTAA -0.14648113 4.39e-02 0.99993
68201 GGTCACCATTTGCTCCTTTGTAATACTTGCTACCTTAAATGTTAAATAAAACTGGGAACA -0.18776849 4.39e-02 0.99993
77644 TGGGCAAGTTCAGCTCTGTTACTGTGTCTACCATTGATGAAGAAGAAGAGGAGATAGAGG -0.14228356 4.39e-02 0.99993
69717 TCTGTAATGGAATCCCATGTACCCTTATAGTATATGTCTGGAGCTAGGTGCAGTATATTT 0.27605888 4.39e-02 0.99993
16161 AGTTTCCCTATTAGAGTATTGGGCACTTAATAAATGGGCCTTCCCAGAGACTGAGAAACT 1.3032103 4.40e-02 0.99993
269630 GCGGTAGACTCTTTGTAGTTGGAAATCAAGATTTGGTTTGTAGCATTTTTGTTATTAGGT -0.25625146 4.40e-02 0.99993
71564 GTCAACCTGACCTTGGAAAAAGTCTCTGAGTGTCTGACCCAGCACTGACAGTGGCTGCCA -0.24891974 4.40e-02 0.99993
68039 TCTTTCCTGCTGTATTTCTTGCTTCCCTGGTGAAGTGGTGAATAAAAATACTGCTCTTTA -0.22181783 4.40e-02 0.99993
72129 GGGATCATTAACGCTTCTTAAAGTTCTGAGTTAGTTGACTTGAAGTCTTCAAAAATTGAG 0.13932097 4.41e-02 0.99993
56264 GAAGCTGGAGCGGCTGAGGGGACAGAAGTAACGTCTTCAGCTGAAGAGAGCCACATCCTT -0.32938643 4.41e-02 0.99993
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.15795708 4.41e-02 0.99993
23920 CAGCCTCTCTGGGGAAGACTGGAGAAGACTCAATAAATACGGAGGTCTGTTTGTATCTGG 0.81811912 4.41e-02 0.99993
74445 TATGCAAGTTTATGATGTAGTGTTCTAGAATCATGATTTGATAAGTTTGCATGACGGAGG -0.20188393 4.41e-02 0.99993
100504534 TGTTTACAGTTGCTTGAAGACCAGTTTTGTGCGATTATAAGACCATGTAAAGTGTTTTGC -0.17776822 4.42e-02 0.99993
24135 ATCTTCAATTTGGAGCAAAGACTTGGGTCATGGATTGTAGAAGCCTCACACCAGTGTGTC -0.35809235 4.42e-02 0.99993
14198 GAGAGTTGGGACAGTGGTGGAGAAGCATTTCCAGGGGACCTCCATCACCTTCTCCATGCA 0.27205296 4.42e-02 0.99993
104418 CTGGTCTTCCTCCTCATGTATCCAGCCATTTCATTTCGGACTGTATGGCCTGGGGTGGGG -0.31588368 4.42e-02 0.99993
14289 AAATTCTTGACATGTTTGTTAACCCAACAAGCTCATTGGCTTACTTCAATAGTTGTCTCA 0.31337461 4.43e-02 0.99993
50795 TGGCTTTCAGAACAAAACACTTCCCAGAGAGCAATCATAAATAAAGATTGATGCCAAGAA 0.41165405 4.43e-02 0.99993
330788 TTTAGGTGGTTAATGGTACTTAGACAGGAGGGCGTCATAAGATCTCCCCCTCCTTTGAAT -0.15069942 4.43e-02 0.99993
14371 TATTTAATGATGTAATTTATTGTGGCATTTCTCTGGAAGCTGTGACTGGAATAAACCCTC -0.4451226 4.44e-02 0.99993
67238 AATGGAGCACAGCTTTCTTCCCTGCAAGAGTGGTGAAGGCTCATGGTATTTATAAGCAAT -0.30377462 4.44e-02 0.99993
100434 TTGAAAGCCTGGAGCAGAGCCAGAAAACTGAAGCATGCAAGGGGCAGTTGGGGCATCTCA -0.18917653 4.44e-02 0.99993
71393 TCAGAGAACTTCCTGCAAGCTCACGTTTTGGGACATGGAAGAGACTGTTGTTGGGTTTTA -0.40551008 4.44e-02 0.99993
20646 CAAGATGGGAGAATCTTCATTGGCACCTTCAAGGCTTTTGACAAGCATATGAATTTGATC -0.16767354 4.44e-02 0.99993
330385 GGTCTCAAAGGAAGAACTCTCTAAATTAGTGCTATTGGAGGGAAAGACAATTGAAAATTA -0.16444199 4.45e-02 0.99993
67382 GAGGAGGGCCTGCCCATGAGCTATGATGAAAAGCGACAACTTAGCCTTGACATCAACCGG -0.15632626 4.45e-02 0.99993
53906 AGAAATCAGAAGAAATGAAGACACAAGATGAGGAGTCTGCATGGAATCCCCAGCTGACCT -0.16392139 4.45e-02 0.99993
241230 CTGTTCATCCATCGATTTTCCCAAAAAGTAAGAGCATAGGAGATGAGGCCTACATGCCAA -0.37446817 4.46e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.16710182 4.46e-02 0.99993
11607 TCCTCCACATATATGTACATATGTATCTCTAAGCTGTCATTTGATGAAGTTTTGGCAATG 0.52434163 4.46e-02 0.99993
17183 GGAGGTGCTGGTGGGGAAGGACTGCTACACTCGCCGCGAGCTTTGTTGGATTTCTTTTTT -0.42675114 4.47e-02 0.99993
108124 TATGGGTATGCACAAGATACATCTATTACATACACAAATAATAAAAACGAGAGGCCATGC 0.64275999 4.47e-02 0.99993
30944 AAAGGTGAGAATAGGTGTCAGATAACGTGGTATGGTTACTTTTCGTAGACGAGGTAAAAG -0.14966561 4.47e-02 0.99993
75452 GGGAAAGGATGGGGATGCCGAACCAAAGTGTCTTTCATCTTGTGCAGCGAGGCACCACCT 0.2103815 4.48e-02 0.99993
16205 GCTCAGAGCTTTAATGATTCACAGTGCAGTGACTTGGCATCAACTTTGCTAAGGTTCTGT 0.58940631 4.48e-02 0.99993
20360 CCGCCCCGCACGGTGGTCATTTCAACTTCTGACGGAAGCTGCTCGCGCCCGCCCGTCGAG -0.25894393 4.48e-02 0.99993
56189 CTCTGGATGGGCCTGTCTGTTTTGGACAACTTCTGGGCATGTGTGACCATGTCTCCCTGG -0.19721194 4.49e-02 0.99993
80334 TTTACGACTGTCTGCAACAATAAATCAGGTATCTATTCTGGTGTAGAGATAGGATGTTGA -0.24733538 4.49e-02 0.99993
101533 TTAGGTCATCTTCCCTCTTGGGGTCTGCTCCCAGGCAAAACAATTATAATAAAACCACGC -0.37280189 4.49e-02 0.99993
319215 ATGCGCTGGTTCTGAAAGAGTTCCCTGACTCTGCTTCTTACGTGTTTCATTTTCAAAAAT -0.22981134 4.50e-02 0.99993
19652 ATGACAGTCGTCCTGGAGGATATGGATATGGGTATGGGCGGTCTAGAGACTACAGTGGCA -0.49477071 4.50e-02 0.99993
66307 GACATCATCAACCAGACTCATAGGGGTAATACTGTGGTCATTGTTAACCAATCAATAAAC 0.22690166 4.51e-02 0.99993
14062 TTTCCAAATACTGTAGAGTCGCTTCCACGAAAGTCCTATGGTTGTATGGTTAACTTGGTT 0.27660981 4.51e-02 0.99993
380608 TAAAAATCCGCCAAGAACATTATCCACACACTGTTCCATTCAGCCAGTGTCTGTTCACTA 0.23889018 4.51e-02 0.99993
73673 CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC 0.28515902 4.51e-02 0.99993
66729 ACTGCAACGTACAAACTACTGGCCCTTAATCCCTCCAAAAAATTAAACTGACTTGCACAT -0.22783418 4.51e-02 0.99993
18583 GTCTTATGTAGAGCAAGCACAACTGTAACCTAGTTTAAGAGAAACGGTGCTTTCTTTTAG 0.15295401 4.51e-02 0.99993
228788 GGCAATAGCTTAGTGTTGGGCCTAGCATGCTGTAGGTGCTCAATAAATGCTGTTTCTCTC 0.23784951 4.52e-02 0.99993
54483 ATGGATTTCAGGTTACTCTTGACTGTGGTCCAGGCTCCATACAAAATGAAAGAAAATAAT 0.58586702 4.52e-02 0.99993
207227 GGAAGAGAAGACTGCGGGCATGATGACCAGCGCAGAAGCGTTTTCCAAGCACGCACATGA -0.27136414 4.52e-02 0.99993
100042450 TCTTGATGTGTTAAGTTGGTGCTATTTTTGTGAAGTTGTGGTCTCATGGCTTAACTTGAC -0.12847836 4.52e-02 0.99993
13846 GTCAACAGAGGCAGACAACGGTGCTTGGAAGGGGATTCTTAAATTATATTTAAAAAGAAA -0.25928672 4.52e-02 0.99993
12389 TATTCAGCAACATCCGCATCAGCACGCAGAAAGAGATATGAGGGACATTTCAAGGATGAA -0.22320849 4.53e-02 0.99993
56452 AAGACTCAGATCTGTCCTCTCACGTGGGGTGAAATTGGGACCATTTTGCTTCTATGTGTT -0.20457219 4.53e-02 0.99993
15129 TTTTCTGCTATTGTCTATGCACAAAGGTTATATGTCCCCTAGAGAAAAACTGTCAATTGT 0.34400539 4.53e-02 0.99993
30932 GGTTGGATTATTACTGAGTTCAATAATCTGGTGGGTTTTGCCAGCTAGAAACATAATAAA -0.15750187 4.54e-02 0.99993
229007 CAGCGGAAGGCAGACACTCACAGGAAGATGACAGAGTTCTAGCGGCCCTGCCTGTATTGT 0.16113556 4.54e-02 0.99993
13405 CAACAGTTGGAGAAATGCTTGAAGTTGTCCCGTAAGATGAGAAAGGAAATGAATGTCTTA -0.30939938 4.54e-02 0.99993
625109 GCTAGGGTGTATCTTTGTCCCAAAGTGTTATGTTATTTTAGTTAGGCCAGATTCAAATTA 0.22253102 4.56e-02 0.99993
60599 GTGTGTTTATGGGCACAATGTTTTCTCTCATCAACTTGAAACTTAAAAGGGACATTTTGG -0.29167079 4.57e-02 0.99993
17357 GTTTTTATAAATGTCTTACTCAAGTTCAAACCTCCAGCTTGTGAAATCAACCATGTCCCT -0.44384753 4.57e-02 0.99993
13841 TGTCATCATAATTGCTGTAGTGGCTGTAGCAGGGACCATCATCTTGGTGTTCATGGTGTT -0.53810719 4.58e-02 0.99993
225895 TACCGTGAGCTATACTCCTTCTTTGGTGACAGCTTGGCCACTCGCTTTGGCACTGGCCAG -0.23593333 4.58e-02 0.99993
11515 TTCATTTCCACCCATTTCGGTTTTCCTTTACTTGCGTTCCTGGAAGCCTTTTCCTGGAAG -0.35809153 4.58e-02 0.99993
97165 CTGTCCTAAAGTGTGGAGTATATTTGCTCAGGCAATTATTTTGCTAAGAATGTGAAATTC 0.40500583 4.59e-02 0.99993
74762 TGGGACCACAGTTAGTTAACCTACATGCCTCATTCATCCATGAAGACAAAGCCTGCTGCT -0.30972411 4.59e-02 0.99993
58799 ACAAAGTCTTGGTATGGTTTCAATGGTTCTGAACTATCTGTTGCTTTAATCAAGTCTTTC -0.14424063 4.59e-02 0.99993
76295 GACAAACATGAAACAGCTGTTAGTGTGAGTTTATCTTGTGGACATTTTCATAGAACTATG -0.15792671 4.59e-02 0.99993
68355 CGAGCTTCCTCCAAGTTTGGACCTTAGTGGGCCGGATGATTTGGAACTTGGAGAACTGAG -0.17935383 4.60e-02 0.99993
20344 ATGCCTGCTTTAAGATCTCCTGGGTCTTCCATGTTTCATATCAATGAGGTTGTTTACACC 0.5640861 4.60e-02 0.99993
226525 ACCAACCCCACCAAGCTTTCCATCACGGAGAATGGTGAATTCAAAAATAGCAGCTGCTGA -0.2127458 4.60e-02 0.99993
22283 GAATAAACAATCAAGTTAGAGCGTGGAACCCTGGGATGCATGCTCTGCACACTGTTTTTT -0.17973832 4.61e-02 0.99993
380701 TTCTCGCTCTGTCTGGGAACTGTGTCACAGAAGCATTGATAAAATAAAAATCTAAGATCT 0.1928318 4.61e-02 0.99993
16172 CAAGTGTGTTGCTCATTCCTTGAATATTTATTCTGTACCTACTATTCATCAGACATTTGG 0.17831028 4.62e-02 0.99993
216454 ACATGGGGGACATGGGACCACAGGAATCTGCTATGCTTAAATGATCATTACCATTGTTGG 0.16631568 4.62e-02 0.99993
22268 CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG 0.18492281 4.62e-02 0.99993
13421 CGCCATTCTCAGATCTCTCCACATGTAAACATGCCCCCAATAAATAAATGTAATAAAATT 0.37363437 4.63e-02 0.99993
14571 TTACAGATAGCACTGAAATCAGCCTGCTGCCTTCAGACATCGATAGGTACAAGAAGAGAT -0.32462239 4.63e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.27392504 4.63e-02 0.99993
65972 GGATGATATGGAGAAGAAACTGGGACCGTGCCTGCAGGTGTATGCTCCTGAGGTGTCACC 0.83802612 4.64e-02 0.99993
16680 GACCTGTTTGTACTACTCTTTGTATTTCTGGGTTTTCAATAAACTTGCCAAGCTAACTTC 0.23739775 4.64e-02 0.99993
18933 CACGTGGGAGGTTAAATTAAACCAGAAGTAATGACCTAATTACAAAAAAGGGAATGGCAT -0.17596717 4.64e-02 0.99993
94093 GTTGTAGAAGTTGTACTAGATTAGTTTGAAGCCTTGTTTAAAACCCACATTGTTTTGGCT -0.17674034 4.66e-02 0.99993
216874 TTCCTGACTTGCCTTATTTATTTGTTCGAGAGTCTCTGATGAATGTATCCGCCTCGGTCC -0.50286621 4.66e-02 0.99993
12905 CCTGGAGACTGGATTGTGCATTTAGCTCTTCATAATGGTGATGATAATAAAAAAGCAAAT 0.29454434 4.67e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.27245621 4.68e-02 0.99993
76787 CGACTCGGCCTCTTGGCTCCAGGCGTTACTCAGTGATCACGGGTAAAGACCTACTGTTTC -0.15080563 4.68e-02 0.99993
15245 TATAGAATTATGACCATGAGCATGAAAGACTTCTAGTAGGAAAATCTTGTGTCTTCCTTG 0.44273732 4.71e-02 0.99993
22337 GAGGCGGAAATGGGTACCAAAATGAGAGATCAGCAAGATTTCCCAAGATAGGAGAATCCT 0.42735617 4.71e-02 0.99993
66537 TGAAAATGTGTGTCTTATAAATGTTATAAAAACGCAATAAAGTCCCCGGGAGTTACCTTG 0.13274856 4.71e-02 0.99993
12444 AAGAGACCATCCCGCTGACTGCGGAAAAGCTGTGCATTTACACCGACAACTCTGTGAAGC -0.32955979 4.71e-02 0.99993
63959 CATTTTACTGCCTTTTTTATACTGACAGAAACCAGGTGCCTTCAGAGGCCATCTGATTAA 0.35916597 4.71e-02 0.99993
68048 TTACTGGGAGAAGTCAGCTTGCTCATAGTACCAGACCATCGGCATAGGAATAAAGTGCAT -0.17417121 4.72e-02 0.99993
14775 ACTGCGCTCATGACCGACCCCAAGTACATCATTTGGTCTCCGGTGTGCCGCAACGACATT 0.40786305 4.72e-02 0.99993
19698 ATCAGTCTTCCAGCTTCCTCATCCTGAATCGGACATCTGCAGCGCTGGTGGGAAGATGGG 0.20159526 4.72e-02 0.99993
18546 CAAACCTGAAATGCATGAAGAGAAACCCATAGTATTTATGCCCCCTATAGGCAGGTATCC 1.24874516 4.73e-02 0.99993
100041779 GTGTATCAAGGGAGAAAAGTGACACCTTCTAATTACGTTAATAAAATGTTTCCATTTGGG -0.22767186 4.73e-02 0.99993
99382 CTATTTATTCATCAGAAGCCCCCAGGGCTTGCAATCCTGGAAAGATATTTTCAACTTGCT 0.21664165 4.74e-02 0.99993
102058 CCAGCCTTGTCTACATAATGAATTCCAGGACAACTAGGACTACATAGATGCTGTTACCGC -0.27631996 4.74e-02 0.99993
68152 TCGGCTTCAGACAGCAAGGATGGTTCAAAAAAGAAAAAGAAGTCCAAGGATGTAACTGAA -0.21094232 4.74e-02 0.99993
544678 ATCTGCGCATGAGCCAAGGGTATTTTATGACTACTTGTACTCTACCTTTCCCGTGAACGT -0.24637081 4.75e-02 0.99993
52372 AGGCGAGAAGCGTTCCGATTTGGTTCAGCACAAGCACAGAAAGGTGATTGTTAAGTAGAA 0.28798068 4.75e-02 0.99993
66573 GGGTTTCCCCCTCTTGTCCTCATTCAGTTGTTTTATTCCTTTTCCTTGACAGAGCTTAGG -0.13739617 4.76e-02 0.99993
100039641 CCCAGAGGGATATGACCATCTCATTATGAATAATATACTTAGTGCAAATTCTCATAGTCT 0.18157328 4.76e-02 0.99993
12981 TCTGAAAACGCTGACTCAGCTTGGACAGCGGCAAGACAAACGAGAGATATTTTCTACTGA 0.29223279 4.76e-02 0.99993
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.16843066 4.76e-02 0.99993
226470 TGGTTGAAGTCTTGGTGAAAGAAAATAGGATTTACAGCAGCGCTTCACAGATTAAGTTTA -0.15408736 4.77e-02 0.99993
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.53812576 4.77e-02 0.99993
381059 TTAAAAAATGCCCATCGCACAGTTGCTGGAACTATGGAAGAAGATCGAGGTGGAACCCAT 0.67946191 4.78e-02 0.99993
258587 AAAGTGCTATCCATAGAGTTATCAAAAAGCAGAAAGGCTCAAGACTTAAATTCAGAGTGG -0.24267027 4.78e-02 0.99993
73673 CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC 0.22481498 4.78e-02 0.99993
240754 TATGGGGATGTTGGGGATAAAAAGGCACATAGCACTTAGAGTGGAAGCATGACGTGATAG 0.19173696 4.79e-02 0.99993
114714 TGTGTGTGTGTGTGTGGTGGTGGTGGTGTTTTGAATAGATTTGGCCTACACAGACTCATA -0.16361785 4.79e-02 0.99993
211305 TCAATGGGTGTTATCAGCTGCAAAGCAGGAGAAGGCTACCACAGCAAAGCTTCATTAACA -0.38750662 4.79e-02 0.99993
99712 GGCTTGGGAAATCTTGATAGCATGCAGATAATGTGGTAACTTTGTCAATCCATTTTATTT 0.13312896 4.79e-02 0.99993
171236 ATGCACAAATGCATTGGTTATTCTGTGTACCTGAACTGGGTAATTCATTTCATTATAAGC 0.17482061 4.79e-02 0.99993
66435 TGTCTTCATTGGCTGTGCGTGCCTCTCGCTATGATGTCACATTACTCAAAGAGAATCTCA -0.208241 4.81e-02 0.99993
233115 TGGTGTACCTGCTCGGAGTTTTTGATAATTGCTTTTATAATTCATTTCTAATGGTGGGGG 0.27044538 4.81e-02 0.99993
93871 ACACATTTTACCTTATATATCTGGTTATTTCAATTGACATGGCTTCTACTCCTCGCCCCC 0.16264762 4.81e-02 0.99993
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.18913592 4.82e-02 0.99993
236749 AATATGATGTACTAAGAGGAGTATACCAAGCAGTATGGAGCCATAGCTGTCCACAGCAGC 0.55255832 4.82e-02 0.99993
105120 TGTTTCCCAGGTCAGTTCAGAAAAGGTCTGGAAACAGGAAGTTTAGATAAACATCGAGGT 0.18733941 4.82e-02 0.99993
12145 GGGAAACCAATGCTATAGCTTCAGAGACTGTATCCTCATTGCAGAACCGTGAAGACACCT 0.44840104 4.83e-02 0.99993
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.46592322 4.83e-02 0.99993
15458 TGTTTGGACAAGTCTCTTGGCCCCAACACATGTTCTTCCAATGGTTCCAGCTTGTACTTT 0.23282673 4.84e-02 0.99993
100503330 GGGCAAACTAGACCAGACAGTTCATGGACATGTTTATATGTCCATTTCCAAGATTAAACA -0.32020137 4.84e-02 0.99993
194268 CCACCCAGCTAAGGATGGAGACTTTTAAAAAGAAAGTGGCTTTGTTTTCTTACTATATTT -0.12182239 4.85e-02 0.99993
16866 AGAATGAGTTCTGCCCAGTCTGCATCACCTTCACCACCAGCATCTGTGCCGGCTACTGTC -0.22619474 4.85e-02 0.99993
353499 CTCTGCCACCCGAATGCTACACTCTCAATTGAACCGTATTAATAAACAACAGTCAAGGCC 0.46894939 4.86e-02 0.99993
13646 ATATACTGAAGGTGACAGATGTCATGCTGTGTGCAGGAGAGATGAATGGAGGCAAAGACA -1.17646854 4.86e-02 0.99993
12479 TAATGACCATCTTAGGACACAGTCTCTATGGAAATTTTGCATTAATGACTGAAAGGTGTT 0.41135361 4.86e-02 0.99993
20732 GGAGAAGGCCCAAGAGTCTGGAAGGAGCAGAGCAGCCTTGAGCCAGGAGTACTGTATATA 0.61157946 4.87e-02 0.99993
11796 AGAACTACAGGACCGTCAGTGACCTCGTTATAGGCTTACTCGATGCAGAAGACGAGATGA 0.53524641 4.87e-02 0.99993
234825 TTAGAGTGGGATGTGAATTTGAGGCCCACAGGCTGTGTGCTTCTGTCATAATAAAACTGG 0.28708299 4.88e-02 0.99993
667977 GGAGTTGTGATCATCATTGGAGCTATGGTGCCTTTTGTGTTGAAGAGCAGGAGAAAAATA 0.71853577 4.89e-02 0.99993
76500 GAGCATCAGTTCTACGAGACCCTCCCAGCTGAGATGCGCAGATTCACTCCCCAGTACAAA -0.18540102 4.89e-02 0.99993
258665 GAGGAATAAGCAAGTTAAACAAGCCTGTGGTGTAGTACTTAGAAAAATATTTTCTGCTTC -0.43785386 4.89e-02 0.99993
208154 GCCAATCACATAGCATTTATGCTCTTATTCCTACTTAGTAAATATGTATGTTGTAGCTCC 0.68114662 4.89e-02 0.99993
14198 CTTTTGGAGATCTGAGAAGGAGATGGCTGCAGAGGCGGAGGCTCTGCGGGTCTACTTTCA 0.30233049 4.90e-02 0.99993
77090 TCCTCCTCCAATAGGAAACCACACCAGTTCTTCCAGGGAATAAACATGGATTAGACACCT 1.02497599 4.90e-02 0.99993
67937 CCCTCTGCTAAGGTTCCTTCCCTTTGTCTCTGGAAACCCAACCCCACAAGGACAGAGTGG -0.47372505 4.90e-02 0.99993
74412 AAGTGACGGATTCCAAGGTTGAGCAACAGGACAACTTTCTAAAACGCATGTCTGGGATGA -0.15189729 4.90e-02 0.99993
66789 TTGTTTGACGAATGGCAACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACT 0.17088616 4.90e-02 0.99993
59020 TTCCAAAGTGCAACTTTTCACTTCTGTTGATGAGACCTCTTCCTTCTGCAGGCTTGAGCA -0.16413764 4.90e-02 0.99993
73673 CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC 0.28539267 4.90e-02 0.99993
66573 TATTTTTTATACTTTGTAGAACTATTAGGACTATCTCCAAAAACAAAAAAGGAACCTATT -0.29922256 4.90e-02 0.99993
319259 GTCACCAGTACCTATGGAAGGCAGCTGACAGTAGGGATTAATAAACCCAGATTGCCTGGC -0.99431069 4.91e-02 0.99993
54201 CAGTGTTTCCACCCTGTCCCCTCCGCTGTGGTCAGGAGGACCTAGCTTTAATAAAGACGG -0.20920149 4.91e-02 0.99993
216881 GAGCACGCCACTGGCTTCTACACGGGAAGCTACTACTTCGACGGAACCCTGTACAACAAG -0.35853903 4.92e-02 0.99993
72665 CCAGGACCATCTACTTGTTATGACTTCTTTGGCTTCTGTAACTTGCTTATGCAGATATTC -0.24841204 4.92e-02 0.99993
71967 TGAAGATCGTTTTCATGAAATCCTCATGAGAGCTTCTGAGCGCATGGAGATGGTCTTTGG -0.55699438 4.92e-02 0.99993
213603 CATTGTGAGATAGGGACCAAGAGAACTTTGACTACCTGTGACACCGAGACAAAGTCTACA -0.18255376 4.92e-02 0.99993
12904 CTGTCTCTCTGGCCTCTACTCCTTATCCTTGTAGTCTGTGTGATTTAGAATATTTATTGG 0.3666071 4.92e-02 0.99993
320204 GGACAGCCAGAGCTATATAGTAAGACCCTGTTCCAAAAATAGATAGATAGATAATAAAGT -0.15251923 4.94e-02 0.99993
230935 TAAAAGCAGTTCGATTCTGTAATATTTATTTTTCTTTTTGAGGATGTTTCGTTGCCCCGC -0.14397833 4.94e-02 0.99993
56335 AGCTATTAAATACCACAACAGCCAAGGAACAGTCCATTGTTGAAAAGTTTCGCTCTCGAG 0.20568163 4.95e-02 0.99993
66818 CTGGACATCAAGGCTCTATTTCTGTTTCTGATGACTTCAAGAATCTTCTCAATGGAAAAC -0.19867753 4.95e-02 0.99993
790910 TGAACACATGTGTCTTCATGTGCCCGGAGAAACTGAGACACTTTCTACCCTGTTTTCTGA -0.18034021 4.95e-02 0.99993
18503 TCAATTGTTGTAGTCATAAACATATTACTGGTGAGAGTCTGACTTCACCTGTTAAACATG -0.15887961 4.95e-02 0.99993
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.24289471 4.95e-02 0.99993
101966 AGTTGAAGAAGAGTCTGGAAGTGGGGATCCGGAAGAAGATTGAGCATGATGTGGTAATGA 0.58223455 4.96e-02 0.99993
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.57456081 4.96e-02 0.99993
13867 GACAACCCCGATTACTGGCATAGCAGGCTTTTCCCTAAGGCTAACGCCCAGAGAATTTGA 0.19512933 4.96e-02 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.20905649 4.97e-02 0.99993
14204 CTCTTCAGGGCAGACAGACCACCTACACTAATAGCCCACAATAAAGTTATTTTTGTTAAA 0.74837571 4.97e-02 0.99993
18045 TAGTTCTAGCTCTATCAAAAATGGCTTATTGTATAGTCTGTCCAGAAGGAAATTTTGGGT -0.1513057 4.98e-02 0.99993
20732 ATAGAAGGACCTGCTTATCCAAGAGCTGGAGAAAGTTGGTGTTTTGTGTCTTGTTCAAAG 0.83703013 4.98e-02 0.99993
29858 ATTGAGAAGTTTGACTACGTGTTTGCTGAGAATGGGACAGTGCAGTATAAACACGGACGG -0.19917709 4.99e-02 0.99993
104681 ACTATATTATAAAGTGACATCCAGCCCAAGTCACAGAAATTAATTGGCCATTCCAAAACG 0.40877879 4.99e-02 0.99993
70954 GGCATCTGTTGCAGCAGAAAGCACTTGTGTGGGCTATTTTTGTTTTTTCATTAAATTTTT 0.64150589 5.00e-02 0.99993
18124 AGAATCAGCCTTTTTGGAGCTGTTTGTTCTTAGACTTTCCATCAGGTCAAACACTGCTGA -0.25198121 5.00e-02 0.99993
74653 ACAGCAAGTTGAAGGAACTTTCTTACCTGCCTTGAATGGTGCTTTGAACTTCCTGCTGAC -0.15039743 5.00e-02 0.99993
78648 TGAAGAAGCTGAATTGCAGAAGCTATCTCTGTCCTGTTAATCACCGGGTCCACAGTGAAA -0.15539229 5.00e-02 0.99993
18314 ACAGCTTAAGGAATAATGAGGTGAAGGCTGCATTGAGGCGAATCATTCACAGAACTCTGG 0.37027223 5.01e-02 0.99993
21682 AAGACTTGCTGCGTACGATAGATGAACTAGTTGAATGTGAAGAAACTTTTGGAAGATGAA 0.27866892 5.01e-02 0.99993
66757 GAAATCCTGATTCTGTAATGATCAACGTCTAGTACAGTTTGGAGACCTGGACAGAATTCC -0.14452473 5.02e-02 0.99993
72325 TGTTATATGTCTCCAAGTGGCTACCAACTCAGCCTAAAATAAAGAAGTCACTCTACCGAA 0.17913723 5.02e-02 0.99993
14462 TTAAGGAATATAGGGGGATTAAAGTATGGAGATACAGAAGAAACCACTAAGTCTGATGTC 0.88040307 5.02e-02 0.99993
243961 TTCAGCCTCATCTGCCTCAGCTTCCACCAGACACCTGCAGGGTGTGGAATTTGAGATGCG -0.16862974 5.02e-02 0.99993
103573 GCAAGATCATGTGCATATCATCCCATTGTAAAGCAACTTCAAAAATATGGGAACAGTTAG 0.15154827 5.02e-02 0.99993
67902 GTACTGCATGCATGTGGGTTACATAAAATGCATGCAGCTAAAACATACATAAAATGCATA -0.17899106 5.02e-02 0.99993
13430 TGTACCACGCACTGAAGGAGGCCCTCAACATTATTGGGGACATCAGCACCAGCACCGTGT -0.214261 5.03e-02 0.99993
245536 AAGATGCTTAGAACTCTAGAAGCCAAGAGACTGGCAGCCATGGAATCCTCTGTAAATCTC -0.15428351 5.04e-02 0.99993
12579 CCAGTGATGAATTGTAGTGGTAGCAGGTTACTCTATGCAAAATAGTTTAATAACCACTTT -0.43486904 5.04e-02 0.99993
67304 TTAAGAACACTGACTGCTCTTCATACAATGCATCCTGAATCCTTGTGTTGGGCTCGGCTA -0.33865879 5.05e-02 0.99993
258882 AGAAATAAGGATGTCAAAGTTGCTCTGAGGAAAACCTTGGGTAAGAGAATTCTTTCTTAA 0.14443961 5.05e-02 0.99993
668357 CCTGTACTTGTATGTGGAGAAGTTTCAACTTGTGTCTAGGCTTGTATATTTGAACAAATA -0.14307357 5.05e-02 0.99993
215008 TCTTCTCAAGGTTTGTTGTTGTTTTTGGAACTGTTTCTTCTCCTGAGGAAAATCTTTCCC -0.23171538 5.06e-02 0.99993
11513 ACACTTCCTGACAAAGTGATTGTTACTGTGTACTTCATAGATGACAGGTCAATGCTCCGA 0.74241414 5.06e-02 0.99993
633417 ACAATGTCTTGTTACTTCTACTGCAGGCAAGGACAGCTTCTGTCTTGTCTCTGGAGACTT -0.19045816 5.06e-02 0.99993
20440 GAAGCCTACTCAGTTACTCTAGAGTAAAGTTGTTCCCAGGGCAGTCCCTTTTGATCCTTA 0.18306956 5.07e-02 0.99993
69930 ATGTGTGTTCTGTGTGTGGGAAGGCCTTCAAACAGTTGTCAACATTGAGTAGACATGAAA -0.17348803 5.07e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.24079159 5.07e-02 0.99993
67313 ATTAATTAACTTATTGGTCTTACCTAACAGCTATCTCGTGTGGTTGCACCGTGGCGGTGC -0.31516774 5.07e-02 0.99993
75873 ATTTCAAAATCTTACCCATGGCTTACAAGTTCAGAACAGTTACACACTTAACAGACTCAG -0.19332928 5.07e-02 0.99993
104859 TATTCAAAATGTAGAGCCTGTAAGTTAGAAATCCTGTGTGGGGCTGGGATGTGGCTTAGT -0.17639363 5.08e-02 0.99993
225651 TCTCTCGTAAACTGAATTGCTCCCAAGAGCAGGTGCCGGGATCCAGTCAGTGTGACCGTG 0.25075559 5.08e-02 0.99993
26425 GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA 0.22130412 5.08e-02 0.99993
629967 AAACCATTCAAATGCAATGTTTGCCAGAAGCAGTTCAGCAAGACCTCAAACCTCCATGCC -0.16212974 5.08e-02 0.99993
75219 TTTTTTAACAAAGAACTTTATTTGAGCCTTTTTGTCATTAAAAGAAAACATTTGGAGGTG -0.2312648 5.08e-02 0.99993
224794 CAGTGCCTTAAGTTAAAGGGAGTACATTGTTTCAACTTGTAGATAATGACTTTGCTTATG 0.21917407 5.09e-02 0.99993
382030 TACCTTTGATTACCTGTGTTCAGTATTAGTGTCACTTCAGCACTTCAGCCCCTGCACAGA -0.51720564 5.09e-02 0.99993
20423 AATTTATTATTGTGTGAACTGTACTCACAGTGAGGGAAAGATTATTTTGTGAGGCCAAGC 0.32041868 5.09e-02 0.99993
504186 AAACAGAAGGCTGTGCAGACATTTGACTCGGAGCTTCGATCCATAATAAATGAGTGCTCC 0.30245559 5.10e-02 0.99993
17395 CCAACCTTTTCCAGCTACTTTAGTCAATCAGCTTATCTGTAGTTGCAGATGCATCCGAGC -0.23997338 5.10e-02 0.99993
320671 CTGAATTAGCTACACTGAAACTTTTTAATTTCAAAAGGTCGCATTTGTCAATTGCTGGCA -0.21999751 5.11e-02 0.99993
20944 AGCCGGTGATGTCTTCAGGATTCAAGTTTCCATGGGGCCTAGAAACAGTCCGGGGCCTCT -0.14572747 5.12e-02 0.99993
18991 GGAGCTTCCCCCTTCACCATTTCTTCATCTGTTTGTTAAGGTTTCAGCTTAAATTTTGTT -0.30919948 5.12e-02 0.99993
547349 CTTTTGTGTTGAAGAGCAAGAGAAAAATAGGTGGAAAAGGAGGGGTCTATGCTCTGGCTG 1.14413768 5.12e-02 0.99993
80750 CAAGCTGGAATTAAAAAACGAACCAGGACGAGCAGATTTGAAGCATATTGTTATAGATGG 0.215108 5.12e-02 0.99993
71768 TGATCCCATCAGCGCATACTCTTGACATTGACGTCATGTGACATCCATCCTAGAAGTGTT -0.21026562 5.12e-02 0.99993
242557 GAGTTTACTTAAAGACAAACTTGTGATATAAGAGTGTAAGAGCTATTACCAAGCCAGGAT 0.8899167 5.12e-02 0.99993
236312 CTGATAAAAGCAAGCTCTTTGGTTTAGGAAATGGCACTTATTCTTTCTACAGTTTTAGCA 0.87251967 5.14e-02 0.99993
19125 GACCACTTCTGCAGGTTACAGAGCCCTAGTCCAGGATTAACCTTCTGCCAGGGTCTAACC -0.30259911 5.14e-02 0.99993
18600 GACTGAGAAGTGTTTGGGGAAGAGCCAAAATAAAGAGCAATAAAATAAGCCGTCCACGGG -0.39427534 5.14e-02 0.99993
18124 AGAATCAGCCTTTTTGGAGCTGTTTGTTCTTAGACTTTCCATCAGGTCAAACACTGCTGA -0.26872731 5.14e-02 0.99993
17847 GTACCCTTATCACAAACCTGATAAATCAGTATCAAAACCTACAATCTGATTTCACCAACC -0.17862784 5.14e-02 0.99993
272589 GACAGAGTTCTCTGAGAGGCTTTTTTACGCTTTGAAACTCGTATCTTCTGTTATTACTCA -0.17081597 5.14e-02 0.99993
100039210 TAGCATCTTAGCGCTCTTCTCCGTGGTGGTCACCTGGATCATCTGCTGGCTCAAGTACCG -0.17287299 5.15e-02 0.99993
623370 GTTCCCTGTTTGAGACTTATTACGGGCTCATTTCCTGCAAGCTTCTGACATACCTTGACA -0.16813541 5.15e-02 0.99993
20112 ATTCTGTGGGACTATTGAATACATGGCGCCCGAGGTGGTGAACCGGCGTGGACACACACA 0.50668055 5.16e-02 0.99993
12142 GTTGGTTGGTTTGTTTGTTTGTTTTTTCCTCAGAGTTAAAACTGACCAAAGTTATTGGCT 0.29984817 5.17e-02 0.99993
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.59674897 5.17e-02 0.99993
14687 CGCGGTCTACATCCAACGTCAGTTCGAGGACCTCAACCGCAACAAGGAGACCAAGGAGAT -0.18570748 5.17e-02 0.99993
20834 ACGTCTCTGGGGGTGGCGGAGAACGTGGCGCAGTCAGAAGCGACTTCCGAGCTCTCCTGA -0.15891106 5.18e-02 0.99993
17444 GAATGATATTGTGTTTCTCTAAGGTGAAAACTCAGGTATAAAATGAGAAAAGGGTGAGAC 0.53514412 5.18e-02 0.99993
319430 CTTGGGCCTAACAACACACATACGGTTAAGGCATTGCCTATTACCTATTTCGTGGCATCT 0.46149126 5.18e-02 0.99993
387510 GCAGTGCAGTCAAAGAAAGTCTTAAGCAAAAGATGAACTTCAGTGGAAAAGTTAGCAGAA 0.13885622 5.18e-02 0.99993
13639 AATCCTCCGTCTCCTGAGAGTTCTGTGAGCCAAGCACACCTTCCAAGTCACCCCAAGGAA -0.16630864 5.19e-02 0.99993
331493 GTATATATGGGAGATACTGGAGAGAAAGGAGGGGAAATACTGTAATCATATTATAATTCC 0.7224265 5.19e-02 0.99993
433100 CCAAGGAACTTTGGTCGTAGCTAATTAACTATGGTGTTTCTATGCATGAAATACATAAGA 1.3546792 5.20e-02 0.99993
404307 ATGGTTGTTTTTCTGTTCTATGCTCCTGTTCTTTTTATCTACATTAGTCCCACCTCGGGG -0.17690467 5.20e-02 0.99993
59001 GGAAGAGATGGAATTCCAGCGATTCATAACACCATTGAAAGAAGCTCTAGAAGCGTACAG -0.16716685 5.21e-02 0.99993
319200 CCAGATATGAAGTGAAGTGGTTATCCCAATTCCTCCAGTATTTAAGTATATTTAAGAAGC 0.18203848 5.21e-02 0.99993
213696 GTGGGTTTCAGTTGTATCATGTTCAGTTGTAATATGTATCCAACTTGTTGATGTAACAGA -0.32171425 5.21e-02 0.99993
100042510 ACATATTTGTTTCCCCGAGTCTATTGATCTCCATGGATTGTGCAGAAATGCATTCTAAGC -0.35686794 5.21e-02 0.99993
57340 TTCTCTACCAGGGTTGTTCCCTCATCCAAACAAATGAATAAGGGATGCCAGCCCGCCTGG -0.18751244 5.21e-02 0.99993
70789 TTTACATGACTACAGCCTACAGATGACTGTCTTGATCAGTTGTCACATTTCATGCTCACT 0.45494012 5.21e-02 0.99993
229603 GGAAAGGGAAGAGAGGTCTAAGGTCATATGGGAAATGGGTATTGGGTCTTTTAACTTTTT -0.23316722 5.22e-02 0.99993
546100 AGACTCGCTTTGAATTCATGAGAAAGAAGAGTGTGAAACAAGAAGCAAAGATCGGGTTGG -0.25236326 5.22e-02 0.99993
27424 CATCTTCCTTCCCTGTTGAGACTGGACAGATCTTCTCTGATACCCCAAAGCTTGGATAAA 0.57261212 5.23e-02 0.99993
58861 TCTGCTGGACCCCTTGGGAAATTGTGTTTAAAGCATAATAAAGAGAGGACTCTAAGGATG 0.26458114 5.23e-02 0.99993
20349 CCTCCACCCAATACTGCACAAAGTCTGTATTATTGAATGGAATTTCTATTTCATTTGACT -0.34274735 5.23e-02 0.99993
226751 TTTACTTGGCTGAGATGGTGATAGCCATTGACTCAGTTCACCAGCTCCACTATGTTCACA -0.13911193 5.23e-02 0.99993
231630 AACCGCATCAACCCCAAATAAGCAGTTCTGATAAAAGACTGAAAACGGGCAAACACCTGT -0.15410375 5.24e-02 0.99993
68920 AGTACTGTGCTTTGAAATGGAGCCAACAAACATCCAGTCTTGAGTACTCGGATTCAGGAA -0.15599023 5.24e-02 0.99993
56741 CCAGCATCATGCTTCCTCCTTACAAATATGATATTCTTTATTGTTACACTAAGGTGTTGA -0.39831487 5.24e-02 0.99993
17364 ACTTAGCAGTTATGTCAGTTGTTCCAGAGGGACAAAACACCCAGCAAGAGAAAAGAAGCG 0.14436998 5.24e-02 0.99993
320095 AGCTGAATGCTGGATTTTTAGTGTCACAACAGCCACATAATTATGAAGATATTCATGGGT 0.1948755 5.25e-02 0.99993
26558 TACCTTCCCCTCCAGGATCATCTGTTTCCGCTTGTTGATCTCTTTCTTTTCATCAAAATG -0.62514786 5.25e-02 0.99993
494124 GAACTATGAGCAGTTTTTGAGTCACTACATTGAGACTGTATACAAGGTCCACATATCTGA -0.19774364 5.25e-02 0.99993
66112 AGAATGTTCTGTTACCCCTGGACATGGTGCATACAACGGGAATTAAATACTCTCCCAAGT 0.33637873 5.25e-02 0.99993
12966 GACTGGGGCTCTGTAGATGCTAAGGCGGGCTCTTTGCGGAGGGTGGTAGATTTATACTAA -0.2046931 5.26e-02 0.99993
104082 CTGGAAGGTTAAATATCTGGAACATAGCAGACATAGCAGAGAAACAGGAAGCCGATGAAG -0.14935043 5.26e-02 0.99993
381353 TCTGTGAGTTTGTGGAAGCTAACCGGCGCTTCACGCCCACAACCATCTATCCCACGGATC -0.19696979 5.26e-02 0.99993
11491 TTGATGTCTGTGAATTACTAATAAAGCTACGCACATGTTCACAGAATGTTTGTGGCTACC 0.2778876 5.26e-02 0.99993
14862 TGTTCCTGGTGGAGGAGCCTCCCCAGGCCTGTCTCATCTACAATAAAGTCTGAAACACAC -0.19602495 5.27e-02 0.99993
20646 ACACCAAGAGGTGGTTAAAGCAGTATTGCAACTTCAAGGTGGTGGAATTCAAGGAAAACA -0.14705416 5.27e-02 0.99993
381580 GACGACCTACAGACACGTAACGAGATCATCCAACAGACAGAGCAACAGACTCGTGTGGTC -0.55699118 5.28e-02 0.99993
232089 TGAGAGGCAAAGGAAACTCACCCACCAGCAGTTTTAGAATAAAGGAATTGTTGTAATCTC -0.19209691 5.28e-02 0.99993
224833 CCTGGATGGTCCAGGGTTATATCAGTGAACTGGAATATATGTGTATATATTCTAATATGC 0.28375955 5.28e-02 0.99993
19188 AGAAGGGCATTAATAACTCACTTAAAGAAATACAGGACGAGGCTCGAGAGCTGCCAAGTG 0.47550415 5.29e-02 0.99993
56520 TGTATCCTAAGTCAATACAATATTGGACCATGTCCTTGTGTACAAAAGTGCCAGACAACC -0.20963151 5.30e-02 0.99993
66101 TTTAAGAAACCTTACTAAAAGTCACTTATTAAAAGCCTACACCAGGGCCTGGTTCTCACT -0.20330154 5.30e-02 0.99993
170459 CAGAAGAGTTTAATGGGTATCTATATAAAGCTCAAGGAGTTATGGATGACGTGGTCAATA 0.22600112 5.31e-02 0.99993
20018 GAGATTGTTTAAAAACTCCTAGTTTTTTGATGTACTGCTCTTTTGTGGTCATTTCCCAGA 0.15316445 5.31e-02 0.99993
332309 TCTCTACATGCGCCTAAGTGACAGGGGCATTTTTGAATTAGAATCCGCTCTGAAACTGCT -0.17034669 5.31e-02 0.99993
71520 TGCTGCTACCCAGAGTCAGAGCATCTGCAGATTGGGGAAACTGAGTCAGACTTGGCAAGG 0.275171 5.31e-02 0.99993
19694 CCCATGACAAGGGATGAAATACAAGAATTCACCCGGCAAGGCTGTACTTGCTTTACAGTT -0.15132943 5.32e-02 0.99993
70683 TTGAAGAAACATAAAAATAAGAGTGAAGCAAAGAAGAGGAAGATAGAGTTCCTGCGCCCC -0.17986146 5.33e-02 0.99993
17133 GCCAGTTATCTGCCTTGAGTATTTTGTAGACTTTCTGAATAAAGTCAAGTTCTCTTTTTC 0.49311876 5.33e-02 0.99993
69714 TCCAGAGAAAGAGGGGCTTTCCCCATCCCAAAGGACAACTGCAACCTTAGACCCCACCAG -0.13103809 5.33e-02 0.99993
83672 GGGAGGCTACTGTCAACAGATAGATGTGGAAATGTTCTGATCTCAATAAACGCTCAACAC 0.9961931 5.33e-02 0.99993
234135 TAAGTGTCAGGGGGCAAGACAGGCTTATAATCTCTTCACCAAGTCAGAGAAGTGAAAAGC -0.16116604 5.33e-02 0.99993
94109 TACCTTCCAAGAGTAACCAGAGACTTTATCCAGCCTAGAATCCTTCTCCTGGAGATTGGA -0.23862779 5.34e-02 0.99993
546157 CTCCAGTAAACTTATATGAAATGTTCAGTCATTGTTGAATTTGCCTCATGGTGTATGGAA -0.153719 5.35e-02 0.99993
212933 AAGTACAAAAACTTTTATGTATACAATTAAAAATATATACATGTCTATGCTCAAAGACTT 0.23831394 5.35e-02 0.99993
16939 TCATCTTGGTTTCTGAATGACTACCTCCCAATTCTAGTGTCTCCTCAGTCAATAAATTTG -0.37201141 5.35e-02 0.99993
320795 CCCTGCCTTACCCAAGAGTTCTTGATTTTTTAAAAAACAAGCCTTTGGGGTTTACTCCAT 0.21491503 5.36e-02 0.99993
12827 CAGTCTTCCTAAAATGAGGCAGAGTCTAGGGGACAGCAAAGGAATCTATGGCCAATGATA 0.41944577 5.36e-02 0.99993
13131 TGCTTCAGACCCCTCCCCAATCTGGAAAGTTTTATCCTAGAAATAAATGTTTTTCAGTGG -0.18194612 5.36e-02 0.99993
235505 AGCTTGTGTAAGCACGTAAAACAATTCACCCAATCTTTGTGTGGAAGATGACCAGGATGA -0.46126773 5.37e-02 0.99993
625585 AGGTGTCTAACTTAGAAAAAAGGCCAGACACTGGAAAGAAGTTCCAAAACATAATTATTG 0.15915066 5.37e-02 0.99993
80879 GTGGTCTGTTCACCCTGAGTCCCACCCTTTGTTAAATAACAAACTGCTGATTCTTAAAAA 0.50585496 5.38e-02 0.99993
12774 AAAGTTTCTGCCTAACAAGAGGTGTTACTGGTTTTTCTCAAGCTCCGATTGTGAAACCAG 0.40502492 5.38e-02 0.99993
18760 TGTGTGACCAACTGTGTTGTATTAACAAAAGTTCCCGGAAACACTAAACTTGTTATTGTG -0.22375141 5.38e-02 0.99993
26904 ATGGAGTTAGAGCTGAATGTTTATGAGAACACTGATGAGGAGTATGTGGACGTCTTGCCT 0.50560495 5.38e-02 0.99993
16182 TGTCACAACAGCTGTGTGTGAAAACCTAGCATCAGAAGAGAGTTGGGAGAGTTTGAGACT 0.9290127 5.38e-02 0.99993
13418 CGTCTAAGAGTAAGGAAGACTGCATTGCTAGATACAAGCTGCTGGTTGAACTGGTCCAAA -0.17218662 5.39e-02 0.99993
380856 CATACCCATGTTAGTATTCCAAGTACCCACAAAATAGGTAATTACCTCTGCAGATTTTTC -0.14105239 5.39e-02 0.99993
15937 TGCTGTAACACAGATATTTATTACGATTTATAGGGTCGGTAAGACAGAGTTGTGGGAGGG 0.295423 5.39e-02 0.99993
280621 TTTCTGATGGTGGCTGGGGCTTGGGTGGGGCTTGGGAGAGTAAAGAAAAATGTAAACTGC 0.33345694 5.40e-02 0.99993
77090 CTGTGTGGTTGGGACAGATTAAAACCCATAAACCTGTAAGTTCTTCTGGCTATCTCACCT -0.57753968 5.40e-02 0.99993
52036 GACTTTAAAGACACGGGTTTCTCACAGGATTCCTCTTTACAGCAAGTGAGTCACACCTAA -0.23416719 5.41e-02 0.99993
100294583 CCATAATTCCTTTGCATTTTCTATGTTGCTGACAGTTTACAATATGCATCAGTGAATCAG -0.59965471 5.41e-02 0.99993
65246 AGTTCAAAAACAGCCTTGCTACATACCCAGACCTTGCTACATACCCAGACCTTGTTTTGG -0.27915571 5.41e-02 0.99993
12759 CTCGGGAAGAACTGATTCCCCCACGCAACTAATCCAATAAAAGCCGCCTTGCGATACGTG -0.25803394 5.42e-02 0.99993
20300 GAGGAACGAGAGGATAGTGAGTGTGTGAGAGTGCCTACACATGTGAAATGGTCAAAGAAT -0.27368424 5.43e-02 0.99993
67621 AGGGCTGTAAAGCATCAGAGTAGCCTGTCGGGACCACAATACGAACTGTTATTTTTACCA -0.23157805 5.44e-02 0.99993
448987 TGTCGTGCTGTATGACTCTAGAAAGCCTTAATTTACTTCCACCAAGAAATAAAGCAATAT -0.49921993 5.45e-02 0.99993
75772 TGACCCACACTTATCTGAGGGATTGATCCCTGTGATAGTGAGGATGGAAGGTGGCTGGCT -0.19365527 5.46e-02 0.99993
381650 CGAAGGACTCGATGTGGCATTTTCTTCTCCATATCAAGTTTAAACTTTGGAAAATAAACT 0.26968376 5.46e-02 0.99993
50795 AGGCTTGGCTTTCAGAACAAAACACTTCCCAGAGAGCAATCATAAATAAAGATTGATGCC 0.40689118 5.46e-02 0.99993
329559 TGGTGTCCAGCACTTACTGCCTCAGGAGTACGTTGTGGTCCCTGATGGCCATCATATCCA -0.16201355 5.46e-02 0.99993
74525 TGGAAAGATGCCTTTTATGTCACCAGGACAACAGGGATGAGCCCTGAAGGACACCCTACC -0.15427138 5.46e-02 0.99993
68479 AGACTGGAGGAGACGTTGCTCGCTTAGTCCCTAGTTCCCTTTTTGTTTTGAGTTGGAAAA -0.17485325 5.48e-02 0.99993
18861 CCCTTGTAGCATAGAGTTTATTACAGATTGTTCGGTTTGCAAAGAGAAGGTTTTAAGTAA -0.18379221 5.48e-02 0.99993
63913 TAATCACCTTTTAAGGAAACTCAGATGGGGCAAGAGATTTCATTGGCACAAATTAGCCTT 0.50703027 5.48e-02 0.99993
215243 AGTGTTCCTGGCAAACAAAGGCAACCTGGTCATCTGAAGAACTTCTGGCATCTATCTGAA 0.37939119 5.48e-02 0.99993
258041 GCCTTTCATCTTCTGTCACACCCAATATGCTTGTCAACTTCCTGACTGAGAGACATAGCA -0.21714295 5.49e-02 0.99993
382030 GCAGGAACAACATCAAATTCCACTTAGACTGAGCAAATCTCATCTCCATTATGTTGAAAA -0.48902119 5.49e-02 0.99993
226982 GACTGGTCAATCTGTAAAATACCAAATGTGAACTTGATGCTCAGAAATAAAAGTTTCAGG -0.17971233 5.50e-02 0.99993
237636 TTTATCCCTGAAATTAATGCTGCTAGCAGCTCTCTGCCCAAAAGTGACCAAAAGTTCTAA -0.2457859 5.51e-02 0.99993
258607 GAACCCACTCATCTACAGTCTGAGAAATAAGGATGTCAAATCTTCCATAAAGAAAATTCT -0.31031103 5.53e-02 0.99993
12449 CTGTCTTTATTTCTACATTTCTTCTAATGGGGAACAAAAGGAAGCATTTGAAATAGAGGG -0.2606003 5.53e-02 0.99993
18107 AGGCTCTGAAGAGGTTTCATGGAGCTGTCTACGTCTAAGAGAGAAAGAGACTCTCAGAAA -0.30103297 5.53e-02 0.99993
72685 TGGATTCCAGACATCTTGACCACTACACAGTATACAACTTGTCACCCAAGTCTTACCGAA -0.24584993 5.53e-02 0.99993
21817 CTGGGAAGAATCAAACTGATGCATTTAACGTGTTCTGCTTTACACAGAGGATCGCACCGT 0.56542792 5.54e-02 0.99993
75629 ACCGTGTCACAAATGAGCAGGCCTGCTAACACCTGTTGTGGGGTGACACAGCCTCAAACC -0.18483517 5.54e-02 0.99993
27358 GAAGATGGACAAATCTTAAACCAAATTAATATTCCTTGATTAAATGCAAACAAGTGCTCC -0.165285 5.54e-02 0.99993
23961 CAGAAGGAGAATATTATGGTTTGTATATGGTTGGCCCAGGGAATGGCACTGTTAGGAGGT 0.22950102 5.55e-02 0.99993
13013 TGTGCTCATTTTCCTTGTTTTGCAGCATTGTGCAGTATCAAGACTGGATATGTGGATAAT 0.25905912 5.55e-02 0.99993
16185 GTCTATTCTGGGGTGGGTTTTTCTGTGAAGCAGCTTCTTTGGGGTAACCTAGCCCCCTTG 1.14749358 5.57e-02 0.99993
319783 AATGTCACCACTTGGGATCTGAGAGGCTAACACATGAGGCCAATTTCACATTTAAACTGT -0.23355294 5.57e-02 0.99993
16833 ATGCCTGATCACATCACTGATCACGGCAGTCCCACTGAAAGTGTTTCCACATCATAACAA 0.13248852 5.57e-02 0.99993
26401 TAAGACTTCCAGGGCTTAAGGGCTAACTCCTATTAGCACCTTACTATGTAAGCAAATGCT 0.23896471 5.58e-02 0.99993
100040872 TATGCATACATTGGTGTGGAAACTTCTAGTGGAGCATGGGTAGCCTTTCGGGAGGTATAT -0.26121649 5.58e-02 0.99993
66492 AGTTACTGAAGCGTTCTCTTTGGCCTAACTTTGGCCTATACTGGACCTAATGAGTGTGTG -0.15720739 5.58e-02 0.99993
71085 GTTATTTTTTATTATTTTGCATATATATATGTAATTGTAAAGAAACAATCATATATATTG 0.18699498 5.59e-02 0.99993
319293 CTCTTTGCTACACCCCTTCTACACTGATATTTTACTCAAGTGCATAAAATCTAACTGATA 0.29721701 5.59e-02 0.99993
20689 GCATTGTCTCACAGATAACATTGCTATAAATCTTAACTTTAAGAGCTCCTAGATATGACG -0.22561061 5.59e-02 0.99993
245423 AGGACTTTCTTTCCAAAATCAACTATTACCATTATACTTGGTAGTCTTTTACCCTTTGGC -0.18568137 5.61e-02 0.99993
12428 GCTGACACTCTTTCCGAATCTTACCCTGTTCTAAGTAAGTAGCTCCTTGCAGCTCTGAAA 0.38390081 5.62e-02 0.99993
53614 ATATGATTATTTGTACTTCCAAGCAATGTGAACATTGAGAATGAAACAGTTCCTTACCCT 0.17539655 5.63e-02 0.99993
68877 TTTTGTATTTCTTATTGGGCCTGTACACTCCAGCTCTAAGGGCCAGTAGTTTGAAGCCCT -0.13727787 5.63e-02 0.99993
16857 ATCGGTTCCAAGCTTTACGAAAGATAAACACGCTGGAGATCAATGGTGACCTCACCTTGT 0.34480935 5.63e-02 0.99993
107250 CACTCTAGGGGACAAAACCCACCTAGCATACGACTAGACACAGTGGGCACCAATAAAAAA 0.29407967 5.63e-02 0.99993
71566 AAAGCAGAAACCACACTCAGCACAACGCCCAGCCAGAGCAAAGCCTTCCAAACTGTCTGA 0.30413978 5.64e-02 0.99993
16498 TTCACTGGATACTGTCCGACAACGGATGCCAGGGGATGGCATCAGTTAGGGGGACATCCA -0.42203628 5.64e-02 0.99993
100039781 AGACTGTGGTACGGGCATTCACTGCTGCTTGGCTGTAAGAAATAAAAGCCACCAGGAAGC 0.27901705 5.64e-02 0.99993
15117 CTAGTGGGAAACAAACACACCCTGACAATAAATGAAACTAAAACTTGAGTTTGCCTTTTT -0.23410177 5.64e-02 0.99993
210009 TTGTGTATAGTAACGGTCTCATTTTATAGTCCACCTTTAAAACACATCTCTACCTGGTGA -0.26469373 5.65e-02 0.99993
69443 ACTGCTTCCCTCCAGGTTCTGTGCCTTAGGCTTGCCATCAAAATAAAGAGCATTTACATG -0.14596402 5.66e-02 0.99993
66320 ATTCTCCAGGAACCGGGCTCTGAAGAGAGAGGCATGTCAACGGTGGTGTCTGACCCAAGT -0.23500967 5.67e-02 0.99993
76088 AACCATTTTCCAATATATCTGTGAGAAAAAGTCTTACAGGAAATAGATGGAGCGCTCCAC 0.24349138 5.67e-02 0.99993
258541 CAAGTCAAGCAGGCCTTCAATGACTCAGTTAAAAGAATTGTGCTGTTCTTCCAGAAGTAG -0.20764491 5.67e-02 0.99993
18127 GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA 0.19840983 5.68e-02 0.99993
76261 AGGTTCGAGTTCGTGAGTGTTTTGTAACAGCCTAGCCATTTATGAAGGGCTCTGTGTCAT 0.17675354 5.68e-02 0.99993
68133 TTAATGTTTTACTTAGTGACTGCTAGTTTTAGAAGGGTTGATTTTAATTATAGGATGTTC -0.25543997 5.69e-02 0.99993
170718 GTGCAGAACCCTTACCAGTTTGATGTGCTCGTGATGCCCAATCTCTATGGCAACATAATT -0.14971737 5.71e-02 0.99993
227998 GCTCAAACACTACTAACAGTGTGCATGTTCCCAAATAAACATCACTTTTGTTTACAAGTA 0.18661298 5.72e-02 0.99993
83925 ATGACTTCACAACACATATCCAGAGGGGCCTGCATAGGAACAATGCACAAGCAGAAAAAA -0.23485506 5.72e-02 0.99993
243548 GGCAGAGGACAGTTGCATAGCAGGAAAAGACAGAAGAGCAAAAACTGTATCATTTCGTAA -0.25508952 5.73e-02 0.99993
619355 TGCCTCAAAAACAGAAATGAAATCTTTTCTAAAATAAAGATAATCTTGGGGCCATGGTGG 0.15581234 5.73e-02 0.99993
218215 CACATGTGTACATTAGCATCTGATGTCTGTACAGAACATTCCCTGGCCACGTGCTTTTTT 0.18395943 5.74e-02 0.99993
68229 CCTGTTGTCCTGTTGCATCTATTGTCCTGTTGTATATATTGCCTTTGTTGACAATAAATT -0.19455516 5.74e-02 0.99993
83925 TTGTTTTCATAGTGCATGTTCATTTCGACTCACAACATGTTCTTGGTGTATTTCTTATGC -0.23019736 5.74e-02 0.99993
66789 TTGTTTGACGAATGGCAACCCTAAGTCTTGAGAACATTACAAGTACCGATAATATTTACT 0.16588028 5.75e-02 0.99993
84585 ATCAACCAGCACCTGATGAACAACAAGGACTGCTTCTTCTGCAAAGCCACCATTGTATCT -0.12027286 5.75e-02 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.15841609 5.75e-02 0.99993
113868 CCCTGGTTGCAAAGCCATTTGTACCTTTGAGGGAGGGATGCAGTAAATGTGTACTGTCTC 0.3152995 5.76e-02 0.99993
68171 CTAACAACACATACATACTGCTGTAGTCATGGAGATTTCTGTAATGACATTAATTTACCC -0.15220553 5.76e-02 0.99993
30944 AGGTCAAACCTTTGTAGACACAAAAAAGTCCACCTTAAGGAAAGGCTGTATAAATGGAAA -0.14319821 5.77e-02 0.99993
13831 TTGGCACTGTAAGAATTTCTATTCTCTGTAATGTTTTTCAAAATAAAACTCTTCAAACTG -0.16097604 5.78e-02 0.99993
70382 CTCCAGAGAACTAAATAATTCTACCAATGGCATCGTCATAGAGCCGAGCGAAAAGGCCAA -0.17444153 5.78e-02 0.99993
67187 AGTTTTCACCTCCAGCAGAGACAACAGGGAGGCTCCCTAGGACCTTTCTCATTATTTATA -0.17354012 5.79e-02 0.99993
14811 ATAGTCTCAGTAACTATGTGTTTCAGGGACAGCATCCTCTCACTCTCAATGAGTCCAACC -0.45418143 5.79e-02 0.99993
77045 TTTATTCCATCGGTAGATATTGTTTGTACAATGTACAATGGTTTCATTTCAGAAAATAAT -0.25990689 5.79e-02 0.99993
622473 TGACCCACACTCGGCCTGTCCAAATTGAAGCAATCCCAGATATACTTGGCACGTTTCCAA -0.2580753 5.80e-02 0.99993
14661 TGAACAGGAATGTCCCACAGAAGTACCAGACATTATTTATATAAGGATGAACGCTTTTTT -0.18534149 5.80e-02 0.99993
667214 ATAAGGAAGAGTTTTTGTCAGAGAAGCCAGGATCATGCCTCTCTGACCTCCCTGAATACT 0.22780125 5.81e-02 0.99993
73728 CCTTCTTTGGTGGGCCCTACCCTTTGTACAGCCTCCACCCTCATTAAAACTGCTCTGAAT -0.14390913 5.82e-02 0.99993
170765 CTGAGAACTGTGTGTTTAAGTGTATATGTTGTAAGGGTTAATTCTTATTACTTGGTGACC 0.15879568 5.82e-02 0.99993
239857 ATTATCAATGCTGAAGGCAGCCAAGTCAATGCCGAAGAGAAAAAAGAGTATTTCATTTAA -0.23894908 5.83e-02 0.99993
21784 TTCAACCCCTCAGACTTTTAGTCCTCGAATTCGGCCTGAGAATTAAAAGAGATGAATGTT 0.45601168 5.84e-02 0.99993
67979 TTGGGGTTATAGATTGCGGGAGACTACTTAGGATAACAAAAAGCAAGCTGGGCAAGATTG 0.21814964 5.84e-02 0.99993
22268 CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG 0.20590775 5.84e-02 0.99993
14349 AAGCAGATGCCCCTCAGATCCAGTCTTCAACATCCTTAGTTACTTCTGAACCTGTCACCA -0.17381739 5.85e-02 0.99993
110596 GATTGTGTGGCCATTTGTTTTCCCAAGCAAACAAACAAAAACCACTGGCACTTTGGGGAG -0.3099517 5.85e-02 0.99993
18300 AAAGCCCATATGAGCAGTTCTTAAAGAACAACCCAGAAACAAACAAATATGACGGATGGC -0.18152066 5.86e-02 0.99993
75125 GGCGTCAAGATGAAACACACAAGGATGTTAACAACACTGATTTGGTTTACATTTCATCAC 0.19428539 5.86e-02 0.99993
108899 CATGTTTTACGCTGAGGGTGATTATTCTCGCCCACCTCTACATAAATTGGAGCCACAGAT -0.33752452 5.86e-02 0.99993
234267 TCGTGTTTGTTTTAACCTTGACTCTCTTTTGATTCTTTCTAATGCTACAAGAATGCTGTG -0.22344769 5.87e-02 0.99993
381062 ATGTTTAAACAAGCACTGATAACAGGTTCCCCAACAGCCCAAATAAAGTTTTACAAGGGG -0.21036027 5.87e-02 0.99993
207921 CATTGGGAGACTTGGTTTATTGGTCAGAAGATCTAAGTTTGGGTATTCTTATAGTTGTTG -0.2739786 5.88e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.19903949 5.88e-02 0.99993
20638 GAACTCCAAACAAGCAGAAAGGGAAGAGAAGCGAGTCCTTGGTCTGGTGTTGCTTCGAGG -0.20540119 5.88e-02 0.99993
68554 TTACAAAGTCTTCAAGCATGTGAGAGTACACCTTTAGCTAAGTCTAAATAAAACAGACAG 0.18975532 5.89e-02 0.99993
76251 GGATTTTTATCTTTGCCCAGGATTCCGATGCCTTAACTTTTCACATTACTATGATTTAGT 0.13781486 5.90e-02 0.99993
230751 CAGGCCATTCTGGCTGCATAACAAGATAGATCTTTTAAAAAACCAAAACCAAAACAAAAC -0.26011898 5.90e-02 0.99993
270627 CATCAAGTTGGGGCAGTGAGACTGGAATTCAAACAATGTTAATTAATCAGAGAACTCTAA -0.15780008 5.90e-02 0.99993
53412 GTAGATATGAATTATTTTGAATGTGAACTGTTTTTGCGTGCGCATAAATCCACTTTGTGG -0.25907443 5.90e-02 0.99993
78425 AATTGAGAGTTGCTATTCTACAAGTGAATTCTAGGCGTCTCGACCTTTCACTGACGGAGG -0.25145788 5.90e-02 0.99993
12006 CTTGGTACAATAATTATTGTAATTAAGAGATGTAGCCTTTATTAAAATTTTATATTTTTC -0.1382301 5.90e-02 0.99993
20602 ACTCATCTGTCCATCCAGAGCTGGCATCCTGCCTGTCTAAAGCCTTAACTAAGACTCCCA -0.30761674 5.90e-02 0.99993
71591 CCTCACTGAATTAGTCATGTGCAGTGTACAAATGTTGTAATTTCCATTCTCCTCTGCCAA -0.23664487 5.90e-02 0.99993
72479 CCCTACAGTAGTCAGATCTACTCATTACCTTTAGCAGCTTCTTAAAAACAGATTCTTTAA 0.1938625 5.91e-02 0.99993
73212 CTGGCGGTTCCAGAAGACAAGACAGACGTGGCTCCTGCTGCACATGTATGATGAGGACAA -0.24292183 5.91e-02 0.99993
60532 CCTTTAAAGGACTTACTTATGCTAAGAACCAACTAATAGCCGTGAGACAATCACGTCATA 0.13685008 5.91e-02 0.99993
434223 TTCCTCAAAGAAGCCATGAGCAAAGCTTTGGATCCTGCAATGAGGGAAGTAGAAGCGTAT 0.82696269 5.92e-02 0.99993
22127 GCAGTGCAATGGACTTGCCAGAATTCGAGGATGAAGAAAACTGGCTTTTCAAAGTTCTGG 0.17649733 5.92e-02 0.99993
73934 TTTCTTGCTGTTATGTGTAATTTCTACTCTGTGCCCGGCAAGGAAGGGTTAAGTTTCCTG -0.13479792 5.92e-02 0.99993
209760 CAGGAAATGTACAAGCTGATGATCTTCGACTTCATCATCATCCTGGCCGTGACGCTGTTT -0.16477272 5.93e-02 0.99993
14060 CAATTTTAGGAAGACTCCACTAAGTTCAGTGTTCTGAGCCTTTACTTTTGCATAAAATTG -0.18380198 5.93e-02 0.99993
15042 AATGTAAATAGTTTACAGCTCAAGGCAGACCTGGCCATGATCCTCAGAGGACACAGGTTT 0.19489514 5.94e-02 0.99993
217578 TGAGCACATGGTTTCAACACTACACATGAATGAATCCAATTCTCTAGCTCTGACGTGCTG 0.59985747 5.94e-02 0.99993
14119 GAATGGGCTTCAATAAAGGACAGTACCTGTCGGTGGATGCGGAGGCAGAGGATGACGAAA -0.37675325 5.95e-02 0.99993
22594 GCCTTCGTGCGGCCCCGGTGGATCTACAGTTGTAATGAGAAGCAGAAGTTACTCCCCCAT -0.13398493 5.95e-02 0.99993
66790 AAGCAGATCACCAAAGGGGACTTTGTGACAGAGTGTCACGCATTCATGCAGAAAATCTTT 0.14597606 5.97e-02 0.99993
207227 CGAGTGTGGTTTCCCACTGGATTATGATTCTTTGTACCATTCTTGAAACTTTTATTTAGA -0.21813425 5.97e-02 0.99993
22157 TGTAATACTGTCTCCAAGAAATAAATAGAGCTGGAGAGATGGCTCAGCCATTACGCTCTT -0.23207277 5.98e-02 0.99993
77037 ACCGGGACAAAACCAAGTTTACAAAGAGGACCATCACACACATTGATAGTGCAGCTAGGA 0.50800663 5.98e-02 0.99993
68703 ATCTGCAACCATTTCCTTCTCCAGATGGTGATACTGTGACTCAGCATGAGGAACTTGTCT -0.22875549 5.98e-02 0.99993
101351 AGAAGTGTTGAGGTTGTTTCCAAGAGTGTTGACACCCTCTCACAGCCATAGACTCACAAT 0.28054526 5.99e-02 0.99993
170790 GGGGTCTGAAAATCGTCTCTTGTATACTTTTGTCTGTTATAGATTAATATGCTTGAGCAA -0.28723705 5.99e-02 0.99993
106648 CTAGTTGGTCTTACTCTATTGCCCAATAGAGAGATAAAGGGAAGTGTCTAGGCAGGATGG 0.40949217 5.99e-02 0.99993
432860 GGTAGTGCTGTATAAAATCAAAATCACAAAGCAGATCATATACCTACAACATCACAGGAT 0.23477091 5.99e-02 0.99993
12772 GAAGCAGGGACAGAATTCTTGCTTTGAAAATAATACTTGGGAACATATCTTAATTACAGG 0.81743675 6.00e-02 0.99993
320111 GTTGCTGACATTCTGAGGACATTTTCTAGTCACTGTGCTACAATTTCTTAAGGTTTAAAT 0.5546403 6.00e-02 0.99993
56428 ACACTTAATGAAGGCAAAATCACTTTAGAAGGAAAATTTTCAACTCAAGCATTGAGCTCC -0.26458099 6.00e-02 0.99993
52064 TAAAACCAGCACGATTGCAATTCTCAAGTTTGTTCATAGTTTCTTCCATGACAGATGTTT -0.16049619 6.00e-02 0.99993
394435 TCCTTACACCAGAATTCTCTGTGGCTGTTACGGTACGATTTTGTGTTCGAATATCCCAGG -0.23621874 6.01e-02 0.99993
71853 AGGATGTGGTTCTGTGTAGAAAACGTGGTACCAAGTGAGAACAGCATTTCATGTCCTGGA 0.21778252 6.02e-02 0.99993
258650 CATCTCCTTCATTCTGTGCATAATGCAAACATTCTTGTATCTGGCTTTTGCTTGCACAGA -0.21634115 6.02e-02 0.99993
229791 TGAAAACACAAGAAACATCTTCTACAAAGGGAACCTCCCCCACGCGGGCTTATAAGGATT -0.20289924 6.03e-02 0.99993
54638 CTTATATGTTCCCATATCTGATCAGGGTGACTGTCCAGCTGACCACAGTTTATTGGATGG 0.14935478 6.03e-02 0.99993
641235 AAGGAGCAGAAGTTCACATGCCATGTGCAACATGAAGGACTGTATCAGCCTCTCACACTG 0.14457178 6.03e-02 0.99993
67084 CCATCTGGAATGTGTACTCTCACTTGGGTTTGAGCCTTTAGTAAAAGACACACATCATGG 0.16960344 6.04e-02 0.99993
18124 AGAATCAGCCTTTTTGGAGCTGTTTGTTCTTAGACTTTCCATCAGGTCAAACACTGCTGA -0.22703418 6.05e-02 0.99993
68027 GGCTTGTTGGATTTTAATGCAGCATCTTCAGAACTCGTCCTGATGGTGTCTTGTTGTGTC -0.417785 6.05e-02 0.99993
244698 CTGAAGAGGTAGAATGGGATTATGCCCCTAACAAAAACTGGGAGTTCGAAAAGCAGCACT 0.20632785 6.05e-02 0.99993
81910 TTACAAATAAACCAACCAACACAGCGTTATCCAGGCCCAACTTCCAGTGAAGCCATTGGA 0.23836656 6.05e-02 0.99993
104457 CTGTGAAGCGCTTTGGGGACGATCTTAATCACATCAGCTGTGTCATCAAGGAACGGACAG 0.16046034 6.05e-02 0.99993
72275 GGGAAGGAGTATGCCGCTGGCTGCAAGAAGCATGAACGCTCCTCAGACAAGGCCAAGAAA 0.21710458 6.06e-02 0.99993
667284 CAAAATGTCCTCATATGCATTCTTTGTGCAAATCTGCCAGGAGGAGCACAAGAAGCAGCA -0.21780318 6.06e-02 0.99993
21400 TCATCATCAAAGGATGCCTCAAGGACTACGGATCTCAGCTGCAAGAAGCCAGATCCACCT -0.29762279 6.06e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.28270805 6.06e-02 0.99993
258699 CTAGTCTACAGCATGAGGAACAAGGAGGTAAAGAATGCATTTATAAAGTTGATACTACAT -0.19223501 6.08e-02 0.99993
667551 AAGTGTCCCAAATTTTGCGAATTATTCTTGCTACAGTTGTTGGTTTTTCAGTGTCTTAAG 0.30253506 6.08e-02 0.99993
74376 GGAGAGAGATAAGAATGGGCTACCCTGAGACTGTGGATTCTAAAGACGTACTTATGGATA 0.48260299 6.08e-02 0.99993
101786 CCAAAGAAGATGTAGCATTCCAAGTCAAAATTACAATTTGTCCTTGAGATATGCTACTGA 0.14897324 6.08e-02 0.99993
192652 GCTGCCTTCTCACTAGTTGCAGTCTATGTAAATAAGGTCAATAAATTCTTTGGAAGAGCC -0.24796901 6.08e-02 0.99993
13168 TAAACAAAGGGATGTCCAAGATGGATGCCATGAGGATCTACATTGCTAAAGTGGAAGAGC 0.29621218 6.09e-02 0.99993
67014 TAGGCATCCCAGACTCTGATAAAACGATACTTCGGACAAGTTTATTCAATGCAGTGTTGT 0.18854639 6.09e-02 0.99993
67579 CATATTTCATTCCGCTGGAACTGAAGAATGAATGACTCCAGAGCTCATTTGCAGGCCTCA -0.17875786 6.09e-02 0.99993
19084 AAATGTACGTATGTGAATGATGTAGAACGCCATAAAATGCATTTCATGTGTATATACCCC -0.2299957 6.09e-02 0.99993
66573 TTGTCACTACGGGTTTGGGTAGAAATCAAGAGTTGTGTTCCAGACTCTGTGTCTACCACA -0.20512754 6.09e-02 0.99993
72184 ACCATCGTGCAGAGCCTGAGCCGATGACTCAGAAGGGGCAGTCTTAGCCAGGAGAACATT -0.34483525 6.11e-02 0.99993
56523 AAGTTATGCTTTGCTGAGTTTTGTCTACCTCCTGAAGTAGAGTTGTAAGACCCCACTCCC 0.37753547 6.12e-02 0.99993
231931 AACAAGTCTTGCAACAGATAGGCAGGACACAGCAGAGATCCTGAGGAGTCAAATATGAGA 0.4822048 6.13e-02 0.99993
329207 CCAGTGCTTCATTGTTGTTTCTTGATTAAGATTACCCATTAAGCATTTCTATTTGATGCC 0.26881431 6.13e-02 0.99993
58998 TGAGAGACACTGAGGCATCTAAGTGATTTCAGTCTTAAAGTGTGTTGCAACGATCGATGG -0.41012806 6.13e-02 0.99993
56398 TTCAGACTCTATGACTTGGATAAAGATGACAAGATCTCCCGTGATGAGCTGTTACAGGTA -0.15643721 6.13e-02 0.99993
268885 AAATTACTTCATTAAGATGGATGTAGGACGTGGTTGTTACCTCCACATAAATGTCTTAAG 0.17899749 6.14e-02 0.99993
209737 GTGGGATTGTATTTGCTCACATGGTAGAACTAAACTAAAAGACCTTAACTATGAATCATG 0.21789508 6.15e-02 0.99993
13162 TGGCTGAGAAGAATCAGGTTTACCATCTCCTCTCAGAGCTGAGTGGCTCCATGTATAAAT 0.19321969 6.15e-02 0.99993
21943 GATACATAATAGGCTACTGAAATCTGTCAGGAGTATTTATGCAATTATTGAACAGGTGTC 0.19942001 6.16e-02 0.99993
52626 TGATGGGATTGAAGTGGAAGACCTGCCACAGTTTACAACCAGAAGCGAACTAATGAGAAA -0.1515758 6.17e-02 0.99993
93876 TGAAGTTTTCCACTAGTTTAACCTACTTATATCTCTTACAGTGCTGATAGTTTCTTTCTT -0.18311528 6.18e-02 0.99993
18040 GGAGGCGATGGTGCTACCAAATACATCACCAAATCTGTAACCGTCACTCAAAAGGTTGAA 0.15563781 6.18e-02 0.99993
114896 CCTCAGAGATGTCATCAGGAGACAGATACTTTCAATTTTCACTGTTTGTAAAGTGTACAT 0.26476195 6.18e-02 0.99993
105855 TAGTTGGAATGGGAAAATATAATTAGCCAGTTGATTAATTAGGGTCGTGCCCATGCTTCC 0.40960934 6.18e-02 0.99993
18073 CAGATGTATACAAGTATTGGATGATTCCTCAAGTTTACAGCTGTACAAATATTAGTGCAG 0.41709056 6.18e-02 0.99993
18777 CTGTAAAACACTTAAAGGGGAAGTAATATCTTGGCATATTTAGAAATACTTGTGACTGGC 0.20429129 6.19e-02 0.99993
245827 CATGTGTGACTGTGGGTGTGACTGATTGCACAAGTGGCTTTGGTGGCCATTTGATTTTTT -0.32119192 6.19e-02 0.99993
16541 GGATATCCCTTCCTGAATGGGCAGTACTTCATTCAGTGTTCCAAGACGCCAACGCTTCCC 0.59992599 6.19e-02 0.99993
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.20006307 6.19e-02 0.99993
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.14246922 6.20e-02 0.99993
628813 CTAACTCTTCAGACTCAAAGAAAACGACAGACATCGCTATAATCTACCAGACATACTTCT 0.31189499 6.20e-02 0.99993
258652 AAGTCAATTCCTTTCTGGGGCTGTGCTCTGCAGCTCTTCATTTTCTGTGTCTTTGCAGAT -0.16578557 6.20e-02 0.99993
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.48891353 6.20e-02 0.99993
19265 CATGCATGTTATGGTGAAACACAAGCTGCCCTGGACCTTCGTCACCCCACCCTTACATCA 0.67983955 6.21e-02 0.99993
245049 ACAACAACAACGAAGAAAAAGCCTGTTCTATGGCGTTCGAACTTTTGTAAAAGGTTTCCT -0.18789075 6.21e-02 0.99993
100038854 AAGCCAGCAAAGAAACAAGTCATCAAGACTATGTACGGAGGTGTTTCAGAGGCCAAACCT 0.14415946 6.22e-02 0.99993
53881 GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT 0.27388338 6.22e-02 0.99993
100043600 AAGAAGCAGGAATGAAGCATCTCTGATTGACTTCAGAGCACTAGGAGAGGCCAAGAAAGT -0.23423796 6.22e-02 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.18048224 6.22e-02 0.99993
13839 GTTCCCATCTGCATTTGTTTGTGCTTTCAGTTTGTGTACATGTTTTTGTAGTGTAAGATA -0.44204845 6.23e-02 0.99993
22350 TGACTCCGCACCAGATTTACACACAATAAAAGCTCTCCAAGGCCTTGTGTCTGATTGCAT 0.32630622 6.25e-02 0.99993
66758 AATGAGTCATTAATGCTGTGTCTACATTACAGAGATATGATTCCCAACCCAACAGCCAAT 0.36102946 6.25e-02 0.99993
22393 ATCTCTTCTGAGTACCCCAGGACTTGGGAAATAATGCAAGAGTGTCCCTTTCAGTACACA -0.5478674 6.25e-02 0.99993
29857 TCCAAGACCCCTACCCAACATGGGACTAGCCTTTGAATTCTGGAGTTGTACATGAAATCA -0.20652739 6.25e-02 0.99993
14254 TCCCTATCCCAACTACACATTCAATCTTCTATCAGCATTACAGTCGCATCTTTGGGGTGG -0.15407586 6.27e-02 0.99993
11745 GGATGACATTAGCTCTGAGACGTCTGGAGACTTCCGGAAAGCTCTGCTGACTCTGGCAGA 0.43672942 6.27e-02 0.99993
20674 TGGCAATCAAATGTCCATTGTTTATAAGCTGAGAATTTGCCAATATTTTTCGAGGAAAGG -0.20066373 6.27e-02 0.99993
213773 GAGCAGGCCAAACGGGAAGAGCAGGTGATCAAGCAGCAAGAACTGGACAACCTGCTCCAT -0.15504148 6.28e-02 0.99993
30937 GTGGTAGATCTTAGAGGGTCAGTAGTTTCAAAAACAGAGGTATTCTAAGAAGTCTTAGAA 0.25005353 6.29e-02 0.99993
408067 CTCTAGAGAAACTGTTGAAGTAGGAACAATGTGGGAAAGCCTTGTCTTCTAATTCTTTCC -0.21866007 6.29e-02 0.99993
93875 GTGGTGCTTGCATACATGTAGATTGTGTACTTTGATCATACTCATCCCTGATCATCAGTC -0.46450234 6.30e-02 0.99993
12992 CTCATTAATCATGAAGTTCATCATTCTTACTTGCCTTTTGGCCGTTGCTCTTGCAAAGCA -0.20998794 6.30e-02 0.99993
101809 TGTGTCACTTCCTTTAAATTATTAACTATTTATTGTATCCGGAACCTGTGATTCAGCTCC -0.20807538 6.30e-02 0.99993
18854 CCCTTTAATACAGTTTCTTATGGTTGTTGTGACCCCCAACCATAAAATCATTTTGTTGCT 0.13192431 6.31e-02 0.99993
237625 AGGAGTAAATGAATTAATCAACACACATACCACCCAGTAAACATTCTTCTTCTCTAACAC 0.18588451 6.31e-02 0.99993
225207 CCTGAACCTGGAGATTACTGGAATTGTTTTCCAAGAGGAAATAAATTCAGTTTACCATCA 0.47484351 6.32e-02 0.99993
72080 TTACGTCTGTCCTGATCCACCTGGCAGGGTTTCCTGGGATCACTGGCTTAGTAAAAAGTA -0.2513868 6.33e-02 0.99993
623121 GGCTTAAGTGCTGGGTATGGAAATTGCAATCTCAGTTGCTTGGATATGAAAATTATAATA 0.30515447 6.33e-02 0.99993
13479 AGCTCAGGGAAGACTGGACAAGCCCAGAGTTCCTGTTGTCCGTGCAGAACCACACCCTTT 0.19742332 6.33e-02 0.99993
52276 TCTCCTATTCTGTTGTCATTTGTGCCCTCTATGGGCGGGTGTGTTTCAAGTTGGTTTTCT 0.2969739 6.33e-02 0.99993
66605 CAAACAGCTGCCTGTTTATTTATGTATGTCTGGGATTCATTCAATACATTACCACAAAAC 0.18199064 6.34e-02 0.99993
620078 GACTCTGAATCCTTATCTCTGGTACTGTTGTTCTCTGCTAAAATAAACTGTTATGCCAGC 0.21358771 6.34e-02 0.99993
74338 CTGAAGAGGGCATATTTATGCACACATGTATATATGCACACATGTGTTATCTAGATGTAT 0.28627029 6.34e-02 0.99993
225049 AGTAGCAACCGGCGAAACAGCCCGAGCGGCAGGTTCACCACTCTGGACACCGGTGAGTGA 0.28739124 6.34e-02 0.99993
270066 GCCTCAGTGTATGATTCATTCAGACTCCCAAAGGGGCTCAGTAGGTAGGCAAGAGCCAGC -0.34810001 6.34e-02 0.99993
20677 AATCCTGTCCGTCACTGCCTGTCAGGTTGTTCCTATATACCTTCTGTAAATAACTTTTTT -0.28428367 6.35e-02 0.99993
30936 CGTGCTAGTTCTATGGAAGACTGTGACTAAAGCCTAAATTTAACCAACCCAAGGGGAATG -0.13229006 6.35e-02 0.99993
257985 CACTTCCCACATGATTGTTGTCTCCATAACATATGGAAGTTGTATCTTCATGTATACTAA 0.48490596 6.35e-02 0.99993
18552 ACCACTCTTCAGAGGGTGGCTACAAATCCTGCAAGAGATGTGATAACAGCTGTTTGACAT -0.28142548 6.36e-02 0.99993
17339 CTTCCTGTATATACCTTGCCAGCTTTAAAACATATGCCTGTAAGAAGACAGACAACCCAA -0.23003934 6.36e-02 0.99993
74081 TAAAGGAAGCACCGTTGTTGTAACTAAGCTGTGGAAAAGCTTTTCCTTCTGGACTTTGCA -0.14243037 6.36e-02 0.99993
16909 CTTCATTTTGAGGTGAGGCGCCCCACAGATTGTTTCTATACAAATGTAAATCTTAAAAAA 0.44781596 6.36e-02 0.99993
67014 TAGGCATCCCAGACTCTGATAAAACGATACTTCGGACAAGTTTATTCAATGCAGTGTTGT 0.20947015 6.36e-02 0.99993
70363 CTGGACTCGGAACTCTTCCTTGAGAAGTTTTTCTTGGTGGCAGGACTCAACTATTTCAAG -0.28530734 6.36e-02 0.99993
207393 TGTCTTATCCCCTGGCTTAGAGGGACTCCCATATTTCCATGGAAATGGCCACCATCCTCT -0.29634626 6.37e-02 0.99993
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.59722108 6.37e-02 0.99993
19052 CTGACCAGCGTGCTACATTCCTATACTGTACTCAATAAACTGTAAACAAATATACCACCT -0.15316483 6.37e-02 0.99993
100039139 AGGAAGAAAAGAGCAAAGAAATTGCAAGTCTGCAGAACACTATCCGAGACCTAGAGCAGC -0.31405288 6.38e-02 0.99993
11852 CAACAGTGTGAATTTTTTCTTTAAATTTGTGTAGCATACGCAGTTTTGGTAAAGGAAGGC -0.19552491 6.38e-02 0.99993
330230 TACCTCTGCAGTGAGTGCGGCAAGAGCTTCTCACAACATTCCAACCTGGTGACCCACCAG -0.2352511 6.38e-02 0.99993
53883 TCCGGAAGGCTATGGGAACCCCGACTTCTGCTGGCTCTCTGTCTATGATACCCTCATCTG -0.14775691 6.38e-02 0.99993
20442 AATACCAGGAAAGGTCTAGCCTCCAAACAAGTTATTTTGTCTTCTGAGTTGGATTGGAGG 0.27427916 6.38e-02 0.99993
109978 TGTCAGCAAAACCAATCACAGAAGCTCAAACAAAGTTCAGGATGAAAGCTTTGCTTCCAC -0.1256152 6.39e-02 0.99993
259042 ATGACATGAAAAAGGCTCTGAAAATAGTTTTAGGGAGGGTAACTAGAAACAGACTAACGG -0.16476952 6.39e-02 0.99993
100042457 TTTGGACCCAGACTCTTCTAAAGTGTTTGTATTGCTATGACAAAATACTTGAGATAACCC -0.32045485 6.40e-02 0.99993
76407 CCCCTCCCAAAGACTCACACCTAGAGCCCCTATCCTAGAGTAAAGTATATTATTCAGTCC 0.19369083 6.40e-02 0.99993
70757 CCATACTCAGTTCTGAGTTTCAGATAAACCATTATAAAACATCAAAGTCACTACACACTG -0.16622304 6.40e-02 0.99993
72486 TGCATATTTTTGAACATGTGTATGGGTGTAAAGTTAGAATCATTATGTGTTGGAAGGCAG -0.23050715 6.41e-02 0.99993
234564 GTTCTTCCACTAACAGTGTATGTAAATCCAAGATGGATCTTGGAGGATCCTGAAGAACTT -0.14121995 6.42e-02 0.99993
22032 TCTAGTGCTAGGTGGGCACAGCAGGGGAACTCTGATTTTTAATAAATCCTGAATTGTATT -0.24625716 6.43e-02 0.99993
497114 ATCGTTGAGAGATCTGATATGCTATTGTAGAACAAGAGGCTGCAAAAGAAGAGAACGCCT 0.13468272 6.43e-02 0.99993
170776 TGATATGTCATCTATCTGTAACACCTGTTGGCAAAATGACCCTGCAGGGTGACTGAACTT 0.22004129 6.43e-02 0.99993
52064 TAAAACCAGCACGATTGCAATTCTCAAGTTTGTTCATAGTTTCTTCCATGACAGATGTTT -0.17344188 6.43e-02 0.99993
21833 AAAGCAGCATGTCAGGGTATATCCCTAGTTACCTGGACAAAGACGAGCAGTGTGTCGTGT -0.28237557 6.43e-02 0.99993
67955 GCCATGAACAAGTCATTTATGGAGTCTGGTGGTACAGTCTTGAGTACCAACTGGTCTGAT 0.11623072 6.44e-02 0.99993
110606 TATTTTGTCCTTGGTATGATGACTACACCCAGGTAATCAATTATGAGTGGAAAACCAACC -0.45455703 6.44e-02 0.99993
192192 CTTAACGAAACTTCCTTTTGAATCTAGCCACCAATGTGCCTTCATGTGGACTGGTCCCAG 0.35384539 6.44e-02 0.99993
78586 ATTTTAATGTGTTCCTCAGAACGTATGTATTGACTTCTACAATAAATGACTGGCTGGTGA 0.16400136 6.45e-02 0.99993
54673 CTAACAAGCAACTTCTACTTTTGAGCCCCAACTTAAAAATGAAAGGATTCTTTTCTACTG 0.21812688 6.45e-02 0.99993
107607 CTCAAAGCAAAGCATGGCACATACCCACCACCATACCATGGTGCGCATGGGATGGGACAG 0.59203037 6.45e-02 0.99993
217169 TTACAAATGAACATCATCCCCAACTTTGCTTTCAGTTTCTTGGTAAGCACCCGCTGTCTG 0.18987582 6.45e-02 0.99993
67453 ATAGAGTACTAGTTTGTATAGCAGAGTAACAATAATCTGTGGTTTGACTCTTGTGTCTTG -0.21338582 6.45e-02 0.99993
26457 GGTACCCACCTCCCTTTCCTATTGTGCCTTAGGTTCATCCACGGTTCCCCTGTGGAGCAA -0.19163063 6.45e-02 0.99993
72323 ATTTATGAGGGGCCCAGAAGACACTGCTGAGGCCTGAAGCTGGCTCCACTCTAGTGCCAA -0.12229203 6.45e-02 0.99993
76915 GGCAAGAGACGGAAGAACGAGCCATGCTTGCAAAAGAACTTTCTTCATTTCGAGACCAAA -0.18638275 6.45e-02 0.99993
434174 TGATGTTGCAAAGAAACTAGAAGAGTTGTGGAACAACAGTGCAGCAGATGACAAGCAGCC -0.21417911 6.46e-02 0.99993
320923 AACTCCCAAGGCCAAGACTCAAAATTGTCTCCTTTTAGACTTGAACCTGGCAAAATAAAT 0.202558 6.46e-02 0.99993
216233 AAACACATGCCTCATATAGACTATCTCCGAATGCAGCTATGTGAAAGAGAACCCAGAGGC -0.24505891 6.46e-02 0.99993
72135 TACTAACAATGCTTCATTTTATTGTTTTTTGTTGGTTGTCTTGAAATGAGATTAATGGGG -0.26860941 6.46e-02 0.99993
56758 GCAGTAGTTGACTTTGCTGTATGGAAAAATAAAGCGAAATTGCCCTAATAAAACTTCTCT 0.20618112 6.47e-02 0.99993
74220 AGTGGGACCCTCTACTTAGGCAGAATGATACTTCTTTCAATTCCTAAGTTGCTAGTTTAA -0.17351856 6.47e-02 0.99993
72565 CTCTTCTGGGCCTTACTCTGATAGTATCAGTAAAATAAACTATATTTTGTTCCGTTGTTG 0.25528213 6.47e-02 0.99993
208117 GTTTGTTACTGATTAGTTGCGAGACTTTCAAAGTGAAGTTCATTAGCTAATTTACAACCC -0.18218603 6.47e-02 0.99993
100502931 ATTTGAAGTGAATTCTTGCATGTGATGTCAAATGAGGAGAGAGACAGTAATTCAGAAAGG 0.24089298 6.48e-02 0.99993
18124 AGAATCAGCCTTTTTGGAGCTGTTTGTTCTTAGACTTTCCATCAGGTCAAACACTGCTGA -0.21220673 6.48e-02 0.99993
404325 CTTGAGAAACAAGGATGTAAAGTGTGCATTGAAAGAATTCCTAAAAAATCCATGCAAACG -0.18065432 6.48e-02 0.99993
16176 AGGTTCCTATAATATGGATGAGAATTTTTATGAATGAAGCACCAGCACATTGCTTTGATG 0.74114377 6.48e-02 0.99993
102103 GCCAAAGCTGAATCTTCTTCAGTCCATTCATCTATGTTATATTAAAGGCTAAGGTGTTAA 0.43211434 6.49e-02 0.99993
100041187 CCAGTCATTTATGGAGTGAGGACAAAACAAATTAGGGAGGGAGTCTTAAAAATATTTGTA -1.00098845 6.49e-02 0.99993
80291 CTGTTCTCTTTCCGGTCAGGGAAGCATACCTAGACTGAAAACCATCACCAAGATGGTGAC -0.22186215 6.50e-02 0.99993
319430 CACATACGGTTAAGGCATTGCCTATTACCTATTTCGTGGCATCTAACAAAATAAAAGAAA 0.5884616 6.50e-02 0.99993
408065 TTATAATCAGAGGCTTATGGGCACCAGGACCTGAAATGTGATATTTTGTAAACGTTTTTT 0.27483663 6.51e-02 0.99993
72330 GCATCTTTGTGGCCGCAGGGGTGACAGACACAGGACTTACCAGCTCTTCAGAGGTGTACA -0.37882398 6.52e-02 0.99993
73998 AGTTACTGAATGTAAAGCCCAGCTTGGAAGATTTGAAGGAACTGTCACCAACTGAAGGAA -0.22999301 6.52e-02 0.99993
12322 TCCTTGCTTCGCAGAGATCCGCTCTTTGTCCGTGGAATGTGGCTGCTGGTTCTCCTTTGG -0.32927264 6.52e-02 0.99993
327799 GCGGCAGAAGGGCTTACTTCATACAGTTAATTTTGCTACTATTTATGAGTTTTAGTGTAA 0.13350003 6.53e-02 0.99993
23821 CCACAAGCCATAAACCAATAAAATAAGAATCCTGCGTCACAGTTTCCAGCTGGGTCCTCT -0.10808127 6.53e-02 0.99993
26934 GCTCTTCAGCCTCCTGTATAATTACTACTTTTAGCATTTTCCAGACTTTAAATACAGTTG 0.23243062 6.54e-02 0.99993
66039 GGTGTAGCCTCTCTCTCCATCCTGATTGCTTACAGATCAAAGCGCCAAAAACACAATTAA -0.41299775 6.55e-02 0.99993
66129 GAAATGTATCATAAAATCAAACCACTGGTAATCCTTAGTAACTGTAGTACTACTAGGACC 0.19799755 6.55e-02 0.99993
74954 TCTACTGTGTTGCCAAGGGCACTCATTGGCTGTAAGTCTTTGCTATAAAATAACAGCAAA 0.2072556 6.55e-02 0.99993
57913 TGCAGACAAGTATGCAGGCAAAACATCCATACAAATAAAATAAAAGCTATTTATTGTGTG 0.2021184 6.56e-02 0.99993
329154 TCCTAACTACTGAATGCTCTAATAATGCAATGAAGTACTTACCTGTAATATACAGTGGAC 0.23011415 6.56e-02 0.99993
12892 GTATGTGATTGTGTTTGCCACTTTTAGGGTAAGAAAATCTACAGATTCAACATGTCTTAC -0.14888533 6.56e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.14601435 6.56e-02 0.99993
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.21010357 6.57e-02 0.99993
118449 CACAAATGCGCAGGCTTCTTCTGTGTACTCGGTACCAGCTTATACCTCTCAGCCCAACTT 0.28968668 6.57e-02 0.99993
14725 GCAAGTAGCATTCCCGGTTTCTCTGTGCTAATATTGCACGTGTGTTAACGAATGAATGGA 0.27256616 6.58e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.15380551 6.59e-02 0.99993
18016 GCGACTTTCCATGGAGATAGAGAAAGAAAAAGTGGAGTACATGGAGAAGAGCAAGCACCT -0.26755948 6.59e-02 0.99993
73174 TTTGAGGGCATCCGCCTGCGCTTTGAGAAGCAGCCATCTGAAGAAGAGGAGTGGGCTATG -0.20283343 6.59e-02 0.99993
69934 AACACTCCTCTTTATCCAAAACCTGAGCTCGTAGGTTTTTAAGATTGTGGGAATTCTGTT 0.1367378 6.59e-02 0.99993
100689 CCACAGGAGGAACAAACGAAGAGGGGCAGTTTTTCGAAACTTGGCCCTTGTGTGTCGTTG 0.25252997 6.60e-02 0.99993
11890 CATGGCTCTATGGTCTCATACCTTAGGAAGACTGAGAATCCCCCCTTCTGCACAATTTAT 0.46538032 6.60e-02 0.99993
108978 CGTTCCCTCAAATATACAATCACTGGAAACTGCAAGTAGAGATAATAAATTCCACAATCT -0.16454339 6.61e-02 0.99993
14560 CTACACGTGCTTTTATACATGCAGTATGCACATGTAATCACGGTTGATTTCTTCTTTTAA -0.38405065 6.62e-02 0.99993
77619 TTGGAAACTTTTGCTAGTACGTTCTTAAGACAAGGAGCCCAGAAGGGAATTAGAATAATG 0.42415947 6.62e-02 0.99993
93840 CTTCTTGAATCTCTTCCAAGTGAGATTGTAAATGTAGAACTTTCCATTGTTGGATCTAGA -0.20452749 6.63e-02 0.99993
20510 GTTCACAAGATCATTGGGGTCATCTTGTAACCAGCCACTTCACACACTGTGCTGTTAACT -0.17398709 6.63e-02 0.99993
67120 AACATCTAGGAATGTGACTCCATTCAGAAGTTAGGCCTTTGCAGATGTCAAGATGTGGCC -0.38971758 6.63e-02 0.99993
258799 AGGAACAAAGATGTTAAAGTTGCCCTGAGGATAACCTTGAGTAGGTGGAAACTATGGTAG -0.15719756 6.64e-02 0.99993
11853 GGGGGTGGGGCTCTTAGTCCCTCTGGCCTTCCCCATATTACACACCAGCACTTTATATAT 0.22793956 6.64e-02 0.99993
239591 ATCACTCTTAGATGCTCCACCCAAAGTGCGGAGTGCCCGGGCCCTGATGGAAACAGTGAT -0.1481435 6.64e-02 0.99993
321001 CCACAGAGGTATATTCAGCAGCTTGGGTTATAGTTAATTCCAAATATGGTAAAGTTGAAT -0.18306685 6.65e-02 0.99993
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.5797924 6.65e-02 0.99993
12412 GCATATGTTGTCACCAAAAAGTTTGAGGAATTGGCATTATGTATTAAACACTCAGTTGGA 0.1504136 6.65e-02 0.99993
18858 CTCTGATTTTATACCAACTGTGTGGACTAAGATGCATCAAAATAAACATCAGAGTAACTC -0.3102463 6.65e-02 0.99993
353235 TTATACACCGGTGAGATCAGCACCACAAGGTCTTTGGATGAAACAGATGGGACTAGACAA -0.24584795 6.65e-02 0.99993
67871 GAAAAATTACCAGAGAGAATGACACAGAGTACCGCTTGAAGTTGTCCGTGTATTTATGTT 0.15647831 6.66e-02 0.99993
331026 AGGGTAGGACTCAATGCTTCACGAGGCCCTGGACTTGGTGCCATTTGTCTAGGGAGGAGT 0.16953826 6.67e-02 0.99993
241489 ATTTGTCCTCCAAGGAATACAGTGACCTCATGCAGCTCCTGAAGCAGTCAATATTAGCCA -0.3011825 6.67e-02 0.99993
100046275 AAGCGCTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGAAAC -0.3399434 6.68e-02 0.99993
14406 TAACACTGTCAATATGGATATATATTACACATCATCTAAGTCTCAATCATCAGCTGCTCC -0.22050829 6.68e-02 0.99993
434438 GGAAGCTTTGAGACCAAAGGACCTTATTCCTGTTGAACAATTGTAGTATTGGTTATATTT 0.17436703 6.69e-02 0.99993
319765 TTAAAAAGTGACAAAGAAAAACAGAGAATATTGGAGCCGTCCTGAATTTCAATAGGGTAC 0.29085131 6.69e-02 0.99993
433466 GGATCGACGGGGTCATTTGATTCTGGAGACAGCCTAGAGTTCGAATATGTCCTGGCTGCT -0.27843961 6.70e-02 0.99993
216233 AGGTGTGAAGATGTAGCTAGGTATTTTAAAGTTCCCCTTAGGTAGTTTTAGCTGAATGAT -0.26701293 6.70e-02 0.99993
117197 CCAGTCCTGTTTCGGACCGAGGACCACTTCCCTGGCTGCGGTGACAGACCGCAGCTCTGA -0.1610349 6.70e-02 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.17486974 6.71e-02 0.99993
637004 ATTTGGGTTTGATGTTCTCCTGGCTCTGCTGTGTTTTGTTACAACCTTTATGGCTCGTCA -0.14644616 6.72e-02 0.99993
385138 AACGATTTGAATGACAGGATCAACTTTGAGACATTCATGCTTGAGATGCAACATAACCAG -0.16934928 6.73e-02 0.99993
231986 ATTATCTTGCCCTTTAAGAAGCTGAAATTCTTGCCATCGAACTTACCAATCATTTTAGTG -0.16290801 6.73e-02 0.99993
57259 GAACACAGGTACCACCTGCACCCACGACAGCTTCTTTTCTCACACATGGGGAGACTGGAG -0.35989712 6.73e-02 0.99993
56707 ATGCAATGAGTGCCAGAAGCGGTTCAGTCAGGTCTCACACCTCCAGTCCCACCAGAGAGT -0.17612631 6.73e-02 0.99993
245865 ATGACGAGACAGAAGTGTTCTTGGGGAAATTCATCTTTGATGTGCAGAAATCTGAAATTC -0.17296965 6.73e-02 0.99993
319909 GGGGTGGGTAGTAAGTGAATGTGCAGAGTCAAATCTAAGACATCGTTTTCAATGGCTTTA -0.20707664 6.73e-02 0.99993
18436 TCAGGTGGAGAAGTAACCCTGATGAATCTTGGCTCCTTGCCTGTGGCCCAGTCCCAGCTT -0.13745541 6.74e-02 0.99993
574437 TAGGAGTAACTTAGAATGTTTTGTTTGTGGAATTTATCGCACATGTAGTATGGGATCATC 0.68902818 6.74e-02 0.99993
72058 CCCTCCTAAATCTGCTGAAGTCAGCCTTCCAGAAAAACGCAGCAGTAGCCTTCCTTATCA 0.18809123 6.74e-02 0.99993
81905 CTGGCCCCAAGAGGGACGAGGAGAAGAAAAACCACTACTCGTACGGCTGGTCCTTCTACT -0.29191412 6.74e-02 0.99993
58194 GCCAATTAAACTAAGACCAAGGTCGATTGAAGTGGAAAATGACTTCCTGCCCGTCGAAAA 0.20394035 6.74e-02 0.99993
258398 TAACTTGCTTTAGTCTCTTGCTTATATCATATACCTACATCCTTGTCACTGTTAGCAAGA -0.13269136 6.75e-02 0.99993
258458 TATTGCATCCTATATCTGTGTGATTCTTGCTGTCATTAAAATGGCTTCAGCTGAGAGTCG -0.17214858 6.75e-02 0.99993
27222 ATGTGCAGTCTTGTTACATCCAGCAGCCTGTCTAGAGATAAATGCTTGGAACAACCCTCA -0.36648233 6.75e-02 0.99993
102626 GCTGGGAAACCTTAGATCTTATCAATTACAATGCTGCTGGGTTTTATATTCTGATATCAA 0.40308554 6.76e-02 0.99993
24058 TTGCCTCTATCCCTGGGCCCCTCAGGAAAGGAGTGTGGCCCCAGGGTGTCACAAAATAAA 0.18005849 6.76e-02 0.99993
16423 AATGACCTCTTTCACCATTGCCATATTGATCACTCAAGTGCTGGGCTACGTCCTTGCTTT 0.22487709 6.76e-02 0.99993
67080 CAAAGATGCTCTTGAAGTAGTCCTCATTAACACAGCTTGCCTTCACCTGCCAAAGCTCTT 0.14892864 6.76e-02 0.99993
22004 ATTCCACCAAAGAGGACAAATACGAAGAAGAGATCAAACTTCTGGAGGAGAAGCTGAAAG 0.42073289 6.77e-02 0.99993
242585 AACTCTCAAGTGTAGTCCTCAGCCAGAGTCGGACCTTAGTTGAAAGGACACAAATGAAAG -0.18869354 6.78e-02 0.99993
16530 ACCGATGAAGATCAAGATGGCATCCTAGGCCAAGATGAGCTGGCTTTGAGCACTGTGCTG 0.1581281 6.78e-02 0.99993
27361 CCCCTTGATTGCTCTCTGGGATGATCAAGTAGAAGTCAATAAACATGCAGCCTGAGCCGT 0.27569208 6.78e-02 0.99993
114564 ATCTTTGCTTTTGCACAGTGTTTCAACCCTTTGGTCTATGGGCTCCACAACAGAGATCTG -0.2867283 6.78e-02 0.99993
68564 CTCTCTGTCACTAACACTAAGTGTATACTCTTGTTTTTCATCAACCATTTAAGAGAAACG -0.1504691 6.79e-02 0.99993
76469 CTTTTTTCACAAGAAAATGTCACCTTACTTCACTAGAGGATAATGAACCCTAGTCATTAG -0.26280959 6.79e-02 0.99993
633640 ATACGGAATGCGCATTGATGTCTGAGATGACCTTATATGTGGCTCTAAGAGAAGGAATTC -0.49578276 6.80e-02 0.99993
107751 ACACTGTGTGGACTAGTTACATTTCTGACAGACAGTGGACCAGAAAGCTGTTGTCATCCA 0.16435178 6.80e-02 0.99993
245839 AACAAAGCTCATGGAGTTTTGTCTTATGTGAAATCCAAGAAGATCTCTTCAGGAGTCTTC -0.18910203 6.80e-02 0.99993
209091 AGCAAGATCTAGAGAATCTTTTGAATTGGGCATTATTCCACTGAGGACCTCTGACAGCAG 0.22087771 6.80e-02 0.99993
18676 TTGTAGCTTTTTATATTTGTACATTTCTTATGAGGTTTGTTTCTACACCCGTTACCCGGA -0.15881013 6.81e-02 0.99993
545384 TTGCTTTAAAACTGGGTCTGCAGACCAAGGTGCAATAAACATGTTTCATGAAATATTTTC 0.50169476 6.81e-02 0.99993
26970 GACAAGAGAGCCGCTCTCTGCTTTCGCCACAACCTGAACACTTACAACCGCAAGTATGCC -0.15778698 6.82e-02 0.99993
241275 GAAGCCATGCTTGTACTGGGACCCCAGCCAGGAGACCAGAACTAGCAATAAATACCATGA -0.18797599 6.82e-02 0.99993
320253 TAGATCCGAGAAGCCAAGCATGGTGGTGTGCGCCTTTAACTCCAGCCCTCAGGAGACAGA -0.17740133 6.83e-02 0.99993
17920 TGAAGAGATCTGGGAGCGTTGTGGAGGCATCCAGTACCTTCAGAGCGCCATTGAGAGCAG -0.16600534 6.83e-02 0.99993
14810 AAGAGGGCTGAGCCTTCTCTTCTGTCTGCAGCCACAATAGGCTTCCTCAGACGCTGGCTT -0.21276135 6.83e-02 0.99993
100042314 GCCACAGATACTGGCCTCTAATGGTTTGCAATTATAAAATACAATTGTTGATTTGGCTAT -0.26334362 6.84e-02 0.99993
14724 TCAATAGGCAAAGTCTTGGATCAGAGGTGGATGGAAACTCGAGCCAGCGCCCAGAGTGGC 0.43657062 6.85e-02 0.99993
20444 AAGTGGACAGCCACAACTTTATCATGAGGATGAATCAGGCACCGACTGTGGGCTTTGAGA -0.15988983 6.85e-02 0.99993
216527 CATGACTTTCCTCTTCTACTTCTCAGAGACCTTAAAAACAAGTTTACTGCAATGTGAATA 0.6278788 6.85e-02 0.99993
76813 GGGACAAAGGGCACATGGAACTGCAGTGTTCTGTCTGGAGTTTGAGGCCTCCACAAGCTG -0.15129986 6.87e-02 0.99993
70950 TTGAGATGCAGGAGTTTATACGAAGACAAGTACTCTATAATATGGCTTTGTTAGAAGTAG -0.19217107 6.87e-02 0.99993
12769 CTCAGATCCTCTTTAAGAGTGTTATATAGTCTTAACCACTAAGCTATTTCTCTAGTTCCA 0.16729178 6.87e-02 0.99993
381406 GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC -0.16509209 6.87e-02 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.32643173 6.87e-02 0.99993
381359 ACCTTCCTGGGCATCCCAGGTGTGCCAGGCCTGGAGGAGGAACAGAAGAAAAACAAGCAT 0.49735411 6.88e-02 0.99993
100046147 AATTAGACCAAAGTCCAGAGTTAAGCCTGTGGTTTCCATGAAACATCCCCATCAGACGAC -0.1390474 6.88e-02 0.99993
27218 TTTTAGAGCCTCTTATGCTTCAAACAACAGAATGAAATCCATCCAATGTTCTTCAAAGTG 0.2803394 6.88e-02 0.99993
18045 CACCACCTTTTTGACAGGTATTTGAGAATACCACTGATACACAATACAGTATTTCATGAC -0.22348353 6.88e-02 0.99993
18974 TCACGACTAATCCTTGCAGAATTCAGTATTGTACACAAGAAATAATTATCTTCCGTGAAG 0.17867456 6.88e-02 0.99993
329506 GAATGAGCTAGAAGATGCAGCGCTCACTTTTCCAGTCCTTTTCCAAGATGTCATTTATCA -0.17382047 6.89e-02 0.99993
75471 GCAGGTTTAGCTGTTTGTTTCTTCCCTGAGGTTCAAAACTAAGGGTCCTGCAGTTACAAC 0.16917705 6.89e-02 0.99993
140703 GAGGCTTTGAAGATTTTAGCTGAGAGGGTTTTAATCTTGGAAACAATGATTGGGCTCTAT -0.25101504 6.90e-02 0.99993
68833 TGTTGGAACTCTTTAATTAATCATGTTTCTTTAAGAGAAATTTAAGCAAGCTTGTTATGT 0.18439387 6.90e-02 0.99993
192157 TGTGTTTGTATCTCCTTTTTATGATTGCTGTACCGACCCATGTCTTTTTGGGGAGGGATG -0.14859196 6.90e-02 0.99993
74204 TTCATAAGTCTCATGACCTTCTGCAGGAGGAGATCGGCATTGCCATTTACAACATGGCTT -0.13722635 6.91e-02 0.99993
76498 GCCTACCAGAGACTTGTCTGCTCAGGAAATCTCTATACAGTGGGTGGCTCCAGCCTGCTG -0.16577377 6.91e-02 0.99993
72982 TTCGCAAGGAGTTCATGCAAGTCCGAAGGTGACCACTTCATGTCACATGGGTGAATACCT -0.18003877 6.91e-02 0.99993
667387 GGGGTCAGAAAAAACTTTATGGAGAATGTTTTGTTTGTGGAATTTATTGCGCATGTAGTA 0.39553644 6.92e-02 0.99993
227800 AATGCAAAGAGGCTCATGGAGCTTGCCTGTAACACAAAGGTACAGCAACGTTTGCTCTAA -0.17112361 6.92e-02 0.99993
21414 TTTTTTCATTCTCGCTGTAGATAGCCTGAATCCAAAGAAAACCAAAAGGGGTTATCCAAG 0.60479615 6.93e-02 0.99993
234964 AATAAAAGTACCCTGTAGTAAGCAGGATAGAAGCAAACATGTGGATTTCTGACTCTTGGC -0.17739114 6.93e-02 0.99993
11491 TGTGAATTACTAATAAAGCTACGCACATGTTCACAGAATGTTTGTGGCTACCAACATGAA 0.17850235 6.93e-02 0.99993
71138 AGATCCCACTGGAATATATCCATAGAGAGACAAGGCCTTTGGACTTCCAGAGAGATCTGA -0.1888112 6.94e-02 0.99993
56464 GTGGTGAACTGAGAGTTGCTGGCTCAGGACCTATGTTGTCACAGTGGCCCCTTCCTTAGC -0.14724798 6.95e-02 0.99993
12776 ATGTTCTTCATCACCCTAATGAGTGTGGACAGGTATCTGGCTATTGTCCACGCTGTCTAT 0.18743804 6.95e-02 0.99993
226594 CCTGTCCGGGGATAAAACAGGGTTTGCAGGAATATGGGTCGGTCTGATATCCATTCCTCT 0.36310168 6.95e-02 0.99993
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.68379659 6.96e-02 0.99993
232813 TCTAGATGACCAACAGTAGTGACTGCATAATGATTGTGTCATCAGAGTCCTTAAGTCCCT -0.20754959 6.97e-02 0.99993
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.26585393 6.97e-02 0.99993
71911 TGGTCACCTCTTCTTTGTATTGGGAACTTCTTTTTAATTAAACTGAGACACAGTTAGAGA -0.22938589 6.97e-02 0.99993
170936 AGGAAGGATGTAGCCACCTTACCAGTTACTGTACCACCTGAGGCGCCGGTGACTTTCCAG -0.1574063 6.99e-02 0.99993
74770 CTCGGGCCTTGTGACATCGTCTACCTGTGGTCTGTTCTTAACTGCTTCGGCCTCAACTTT -0.20234716 6.99e-02 0.99993
100038618 ATGGTTCTGACTGTCCCAGAACCAGCAGTATAACTCAAGAAAGACTGGATGTGGAATGTC 0.21855594 6.99e-02 0.99993
497097 CTGCAGTACAAGGATGATGCCCTTATTCAGGAGAGGCTGGAATATGAAACCACTTTATAA -0.20279611 7.00e-02 0.99993
226778 GAGCTGTAAAATTCAAGTCAGTATGAGCTATAATAATCGTAGCTTCAAAAGTAGGTTCAC 0.39559576 7.01e-02 0.99993
56417 AAGTCCCCACCTCCCTTTTCTCAAGGGAAGAGGCCAAGATTAAAGGAAATGGAAATGCTA 0.27142455 7.01e-02 0.99993
50757 GTAAGCTGCCAATTTGCTGGGAATTTATCAGTTCTCAGAGTTTTCCAGAGGAGTCATAGG 0.96771283 7.01e-02 0.99993
100033459 TGGTTTCTGCCAGTCTTTATGTATGCATCTTTTGTTTTGTGTCAGATTACTTCAATGTAC 0.30961754 7.01e-02 0.99993
243538 CACGATGTTGGAGAGCCTGAACCACAAGGTGCTGGAAGTCTACCGGAAATGTGTGGGCAT -0.5170041 7.02e-02 0.99993
54710 TTTTATTTTCCCAGATCCAGAAGTTTGCCTGTTGCACCAACCTTGCTTCAGGGTAGCCTT 0.15980005 7.02e-02 0.99993
233016 AATAGAGGGGTCAATAAATTTTTAGCCAAAAGCTTCAAATTCTTTCAGGAAGCCTAACCC 0.15597801 7.03e-02 0.99993
381853 AATCAACTGGAAGGCAATTGGGATAGACATGATGCTTAGGTCATGGGTCATGTTTGAAAG 0.59441178 7.04e-02 0.99993
12669 TGGTAAGGGAAGTTCCCAAAGCCTAATGAAAAGGAACCTGAACAAATTAACCCCACAGTC -0.24643323 7.04e-02 0.99993
76199 TGACCTTCCATTCCCAGACGACATGGACAATGACATTGGCATCCTCATGACCGGGAACCT -0.15383083 7.04e-02 0.99993
269717 GACACTGTAAATAACTCCTTTCCTGGGTGTGTGGTTTTTTGTTTGTTTGTTTGTTGATTT -0.47096217 7.04e-02 0.99993
337924 CACTGAGCTTTCTCAGTGTCTGTGCAAGTTAACATATAATACGAAAGAGATGAATAAATC 0.19423866 7.05e-02 0.99993
13177 CAAGGCTCGCTCAGTGATGACCAAGTGGTTAGCTATCCCAGACCATTCTCGGCAGCTGAC 0.23605232 7.05e-02 0.99993
54638 CTTATATGTTCCCATATCTGATCAGGGTGACTGTCCAGCTGACCACAGTTTATTGGATGG 0.1489202 7.05e-02 0.99993
12442 CCTAGGCACTGGACTCCGATCCTGCGCTTCTCAGATCCTGTATGTATTTTATTCTAGTTT 0.39537078 7.06e-02 0.99993
23797 TTTTGTGATGGAATATGTTAATGGCGGAGAGCTGTTTTTCCATTTGTCGAGAGAGCGAGT -0.16979872 7.06e-02 0.99993
57315 AAGGGAACACAAAGATCCATAGGGAAATTGTCCCATGTGCCTTACATCTTAACTGGGTAG -0.13560443 7.07e-02 0.99993
75219 GTATGTTTACCCAGTATGAGTTGAGTTGATGAGTTGATGTGACAACAGCCTTAAGATAGC -0.2599924 7.07e-02 0.99993
258499 ACGGAGAAGAACATCATCTCCTACCTTGGATGCATGGCTCAGCTCTACTTCTTCATCATT -0.16521532 7.08e-02 0.99993
12775 CAGCCACTGATACCTTTCCTCATGTTCTGCTTTTGATTCATATATCTTTTATGAAGAAAC 1.32190893 7.08e-02 0.99993
100039227 TCTGTGACAATGGGCTAAAACATTCTGACAAGAATCCAAATAAACACTCTCCTGTCACGT -0.34216382 7.08e-02 0.99993
80914 GTGCCAACTAGTACTGGTGATGCCTAATTATGAACCCAACGTGTAACCAGTTATAAATAC -0.14355344 7.09e-02 0.99993
71768 TGATCCCATCAGCGCATACTCTTGACATTGACGTCATGTGACATCCATCCTAGAAGTGTT -0.13044965 7.09e-02 0.99993
56739 GGGCCCCTCCTGATTCGTCCTGGACCCAAATTCCCCTGAGCAAGTTCATTAAACCATATC -0.7505573 7.09e-02 0.99993
15245 GCAGTAGCCTTCATCTGTAGGTTAATAGTCTTTTGTCTCTGTTACTTTCTCTTCATAGTC 0.58766048 7.10e-02 0.99993
113848 CAAGCATATATCTCCTCATCACATATCAGGTGCCATTCTTTTCCTGAGTGTCCTCTATAT -0.17105775 7.10e-02 0.99993
216984 AAGACACTGGGCTTAAGTGTTATTTTACATACAATACTTACCTTACTTCTTACAAGCCAC 0.13739901 7.10e-02 0.99993
233918 AACCAGGATTTTGTATCAAAGGGAATCCACCCGAGTGACGCCATTAAAATCTACTGGCTG -0.13508662 7.11e-02 0.99993
53872 GGGAAATGACAGGCAGTAGTTTCAGTTCTGATGGCAAAACAAATAAAAACATGTTTCTAA 0.11640861 7.11e-02 0.99993
408067 ACACTGTCTACTCTTACAGAACACAAGTTTGTTCATTCTCTAGAGAAACTGTTGAAGTAG -0.17108147 7.13e-02 0.99993
70998 GCACTGAAGTTAGACCAAGGCACAGTTTTGTTTTAGCAGACATTTAAGTTAATTGTAAAG -0.11491894 7.13e-02 0.99993
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.16436181 7.13e-02 0.99993
76866 GATCACCAGAAGCTCTAAGCTAGCGGCTACTCTTGGCTGTTGGACATAAAGGAGCCAGCA -0.2656703 7.13e-02 0.99993
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.24663199 7.14e-02 0.99993
93747 ACTACTTCACAGTTTAGTTTCGACTCACCTGTAGTTGTCTCTAGAGAGCCAATGTGGTTT -0.15480399 7.14e-02 0.99993
66420 GAACAGTTTCTACAGCAGGAGCTGCTCATCAATATCACAGAGCACGAGCTAGTCCCTGAG -0.13616706 7.15e-02 0.99993
94352 TGAAGTGCCAGAATCAGATTTCTCTAACAACATCATGAAGTGCAGGAGCCGCTATGATGG 0.31913354 7.15e-02 0.99993
622434 ACAGGAAATCTGTCTCCTCTTCAATGTCACAAACTTTTTAGAAGTACTAACATGTTGTAG -0.45238345 7.16e-02 0.99993
11637 GCGAGCATCCTGGCAGCCTTCTCCAAAGCCACATGTAAAGACCTGGTCATGTTTATCTAA 0.20410648 7.16e-02 0.99993
20273 ACAGCAAGCCCAAGCCAAACAGTGACCTGGAGGCGGGGAAGAGTTTGCCTTTCATCTACG -0.15973569 7.16e-02 0.99993
13549 TGTTTTCTATTTATTGTACCAAAGACAGTGGTGGTCCGGTAGAGGGGAGATTCCCCCTTA -0.23262734 7.16e-02 0.99993
54153 TCAACTGTTCTGGGGAGGGCTGTGACCCAGCATAGTCTTCTCCATGTCTGCGAGGGACAA 0.46143882 7.16e-02 0.99993
93837 CTACTAGCACATACCTTATCTATAAAGAAGACAATGATAAAAACTGATCCCAGCCTACTA -0.1481861 7.17e-02 0.99993
11990 ACAGATGAAGAACCTCCTGATCTCATTGGGGGAAGTATAAAGACCGTTCCTAAGCCCATT -0.14296649 7.18e-02 0.99993
68087 GTTACGACTGTGTAGCCAAAAGTGTCTTGGGCTTGAACCTTTCCAGAGCATCTGCCGCAT -0.34806293 7.18e-02 0.99993
69876 CAACACCTTAGCAGGAAGTGGTGTTCTGGCCTGCTATGGGCGTTTCTACCCGCTGCTGAT -0.21030324 7.18e-02 0.99993
66885 CTAATCAGATATCCAGCTGGTGAAGCCATTGATCAGTGTTAGGGATTTACAGTCGGGAGA -0.17856176 7.19e-02 0.99993
97820 CATGGGCAGCATCCCCTGGAAGCCAGTGATTCCAGAGCGCAAGTATCAGCATCTTGACAA -0.11956577 7.19e-02 0.99993
69562 CCCATTGGATACTAAGTAAGGAAGAACTGTTATGAAAAGCAGCTTAGCTTCATGCCCTTT -0.20476808 7.19e-02 0.99993
73673 CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC 0.24042767 7.19e-02 0.99993
230991 CCCTGTGAGGCACTGGTCAGTTGCCAACATCTAAATGTCCATCACTCTCAGACCAAAAAA -0.19268683 7.20e-02 0.99993
230674 CCCTGCAGTCCACTGAAATATGCTTATATCTCAGACCAAATTATTTCTAATAGCATCTAG -0.31061599 7.20e-02 0.99993
12593 CGAGTGTTACTTGCTAAGTTATGAATTAGCATTAGTGGGTTTAAATAGTTTTTCTGACCC 0.11783132 7.20e-02 0.99993
21940 AAAGCACACTTACTCTAAGTGAAACCGTCCAGCTGACAAAACTACATGCCAGGGGTGGAA 0.20630309 7.20e-02 0.99993
11852 CAGTAAAGACGAATTCCCCGAGGTGTACGTGCCCACCGTGTTCGAGAACTATGTGGCGGA -0.20813273 7.20e-02 0.99993
105855 TAGTTGGAATGGGAAAATATAATTAGCCAGTTGATTAATTAGGGTCGTGCCCATGCTTCC 0.39016201 7.21e-02 0.99993
69161 TTGAAGCAGGCTTGTCCCTTTCACACCAACCTCCTTTTAACCCAGTTAACATTCAAAGTG -0.23535761 7.21e-02 0.99993
211712 AGGAACCAATTCAATGACCGTAAGCAGTATGGCTCCAATGAAGGCCATTTCAACAATGGC -0.15223488 7.21e-02 0.99993
244334 TTGGCCTTAGGCATAAGATTGGAACTTGTGGATCTCCTTTCAAATGCTGCAAGTGATAAT -0.13432405 7.22e-02 0.99993
11628 AATCCTGTATACACGACCGTTATTTATTGTATGTAAGTTGCTGAGGAAGAGGAGAAAAAA 0.17381422 7.22e-02 0.99993
101612 ATTCTGGCTGTTGATCAACTTCAGGAACTTTAAGGGTTTTGCCATAGCTGGGCCAAGTCT -0.15183473 7.22e-02 0.99993
58194 ATCTTTCCTGCACTTATGGAAATGCTTTGTCTTTCCCAATGAAACTGATGTTTGCTTGTC 0.3565083 7.23e-02 0.99993
320706 TATCCTTGCCCTGTGTCTTATTTTAGACATGAGAACTGTACAGTGTAAACTTACAAAATG -0.19997328 7.23e-02 0.99993
77446 CAAAGTGACACATTTGCTTACAATGTATTAGTTTTACTTTCCCAAGCAAGTATGAATCGG 0.16030856 7.23e-02 0.99993
67871 AAGAACCCCAGAACTTGTTTATAAAGCAACCAAGGGCAGTTTTTGCCTCTGGGTTGTCCT 0.12844589 7.24e-02 0.99993
257889 CAAGGAGGTAAAAGAAGCAGTGATAAGACTGTGGTGGAAGACTTGGATTTCACAAAGATA -0.17882786 7.24e-02 0.99993
234396 GAAACCATGTCCCCCAAAACAAACCAAAAAACAACAACAAAGCCAAGATGGTACTCTGGA 0.18842806 7.24e-02 0.99993
83672 ACAGTCCAAGCTTCAGTGGCACAGAGTCCTCTCCAGCCCAAACCTGTGGACAGACATGAC 0.37113681 7.25e-02 0.99993
245240 CAGTAAAGAAGAGCTTTTCACAGAGCAGGTGAGCTCATTCAACTCTAAGGCCTCTCTATA -0.78454755 7.25e-02 0.99993
68048 AAGTCAGCTTGCTCATAGTACCAGACCATCGGCATAGGAATAAAGTGCATCTGGAAAAGT -0.16369529 7.25e-02 0.99993
229706 TCAACTAGAGTATGCCCACTGTGAAAAGAGAAGTGAGATCACGCAGGCTGTAATACACCT -0.1544898 7.26e-02 0.99993
381310 ATCGTTATGGTGGGCTGGATCATGAGCATCTTCTGGGGCATGGACATGGTCATCCTTGCC -0.29294194 7.26e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.14794584 7.27e-02 0.99993
93726 GATATTTTAGCTCCAGTGCCAGCACTTTGTACCTTCATTCATCGGCTACTGCCAAGATCA 0.71599476 7.28e-02 0.99993
11652 CTGCTGGCCTTTCCTTACTCCTCGTATTTGTACGGTACAAGCAATAAAGACACTCATTTC 0.25568914 7.28e-02 0.99993
192231 TTCCTGCCAGCTAAATGGTAACAGTGGAGTTGACTGGAACATCAAGAACGAATGCAGCTA -0.18326605 7.28e-02 0.99993
503556 GTCAATACCCTTGTGCTTAGCTTTGACTGTTTCATTCTCCAATAAATTTCATGCAGAAAA 0.1965196 7.29e-02 0.99993
13356 ATCTGTGTGTGTGTCCTAATGTGGCCAAATGTTTGCAGGTGATAATGGTTCACAGGAGCT -0.17666163 7.29e-02 0.99993
15970 CTGAACATCTTCACATCAAAGGACTCATCTGCTGCTTGGGATGGATCCCTCCTAGACTCA -0.25147246 7.29e-02 0.99993
70617 TATGTACAGCAGTAAAACACCAGACATTTGATAGCCATGTATGTAACTGATATACACTTG 0.55572629 7.29e-02 0.99993
12515 TTTTGTCAATTGTTCTCCACCAAAGAATAAGAGTGGCCTTTTCTTTAACTTCCTCCGTGT 0.55987545 7.29e-02 0.99993
78552 GCGGGTGCTTCTTCACAACATAATCTGCTTATTGTGAACTTGGTCTTTTTAAAATGTATT 0.17200499 7.29e-02 0.99993
20344 ATGCCTGCTTTAAGATCTCCTGGGTCTTCCATGTTTCATATCAATGAGGTTGTTTACACC 0.30680723 7.29e-02 0.99993
66874 ATACTTTGGAAGAAGGCAAAGAAAGGAGTGTCATTATTTTGAATGGTACCAATTGTATGG 0.14977015 7.30e-02 0.99993
272382 CCATGTGGTCAAGGCTAAACTGTACTAAATAAAATTATTTCTCATCACCACTATACATGC 0.47177436 7.30e-02 0.99993
99169 GCATAGGTGCAATTCTATGTGATTTAAACTTTTTTGGCAATGCATTGCCTTAAGAAAACC 0.15079141 7.30e-02 0.99993
22722 TGTCTTAATGGTTACCAAGGCTGATTCCAATGTGGAGTTGGAATTCACCACAGTAGGACT -0.11651721 7.30e-02 0.99993
26373 AGTTGCAGTGTCTCTGGCACAAGTCTGTTATAAGGTCACACAGGGTCTTTCTTTGGAAAG 0.3103105 7.31e-02 0.99993
258934 CAAGTCAAGCAAGCCTTTATGAACATGACAAGGAAGATAGTGTTTTCCACAAGTAAATGA -0.12181829 7.31e-02 0.99993
14865 GTGAGAAGTTCAAATTGGGCCTGGACTTTCCCAATTTGCCTTACTTGATTGATGGGTCAC -0.21725084 7.31e-02 0.99993
234669 TTTTTGTTTGTTCCAACACTTACATAGCATTTGTCACCTCAGTCTTTGAGCTTTCCTGTG 0.22130295 7.31e-02 0.99993
57252 TCTAACAGCCAGCTAAAGCAAGCCTTTGTAAAGGTACTGCAAGGATTAAAGTTCTTTTAG 0.195317 7.31e-02 0.99993
16189 GTCCAAGTCCACATCACTGAAAGACTTCCTGGAAAGCCTAAAGAGCATCATGCAAATGGA 0.33629348 7.32e-02 0.99993
431706 ACCCTACAAGTGTGAAATATGTGGCAAGGACTTCCATTATCCATCATTACTTTCTTTTTT -0.15955982 7.32e-02 0.99993
56075 CATCTACAGAAAGGGACGCCCTCATTCAGCTTTCAGAAAGTGTGCTCACCAGAGATAAAT -0.14966434 7.33e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.14586369 7.34e-02 0.99993
11630 GGTAAGATATCCTATAAACGCCTGTTGAGTTTGTCTCTTGAATTAAACTTATTCCTGGTT 0.6900221 7.35e-02 0.99993
75667 CTGGGCTCTGTGACTTGACAATACGTACCTTTCAGTACTACCTGACGTTGCTATGGAATT 0.3318827 7.35e-02 0.99993
21682 CCACCGGCCAAAGCTGGCTTCCAAATATTTGTATGAGGTGATGCTGAGATGCTGGCAAGA 0.21466116 7.35e-02 0.99993
213006 TTCATTGAAAAGTACCTCATACTAGCCATATTAAAATCTAGCTGGGCAATCTAACTATGG -0.5947248 7.35e-02 0.99993
79565 TCTTAAAGAGATAAGGCAGACCGATGGAGAGTGACAGAGAGGACGACCCCCAGCCCCTTG -0.27869676 7.35e-02 0.99993
84652 GGTGCCATGAAATCTAGTAAGGAAGGTACAAGGTGTATTCAAGTGGAGATCACACCAACC -0.13381452 7.35e-02 0.99993
56469 AAGAAAGTCGAGGTCATTGACCTAACCATTGACAGCTCGTCAGATGAAGAGGAGGAAGAA -0.15595258 7.36e-02 0.99993
320720 CTCACTTAAAAGGAAAATCTGCTATGAAAAAGCGGCATTTGGAAATCTTGGGCTACCGTG -0.16851814 7.36e-02 0.99993
11595 ACAGGCTGGCTGAAGAGAAGCAGAGCCCTCTCCTAGGGACCTTTCATCTGGGTCAACCAA -0.19589275 7.36e-02 0.99993
109267 GAGTGGCTGACGGCTTTCCCAAAACTAGCCTTTGACTTTTCAGAGATACCAATGAAAACA -0.1521986 7.37e-02 0.99993
76594 ACCCTACTCTGGGTGGGGGGTTCTTACCCGTTACAATTGCATTGCAAATCCCATTTTATA 0.23305072 7.38e-02 0.99993
228598 TGGATTTTGACTCTGACCCCAATAGATGTTTCATGAAATTTGTCCCCCTACCACCACACA -0.20607865 7.38e-02 0.99993
269346 GTGTAGGAGTGGATGTGAGGGGAGATATTTTTTAAGTTATATTGGAAACATGTGTGAATT 0.46327605 7.39e-02 0.99993
211135 CATGAAAGAACTCATACTGAAAGGAATCTCTGACTATAAAGTGTTTAGTGAGATCTGTAG -0.25807007 7.40e-02 0.99993
13405 CAACAGTTGGAGAAATGCTTGAAGTTGTCCCGTAAGATGAGAAAGGAAATGAATGTCTTA -0.28517659 7.41e-02 0.99993
216166 CTGATGGGTAGGGGTCTTTGATTATTTATAGTATGACTATTCAAGCTAGAATTTTGTTGG -0.42234995 7.42e-02 0.99993
22422 TCTGAAGATTTACTGGAGACCCCACGGCTCTGTGAAATAAATATACTGACACAGCCCCAT -0.41052204 7.42e-02 0.99993
100037258 GAAAGTGAAGTTCCAAGTTGTTTGGTCGAAATTCCCTGTCACAAAATTGGTTAGAAGTGG -0.25340036 7.43e-02 0.99993
69641 AGGATATACAAAGGGACGCAGCCCACTTGCCATGACTTCAACCTCCTCACAGCTACAGCA -0.14601367 7.43e-02 0.99993
629300 AGGCATGTTTTGTAAAACCGCTGTTTCTTGGTTGCTTGATACTGCAATGTGACTCCCCTC -0.35924422 7.44e-02 0.99993
20388 ACCCCTTGCTAACATTTCTATGAAATCCAAACTTGAGAAGAATAAAGAATGGGAACATGG 0.16716334 7.44e-02 0.99993
14633 AGGCATTGATTCTTGGACTTTGAGGAACTCTTAACTGAATTTGCTTGTTCAGTATGGCCT -0.21377202 7.45e-02 0.99993
268281 CATTTGCAAGATCACATAGGTTTGATGTTGAATATGTAGATGAAGGAAGTGTTTCAATGG -0.12500378 7.46e-02 0.99993
68789 GAATGTTCTCATCACCGACCTTTGGAGTTTTTCAGCATGTTGGATTTTTAAACATGTTCA 0.4898826 7.47e-02 0.99993
12399 TGTCAAACAGAGGAATCTGTGTTTGTTACAATAATATAACAGATGCCTTGAAGGACCCGC 0.18251089 7.47e-02 0.99993
330474 AGTGAAAAGCCCAGTGATCCGAGGGTGCGGAAGACCCCTACTGACCCCAGATTACAGAAG 0.21951133 7.47e-02 0.99993
269589 AACCCTTCTGTGGACCCCCACCTAAAGCACACCCATGGCCGGAATCAATAAAGTCTGTTT 0.34282915 7.47e-02 0.99993
27371 CGAGTCTCTGGAGGTAGCCTTTGCCACTGTTTCTCTCTCTGTGTAGCTCCCCACACAGCT 0.22793238 7.48e-02 0.99993
100504561 TTATATATAGATGACACTGGCACTTCAGGCAGACACTAGAGTTAAGTGACTGCAGCTGGC 0.13837274 7.48e-02 0.99993
14362 CAAATGCCGATACATACATAGGACCTAAATTTATCTATGTCTGTCATACCCTAAAATGAC -0.2629375 7.49e-02 0.99993
239759 GGAAGAAAACCAAGGTTATTTTCGGCTGTGTTCCAAGGATGTCGCGTCACAAAAATGTCA 0.14489399 7.49e-02 0.99993
56459 ACTTCATCCTGCCTTTGTCTTCGAAGCTATCAGGGAACTGCGGGGTCCCAAATTTGATAA -0.13126935 7.50e-02 0.99993
271221 GTGAAGGACCTTCAGGAGCAACTTTTTCATATCAAGAAGCTATTGAAGACTTGCAGGTTT -0.1407221 7.51e-02 0.99993
21817 AAAGCGTGGAAGCCTGTGTGGGGGTCATCATCCCAAGTTAGCCCACTCCTACCTCTCTGT 0.50507859 7.51e-02 0.99993
236069 TTAACCTGTTCTGTGCCTCATCCTAAGGCAAACTCTGTAGGCTTTGCCTATGTTAGACTC -0.25352539 7.51e-02 0.99993
94094 AAATACCCATTTAACTGTCTTGTACATAATACATGGGCCTATAGTCCTTTGTACTCAATG 0.69824546 7.51e-02 0.99993
258712 ACAAAGAGGTGAAGGAAGCCGTGAAGAGGGTCAGTGAAAAGATCAGAACTTTGTTGAGAG -0.22504291 7.51e-02 0.99993
20607 AGTTGAGAAATTCTTCGCTGCTTCTGACCTGAGCGCCTATCAATAAAGACAGTGACTAAG -0.66743886 7.51e-02 0.99993
231861 TGCTGTTTGTACGCGGTTTTGGTAATGCCAAGCTTCATTAAACATACCGAGTTCATTTTT -0.2029538 7.51e-02 0.99993
105855 TAGTTGGAATGGGAAAATATAATTAGCCAGTTGATTAATTAGGGTCGTGCCCATGCTTCC 0.39896344 7.52e-02 0.99993
19401 TCCTGCTGGGTTTCCACTGAGATCTACTGGAGAAAGAATAAAGTTCTATTTATTCTATAA -0.42739144 7.53e-02 0.99993
77296 GAAGAAGCTGCATTGGCTGCACAGTCCAAGTCTAAATGATGCTTTAGGCTAAACTGTGTC 0.17269456 7.53e-02 0.99993
69656 GCCATTCTTGATTTCAGAAATGCAAAAAATGGTTTTGAGGGGGCCAGAACCTGGAAGTCA -0.18272677 7.53e-02 0.99993
100637 GCGGCATTCACTGTTTGTCATGCTGGACCATGCAGTGTACGTTTTTATTTTGTTTTTCTT -0.20882969 7.54e-02 0.99993
98733 CTGCTGGTAGATGGTGACTAGAGGACTGAAACACACCAAGCAGGTGCCCTTGGACAATTT 0.26464105 7.54e-02 0.99993
20608 TTGTTGGGCTTCCTACCCCCGGTTCTGGCCATCGGATTATGCTACCTGCTTATTGTGGGC -0.16677801 7.54e-02 0.99993
69748 ATTCTGTGCTCATCCCCTAAGGATCTCTGTTGCTAAGAGGAAGAAATGTCTTGGCAACAG -0.1811217 7.55e-02 0.99993
11785 TGCAAAAGTTCCAAGTCTATTACCTGGGAAATGTGCCAGTTGCTAAACCTGTTGGGGTAG -0.20632545 7.55e-02 0.99993
328417 TCAAATAGTAAAATGTACCAATAATGACGTGTAATACGTGTTAAATGTAGCTACAGCCCC 0.33728455 7.56e-02 0.99993
71295 AACAAAGACGCTCAGTGATCTGGAAGCTAGTGATGTAAATAAATGTGTTGCCCTGAGTTC 0.20606796 7.56e-02 0.99993
104112 GCCACCTCAGTCTCTTCTCTGTGTTATCTATCATGTTTGCTTTAAATAAACTAGATAGTA 0.20390946 7.57e-02 0.99993
97184 TCCTCACAGCAGGTAAATGAGTGTTGCATCTGCAAAACATATCAAGCACTCTTTTCTTCT -0.11626739 7.58e-02 0.99993
223455 CCAGTGGCTTTCAGGAAGATGATGTCCTCGTGGGGATTTATTGTGCATAACATTTGCTAG -0.13573232 7.58e-02 0.99993
26562 AGGGAGGAGGCATCTTCCCTGAAGCCCCCAAACTGGACCCCTTCTTCAGACCCCCACAAA -0.23637404 7.58e-02 0.99993
66705 AGCAGCGCCAGGCACATAGCTGCATGCTTAATAAACAAGCCGCTCTTGGCCAGGACTACC 0.82409273 7.58e-02 0.99993
223672 AGCCCACGCCCATCCTCAGGCATGTCATTGTCCCCTAAATAAACCGTTTCTGTTGTTCCT 0.5212521 7.59e-02 0.99993
19074 TGTTAACTTCGGAATCCAGTCCGCTGTCAGGGGAATCAACCAGGGTCAAGTCTGGATTGG -0.2103583 7.59e-02 0.99993
12289 ACACCTGGGGACAGTTAGCTTTGGAATCGTTAGAACTGTCAAGATTTCCTGTCAGCATCA -0.20610327 7.60e-02 0.99993
170459 AGCTGTCTGAAACCTATGTTCATTAATGTAGAGTTCACATAATCTACAGTTTACCTGTGG 0.35463146 7.61e-02 0.99993
227638 CAGACCAAGCTGTTCTCTGGCTTTGGAGAAAGCACAACATGGTAAACAGCCGCCTGGCAG -0.13823013 7.61e-02 0.99993
320802 GTTCGGGACAAGAAGCTCTTGAATGACCTGAATGGAGCTGTGGAGGATGCCAAGACAGCA -0.37981929 7.63e-02 0.99993
22361 CTGTTTGTCAACAGTGGACTCGGGTGTAAGCAAATAAAGTGCCTCTTCTTTAGAAAAACA 0.20229248 7.64e-02 0.99993
20926 TATGGATGAGAACCAGGGGAAGGGCATCCGAGTCCTAGGCATTGCTTTCTCCTCTGCCAG -0.15480192 7.64e-02 0.99993
230935 TAAAAGCAGTTCGATTCTGTAATATTTATTTTTCTTTTTGAGGATGTTTCGTTGCCCCGC -0.12793301 7.65e-02 0.99993
216560 ACATTGGAGATGTTGGTTCTCTCAGAATGGTTCACTTTGGTTTGGTGTAAATCATCCGAA -0.18364649 7.67e-02 0.99993
13237 ATTTAATGTACACACTCTGCTGTCGCTGAACATGGAGACCACAGAGGACAAGACGAACAT 0.1170949 7.67e-02 0.99993
13603 GAAGCGACTGAGCAAGACAAATTATTTTAACTCAATGGGTGCTTTATAACTTGAGAACCT 0.80945616 7.67e-02 0.99993
259036 TGTTGTGACTCCCATGTTGAACCCCATCATCTATAGCCTGAGAAATAATGAGGTGAAGAG -0.16407814 7.68e-02 0.99993
72401 TGCACACATATATGTTACGCACATGCATATTGCATCCTTTCCTGCAGGAGAAGGACTGAG 0.14211133 7.68e-02 0.99993
69754 GGTTCACCTCTGGGATGGAGATTGTGGTATTGATAATGTTTTGTGTTATATTAGTAAAAG 0.21424907 7.68e-02 0.99993
408192 ATATTTACAAAATGAGAGCAAGACCCGCAGGAACATTGAGCTGGACCCTTTGGAGTGGAA -0.16985005 7.68e-02 0.99993
13841 CAGTTAGGCTGCAGTGTAAATATATAAAGACATTGTTCTGAGAGCAGTACGATTTCATGG -0.4946956 7.68e-02 0.99993
105193 AGCACATTGATGGCAGAAGTGATTTTGTTTGGTGTGGTAAATCTCTGACGCCTGAAGCAC -0.18150202 7.69e-02 0.99993
22632 ACTTAGAATTCTTGAGCCTCCCAGAAATTGGAAGCAAATAAAGCAACTTGAGTTTCCTTT 0.17940482 7.69e-02 0.99993
67006 GGTGAATGAGATAAACATTGAAGATCTGTGTCTCACCAAAGCAGCTTATTGTAGGTGCTG 0.12522385 7.69e-02 0.99993
17703 TGAGCCTCACTGAGACTCAGGTCAAGATCTGGTTTCAGAACCGCCGAGCCAAAGCCAAGC -0.19597191 7.69e-02 0.99993
67759 AAACAGAAAAGACGAAGCTGGAGCTGCCAAAAGGACTGATCACCTTTGAAAGCCTTGAGA 0.14093793 7.69e-02 0.99993
17701 ACACTTCCTCCTGGTTGTCGCTTCCTAAACCTTCCTCATCTGACCCCTTCTGGGAAGAAA -0.38326475 7.69e-02 0.99993
22712 GATCCTATATCCAATACTCACATCTTAAAAGACATCAGAAAGTTCATACTGGAGAGAAAC 0.22195504 7.69e-02 0.99993
76022 AGACCAAACAGCTGCCAGTTCTGGTGAGGTGCTGTGAAGAGATCCAGCCACATCAGTGGA -0.3493843 7.70e-02 0.99993
67541 CTCATCACAAGCAGCATGGCTAATAAAATGTGGCATTTGTATGGTAAAATGCTAAAACAA -0.40289025 7.70e-02 0.99993
19231 TGTACCTGCCAATGGGAACGCTCAAAATGAGGAAAATGGGGAGCAGGAGGCTGACAATGA -0.17504919 7.70e-02 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.19649278 7.70e-02 0.99993
629016 GTGTTTTGTAAACATATACCTCTCTTACTTTCGGATTGTCTCAATAAAGAACTGATGGCC 0.1522975 7.71e-02 0.99993
619441 ACGCAAAACTTAGCCTTTCTCCGCATGGAACATTCCTGGGGTTTGTGAAACTATGATTGT 0.30966371 7.71e-02 0.99993
23912 AGAACCCAAGGCCTTGTGAACAGATCGTGGGATACAGCAGCAGTCAGCAACCCACAGCCT -0.19878023 7.72e-02 0.99993
13010 AAAGGCACACACTCCCTGACAAAATTCAGCTGCAAAAATGCCTAAGGGCTGAGTCTAGAA -0.28864448 7.72e-02 0.99993
22169 GAAACTCCATAGTAGAACATGGTATTGAATATTCTATCCTTGGGTTCAGAATCTGGGGTC 0.29041895 7.72e-02 0.99993
675749 TGCATCTTCAATGTTCTACACTCTGGGAAATAAAGATGATGACCCAAAGTTGTCAAAAAA 0.54324287 7.73e-02 0.99993
238692 CCTGTACCTCTGTATCTGTTGTTGTGGTATAAACTGCTCCTGGAATAGGCACCTATGTAT 1.03383903 7.73e-02 0.99993
57748 CTCTTGGTCCCACAATTGGATTCCATTATGTCCTGAGTATATTGACAAAGTGGTTTGAAA -0.15205334 7.73e-02 0.99993
243912 ACATTTCCCATCTCCGCAGGCCTTCCTACCATCAGTCCCCAATAAATGCACTTGAGATTT -0.34740668 7.74e-02 0.99993
19062 TGCCTCTTCTCCCAGGAGAAGACACCTCAGGGAGTCTTGCCCTGTAATGCTCACGTCCAT -0.14378585 7.74e-02 0.99993
258558 GGTTGTTTTGGATATTTTCCTTCATGGACTCACAGATGACATAGAGCTGCAGCCCTTCAT -0.17500642 7.74e-02 0.99993
77951 TTAGGTAAATGAAGGGAAATGCCCAGTTAGAGTATGTGCTGAGACCTTTTATAAACCCAG -0.20386165 7.75e-02 0.99993
21645 GAGTCATCCACACTTTTATTATCCATCAGTGTGATTTGTACAATCTTTGCGCTTGGAATT -0.20742457 7.76e-02 0.99993
66991 GAAGAACAGAGTAGAGCTGTTTTTGTTTCCCCATTGTGTTAAATGTTTGCAGACACAATT -0.34004212 7.76e-02 0.99993
15081 GCTTGGTAGAAAAGGCTAAAGTACAGAAAGCATTTGAACATCCAATACACTCTAAAAATG 0.25459564 7.76e-02 0.99993
13405 TACAAGAGTTCATGCCCTGAACAATGTCAACAAGGCACTGCGGGTCTTACAGAAAAATAA -0.18449962 7.76e-02 0.99993
19401 CCTGTACATATCCTGCGTACCAATCCCCAGATATTAATTCTCGTTGGTTTTGTTTTTATT -0.32922564 7.76e-02 0.99993
75852 CCTCATTCTCCCCTCAGAAAACCAAGTAATGTCTTGAATAAATCTTTGGCTTCAATTTAC 0.25710704 7.76e-02 0.99993
22722 TGTCTTAATGGTTACCAAGGCTGATTCCAATGTGGAGTTGGAATTCACCACAGTAGGACT -0.11937373 7.77e-02 0.99993
94282 TCAGACTTTTTAACCTCAGAAAATGTCTCAATGTATGTGATTTATGTCATACTAACGGGC -0.19530549 7.77e-02 0.99993
207175 CTTGGCCCCCAGATCCAGATGAAATTGTTTTTAAAAACAATCTGAAAATGGTATTTTTCC -0.43425541 7.77e-02 0.99993
56218 TTCTGGTTTCTCTAGTGGTCTGAAGCCAGAATTTCTGGTGCTCAGTTATTGGTGTCCTCA -0.13417464 7.78e-02 0.99993
381286 ATTTTAATCTAGGTTCTTCTAATCTAGCATGTATCTGTGCCCTGTGTCAAGTGAGCTAGA -0.21334904 7.78e-02 0.99993
381654 ACTAACAGGAACCTCTATATGAAGTCTTCATGCCACGTGTCTCTAGGGCCCTATTCCTAT -0.13090704 7.78e-02 0.99993
56349 GGCAGCTACAGATACACAGATTACTGTTAAATTGGAGACTTTAAAAAGGTATTTTCATGG -0.39820308 7.79e-02 0.99993
54638 CTTATATGTTCCCATATCTGATCAGGGTGACTGTCCAGCTGACCACAGTTTATTGGATGG 0.12742027 7.79e-02 0.99993
258342 TGGTTGTGGGACTCAAATGTTCTTCTTCCTCACTCTGGGAGGTACTGATTGCTTTCTCTT -0.16086982 7.79e-02 0.99993
54160 ATGCTTCTATTTAATGTGTGAAAAACTCTTGGCAATGCTGGAAAATTTTATCCCAGAAGG -0.17358771 7.79e-02 0.99993
18577 TTGAAGTGGGGTATGGAGAGCCAGGAACTGAAGTCCCCCAAAAAAGGGATTTTATTTTTT -0.15796608 7.79e-02 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.1514908 7.79e-02 0.99993
12300 CCACAGGCTATGCGGGGGGAAAATATAACCGAGGGAAGACAAACTTTAAACAAAGCAAGA 0.22334468 7.79e-02 0.99993
235302 TGGGACTTGGACCAACATTCAACCTGGGGTGAAGCCTCACAACTGGTAGGCTGAGCTCCT -0.38745414 7.79e-02 0.99993
77475 CTGGGCACGCCATCAGGGAAACCGCTGAGAACAACTGGATCTCATATACTTCAATAGCTT -0.28810556 7.80e-02 0.99993
50771 GTGTTGTCATTTATACTGGAAAAGAGACTCGAAGTGTAATGAACACATCCAATCCAAAAA 0.15291576 7.80e-02 0.99993
72852 TAACTGACCATCCTCAGACAGCATGGGCTAGAAACAATGCTAGTAACTGCACACAGGTTT -0.15255711 7.80e-02 0.99993
666806 CATTTGGCATGAGTGTGTCTTGTCAATGCAAACTGATGACTTTTATGTTTTGAAGTATTC -0.19597359 7.80e-02 0.99993
74762 CAAAATGTAACCTCTAGTTGCGGACGCGGTTGTTCCAATCAATAAAGATGCAGTGTTCTA -0.72891044 7.81e-02 0.99993
53380 TTGTATTTCAAGTACTACAGACCTGGATTTCAAGTATTACAAACAATAAACTGTTGAAAG 0.13978482 7.82e-02 0.99993
235587 TTCAAACAACGCCATTCTTTAAGGCTGACTAGTAGGCCCGTTTGTGTTCACGTCCTCTTT 0.59062081 7.83e-02 0.99993
228151 TTACCCAGATGAGTCACATACCAATGAAAATGAGCAGTGAAGAGAACCACGACTGGCTCA -0.31123425 7.83e-02 0.99993
18126 CACCATGCCGCCGCTCTAATACTTAGCTGCACTATGTACAGATATTTATACTTCATATTT 0.17489058 7.83e-02 0.99993
105855 TAGTTGGAATGGGAAAATATAATTAGCCAGTTGATTAATTAGGGTCGTGCCCATGCTTCC 0.39435728 7.83e-02 0.99993
211712 TCAGAAATGTCCCGGCTCTACCAGTTTCCACATTCGAGAGAATGAAGAAAGTCATTCTGA -0.14826646 7.84e-02 0.99993
100038433 ATTTCTTGGAGGTTCACTATAGCCCCACCAACCCTGAAATAAATGTTGGCATGCTTCTGC -0.34757905 7.84e-02 0.99993
170758 TATGCCTCCTTTTTCTGGGATATAGCTCCAGCCTTCCCTGGTCCCTATGGGAGGCCAGGA -0.20463138 7.84e-02 0.99993
240334 GTGGCACTGTTGGCTTATAACCGCTGGTACCAGGACCTGGATAAGATTGACCAGAAGGAC -0.12578966 7.85e-02 0.99993
215467 CTCGGAGTGCTCTGGAAACCCAGGAGGGAGCTTATGAAATAATTTCCTTACTGTTCCAAT 0.1489155 7.85e-02 0.99993
12032 CTTAAGCCACTACTTCTGTGAAGTATTTTTTGACTGTTTCATGGAAAACAAACCTTGGAA -0.36879039 7.85e-02 0.99993
75782 ACTATCTCCCTAAAATGTCTACCAACTGGCAGAAGAGTCATTGCCCATGGTTTGCAGTGA -0.16690446 7.85e-02 0.99993
387354 GAAGCAGAGGTTTACATCATGGATTCCTAACATAAATTGCAGATCATCTTGCATATTCTA -0.17638773 7.86e-02 0.99993
268527 CCTATGCCATCCTCCCTGCTTTATTAGTTAATTTAAATGAACACTCTTATGTTCCAGTCT 0.24472238 7.86e-02 0.99993
235028 GAAACTATGAAAATTAGATACTTAGCTTAGAGCAGTGCTGTGTTGCCATACTGGGCAACA -0.1101416 7.86e-02 0.99993
211949 GTAATGTGAATGTGACCTACAAGCAAGGAACATTTCTAATAAAAGTTTGTCATTCTGTCC 0.2455122 7.87e-02 0.99993
192173 ACCAACAGCAGTGAGATTTTCACACCGGCACACGAAGAGAATGTGCGCTTCATTTATGAA -0.12857458 7.87e-02 0.99993
27278 GGCTCAATGGATTCAGTTCTTCTTCCATCTGCATTTATCTCAAAGTATTATTTTCTGTGT 0.45864063 7.87e-02 0.99993
217835 AAGGCTCAGTTCTTGTGTTTGAGGACATCTTCAGACTGATTGCGTTCTACTGTGTCAGTA 0.29468527 7.87e-02 0.99993
15289 CCTACAGAACTAAAGGAAAACCTGATGCAGTGAAAATGGGGGTGGTCAAGGCTGAAAAGA -0.22403791 7.88e-02 0.99993
333473 CCGTCTGCCCATCTTCAGCCGCTTCTCAGACTCTGAAAAATGAAGCAAAAAGATGCCAGT -0.25846454 7.88e-02 0.99993
209380 CCAAGACCTTTGATCTGCTTGATTGATGACAAAGAAAAGGTTGACACAAATAATTCTGGT 0.41943279 7.90e-02 0.99993
22163 GGCTTTCCTATGTATGCTATGCATACTACCTGCCTGGTGGTGCTCCTAATAAACATGCTA 0.35963082 7.90e-02 0.99993
66790 AAGCAGATCACCAAAGGGGACTTTGTGACAGAGTGTCACGCATTCATGCAGAAAATCTTT 0.17123096 7.90e-02 0.99993
71898 AGCCGACACCCATCCTCAGGCATGTCATGGTCCCCTAAATAAACCGTTTCTGTTGTTCCT 0.9097869 7.92e-02 0.99993
629554 TTCCATCACTTGAATTGAAATTCTACCTATCTGATAATGACAGCCCATTTTCCTTCCCCA 0.28380285 7.92e-02 0.99993
13813 GCTATGAAGAACGAGTGCCCGGTGCTATTAAATGAATTTCAAAGACAAGAAAACATGACA -0.44642536 7.93e-02 0.99993
20648 CCTCTCTCCCCTCCTTCATCTTGAATAATAAACAGCCTGTGAGCACAATGGCAGCCTGGC -0.10807689 7.93e-02 0.99993
23853 AGACAAGATCATACGCCCCTCCCTCCAGACCAAGTTATGGAGACATACTTCCAAATAAAA 0.15901726 7.93e-02 0.99993
110460 GTCATCAAGGGCTCCAGAGTGAACAGCATTTTCATAACTTCCATGTTTATCGTCTTTACT -0.42463701 7.93e-02 0.99993
216233 TGACAGTGTGGTTCATCTGATTGACTACTATGTCCAGATGTGCAAGGATAAACGGACAGG -0.20932802 7.93e-02 0.99993
16865 AGACCTATAATAAAAAGGTGACTGTGGTCCGGAACTTGGAGACCTATGGTCTAGATCCGT -0.13345113 7.94e-02 0.99993
18854 AGTGTTTGTGACTTATGGGCTTATTTTACAGACAAGATGAGAGTTACCACTCTAAGAAAA 0.29729308 7.94e-02 0.99993
78414 GACAGACTAATTGTCCACCAGAGATCTTGTAAACCCAAAGCCTCCAAGTAAAGCCCTTTC 0.19003977 7.95e-02 0.99993
12700 ACTTTAGAAAACAAGTGTTAGAACACAAGAACCAGTTTGGGAGTTTTTCTTCCACTGATT 0.74875429 7.95e-02 0.99993
13876 TGCTTGTTTTCTTTGAAATCAGATTCGTTCCATTTGATAGAGAGCTGCCAGCTCTGTCAA 0.15343677 7.95e-02 0.99993
20842 CCAGTGGGTTTCCAAGTTCAGTTTAAAGTCAATCAAATTTTTGTATTTTCAGTGTCTCCT -0.12084233 7.95e-02 0.99993
432530 GCACTACGGAATTGCATGCCTTGAAATTCCTTACTGTGTGCACCTTAGTTTGAATTTTGA -0.50301979 7.96e-02 0.99993
58802 TTACGAGTACACGGAAGCCGAAGACAAGAGCATCCGGCTCGGCTTGTTCCTCATCGTCTC -0.1679072 7.96e-02 0.99993
171429 AGCTTGAAGCTGGACACTTCTTTGATGAATCTATCACTAAGCAGCATGTCTTTGCCTCTG -0.18988775 7.96e-02 0.99993
330401 ATCCTGTTCAGTATTGTGAAGTAGCCCTTAATCCTAACTTTTAAGCAAAATCCCTTGGCC -0.14124664 7.97e-02 0.99993
230801 CCTTAAACAAAAGATAAATGGAGGCTCACAAGTGGTCTAATGGGAAAGTCCTCCTTTGAT -0.15133673 7.97e-02 0.99993
258616 TACAGCCTGAGGAATGGAGATGTAAAAGAAGCCTTCAGGAAGTGGGTGAGAAGAGTATAA -0.20620048 7.97e-02 0.99993
14381 CACCAGATGGAAGAGACCTCATGCTGCCTAGCAATATTTTGGGGGCTCTAGATGTCCCCT 0.21806818 7.97e-02 0.99993
68275 CTTCATTATCCACATAGTGGGGTCAGTTACTTGAGACGCAATCCCTGTTTGAAGATAGCA -0.18794886 7.97e-02 0.99993
76889 TGTATTGGAGGGTGGGGGTGGGTGCTGATCCTTTCCTCCGAATAAAGGCACCCTTTCCCT -0.18450323 7.98e-02 0.99993
56771 GTTTTCAGAGTTGCTCAAAGCACTGTGGACACATGTTCCTGACACTCAACACTCAGGTTT -0.17368017 7.98e-02 0.99993
74686 AGGCTTTTTGGATTAATCTAGAAGTGGAATACCAAACTGTCATCATTGCCATCATCACCA 0.36862626 7.99e-02 0.99993
23876 TTAAGAGTTTTTACCCAACTGTGTTGGAAGACAGAGGTATCCAGACTGATTAAATATTTG 0.47113309 8.00e-02 0.99993
60505 TGTTTGTGTTCATGGCTTCTTATTTAAGACCTGATCATATTAAATGCTACCCAGTCAGAA 0.30899658 8.00e-02 0.99993
21462 GATCCAGGGGGATGTATCTTCACTGGTGCCTGATGTATGAATAGACTTGATTTAACCATC 0.1827781 8.00e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.13933624 8.00e-02 0.99993
17194 ACAATAGAGCCATTGAGGAGAAGCTGGCAAATATGGAGGCAGAGATAAGGATCCTGAAAT -0.13707386 8.00e-02 0.99993
66066 AGTTATGGAATGAAGGCATGGCTCCCCCACTTTCAGTATACTCCTTGCTGTCTCCAATAA 0.4159979 8.01e-02 0.99993
385317 GTCCCAAGTGATGATATTTGCATCTTGGAGGCTGGGCATCCATCTTAAAGTCTCAGATCA 0.16471304 8.02e-02 0.99993
269999 TTACAGGGCTCCTCAGATGAGCCACTTCACCCTTGGTGACTTGTGGTGGTCGTTCCACTG -0.43984543 8.02e-02 0.99993
320924 TATGTCAATGGTGACAAGGTACTGGCCTCAAACGCCTACCTTCCAGGACCTCCTGGCCTG -0.51450892 8.03e-02 0.99993
16367 TACCCCCAATTCTGTCTGGTACTTAGAATTGTAGTGTCTTCATCGTTAATTAAAGAAAAC -0.38585462 8.03e-02 0.99993
17174 TCCAGGCAACTGAAATCTACCTCCCGAGAAATTAATTTGTATAATGAAAGCTGTGATTTT -0.18252003 8.03e-02 0.99993
21941 CCTACTCTAGAATCCCCAGCCAATGACAGTGCAAGGAGCTTGCTGCCAATGCGTGTCACC -0.18209268 8.03e-02 0.99993
320332 ACTTAAATATCATTTATTATTACACAAATAACAACAGCAACAAAAGTATTTGTGCATTCA -0.14034755 8.04e-02 0.99993
12480 AGCATTTCAAGGAAAATATGCCGTGAGATTCCGGGGAACATCTTGGCAGAGGGTCCTAGG -0.18425894 8.04e-02 0.99993
19339 CACTCCTCCCTAGAAGTTATGAACACTACACACAGTCAATAAAGCGAATGGACCTTGCTG -0.1696522 8.04e-02 0.99993
68118 GTGTTGCTGGGATCTCGGGGCTCTGGAACCTGCACTAGATCCTTGGTGAGACTTGAAGAG -0.14422671 8.04e-02 0.99993
64103 AAATTCTAAAATTCTGGAGATTTGCGATAATGTGACCATGTACTGGATCAATCCCACTCT 0.22079315 8.05e-02 0.99993
66420 GTTCAGAGTTCTCCATTCTCGAAGGACTCTCCTGAGAATTAAAGGATACTTTGATAAGTT -0.11831717 8.05e-02 0.99993
68725 GGTTTGCTTTAAACTTCTCAAAGCTAATGACCCTGTCATTAAAGAAAATCATCTGAAGTG -0.23194722 8.05e-02 0.99993
258854 AGGAACAAGGAGGTAAAACATGCACTGGTGAAGCTTGTCAGAAGAAAAATATCTTCATAA -0.22896675 8.05e-02 0.99993
117005 TCTTGGGCTTCTCAGATTATCCTGACCTTAAAGTCCCTCTCTTCTTGGTGTTTCTCGTCA -0.15262665 8.06e-02 0.99993
230789 TTTTCTTGATAAAGGAATGATGGTAGCCTAGCTAGTTCTTGTAAAAGTGATGCCTCTTTG -0.15188705 8.06e-02 0.99993
214403 TCCCATTCAGGGGAGGATATTGAATTTGAATGTAAATATGGATATCATAAAGCAAGAGGA 0.42816886 8.06e-02 0.99993
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.69067886 8.06e-02 0.99993
21907 GCTTAGCATAGGATGAGTCAAACTTCTCTTGTACAAAGTGAATTAACTGATTTGTGAAGT -0.16094467 8.06e-02 0.99993
67131 TTATCCTGTGGCCCTTCGTTGTCCAGTGGCTCTTCCGACAGTTTCGGACCCAGAAGAGGT -0.15823483 8.07e-02 0.99993
69863 CATATCCCTGTAACCAGTTTGCCTACAATGGGCAATTGAATTGTTATTTAATAAATGACC 0.16170765 8.07e-02 0.99993
18358 GCACATAAGAGATCCACAACATATGCTGAATGCCTAACTCAGGTATCTTTCTTTATTCTT -0.24289825 8.07e-02 0.99993
666464 TAGAAGTAAAAGTTAACCGTGGAAGAATCTGGTGTGTCCTGTGTTTATTTCCCGCGGGAC -0.2427529 8.07e-02 0.99993
58185 TGTTTGGAGTTTGGAGTCTAATGGTTGCATAGATAAACAGGCGACCAATCACACCCAGCA 0.76183092 8.08e-02 0.99993
20230 CACCGGTATTTCCTAACAACATGAGAAGTCCACCTTGTGTTCACTCAGACAAACCTTCAT -0.2941225 8.08e-02 0.99993
208151 TTGTTAGTTGTTTGTGAATCTCCTGGGGGTACAGTTCTGAGGGAAGAAAGGCTCCAATAC -0.15843565 8.09e-02 0.99993
27204 GCCAAGGCTGAGACAATCCGCAACCTGAGGAAGTCCTTCGCCAGTCTCTTCTCTGACTAG -0.1781863 8.09e-02 0.99993
272322 TCTTCATCCCCAGAAGATGCAAGCCCTTCAGAAGAAGTGAGAGATGACTGCAGTGTAAAT -0.16487507 8.09e-02 0.99993
100043119 CAATAGGAAGAAATGGCAGCATTTGACACATCTGAGAGAGGGCTAATAGCCAAAATATCT 0.15545141 8.11e-02 0.99993
69352 CAGAAGGCTTTGGTATGCGACCCATATAAATAGCTATTCTTATAAAAAATGAGCACTTGA 0.30832338 8.11e-02 0.99993
71361 GTTGCCGTGGCCAACATCGTCAACTCCATGAAGCAGAGGCCACTCAAAGCTTACAAGCCA 0.19027157 8.12e-02 0.99993
14373 ACAGCCCAGAGCTCAGATGGAAAGTGTGCAGGAGCTGATCCCTCTGGCCAAGGAGATGAT -0.23779245 8.12e-02 0.99993
22222 TTTTTTGAGAGATTGTTTAGCTCTGAAATCTGGGCTAGAATAGGCAACATAAGATGCTCA -0.11708023 8.12e-02 0.99993
68875 TCATGTAAGCCACTAAGATAGAAGGCCAGTCTCAGTTTCCCTAGGGAAGAGCCCATCCTG -0.18330349 8.13e-02 0.99993
19663 AACCTTATATTTAAGGGGAGGGACCTTAGTTTGGAGGTAACCATTGCCTCAAGAGGAGCA 0.1314249 8.14e-02 0.99993
226757 ACTTTGATTTGCTTTACTGGGATTTTTAAATTTTATTTTAATTCCACTTTTTCCATGTCA -0.17324789 8.15e-02 0.99993
13142 GGAACTGGAGCGGGTTAAACAGCGTCCGTGACCACAATACCATTTGGAAGAGCTGCTGTA -0.14107851 8.15e-02 0.99993
72902 AAATAAAAACTTTAATGTTGAACTTACATAATATTTAAGCTATAATGCATTTTCTTTTTT -0.92893981 8.15e-02 0.99993
100041879 GCCCCTCTTCTAGCTGCCAGATCTGCTAGAGCTTTTATAAACCTGAGATTTATAACGGTT -0.17558406 8.17e-02 0.99993
19763 GGACAAAGGAGGACAAATGGCTTTTATACAAAGTATCTATATTGAATTAGTCTATATTGG 0.22056965 8.17e-02 0.99993
54139 CCAACTTGGAAAGTCAAAACTGTTTGTCTTAGATTTATTGCCAGGTCTTTAGCAGTGTCT 0.30950278 8.17e-02 0.99993
80749 ATCGTTCTGCTCATGATTCGCTACAAGGTGTACGGAGATGGGGACAGCCGCCGCATCAAG -0.23870727 8.18e-02 0.99993
113858 TCTGATAACAGAATAATAATTATGCTGAAAAACCTGCAATCAAAACATCAACAGAGATTT -0.17218438 8.18e-02 0.99993
330723 GTTTCTGACAGTCACACCTGAAATAATCAATTAAGTATCTTACTTTGAGAAACTGCCTAG -0.50663413 8.18e-02 0.99993
14563 ATCAGTGCCTTGGAGAAGGATGGGCTGTTGGGGGCTGAACTGCGGATCTTACGGAAGAAG -0.25207424 8.18e-02 0.99993
75740 GAAACAATTACAGCTCAATAACATTGACTCATCAATCAAAGACACGCTCTCCTCCAGCAT -0.37606557 8.19e-02 0.99993
14202 TCATCAACATTAATATGACATTTCCAAGTCAAGACTTGAATCCCTTGTAACTGTTGTCTG -0.16952286 8.19e-02 0.99993
192652 CTTCTCACTAGTTGCAGTCTATGTAAATAAGGTCAATAAATTCTTTGGAAGAGCCACGGA -0.21140103 8.19e-02 0.99993
17306 TTCCTATCCCTCATCCTGCTGGGGCAGCAAACGGCAGGATCTCAGTGCTTCTTGTCTGCT -0.16260138 8.20e-02 0.99993
75870 AGCTGTCATGAAATGTCTACTGAGATATTAGCTGTGGCAAAATAAAATAGGCTTTGTGAA 0.1888563 8.20e-02 0.99993
19744 TCTATCTTCCGTGTTAACTGCAGTGGCCATGTCATGCCTAGTAAACAGTATTTTACTGCA -0.1162869 8.21e-02 0.99993
21936 CCACCAAGAGCACCACGTTTAGCACAAGATCTTGTACAAGAATAAATACTTGTCTAGTAA 0.93415065 8.22e-02 0.99993
30841 GTTTCCTAACCTTTCCCTGATGCAGTTTGACCTTTGTTGGATTTATATAAACAATTGTAC -0.19683602 8.23e-02 0.99993
21885 CGGCTTCATATTTACAGTTGGATTGGGCCAAATGTTTGGAATTTGTAGAAATAGAAGTTA -0.17827599 8.24e-02 0.99993
68790 GAAGATGATGGTGACACTTTCTGGGAAGACCTTCCCGGATCTCCAGAGGTACGGAACCGA -0.16793501 8.24e-02 0.99993
13521 CCAGCCTGATACTATTGTATAGAACCCATATTGTAAATATCTAATGTCTTAAGTCTTCCC 0.21582645 8.24e-02 0.99993
13205 GTCTCCTTTGTTGTTGTCAATTGTGGTTTACTTTTAGAGGTGAAAATAAAGTTGTGCTCT -0.12038067 8.24e-02 0.99993
72199 GAAGCCAGAGTTTCAACATACCTGATGGATCTTTTCCCAAAGTGAAAGAAAGAGATGGTG 0.23801391 8.24e-02 0.99993
230484 CTGTACATAGAACATCAACTTAGATGTGTGACCTTTAACTTTTTTAAAAACTGGGAGGTC -0.11798189 8.25e-02 0.99993
20661 CACAAAGCAGAATTCCAAGTCAAATTCTGTCCCTATTATCCTGGCCATCGTGGGACTGAT -0.15145653 8.25e-02 0.99993
74069 CTGGTCTCAGACCTGCATAGGAACACATCCATGGCACTAGTGAATTTCCTCAACTTTCAA 0.18038419 8.25e-02 0.99993
11517 CAAGCTCTGAAAACAACACCGCTGTGTGCTCATTCTTAGAGTGAAGACCCTGAAAGGTAT -0.18229505 8.25e-02 0.99993
434484 CTTGTCTCTTACTCTCCTGAGAACAATCCACAATAAACCATAAGCTTCCAGGACTTCAAA 0.26524407 8.25e-02 0.99993
114606 CCTAACTGCACAGTGGTGGATGGCAATGGGTGTGATGGGTCTGCAGTGCTTCTAGAGGCT 0.50022468 8.26e-02 0.99993
320806 TTTTACTTTTGAGATGTTCCATCCCCCTGGAGCTGGAATTGTGGTGTGATTACGGAGATC 0.12801827 8.26e-02 0.99993
69225 GCAGCACTTGGAACAGAGGATTTACGACCTAACCATGTATTCTCACTAATGTAGAGTTGA 0.13260278 8.27e-02 0.99993
100034361 TACACAGACAGTGAGGATGAAATGGAGCCTCGACTTAAGCCTGTCTTCATTCGAAAGTAA -0.14277253 8.28e-02 0.99993
59012 CACTCAGTGCTACCCTCTGGGTCGATCTGAGTTCCCATGTCCTATAACAGATTCATTTTT 0.25211041 8.28e-02 0.99993
26926 GCAGGAATCGAACAAGCCTCTGTGAATATTTTCATCTGTATAAATGCACATCACAAATTA 0.1274086 8.28e-02 0.99993
56292 CTATGCAGATGGGGAAGATGCGTATGCAATGAAGCGGGACCTCACGCAGATGGCTGATGA -0.11115103 8.28e-02 0.99993
227929 GACTCTCATTATTTTCGCCCATTTCAATTTTTATTTTCTGCCTGAACATTCATGCCAAGG 1.06700892 8.29e-02 0.99993
14699 GTTGTGAAGAAGTGAGAGATTATATTGAAGAAAGGTCTGGAGAAGACCCTCTAGTGAAGG 0.90361237 8.30e-02 0.99993
74663 GTGGTAACTCTGCCTAAATGTGGTCTTAATTTTTAGGTCAGAATATTACATAGAGTGCTT -0.11916286 8.30e-02 0.99993
102060 GTGTCTGGTGAACCCAGCTCCTGAAAGCTCCCTTCCCAATAAAGCCAGCTGCTGACAACC -0.35671251 8.30e-02 0.99993
16176 AGGTTCCTATAATATGGATGAGAATTTTTATGAATGAAGCACCAGCACATTGCTTTGATG 0.70844153 8.31e-02 0.99993
75458 CCACGTCAACCTTATCAGAAAAAGTCTACTAATGACATCGATGACAGAGAATAATTTTGT 0.15324564 8.32e-02 0.99993
435927 TTTCAGTCAAAATGTTCATCTTCTCATTATCATCTATACCTGGGTACATGGTTCTTCTGA 0.15124448 8.33e-02 0.99993
59053 TGCAAGCCCTGGGAAGCCAACTAGGTTTTCATTCCTGAAGGCACTGAGGGGTCTGGACGT -0.16645579 8.33e-02 0.99993
435528 ATAAACCTGCTGAAGAGTGTCCAAGCTGAGTTCTTGCCTTGTCGTTTCCACAGGCTTATT -0.17817902 8.34e-02 0.99993
20887 AAATATGAGTGGATATGGCTATACTGGGAACCAAGGCAAGCTGACACAGCCCATCATGAT 0.28038984 8.34e-02 0.99993
18029 TTGCTCTTCCTCCTTGTTTTCTGGGTGTTTTCCTGCAGAGATCTTTTGGGTTTATTTTGA -0.13178217 8.34e-02 0.99993
22226 CCCAGAGTCACCCTGAATACTCTGAGTGGTTATTTTTTAATAAAACTGCCCAAGAGCTTA 0.15357511 8.34e-02 0.99993
381668 CGTGCAACCCTCCCGAGGTGGAGGCGCGGTAGTCCCGGCGTAGCGAGCTGGCTCACTTAA -0.23963946 8.35e-02 0.99993
13589 CAGAAATGCAAAGACTGAATTGAATTCTAAGCTAATGTGAAATTCTGGCAGAGAACGTTT 0.13710346 8.35e-02 0.99993
232959 CCATACTATCCTGATGCTGGTGGTCACATTTGTTAGCTTTTATCTTCTAAATTTTATCTG -0.34331283 8.35e-02 0.99993
75388 AGTTCAAGCAGCATATCACCAGGTTTATGCTTCAAGTGCCATTGCTATGCCTGCACCTAT 0.13586688 8.35e-02 0.99993
140579 AGGCCATTGTTACTGGAAAAGACTGTCCTCACATGAAAGAGAAGAGTGCCCTGAAACAGA -0.22408061 8.36e-02 0.99993
54201 AACTGCGGCCGGCGCTTCTCGCAGAGCTCGCACCTCCTCACGCACATGAAGACGCACCGC -0.15216458 8.36e-02 0.99993
56279 CACTTGCCAATGTGGGGTACACAGCTACCTACGACTTCAAGATGGCTGACCTGCAGCAGG -0.14397775 8.36e-02 0.99993
216613 GTGGTCATGATTGGCTTTTATCAACTGTGGGGTTCCCATTCAAGATATCTGAGGGTCATC -0.64798605 8.36e-02 0.99993
19348 CTTTGGCAAAAAATACTAAAGTTGTGGGGATGAAGATGCATGGTTGTTGCCCTGAGGTTG 0.38536073 8.36e-02 0.99993
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.12546602 8.37e-02 0.99993
12777 TTGGATCCCTTCTAAAGTCCTGCTGTGCAAAGAAAAACGCTAATTAAAAAGTTGAGTCTG 0.24030656 8.37e-02 0.99993
74486 AAGACACACTGATGGGCGGAGGTGCAGTGCTTCCCGTAATAGGCCTGGTTTTGTAGGAAT -0.19735594 8.37e-02 0.99993
12021 CCATTTAGGGATACTCCAGTCTCTGATCGCAGTAGACCTGCTTCTGAGATAGCCGAATAA 0.16838132 8.37e-02 0.99993
105734 AGGCAGCCTTTTCTGCTAGGTTCTACCTTGGATTCATAAACAGACTGTCTGGAGAAAGCA -0.18342089 8.37e-02 0.99993
69661 ATGTGACTTCTAGAAACTTCCAGTCTTCTTGTCACAGACCCACCTGTGGATCAACCAAGT 0.13740112 8.38e-02 0.99993
268564 GACTTTCCCTCACTTGAGAAATTAGTGGGGATAAGCCATTTTGTTTTGTGATAATGAATT -0.21270724 8.39e-02 0.99993
229644 CAGGTCAGACTTTGGCTCACAGTAGAGACAAATAGTATGTTGAATGAATAAAAATTCAAG -0.16318002 8.39e-02 0.99993
60532 TGCCCTGTGACTCCAGTATATCTCACCTGTACTGACCAAACCTAAATAAACATTTTTATT -0.29386166 8.40e-02 0.99993
70291 TGAGGGCCGTTGAGACAGAACAGTTGGGTTTGTTGCCTTTAGACGGTAGTACAGATTTAT -0.15639937 8.40e-02 0.99993
13866 GGCTATGCCAGGAACGTGCCCTGAGGAACCTCGCTCGATGCTTCAATCCTGAGTGGTTAA -0.13731964 8.40e-02 0.99993
68039 ACACAAAGTCTTTCCTGCTGTATTTCTTGCTTCCCTGGTGAAGTGGTGAATAAAAATACT -0.19922531 8.40e-02 0.99993
210789 CCATCAGGTTCCTGTAACGTCTAGAATTATTTCCAATAAATATGTTGCTGCCATTTCCTG 0.37216083 8.40e-02 0.99993
239081 CAAGGGGGCAAAATGATATATTAAATTCCACTGGGAGGGAAGTCTTTTAAAACACTGAAA 0.24354497 8.40e-02 0.99993
14184 GGCAGATGTGGTTTTGTTAACACAACCAACTTACTTTCCAAAAAATAAAGAGATAACTGG -0.18488647 8.42e-02 0.99993
67014 TAGGCATCCCAGACTCTGATAAAACGATACTTCGGACAAGTTTATTCAATGCAGTGTTGT 0.18846008 8.42e-02 0.99993
21813 GGGAGGAGCTGCTCCCAGGAGAAGATTCCAGAAGATGGCTCGCTGAACACTACCAAATAG 0.21530369 8.43e-02 0.99993
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.15281613 8.43e-02 0.99993
11601 ACCTATCTTGATGGCTTAGTTTTTAATGGCTGGCTACTATTTACTATATGGCAAAAATGC 0.33975817 8.43e-02 0.99993
67125 TTTTTGTTTGTTTGTTTTGTTTTCCCCAAGTCTCCAAGTGCAAAGCCAATTGGAAAAAAC 0.13895895 8.44e-02 0.99993
619937 CGAGCATCCTGGCTTATCCGTTGGTGATGCTGCAAAGAAACGAGGAGAGATGTAGAACAA -0.22594879 8.44e-02 0.99993
320556 ATCTGAAAATCCACCTTAACTGCCTCTATTCTTTTGAACATTTTCTGGGAAGACAGGAAT -0.25377176 8.44e-02 0.99993
77917 AGTTAATGATGTCCCTTCTTAAATCGCCCATTTTTATGTTCTGTTTTTACCTCTGCAAAG 0.14109662 8.45e-02 0.99993
15467 TGTACATTTCCAACCCTTAGTGAGGACAGGTGTGACTCCCAGTTGTACTGAGAAAACCTA 0.17207264 8.45e-02 0.99993
14960 TTTGGCCAATTGGCAAGCTTTGACCCCCAAGGTGGACTGCAAAACATAGCTGTAGTAAAA 2.59086407 8.46e-02 0.99993
68230 GACTACTAAAATCACACAATAAAAATATGCAAACCCACCAAACCAACACACATGGCTTTA 0.1837424 8.46e-02 0.99993
212632 TTAAATATAAAACTCTAAGGTGAGGGTGGGGCCTGGAGGCGTGGTAGCTTTTGGTTTTCT -0.14882453 8.47e-02 0.99993
218442 TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT 0.21369772 8.47e-02 0.99993
224792 ATATCAGTGTATTAGTGATGCTGTCTTTCCTCATAATAAAATACCTAATGATTTGCCCGG 0.32330597 8.47e-02 0.99993
269423 GGGAAATGGGGGTTATACATGTTTTCTCTACTTAAGAGAGTTTTATGTCGAAAATGGAAA 0.17582914 8.47e-02 0.99993
353148 CCCTGGATTAAGAAGAACATGGAAGCATCTTCAGTCTCAAATTCATTTGTACTTACAAAA 0.15931945 8.47e-02 0.99993
16869 AGTGTCGCCAAAGAGAACAGCCTCCACTCGGCCACCACAGGCAGTGACCCTAGTTTATCT -0.34850412 8.48e-02 0.99993
258465 CTTCAACCAGTCCATAGATATTCTGAAAGCAAGGGAAAGTTTGTTGCCCTTTTTTATACT 0.16802574 8.48e-02 0.99993
12487 TGCTGTATCCCCAGTGCCTAGAATAATGCTTAGCCTGCAATAAATATTTATTCATTGACT 0.40015514 8.49e-02 0.99993
140474 CTAACTTGTCATGGGTACTCCAGCCCAAGACCGTGGCTTGCTTCTGCAGTAAGGAGGAGC -0.29338996 8.49e-02 0.99993
29811 TCAGGAGAAGGTTTGCTGGTGGGTCAGCGATCCTTAATGTGATAGAAATATCCAGCATGT -0.14644952 8.49e-02 0.99993
75770 CAGATTTTAATGCTTCTATTACATTCAACCACCACAGGCTGGGATTTCTATACATAGAAC -0.12678215 8.50e-02 0.99993
230971 ATCATGAGGAGAACTGAAATTTTCCTTCTAAACCACAGGTCAACCCCAGGCTGGGTAACT -0.14565476 8.50e-02 0.99993
12167 ATTTATGGAAGCATGTACATTGTGAACTCCCAAATGAAAAGCAGTTAAACAGTGTGTATG -0.61344076 8.51e-02 0.99993
269954 TTGTCAATGAAGAAATCTGGGAGGCACTATATTTCCAGCTCTAGAGTCAGGCTCACTAGC 0.21942162 8.51e-02 0.99993
15562 CGGCATAGTTGATGTGATAGAGAAAAGGAAATTCAGCCACAACTCTAACTCCACGTGGTG -0.23813337 8.52e-02 0.99993
433294 TCTCCAAGATGCTAAAATACTTGAAATTGGTGCTGGAGCAGGCCTTGTTTCCATTGTATC -0.14261955 8.53e-02 0.99993
237500 ATGTAGGAAGAACTTATAAAAACTTAAACAGATCTAGAGAAGCTGAAGCGTCTTACATGC 0.18395582 8.53e-02 0.99993
73178 TGACGTGGAGAAAACATTTTCATGCCTAAAAATGTCTTTGAGATAATGCCAATTCTGATG -0.17333925 8.53e-02 0.99993
14299 CCTCCAAGATTCTTTCCAGTGTGTTTCTGCATTTACATGATCTAAAGATGCATGGGGACG -0.17803228 8.53e-02 0.99993
68303 CAACGGACTTCTATGTCACTGGCCAGACCATTTGAGGACACTACAAGCAATTTTTGCACA 0.26356783 8.54e-02 0.99993
382864 TTCCGGGGCTTCTGGGTGGGCAAACAAGGAATAAAGGTGATTCTTGGCTGTGGCCCACTC 0.29050605 8.55e-02 0.99993
108075 TTCCAGAAGGCTTCACCTGCGATTGTTTCGATGGCTACCGCCTGGACATCACCCGCATGT -0.21732499 8.55e-02 0.99993
64339 TCCAGCTGCTGGTGATCTCACCCCTGGGACATTTTTCCAATAAAGGTTCTGGACAAACTG -0.23471113 8.55e-02 0.99993
66531 CTGGTGGCCGAAGAATATCCTATCTTATTTGCCTCTAGGACTCTTTGTATGAAAAGTGCT 0.17395944 8.56e-02 0.99993
212281 CTTGAGCATCAATATATCTGTCTCTATCCACCATGTTCCCTACAATATGTTTTCTACAAT -0.17114168 8.56e-02 0.99993
56727 CAGTCCCCACCCATCACAATTGAGGTCACGTTTGCTGGGTATCAATAAAGAATGAAAGAG 0.14905416 8.56e-02 0.99993
76843 CCGTAGTCTCATATTTGAATGATTGACCACTAGGAAGTGGAAATGTTTGAAAGGATAATA 0.29252903 8.56e-02 0.99993
268491 TTAAAAAGAGTGTAATCACACCACATAAATTTCCTTTAGATGATGTGCGGGGAAACTGAT 0.13221776 8.58e-02 0.99993
108841 CCAATTCCTGTGTAATTTTAACTGTAGACTCTTAAGCTTGTTGTTTGATTACAGTAACAT -0.2774239 8.58e-02 0.99993
69815 GCACGGGGGCCCTGACCCTAGGGTGGTATAAATAATTGTAATAAAAGAACTTGTATTTTG 0.27690228 8.58e-02 0.99993
100505163 TTTCAAAGTATGAAGTCAACAGAATACGGTCCTCATTCAGGTTCCTCACAGACCCAGGGA 0.56179798 8.58e-02 0.99993
20853 TTTTTAAAAGAAGAGAATATTTCTTAGAACTTTATATTAAAAATAAACAGCTACTAAGAA -0.1608242 8.58e-02 0.99993
19645 ATTTTCAGAGATCCTGCTTCGAGATTTCTTAAAGCTGCAGACACTGCACTATTGGTTTTG -0.21623857 8.58e-02 0.99993
210573 TCCAAGCGCAAAGATTGTACAAATCACACTGATGGATAATAAAAGTGTGGATGACTCACT -0.31715 8.58e-02 0.99993
14732 GCATGCCCTTCAGGGGAAGACTGTGAGTCAAGTTTAATAAATAAAAACCTAATACTAAGC -0.19626076 8.58e-02 0.99993
16974 CAAAGGAAACAGGAAAAGAAAGGCATCACTGACCAGGAGTGTCTGGGTTTTAACGATACC -0.16664571 8.58e-02 0.99993
107823 AGCACAGGATTCTTATCATTTGTAAATCTAAAACCGTCTGTGAACGCATTTCTATGCTTC 0.14485198 8.59e-02 0.99993
20530 AGCTAGGTCATTTTAAGAGTTTGGTGGACTCCAGATATTTGAGCCTTTTCACTTTACACA 0.20488086 8.59e-02 0.99993
74383 AATGCCTCGGCTACCCCTTTCCAACAGCCAAGTGGATATGGGTCTCATGGATACAACACT -0.20693126 8.59e-02 0.99993
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.24554615 8.59e-02 0.99993
252830 GTGTATTTGGAGAAATTAAGTAGGTCTATCTGTAGTAGTTTCATGTCACTGGTTTATGTA 0.15698689 8.59e-02 0.99993
353310 TCTTGTGGGGTGAACAGAGCTCTCCCTTGCTAAGACTATTTTGTTAATAAATGGAATACT -0.19055903 8.60e-02 0.99993
108079 GTCTTTGTATACTTCCAAAGCTTGATCTCTGTGACCTTCACTGTTGAACCTGATTGGACA -0.12518278 8.60e-02 0.99993
76022 TTTGATGACCTCACCCAAGATGAAGAAGATGAACTGTCATCAGCTTCTGAGGAGTCTGTG -0.15582306 8.60e-02 0.99993
68720 CTGCAAAGTTGTGACTTTCCCCTAAAATGACAAAATTGCAATAATAAAGTCTCCCCTTGC -0.16328449 8.61e-02 0.99993
13800 CTTTTAATAGAACTAAAGTGAGGCTTAAGTGGTAGGGAGTGTCTGCTGTTACACCCTGAG -0.18622071 8.62e-02 0.99993
75677 TTTACTGTGCATAAACTAGGCTGCGACTGTGCACACACAGGGCACCTGTAAATAAAACGT -1.07631726 8.63e-02 0.99993
68328 GCTGCTTTTGTTAGAGTATTCTCAGTGTTGCACAAAGAAATACATGAACAAGGTGAGAGT 0.26164515 8.63e-02 0.99993
59010 TGGACAACCCAGAACGAGTCTTTGGAAACATCCAAGTGAAATAATAAAACTCTATTTTCT 0.24124657 8.64e-02 0.99993
17714 CAGGGGCTGACAAGTTACTACCTCTCACAACAACAAAACTTGGGTTTTTAGAGCATTGGG -0.14615573 8.64e-02 0.99993
232910 TAGATGAGATGTTCCTGGCAGGAGAGATCCGAGAGACCAGCCAGACGAAGGTGCTGAAGC -0.18494476 8.64e-02 0.99993
18817 CCCCTTTGAAGGGGTTGCTGTGTGTAAGTTATTTTGTACATGTCTGGGTGTGGGTTTACA 0.25176749 8.65e-02 0.99993
NA CCTGCTCTTCCGATACAACACAGTCCCAGATTGTTTTGGGACAATGGAACATTTATTCCT -0.12705495 8.65e-02 0.99993
320183 CTCACTCCACAGAGATGCTAGGTTGTTTTACTCTTCCTTCATTTTTCTCATACTATAGTA 0.16901623 8.65e-02 0.99993
68755 CTGTACAGTGACTATCTCCACCGAGAACAGTATTTTATTAAAAAGCACAGCAAAGAAGAA 0.21340879 8.66e-02 0.99993
23945 TATGATGAGCTGGCTCATATGTTGAAGGGGCTGGACATGCTGGTATTTGCCCATGACCAT -0.24600997 8.67e-02 0.99993
67865 GACCTTCCCTCTGGATATGTGTATTTTATTAACTGAACAGCAACCTCTGCATGATGCTAA 0.19852021 8.68e-02 0.99993
20358 CCACACCACACACGCAATGGTAAACGACAACCACATTTTGTCCCTGACTATACAGGACGT 0.34362095 8.69e-02 0.99993
93686 TACACATTTTTGACTGATAAATGATTCATGTCCCTGAATTAAAGTGGCTGACCTTTGACT 0.16725939 8.69e-02 0.99993
207798 GGCTTCGGAGTAATACCTTCTGTTCTGTTCTGTTCTGTTCTGCTTTGTTTTGTTCTGTTC -0.3012508 8.69e-02 0.99993
56839 AGAGCAACTTTGGGGAAGCTATGCTCTTCGTCTGACTTAAAGGGAAGAGGCAAAAGAAAG -0.26035511 8.70e-02 0.99993
245536 TCTGCATGATCCATCAAGGGGTGAAGGATGAAATGACATAAGTAGCATGTTTATCATCAT 0.15964093 8.70e-02 0.99993
258976 AATGAGGAGGTCAAAAGGGTTATGAAGAAGCTCCTGGGGTCAAATCATGTCAAACACTAG 0.12895224 8.70e-02 0.99993
626848 GAAAGACACCATATAAATGTAACTAGTATGATAAACCCTTTGAAGGAAGCAGTGTTCTTG -0.18680873 8.71e-02 0.99993
116870 GGCGAATGAACTGGATCGACGCCCCAGATGATGTATTTTACATGGCCACCGAAGAGACCA -0.11255874 8.71e-02 0.99993
240697 CTTTTCTAGTGATGAATAAGCAATTTAAGAATTACCTTTCGGGCCTAGCAAACACAGAAG -0.17751148 8.71e-02 0.99993
100038909 TCTTTCAATGTTCTACACGCTGGGAAATAAAGCTGATGACCCAAAGTTTTCTGTCAAAAG 0.47879957 8.71e-02 0.99993
320302 ATGGAACCTATCCATACCGTGGACCTCAATCAGCTCAGAAGTAGCAGTACTCCTTACAAA -0.19146555 8.71e-02 0.99993
272714 GGTACATTTGGCCAATGGATTGCTTTAAGTGATAAATTGGAACCACACTAAGTAATGTTA -0.18424859 8.72e-02 0.99993
628431 CTTGTTGGTGCTCAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGTTTTTGTTTTT -0.19292411 8.73e-02 0.99993
77740 TCTGCAGGCAGGTCTGTTTTTGCAATGCAGCCACGTTTAAGCTTGCTTTATCACCATTAG -0.14792767 8.73e-02 0.99993
72310 AAGGAATGCAGAATTCTGTCTCTGTCCCTCCCACCTTGCCTTATCCTTCATTGGTTTCTT 0.44907995 8.74e-02 0.99993
20390 ATGGAGGCCTTAAAAGGAAAACTACAGCGTCTAGAGGTTGCCTTCTCCCACTATCAGAAA -0.14498593 8.74e-02 0.99993
258595 GCCTATGACAGGTATGTAGCCATTTGTCAACCTCTGAACTACACAATCTTAATGAGTCAC 0.14418896 8.74e-02 0.99993
12981 TCTGAAAACGCTGACTCAGCTTGGACAGCGGCAAGACAAACGAGAGATATTTTCTACTGA 0.18816609 8.74e-02 0.99993
17215 AAGCTTTCTTTGCGATTAGACTAGTATGTATTGTTGACCTAAATATCCAAGACATTGATA 0.30750688 8.74e-02 0.99993
12876 TTTGAAGAATGGAATTGTATTAGTCAGCCTGTTAATGCCACTTCAGAGTTTGGGGTTTTG -0.21302136 8.75e-02 0.99993
17909 GCTGGCCAACACGTACAAGATCGTAGTTGACGAGCGGGAGCTGCTCTTTGAGACGAGTGA -0.18487242 8.76e-02 0.99993
76108 GATCCAGTTCACAGTTAATTGTTGGACTCTAATACAACTGACCATTGAAAAATGAACAAC -0.15112959 8.76e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.1352555 8.76e-02 0.99993
66039 CTTTTTCTGGTTCTGGACCAAGATAAAGTAAAACTTCCACATAACATCAGTTCCACATGC -0.36002993 8.77e-02 0.99993
229571 CTGGCTTCTACACATCGTATTTTCGGGCCCTCCCTTTCAAACAACTTAAGCGGTCTTTAA 0.13036752 8.77e-02 0.99993
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.66029129 8.77e-02 0.99993
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.3452119 8.78e-02 0.99993
12616 GAATTCAATAAATCTGTCCACTCCCCTTTTGTGGGAGTGAATGTTTTAACAGCCAAAAAA -0.15692579 8.78e-02 0.99993
93694 TCTTCTCCCTCTTGGTCTTTTTAAAGACCAGGTCGCTGAGGAGAAAGAGATGGAGAAATG 0.53433948 8.79e-02 0.99993
231151 AAGAAAAGGATTTTAAATTTCCTCACAGAAAGTGGGTGGATATCCAGGGATGCTTCCTGA -0.1427497 8.79e-02 0.99993
619332 GGGCTGCGGAGAAGTGTTGTAAAGCTTTATTTACAGTCTATGTTCTTTAAGCAAAAATAA -0.12819333 8.80e-02 0.99993
66300 CCACGGGATGATGTACAGCAATGTACTTAAATCTCTCTGGTCTTGTAAAAGGAAGACAAC 0.17670065 8.80e-02 0.99993
75099 GGGAAATGATTCTTTTGGCAGACAGAGAATGTCTATATTTTTTCTATCTTCTGTCTCAAG -0.11708955 8.80e-02 0.99993
73466 TAAGTTCAATTGTGAAGTCATTGGTGAGGAAAACTTGGAGGCTCAGCAGCCTTGCTGCTT -0.14830932 8.80e-02 0.99993
16521 TTAGTAAGATAACAGACCCAATCAGGTTTCTATCGTGGTGACCTAAGTGTGAGGGGACTG 0.1829688 8.80e-02 0.99993
381760 CCCGCACTGTTTGTAGAGACAGTTTTAGGGGTCTAGAATAACAGAACAAGTTGGAAAAAA 0.13401929 8.81e-02 0.99993
18019 CACATTCCTATGCAAAACGATTTTAATCTCCGGTTTCCTGCAGTTTATTTTTGCTATATG 0.44827213 8.81e-02 0.99993
16195 ATCTTCTCACAGTAAGCAGTCTAGTTATGGGACTCTATCCATGTTCAGCTGTGACTTCCC 0.12120069 8.81e-02 0.99993
12516 GGAGGTACCTGCCTTGGAGCCGCCTGGCCAGGAAAAATTAAATAAACACACAAATACATT 0.60463472 8.81e-02 0.99993
69189 TCATGTATGTGCATCTGGCTGTTCTGTATGTGTGTCACTGAAGTGGTGGGTGATAGACAT 0.82371942 8.82e-02 0.99993
232966 ATCTGCTGTAAGGGCTTCAGTCAGAGATCGCATCTCGTCTACCACCAGAGGGTCCACAGT -0.20036438 8.82e-02 0.99993
227682 TTGTTGGTGTCTGCAGTGTGAACACTAACAGGCTGATGATTGTTGGTGTCTGCAGTGTAA -0.14109206 8.83e-02 0.99993
257936 GTTTCTGTTTGTTTATATTGTCACCGTCTTAGGCAACATGGGCATGGTGGCTCTGATTAG -0.18345001 8.84e-02 0.99993
14588 AAGCCTTTGACAGCTTGCAGCCATCAGTTCTGCAGGACCAGACTGCTGGGTGCTGTTTCC -0.13664966 8.84e-02 0.99993
16636 AGCTGCAGGAGCATTGGGACTGTTCTCTGGTATCTATTTTGACAGAACAGAGTTCATCTT 0.18301112 8.84e-02 0.99993
94282 TCTGCAACGTGGTCCTGATGCGATATGGGGAGTTAGAGGAAGGAATTGATGTCCTGGATG -0.17781115 8.85e-02 0.99993
104709 GAGGGGGGTCGGTCTGTCTCAGTAAAGAAGAGAGTGATAGTCTCAATAAAAGCACACTAA 0.14274731 8.86e-02 0.99993
71733 TACAAGAACACAAGCTCATGTTACATCTTTCCTGGTTCCCGTCTGTTTGTGTTTCCCCAC 0.42254063 8.86e-02 0.99993
14827 TTTATTAGCTATCTACAACGAGAAGCTACAAACCCCCCTATAATTCAAGAAGAAAAACCT 0.14283199 8.86e-02 0.99993
14025 CTAGTAAAAAAGATAGCAAAATAATGGGCAGCTGGATTCCTTCCTGCTTATTCATCATAA -0.18950186 8.86e-02 0.99993
114643 TGTCTGTGTGAGGGTGAGATTTGAAGCACTGAATTAAATCACAATGCACTGACTCGAACT 0.33168775 8.87e-02 0.99993
21942 CGCGCACCTCATCCAAGTCTCTTCTAACGCTAACATATTTGTCTTTACCTTTTTTAAATC 0.16780574 8.87e-02 0.99993
16519 TATCTCCATGAGGGACGGAAAACTCACTCTCATGTTCCGGGTGGGCAACCTGCGCAACAG -0.55836169 8.87e-02 0.99993
57444 CCGCAATGTGTAAAACCAAGAACACTCCCCCATTACAGCAACTCTCTTGCTTTGAGGCAA 0.69918318 8.87e-02 0.99993
223838 ATCTTCTTTTTTCCCAGACACTATCTGGAAAGGCAGTTCCATTTGCTACAGCTGGGGACT -0.17966013 8.88e-02 0.99993
546347 GAAAAATACAGCACCTAAACGGCGTTTCGACTTGTGATTGAGAATGCCAGTCTCAGCATG -0.17561589 8.89e-02 0.99993
75202 ACTAAGGACGTTACGTACTTCCGTGATATGCCGGGGGCTCACGGGTACCTGGCACGAATA -0.29389742 8.89e-02 0.99993
239151 CTTTCGTCTAAAGAGATGAAAATAGGCCTGGAGCCAAATAACCAGAATTATTGCTATTTT 0.2098802 8.89e-02 0.99993
105727 GAATCTATGCAGCAGAGGCTCACTTTAGGAATCCTTCCTTTGTATGTAAATATGTTGTAA 0.59760626 8.89e-02 0.99993
58218 TGTAGAAGGAGGCTCATGAGACATCAGTGAAGAATATAAAATTGAGAGAGATTTGGACCT 0.14479174 8.89e-02 0.99993
20822 GCCCTCCTACAGTATAGGTAAACCTAATTAAAGAGATTAAAATTGAATACAGAGGCCAAG -0.12809229 8.90e-02 0.99993
213056 TGAAGAGTTGGTTTAAGAATCAGGAATGGTGGCATACACCTTGAATCCCAGCACTCCAGA -0.13352995 8.90e-02 0.99993
19726 AACTCCAAATACCATTACTATGGGATTCGTGTGAAGCCAGATTCTCCTCTTAACCGTCTA -0.27883111 8.90e-02 0.99993
77996 AGGACCTTTAGCCTCTGGCTCCACTCTTCCCTCACTGGGATCTATGTCTCTGGCTCTTAT -0.45976144 8.90e-02 0.99993
114662 GCTACTGAAGGACATGGCTCAGTTTCCTGGCTTCCTAAATAAAGATATGTTTGTTGCACA -0.11749339 8.91e-02 0.99993
60594 GAGTTCTGGATGGAGCTTCAAGACTTTCTCACGCACTTCAACACAGTGCAGATTTGTTCA 0.18120758 8.92e-02 0.99993
381760 ACCAGGCCTCAGAGATGTGGCATATCAGTATGTGAAAAAGGGGGCTCGTATATTTGTAGA 0.13712172 8.92e-02 0.99993
20362 GTTAATCTGTTTGCGCCTCCATCCATGGACTTGTTTCTGTTCTTTTCCATCCACTTTGTA -0.18248075 8.92e-02 0.99993
328232 AAAGATGTGTGTTATAAAGTAAAACAGAGTCTATATTTTATATATAATGTAGATAGTAAA -0.25558056 8.93e-02 0.99993
15139 GCCGGAAGAAGAGACCCACTGAAACTGTAGCCCCTTATCAAAACATATCCTTGCTTGAAA 0.27221346 8.93e-02 0.99993
14787 TTTTCAACCAAGAACCGATGGCAGTTGGTAGGGCCGGTGCACATGACTCGAGGAGAGGGA -0.16571327 8.93e-02 0.99993
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.29984012 8.94e-02 0.99993
259118 ATGCTTGTGAAGTCTTCTATCATGTCCGTTCTCAATTCTTCAGAAATTGAGATCACCACC -0.19082935 8.94e-02 0.99993
56469 TGGCAGAAGAGAACTCTATGCTCTGTTTTACCTTATCCTGTTTAGAAAAGTATACAAGCG -0.11669476 8.95e-02 0.99993
72194 AAGCCTGGTGGTCCATTTGTCTCATTTTACACCCACTCCCAAACATGCCTTTTACAATGG -0.28976365 8.95e-02 0.99993
228775 GGTTAAGTGTGTATTTTCATCATGTGCCCAATAAAAGAGAGCTGTGTGGTTTGATATGTG 0.62352752 8.95e-02 0.99993
629499 TTTCCTGGTTGAGGAAGCTCTTGTGCTGTCTTCATACTTAGTCTGCAAAGCACATGACAG -0.15707279 8.95e-02 0.99993
70510 GGGGGCTAGAAGCCATAGGGACATGGTTTTCATTTCTTGGATTAATAAAATTGGTTTTTT -0.11692102 8.96e-02 0.99993
328280 TTGTATCAACTCTACTGTGCCCAAGAAAGAAGTCCAGGTGCTAAAGACCTTGCCAACTGT 0.45434728 8.96e-02 0.99993
381418 CTGTGCTGTTGGAGAGAAAATCATTCCATTCATGACATTCAATAAACATCTATGATTGGT 0.22109141 8.96e-02 0.99993
11677 TTACCCCCCTGGAGGACTTTAACACAAGTACCCTTTCCAACCAAAGAGAAGCAAGCTTTA 0.14997721 8.97e-02 0.99993
16176 AGGTTCCTATAATATGGATGAGAATTTTTATGAATGAAGCACCAGCACATTGCTTTGATG 0.74631153 8.97e-02 0.99993
12929 AATGTCCCATAACCCTGGAGTTTGCTTTATGTAATCAGTTAATTTGGCACATGTAAATGT -0.13490707 8.97e-02 0.99993
11541 CTGGGTTTTGCTTCTCTTCCACATTAAAGTTTATTGGGACCTAAAGTGTGAAAATTTTAC -0.23039259 8.98e-02 0.99993
18979 CTCAGACATAAGAAGGTATGAGAGTTTCCTGGCAATAGATCCTAACTAGCAAGGGTTTCT 0.56521965 8.98e-02 0.99993
76743 TTTCCCATCAAGTATTTCAATTCCAAATGTTCTTTAAACTTTAGTGTGTCTATAATTTAT 0.20832819 8.98e-02 0.99993
259151 TTCCAATGCTCAATCCTATGATCTATAGCTTAAGAAATCAGGAGGTAAAGAGTGCTCTCA -0.11807555 8.98e-02 0.99993
77305 TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA -0.14739248 8.98e-02 0.99993
20193 AAGGAACTGGATGAAAACGGAGATGGGGAAGTGGACTTCAAGGAGTATGTTGTGCTGGTG -0.22188893 8.98e-02 0.99993
208151 AGGTAGAATATCCTGTGGAAGACTCCATGAGTGAGCTCTTCGTCTCTGAGATCTTCATCA -0.165019 8.98e-02 0.99993
100040766 AAGTCCCTGGAGAGTTCCTTTGGTCACAGTAACGACAGCATCAATGAACAGATGACAGTT -0.24291668 8.99e-02 0.99993
436022 CCTTTCTTGACATGCTGCTTTTGGGAAGGACAAGGGCATAGCCTTCCTTGAATGTGATTC 0.37151501 8.99e-02 0.99993
434172 TATTCTATCCGAACATATCTTAAGAAAGTTATTTAACATTAAATCAATGGAGAAAATTCT -0.13944935 9.00e-02 0.99993
382034 ACCTTGAATATTTAATATTTTTCACTGGGAGGTTTGAAGCTTACAAATTGAGAACGTGCC -0.20708661 9.00e-02 0.99993
20528 GTTTTGAAGAACGGATAGGGAGCAGAAACCCAAGGGCTGCTGTATTAAATGTGTATATAG -0.40201351 9.00e-02 0.99993
53601 AGGGTGATCTTGTAAGACCTGCGATTGTCAAGCTGGTTCACAGAGCTGTTGGGTTCCAGG 0.26864045 9.00e-02 0.99993
18032 TTACTGTCTGTTTTGTTTTCTGGGTTTTCAGTGTCCTAGCGGAATGCAAGTAGGCAGCCA -0.49254362 9.01e-02 0.99993
171243 ATTTGTCATCTCTTACTCAATATCTTCTATTCGTGTAATCTTTACAACCTACTCTGAGGG -0.14364646 9.01e-02 0.99993
329324 TAACAGGCGGAGCATGAAAAGGAAGGAGATGATAGGCTGGATTTCCTTAGGTCTAAACAG -0.16107552 9.01e-02 0.99993
216859 ATCTCGACATATTCCGAGACTTCTCCCTCATGGCGTCGGACGACCCAGAGAAACTGAGCC 0.54096431 9.01e-02 0.99993
69215 TTCTGCAAACGTGGGAGTTGTCTGTGATCTTTGATTTTTGACAGTGAGGCTCGGAATGGC -0.36746813 9.01e-02 0.99993
14613 CCGACACTGGCACTAAGACTCTCTGTTCTGGCTATGGAGTGTGTGTTTGTTTTCTGAAAT 0.22836808 9.01e-02 0.99993
80509 AACACTTAGCATGGTGTATGCAATTCTGGGTCTTGAATAAATGATAGTTTCCTACCTTTC 0.1320721 9.02e-02 0.99993
66826 ATATCCTGGGATCTGGGTTTTAATGTTTTTAGAGTAATAAAACATTTGTGTTGTGCCACC -0.16746863 9.02e-02 0.99993
232334 TTATGAAGATGGACCTGTTGAACTACCAATACTTGGACAAGATGAACAACAATATCGGCG -0.29675808 9.02e-02 0.99993
29858 AGAATGGCAGAGAAGGGGCATTACTTAAAGGACTCTGTCACAGATATTAAAGTTCCCAAG -0.2172283 9.02e-02 0.99993
16504 AACGCATCGGGGCTGATCCTGACGACATCCTGGGCTCCAACCACACCTACTTCAAGAACA -0.3890181 9.03e-02 0.99993
170768 CACTGCGTGAACAGGACAAGTACTACTATCGCTATCCCACGGGAGAGTCCTACCAGGATC 0.19321267 9.03e-02 0.99993
74984 CAGATCATCGCTCTACAATAGACATTGGCATAAACAAATGCTAAGTCTCATCTTAGATTT 0.16427631 9.03e-02 0.99993
76405 CCATTTGTCATTTGTTCTGGGACTGAAGTCTTTAGCTACTGTCAAGATCCTCCGCAAGAA -0.36078729 9.04e-02 0.99993
15490 GAAAAATTCTATGAGGTCTTACTGGAGCTGGAAAAGCGTGTCAGGACCACCGTTCAGAAA -0.16260868 9.05e-02 0.99993
20423 AATTTATTATTGTGTGAACTGTACTCACAGTGAGGGAAAGATTATTTTGTGAGGCCAAGC 0.26231044 9.07e-02 0.99993
15289 CTGAGTACCGCCCCAAAATCAAAGGCGAGCATCCTGGTTTATCTATTGTTGATGTTGCAA -0.19374963 9.07e-02 0.99993
225743 TATTTCTCATTGAGTTTCTTGTTTTGGTGCCTGACCGAACCAACCAACCAACCAACCAAC -0.29369263 9.07e-02 0.99993
57271 ATGGGAGCTCTAAATCAAACAAGAGTGACTGAATTTATCTTCCTGGGCCTCACTGACAAC -0.17789305 9.07e-02 0.99993
234852 AAGGTACAATCTAACCATGGGCCCCCACAAGGCTTCCTGAAATCAAATGTTAGGTGTTGA -0.15712192 9.07e-02 0.99993
236930 TGGTAATGACTATGAGAGTCTTGTAGCTCGTGGGAAAGAACTGAAAGAGTGCGGGAAGAT 0.2285189 9.07e-02 0.99993
16911 GAACATGATAGACCCACAGCCCTCATCAATGGCCATTTGAATTCACTTCAGAGCAATCCA -0.22017897 9.08e-02 0.99993
170483 AGAGCTGAGGAACTACACGGCCACACTGTCCACGACAGTTTATTCTATATACAAACACGA 0.24022231 9.08e-02 0.99993
21822 CATTAATAACCCCATGTGCTAACCAAACCCAGGCTCTTTGCTGACCATGGTAGTATTGGT 0.82429624 9.08e-02 0.99993
16988 CCTGGGTGCGTGCTCAGTCACACTATGGTCATCTAGTAAAGTCTGGTTCCCCACTTCTGC 0.47256495 9.08e-02 0.99993
319638 GCCTAGGGCCAAATAAATGCTCTTATCTATCTATTATGTGCTTTAAGTAGAGAATTCACT 0.23754857 9.09e-02 0.99993
74268 TGCTTACAGCAGCCAACACCTACCTCTGTGTTTGATGGCATCTGAATATATGTATGAGGC 0.19739956 9.11e-02 0.99993
13495 CTCCTTCAGAAACAGTGTTGGGCTAGGCAAAGCTGGGGACCAGGGCTTTGCTGAGGACAT -0.11839589 9.11e-02 0.99993
27381 TAGCATCCATGAACACATACCGGGGAACAGATGCCATGCACTGGAGATTACTGAATCATT -0.17992095 9.11e-02 0.99993
76131 GAAAAGATTTCCAACCACTGAGAGTGAAGCAGCACTTTTTGATGATAAACCTACAATCAA 0.15345003 9.12e-02 0.99993
11692 ATTTGGGACATAGTTGCCCCAAAGGAAGATGGGCTAGATGATTGCCTTACTACTACACAG -0.33682927 9.12e-02 0.99993
241520 TACATACAACCTTGAAACTTTATAAAGCCCATTTTTATGACTTTCTGCAGGTGAATAGGG -0.19057591 9.13e-02 0.99993
223604 ATGATGATGATGTCGTCGATAATGTTGTTGTTACTGCTCCTATTTCTGCTCCTGCGCCTG 0.15274806 9.13e-02 0.99993
18127 TGTAGACTCCCTTTAACTCTCTCTCTGGAGTATCTTACGTTTAAAGTCTAAGTCATCCCG 0.22362586 9.14e-02 0.99993
14299 CCTCCAAGATTCTTTCCAGTGTGTTTCTGCATTTACATGATCTAAAGATGCATGGGGACG -0.16778397 9.14e-02 0.99993
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.36982474 9.14e-02 0.99993
27360 CGTGTGGAGACACAGTTACCTGTGAACTCTCCTTTTCCATAACTTTTAAAGAATATATAT -0.22244224 9.15e-02 0.99993
234413 GAAAGCCTTTAAATACATTTCTTCCTTACGCAACCACGAGACTACTCACACTGGAGAGAA 0.47827118 9.15e-02 0.99993
73316 TTGAGTATGACTGGAACCTGACATCGCTGAGGAAAACGGAAAAGACATCACTGGACTCTA 0.14761596 9.15e-02 0.99993
76854 AGTCTAGAGACAGACTTTATGTACCAGACCCAAACTGGCTACCTTCCCTTTGCTTGTGAT -0.15880156 9.15e-02 0.99993
214105 CTATCTTTCCCATTTGGTATGCATTGTTATATTGTTGTTGTAACTAAATAAACAGATGAA 0.14948029 9.15e-02 0.99993
231805 TAGCCTTGGGTCAGCTATGTATTCAGCATGGGTGGTCAATAAATTTGAAACCTGAGTCTC 0.27667516 9.15e-02 0.99993
76898 TGACCTGGAGCCCAAGGCAGCAAACTGTACCAAGATCTTGGTCTGGCATACACGAACAGA -0.17337445 9.16e-02 0.99993
70153 GGGTACTCAGAAGATGGAAGCTGGACAGTCATGAGTTCTAGGCCGTCCTGACGACTCGGA 0.35747526 9.16e-02 0.99993
54638 CTTATATGTTCCCATATCTGATCAGGGTGACTGTCCAGCTGACCACAGTTTATTGGATGG 0.14681378 9.17e-02 0.99993
67422 TTCCTGAAGGCCTTGGAACTTAAACGGGCCAACTGGCTGGCACTTTGGGGCACTGCATCT -0.16512314 9.18e-02 0.99993
320038 AAAGCTCCGAGTATCTAAATAGTAGCCCTGTGAAAGGTAAATTTATGAATGGTCTGGAGC 0.34448862 9.18e-02 0.99993
56338 TGGACGACTCTCAAGACAGCCCTATCTTTATGTACGCCCCTGAGTTCCAGTTCATGCCCC 0.26287289 9.19e-02 0.99993
12550 ACATTCTAACGGGAAAAAGGAGACAAGACCTTTGAGAGTTTTCATTCAAAATGCAAATCT 0.29679585 9.19e-02 0.99993
666257 TTTTGAACACTCACCCTTCTACGTAAGGCTCTGTGACCTACTCCATCTTGTCTTCCTGGA -0.15083845 9.19e-02 0.99993
72003 CTGTGATGTTGAAAGCAGTTTAGCACAAAATAGGCTGTCTTAAATACTATCTGTAACTAG -0.24592901 9.19e-02 0.99993
20511 GTAGAATGTTTCAGAGTTTCATGGGTGCCCATACTCTGAAATGCAGGTGACCATAAAGGC -0.32116234 9.19e-02 0.99993
78134 GGGACACATTACAGCCAGAGAGCTACAGTATTTGTGCCCAGGTCAGGAGTAAATTGAAAA -0.31017659 9.19e-02 0.99993
258759 TACTGTGCCAGTCATCAATCAAGTCTTGACATTAGTACTCACTCTCATGGTCCTCACAGC 0.13572768 9.20e-02 0.99993
76308 AAGCCACTTGGGGGAAGATGGAAAAGGATGAAAAAATAAATTTCCACTGGCCCTTGGATA -0.12345056 9.20e-02 0.99993
69136 AACCCACCTTTTAAGTGTGTTTTGTAAATTGCTGACTTGGATAGCCCATGAAGTACTACC -0.21590675 9.20e-02 0.99993
217369 AATAAACCCTGTTCTCTGAAGTGTGTCCTGCCTCAGTGTTGGGGGTGGAAGTTGGGGTGG -0.17570385 9.20e-02 0.99993
319518 CCTTTCATTTCTTTAGAGCAGCTCAAATTTCTAGTGTCTTCTTTGACATTTCTGTAGAAC -0.12474434 9.21e-02 0.99993
30794 CATGGCCAGTGTAAATATATGTCCTCCTGGCCTTTCTAATAAAGTCCTTCTGCTTGCTCT -0.28231636 9.21e-02 0.99993
59009 AAACTGGGCTGAAGGAATGCTGGCAGATAAAATAGGAATATTTCCAATTTCATACGTGGA -0.17727052 9.21e-02 0.99993
623279 AGTGCATACTGGCATCACATTACACGTCAGAACAGTGTTGGGGAAATCTACAGCTTGCAA -0.24535065 9.21e-02 0.99993
93717 AGGCTCCAGCAGGTGGTAATGGCAACAAGAAGAAATCGGGCAAGAAAGAGAAGAAGTAAT -0.2166265 9.21e-02 0.99993
12495 CTAGGCTTTGTGTATGCACATGGATGTGTATGAGAGAGAAAAGTTTCAATTCATCTAAAT 0.27638436 9.21e-02 0.99993
170833 GGCCTCATGTACTACCTGGGAAGAGCCTGATTTTATATTTGAAAAGAATAAAGACTTTAA 0.19941892 9.21e-02 0.99993
13405 CATTCTTGTGGCATGTGTTGCTCTTCAGTCTTTGCCATAAAAAGTAGCAAACAATATTAC 0.38997466 9.21e-02 0.99993
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.49628302 9.21e-02 0.99993
77938 TGTGTTCATTTGCTTTCTGATGTTCTTTTCATCAAGTAAAGCAGGTTTTGTCTAGAAGGT -0.23970904 9.22e-02 0.99993
17472 GTGTATATCAGCTATTATTTAAGCTACCTTGTGATATTGTTTCCACGGTACTGAGAGATA 1.73896141 9.23e-02 0.99993
99526 CATTAACTACCTATTTCTCAGTTGATAGTTGCATGACTGATACCTACAGATTGAAATACC -0.17761892 9.24e-02 0.99993
330149 CCTGATGATGCAGCTGAAGAAATGAAGGCTCTTCTGGGAATATTTAATGGCATTTTCTAA 0.3672491 9.24e-02 0.99993
18754 ACGTTCCTTTTGGACCCCTACATTGCCCTTAACGTGGACGACTCGCGCATCGGCCAAACA -0.21602236 9.24e-02 0.99993
56188 CTGCCTTTCGGACACCCCTTGCTGCTCAGACCTCTAATAAAACTCGGTTTTCCTTCTTGA -0.47180311 9.24e-02 0.99993
108121 CGTGTGTCTGCTAGACAGTGTTGTAGTTGGTTGACAAGCCAGTTCATAATGGGATTTTTT -0.11260573 9.25e-02 0.99993
68632 GTCCTTTTGCTTCAAAGACAGGAGTTCACTGGGGGATTCAGAAAGCTTGCCGTTTATGTT 0.12460163 9.25e-02 0.99993
18127 GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA 0.17940429 9.25e-02 0.99993
218756 AAAGGTTCACGAGTCGGATTCCCCTGGTTCGATCCTTTGCAGATATAGGCAAGAAACATT -0.34676189 9.25e-02 0.99993
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.47973663 9.25e-02 0.99993
258875 GTGGGTACAGCTATTATCTTATGTTGCCTCATTATCTTAATCTCTTATGGTATGATCCTT -0.17164009 9.26e-02 0.99993
56185 GTCACAGCATGTTACAGAAATATTATGATCTATTGCCTAATGTCCATTGTTAACAGAAGC 0.23992303 9.26e-02 0.99993
26557 CCGAAAACAGAGTGAAATCATACCTCAGCTCATGTCCGAGTGTGAATATGTCTCTGAGAA -0.50067118 9.26e-02 0.99993
16617 CACTGATCTGTGATGGTATTCTCCACGGTATCACATCATGGGGTCCTGTCCCATGTGGTA -0.45523702 9.27e-02 0.99993
66541 GCCCAAATGGCCAGAGATTTTCTGATGATTAATAAGTATTTCTTGATTACTGTCTCCTAT 0.24431496 9.28e-02 0.99993
67373 CTGGCCTATCTTTTTCTCAACCACACCTCAAACACCAATTTAAATGATGCATTAACTAAA -0.11150375 9.28e-02 0.99993
69034 CCTGGACTTTTTGACAGGGTTTTAAGTTTACTGCTCTAGTGTTTTTCCTCACTAATTAAT -0.26980208 9.29e-02 0.99993
381308 GTCACCTCTAAATGACAGCTTTAGTAGTATATCCAACCATTGATTAATCTTCATACCTGA 1.23249488 9.29e-02 0.99993
171259 CTCATCCTCTTTTGGATATTTAATTCCCTGATAAGCTCCAACTTGCTTCACTATATCACA -0.44821513 9.29e-02 0.99993
18429 CTGAGCCCACTTTCTGGGAATACCTTTAGCGCGCTTCCTTCGTTCCCCATGGCCACTGCC -0.12780854 9.30e-02 0.99993
232089 GGCAAAGGAAACTCACCCACCAGCAGTTTTAGAATAAAGGAATTGTTGTAATCTCTGGTA -0.15676224 9.30e-02 0.99993
105855 TAGTTGGAATGGGAAAATATAATTAGCCAGTTGATTAATTAGGGTCGTGCCCATGCTTCC 0.37793103 9.30e-02 0.99993
101401 TCAGCATACTCAGAGAACGACAGGAGATCGACCACCTTTTACCTGAAAACTTTGGCCAAT -0.55126051 9.31e-02 0.99993
11694 CTTCAAAGCAGGTAGGACTCCTCCTTATAAAATGGCTCCCCTCATTTAAATTGGGCTGGA 0.14246504 9.31e-02 0.99993
234358 AGCAGTCTCCAAATGCATAAAAGAACACATAATGGAGAGAAACTCGATGTATGCAATTAA -0.40785505 9.31e-02 0.99993
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.44255357 9.31e-02 0.99993
347740 TTTTGGGGGTAATGTCTTTCTAGCTGCTCTGAAGTGCCTGCCATATTTTATAAGTAGTAA -0.12658398 9.32e-02 0.99993
72543 GACTGCTTGGCAAAGGGAGGTCTCAATGTGTGACTGTATCTTAATATAATTTGTTAAATA -0.16050943 9.33e-02 0.99993
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.36671733 9.33e-02 0.99993
239408 GAGTCTGCAAAACTCTATGGTTCTTTCAACTTCAGGATGAAAACTAGTACTAATGAAGAC -0.45628836 9.33e-02 0.99993
99334 ATTTGAAGACTGAGGCAGTCGGATCTCTGAGATCAAGGGCAGTGAAATCTCCATAGTAAG -0.16179914 9.33e-02 0.99993
64934 ATTCAGTTGTGCCGTAGGCTCACTGTGGAGTTCCTGCACTATGTCATCACTGCCCGAGCC -0.11911307 9.33e-02 0.99993
66795 CATGTCTTATACTCTTGTAGTTACCAAGTGCCGGTTCTTTACTTTAGGGCAAGCTTTTTA 0.11790867 9.34e-02 0.99993
216225 GCTGAACATATGATGTAGACACATTGGGTAGGGCTGAGGTTGAGAAACACTGAAGAACTC 0.11947741 9.34e-02 0.99993
380787 ATCTGGAACATACCCCTCTTTGTTCAGTGGCTTGAAGCAGAAATAAAGGCATCCTTCCTG 1.02595238 9.34e-02 0.99993
74558 GGCTCAAGCTCACTCCTGCTATCTCTGTCAGCATATGGAAAATAATGGTTCAAAAAATAG 0.86376453 9.34e-02 0.99993
66494 CCCAAGTACCCTGAACAATATTTAGCAAATAACAGGCACTCAATAAACACATGATTTGAT 0.12756832 9.34e-02 0.99993
211223 ATTTTACTCAGACCAGATTTAACCTTTCTGCAGAAGTACAAAGATAAATTGCCTTCCTGA -0.174181 9.34e-02 0.99993
637916 AAGCCTTCCAGGGCGTCGCGACATCTTCCCCGATCTGTCCAGAAAATCACTCACAGTCAG -0.34322134 9.35e-02 0.99993
22004 GGAGATGCAGCTGAAGGAAGCCAAGCACATCGCTGAGGACTCAGACCGCAAATATGAGGA 0.43330261 9.35e-02 0.99993
381484 GAAGAAACCTGGACTTTTCTATCCGCATCAGTGATGTCACTTTTGCTGATGCTGATACCT 0.21330886 9.35e-02 0.99993
258284 GAGAAATGATGCCATAAAGAGTGTTGTAAGGAAGTTACTGTTGAGTAGAAAATTCACTAG 0.13070041 9.36e-02 0.99993
268930 GAAACTTCCGTGTCTAATAAAAAGTAATGCGTCTTGGGAACACCCAAGGTTGCTCATGTG 0.21103117 9.36e-02 0.99993
240068 CAGCCCCTTGATAGCATTTTCTGATCAGTGATTTTTGTTTCCCAACCACTTAAAATAAAA -0.20488312 9.36e-02 0.99993
77056 AAGGACTGGGCCTTGGTAAGCATGGATTACATGAGGGGGGACCAATAAACACTGATTATC 0.34428254 9.36e-02 0.99993
73673 CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC 0.21056569 9.37e-02 0.99993
16453 TGGCTAGAGCAGAGACATCTCCTGCACGCGCTGGTGGCCGACGTGGACCCAGCGCTAGAC 0.40945746 9.37e-02 0.99993
79362 TTGAAAGCGCTAACAGCCTTAACTGAGCAGCAGCATCAGAAGATAATTGCTTTACAGAAT -0.16071932 9.38e-02 0.99993
16153 GGAAAACCTCGTTTGTACCTCTCTCCGAAATATTTATTACCTCTGATACCTCAGTTCCCA 0.12624043 9.38e-02 0.99993
17295 ACCTGTCCCCTATCCTGACGAGTGGAGACTCTGATATATCCAGCCCATTACTACAAAATA -0.1683484 9.38e-02 0.99993
14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA 0.8026269 9.39e-02 0.99993
665194 GATTAATAATGTGTTTTAAGTTCTTAGTGGAGTGCTGAATAAATGGCTGGACTGTCTTAC 0.13417298 9.39e-02 0.99993
667597 TCCCATTCTGACATCTTTTCGTTATACTAGTCGATCTACTGTATCTATGGAAGAAACCCC 0.78093303 9.39e-02 0.99993
67533 GCAGACTGTTACAGATGCCAAATATTCTTTATCAAGGACAATGTAACAACTGATGATATG 0.15743187 9.39e-02 0.99993
215001 AAGATTGTGGAACTGCTCGAGAAGAAGGCTTGTGAACTGCTCAACCGCTTCCAAGACTAG 0.21164336 9.40e-02 0.99993
230775 GAAACGGCACTCGGAACTCTACCACGAACTCAACCAGAAGTTCCACACTTTCGACCGCTA -0.21207337 9.40e-02 0.99993
271127 CATCTCTACCTCCTATATTTCTGTGCGCAATTCTCTCAAGAGATATTACCTGAATGGACA -0.14956194 9.40e-02 0.99993
107242 CCATCATAGTCCAGGTGGCAGGGCCCTTCCAGGACTAAGCATGCTATTGGGACCTGTACA -0.17419927 9.40e-02 0.99993
57765 GAGGGGGGAGGCTATTTATTGTAGAGAGTGGTGTCTGGATGTATTTCTTCTGTTTTGCAT 0.67986479 9.41e-02 0.99993
67426 TTAGGTGATACCAACATAAAATATTGGTGAGAAATCCTTTGTTACATTTTTGACCACCCC -0.13404125 9.41e-02 0.99993
320871 TGAAACAAGAAAGTATAGAAAGAAGTAATGTAGCCAGGCAACCAGCACTCAGAAGGCAGA -0.20001155 9.41e-02 0.99993
11298 AGAGGGGGTTTGTCTCCGCATTTCCTCCTCTGCCTGCTCTGTTTACTGTGCTCCAGTGCA -0.24541337 9.42e-02 0.99993
237781 GAACCTCTTGGGTAACTTCCGGGAAGAGGAGATTGATGACATTGGCTACGTGCTGTACAG -0.16782495 9.42e-02 0.99993
320878 AATTTCACACAAAGAACATTAAAGAGAAGGCAGCTCACCTGGCCTCCATGTTTGGACACG -0.27283112 9.43e-02 0.99993
11784 CACCCCAACCAGGACCTCTGGCTCCCTCAAAGGAAGGGTGTGTCCTTGTCACCTAGTTTT -0.2892014 9.43e-02 0.99993
66732 GATCGTGTAACCTTATTGTCAGAAGCCTCAGAAGTTGATGTGCTCGATATTTGGTCCTGG -0.15622746 9.44e-02 0.99993
19374 AAGATGACGAGTCTGTAACCGGCTACTGGATAACATGTTGCCCTACTTGTGATGTTGACA -0.20985758 9.44e-02 0.99993
50927 CTCCTGAGGGAAAGTGGTTTTGTACATAATGTATTTTTTCACTTTTGGGGATTCTTTTTG -0.11738585 9.45e-02 0.99993
73122 CCAGGGGCAATTTCACAAATCCCATTTTTAAGATGAATATATAACATAGTTTGTCACAGC -0.10554265 9.45e-02 0.99993
69721 TGATGGCTTTGTTCTTGTGTATAGTGTGAATAACCTTGAGTCCTTCCAAAGAGTGGAGCT -0.16395203 9.45e-02 0.99993
665211 CATGATGTTTGTGTAGGAATAGAAACCATGAATAAGACAAGGGGTATAAGGTATGGATTG -0.14819998 9.45e-02 0.99993
171236 ATGCACAAATGCATTGGTTATTCTGTGTACCTGAACTGGGTAATTCATTTCATTATAAGC -0.44487991 9.46e-02 0.99993
69665 TCAAAGCTTGGACTAGGCAATCTTTATCAGAAATAAATGCCCCGAATACCTTTGTGCTTC -0.1983534 9.47e-02 0.99993
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.6854877 9.47e-02 0.99993
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.38026354 9.47e-02 0.99993
381933 TGGTTCTCCCAACCCCCCAATATCGTGTCATCATCATTGATTTACTGCATTTGTGAGCTC -0.15160012 9.47e-02 0.99993
16164 TAAGTGGTCCTGTCAATTCTGTGTTTTATTGAGAGGGAGACAAATGGAGCTCCAACTATT 0.17574376 9.47e-02 0.99993
258454 ACACCTAAAGTGATTGCTGATTCACTCCATAAAAGGAAGTCTATTAAATTCAATGGATGC 0.16338712 9.48e-02 0.99993
12616 TTGATGATAGTGATGAAGAGGAGGAAGAAAGTTCCTCTGAGGGTTTAGAGGCTGAAGACT -0.17977025 9.48e-02 0.99993
67315 GGCAGTGGAAGCAACAAATTGACAGTTTTGACTTTGTAATAAAGCCTTAATTGAATTCTG 0.33138898 9.48e-02 0.99993
66492 GATGCCCTGAGACCTAATGTTCTTGGTTTCCTCAGTGCATGTAACAGGATATTAAATGGG -0.15789413 9.49e-02 0.99993
216705 CAGCAGCCATCGCTTAATACAATGATTCAACAACAGAATATGCAACAGCCTCTGAATGTG 0.13381339 9.49e-02 0.99993
212528 TGCTGCTGGGGGTATTCCTGGGCCAGGTGTAGACTGAGACAATAAAGAGATGTAACCTGC -0.17165289 9.50e-02 0.99993
217365 TGGATGAGTATTTTTCTGACCCCAGCCCTGCAGTGGAACCTAATAAAAGCACCTGAAGCG -0.11698343 9.50e-02 0.99993
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.54540802 9.51e-02 0.99993
13527 CCAGTGGAGTGATGGTATATGGAAGATATGACCAATTCCTTCGGGAAGTTCTCAAACTAC -0.14072695 9.51e-02 0.99993
242915 TTTAATGAAACCTCAAGGAATATGGAAATAAAGGCTAGACCCTGGAGTGGTGAAAGAGTA -0.17368985 9.51e-02 0.99993
667574 TCAGGAGACCCAGTGGTTCAAGGAGTGAACAGCTTCGAGGCTGAGTTCAGCAAGAGTAAC 0.16535024 9.52e-02 0.99993
12235 AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA 0.19522203 9.52e-02 0.99993
16624 ATCTCCAGTGTGTGTTCCTCAAGCTCCTGCCTATTAAGAACTGTATAGAAAACCACAATG -0.37140471 9.52e-02 0.99993
16331 CTTGTCTTGCTTTTTGATATATCAGGATTAATGTAGGAAACCAGACCTAGATTATTCAGG 0.39047831 9.53e-02 0.99993
26361 GACTTCTTGCAGTGATGGCGCATGACCTGTGAATTATAAGATGAAATAAATACTTTCCTC -0.58135267 9.53e-02 0.99993
20541 TATGAGAAAAACAAGACCTTCTTCATTGAGATTGGAGAGCCCCGTCTGGTGGAGATGAGT -0.29230269 9.53e-02 0.99993
67737 AGTTACTATGAACTGGGAATGCTACACTATCTAAAAGGAGACTATGCCAATGCAATGAAA 0.14233543 9.53e-02 0.99993
100044339 GCGAGATATGTACATTGTTTGAGGCCCAGAGGCTTGACCTATGGCATCCTCCAGAAGTCA -0.14465679 9.53e-02 0.99993
193813 CTGCCACAGGTTGTACTTGCTCTGTGAGATGTTGTAGACATTCCGTAAGAGAATCCAGAA 0.15349969 9.54e-02 0.99993
70103 TCTGAAGTGGACCGTGTAAACCTGGCATCAGGGAGAGAAAGTACCCCCACCCTTCCCAAC 0.16996801 9.54e-02 0.99993
59009 CCATTGTCTTAAAGAGATACGTAATGTGGCTAGAAGTGGAATCATTCCTGTTAATTGATT -0.33957845 9.55e-02 0.99993
330788 GGATGAGCAGGAGGGATATGGAAACAAGCCATACGATTCTAGTTCTCTCACAAGTATTCA -0.14580725 9.55e-02 0.99993
57429 AGCTGAATGAGAAGTTCAACGCTGTCTACCAGTCCAAGATGGGTGACTCTGGCCTTTGCC -0.39579507 9.55e-02 0.99993
193736 GCTGAGGGAATGTGGGATCCCAAAGAAAGATTTCTTTTTTGAAGAGGTGCATAAACGATG -0.14830242 9.56e-02 0.99993
279028 TGTTCGTTGTGTGCAGCTAGACCGTGGCCACCCGATATCTGTACCTCACTCCAAGTGCTC -0.15497462 9.56e-02 0.99993
404286 TTGATCTTCAGAAAATCTAAGGATCCTTGTTCTGTGTTCTTCCGATTGTTGAAATCCTGA 0.13020101 9.56e-02 0.99993
16835 CTGCTTTGAAACCCTTGTTCAGATGTTTTTATAGGCTGAAAATATCATACTGTGATGGAT 0.3431281 9.57e-02 0.99993
100312484 TATGCAGTTCTTAGCCCATTTATGCTGATTCAGAGGGATGGACTTCTGGCTGAATGTTGC -0.12697846 9.57e-02 0.99993
633057 AATGATAGGCGTTCATTTACAGTATTTCGCTATCTGGGAGTGTGTATCATAGAACACAGT -0.10817321 9.57e-02 0.99993
320844 TTGCAACTCCTGTGGAGTCTGGTGGGCATACACACCTACAGGACCCTCCTACAGAGTAGC 0.17022575 9.58e-02 0.99993
621495 ATTGTAAAAAATTAAGTTATGGCTAACTTTTTACTCTTTTACAATATGCATTCACTAACT 0.20738064 9.58e-02 0.99993
83996 AGTAAATGTGGCTCTGAATGAAGGAACCCACGTACACGAGAGGAAATGCATTGCTGCTTT -0.20607054 9.58e-02 0.99993
217166 GGCACCTTTGAGGTGCTGATGGTGCGCTTTGCATCGTTGTTCAACGTGAAGGACCAGACA -0.21389814 9.58e-02 0.99993
56045 CCTTGTGAGTACCTGTGTCGTTTACGAGACTGCATTAAAAATGGAGATTTTAACAGCTTA 0.57324983 9.58e-02 0.99993
229499 TACTTTTGATAACTGACGGACATTAAAGTTGCTTCAGATTTTCATAGGATTAACGCAGTG -0.15439539 9.58e-02 0.99993
77305 TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA -0.13193894 9.58e-02 0.99993
14260 CAACTCAACAGAAGAAAAAACCCCTGTCAGAGGCCTACGAAAAGAAGAACAAAGTCAAAA -0.28561564 9.58e-02 0.99993
108888 AGCGCCTGGTGAGAATGTATTTTGACAAGTATGTCCTTAAGCCGGCCACAGAAGGAAAGC -0.1360337 9.59e-02 0.99993
434689 AATTGGACAAAATGGGGTAGGGGGAAAGTTGTTCATTGCTGTTTGTGTGTTCTCCTCCCA -0.1252838 9.59e-02 0.99993
320563 CGGAGCCCATGTCCTTTTCTAAATGCTTCTGTATGTAAACTGTCAATAAAATAATCGATT -0.35789447 9.59e-02 0.99993
18315 TGTGGCGGCTCCTCAGAAAAACAGTCTAATTTCAGTACCGGTGCCATTTATTCTGTTTCC -0.2953454 9.59e-02 0.99993
103149 GAGAACTTTCTTCTGGGGACTTGGAAATGTTTGGGGATTCAAAAGATGATTCAACATCAT 0.94075859 9.60e-02 0.99993
13723 ATACAGGAGGACTAGTGCACTATCTTTATGTTGCTGCGAATGCCTTAGACTTAACTTCAA 0.26335731 9.60e-02 0.99993
75731 CGTTATGGAAGCCCTCAAGTGAAGAACTCGTTCATAGCAGAGTACACTCTGCTCCCAAGC 0.27197451 9.61e-02 0.99993
74551 AGGCTGCTCTGTGTTTGAGTTAGTATTTTTGTCCCACATAGACATGATGCAGAAGTCCCC -0.16170667 9.61e-02 0.99993
631323 AAGAGTTTGGTTCTCAGCGCCCATGCCAGACAACTCACAATTTCTTATAACTCCAGCTCT 1.22892529 9.61e-02 0.99993
66313 TGCCCTATGTAACGGTCTTCAATAGCACAGACATCAAAAACATGGTTTAGATTTCGATTT 0.18633679 9.62e-02 0.99993
93717 GTACTGACTTCTCTATAAAAAGCTTCTCTTCGCATAGTCACGTAGCTCCTGCCCATCCCC -0.13808617 9.62e-02 0.99993
108075 GCTTTTACACACGTGCCCCTATTCCCAAAATAATGACTCTGAGACTTATTTATTTATGAA -0.16303832 9.62e-02 0.99993
22026 TTCTTGTCCGCCTACCAGCACTCAGGCTCATGAGCTCCAACATAACAGAAGAACTTTTTT -0.1482488 9.62e-02 0.99993
232906 TGTTCCCTGTGTACATTTTAAGCAAAGGAAAAGTCTTGGGATTGTATGGGAATAAAACTT -0.17907372 9.63e-02 0.99993
236790 AGTGCTCTTCCACTTTGACTAGGACCATTACAAAGTGTATCTGAGGCTGCACTAACCTCT 0.15809019 9.63e-02 0.99993
83815 TCTTCTGAAGGACTTGGATGTTCTTCATGATTCAGCCCCAGTGAAGAATGTGTCAGCATT 0.14768661 9.63e-02 0.99993
664968 AATGTGGGCAGACTGAATCTGAGTGTAGACCACACACTTTCAAGAAAAGGTTTGGCAGTG -0.15003154 9.64e-02 0.99993
69423 AGAACTATTTGGTCACTACCACCGTTTGTTGAAAGAGCTGTCAACAGGTAGTGGGAAGGA 0.12998375 9.64e-02 0.99993
69642 AGATGAACCAGCCAGGACTGAAAGCAACTCCAAGGCCAGCGTGTTAGACCTACCAGTGGA -0.18233616 9.64e-02 0.99993
24099 CGTTGAATCTGATCCAAACCAGGAAATATAACAGACAGCCACAACCGAAGTGTGCCATGT 0.53778985 9.64e-02 0.99993
18646 ACTGCCTCAGCCCTGCAATGCCCGAAAGCTTGGCAACTACTGCCACGAAGCGTAAACATG 0.13824924 9.65e-02 0.99993
100038561 AGTGCTATGGGTCCTTTGGGTAAGTGGAATTCCTTCCTACATAAAATCCTGCTGTGCTGT -0.1550073 9.65e-02 0.99993
50935 AGTGACAGCCCTAGATCTGGTTTTGTAATGATTTATACAGAAATAAACACGCCTAAGCCC -0.13875992 9.65e-02 0.99993
52064 TAAAACCAGCACGATTGCAATTCTCAAGTTTGTTCATAGTTTCTTCCATGACAGATGTTT -0.13168996 9.66e-02 0.99993
76905 CAATGTGGTCCCATGTCAGTGTGCAGATTCCTCATTCCCTCAGCCAGGAATGCTATTCTC 0.60279742 9.66e-02 0.99993
243510 AGTGACATCCTTTCCAAGGAAGGAGCCAGGATGTGGGGTGGTGCTGACCTAGATCTCGCA -0.20793695 9.66e-02 0.99993
64082 GACTCCATCCTTTATGGGTTGCAGGACATTGCCAGGTTTACACGGCCTCTGAGCCTGGAC 0.15342892 9.67e-02 0.99993
242748 TAACTGTTGGCACCACCGGGTCCCAGAGGCACCAACTCCCGTGAATAGAAGCTTGACCTT -0.29556096 9.68e-02 0.99993
20871 AGGAAGCTCTCCAGGCTCTGTTTGTTAGTGCATGTGGATTGCTTGTTTTCTCTTTTATGA 0.19102907 9.68e-02 0.99993
20449 CAGTTTCTCTACCTCCCTTCCTTGGAGAATATTTGGAAACGTACCCTGTGAATAAAATGG -0.2401212 9.68e-02 0.99993
233280 ACTTGGATTCATTATGAAAAACACCTGCTTTCTGTTTCAGGCAGTATTGTGTCCATTCAG 0.11073992 9.68e-02 0.99993
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.32251555 9.69e-02 0.99993
545475 AATCTTCCTTTGGACTTCGTCCCCAGAATTCTGAGAAATTAAACTTCTGTTGTTCAACTC 0.26045053 9.69e-02 0.99993
22420 TTCCTCAGAATTACTGGGATGGATGGGTGAGTTTAGTATCAATAAAGACATTTAAATCCA 0.38074057 9.69e-02 0.99993
230935 TAAAAGCAGTTCGATTCTGTAATATTTATTTTTCTTTTTGAGGATGTTTCGTTGCCCCGC -0.14344243 9.69e-02 0.99993
75210 GGTCAGGAGGTGTGCACACAAGAGGAGAGAGAGCTGTTGGAGAACTAAGAATGATTTTTT -0.11515322 9.69e-02 0.99993
74288 CATCCTTTCTGGGTCCAGCAAATGTCCCTGAAATACCCCGGCGCCATTCATCAGGCCGAA 0.19239877 9.69e-02 0.99993
17433 GCCCAGATCTTACTCCGTATCTAAGGTTGACTTCAAACTTATAAAAATCTTACTGCTTTA 0.58834122 9.70e-02 0.99993
66988 TTGAGTTCTTACTTCGATTCAGTAAAGACAGTTCTTAGTTCACTCACAGATTACTCCATC 0.29613442 9.70e-02 0.99993
13074 CGGTGGCCCCCTTGCTCATCCCACACAAGGCTAACATTGACTCCAGCATTGGAGAGTTTG -0.21524054 9.71e-02 0.99993
320495 ATGAATCCCACGTCTTCTGATTGTGTGGAAAATTCTCTTTGAGCAGATGCCCAGATCCCA -0.282494 9.71e-02 0.99993
258568 CAGTGAGCTACTTCTTGTTTATGTAGTGAGCTTCAGTATATTTTTTGCTCTCTTGGTTAT -0.16020549 9.71e-02 0.99993
279706 CTTGGCTGAATAACACTGGCTTGATCAATGTGGCTTCTATGCCTTCTACCATGACTGTGA 0.13264711 9.71e-02 0.99993
69681 CAGCAAGTTTTATTCAACAGCTGTGGACATCTGAAGCATTGGCTGCATCTTTGCAGAGAT 0.14929244 9.72e-02 0.99993
74159 AATGCCAAAGCTGTTAATGGTAAAGCAGAGAGCAGTGATAGTGGGGCTGAGTCTGAAGAA -0.12020461 9.72e-02 0.99993
74154 TTACAGAAGTCATGGAGTTATTTTTTATCAGTATGGAATTAATTAAAACTTTGAATCTTT -0.18012119 9.72e-02 0.99993
436059 ACTCTTCCTGAAAAGATACAGGAACTAAAAGATATTGAGGACAGACATAAAGAGTTGTAG 0.44014282 9.73e-02 0.99993
209824 CCCTTACTGTTGATCTTCAGAGATCCTAAGGATCCTTGTTCTGTGCTCTTCAGCTGTTGA -0.18885848 9.73e-02 0.99993
75528 CCGTAGACAAGAAGCTGAGGTAGCCAGTTCGTGGCTTAACCAAAACATTGTTCCTTCTTA -0.13429551 9.74e-02 0.99993
56045 TGAACTGAAGGCCGAAGATTTCATAGTTGATGTTATCAATGTGGATTATGGGATGGAAGA 0.71652803 9.74e-02 0.99993
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.35499348 9.74e-02 0.99993
11652 CCTTTCCTTACTCCTCGTATTTGTACGGTACAAGCAATAAAGACACTCATTTCAGACCAG 0.23547493 9.75e-02 0.99993
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.60555529 9.75e-02 0.99993
93882 TTGGCAAATCTATTGCAATAAGGATCTTCTAGGAAAGTGAATCATTTTCTGAGTACTGAC -0.16881119 9.76e-02 0.99993
74318 AGTGCAGTGTTGAATGTCTCATTGTTTTGCTGTCCTGCTATTTAACACAATGTGTTTTTT -0.62077418 9.76e-02 0.99993
269966 CATGAACTGGAAAATCATCAGGTTGCCGATTCTATGGAATATGGATTCCTGCCCAATCCA 0.15989021 9.76e-02 0.99993
270118 TTGGGATTGTTTTTCCCTGCCTGAACTTCAGGATATGTAATCCAGTTTATCCAAACACAA -0.36241576 9.77e-02 0.99993
72083 ACTTGCAGAGACTCTGTCCAACACAGATCCCTTTTCAGGCTATACGAATGGCGGCGGCGG -0.18206638 9.77e-02 0.99993
13052 CACAGAACCTTGCTCTTAGTTTTGTGACCTTGTGTACTTTTGAAATAAAATGAAGAAAGC 0.20455722 9.78e-02 0.99993
52728 CTGGGTTGTATTCACAGCACTCATAGATAGCCTGGAGCATGAGCCCACCAGTCAGCCACA 0.13145999 9.78e-02 0.99993
68239 CTGGAAATGCAGATCGAGAGCCTGAAGGAGGAGCTGGCCTATCTGAGGAAGAACCATGAG 0.33293284 9.79e-02 0.99993
18120 TTAAGTACTTAGGATGAAAGGGCTTTGAGATAAGGCCTTGCTTTCATAAAGTACAAGTAG -0.15207067 9.79e-02 0.99993
93877 TCAGCGGTATGGGGACATTGTCCCAGAGCTACCAGTATGAGGTGTGTCTGAGCGGAGACT -0.285135 9.80e-02 0.99993
11556 AGTTTTCATCGCCCTGAACTGGCTGGGCTATGCCAACTCCGCCTTCAACCCGGTCATCTA -0.14245126 9.80e-02 0.99993
58170 GCGGACTTCTCCACCTCAGGCAGTTTAAAAGAATGTGAATATTCTATTAAAATAAAAGTG 0.1422112 9.80e-02 0.99993
98256 GCTTCTGTCTTCTCCAAGCTGGCTGACTGGGACCCTTAGAAGTTCTTTTCATTGTCAATT 0.33789013 9.80e-02 0.99993
23794 GGACACATTGCAATACAGGTCCATTCATTATTAAGCTAATGCACAGGAATAAAAATCAGT 0.25636409 9.80e-02 0.99993
105005 TCATGGTTGCAAGCAATTGGATACTATGGTTTCATTGAACAGCAAACACTATGTCCAAAG -0.18825466 9.80e-02 0.99993
216644 TTCTTATGGCCCAGCTTGGATGTAATCTCTTTACCAGTTATAGCTGCTCTCATAGCTTGT -0.12374321 9.82e-02 0.99993
225358 AAAGAAACTACGTAAGATGCTACGGGAGTTTGAAGAAGCGTTCTATCAACAAAATGGAAG 0.22859404 9.82e-02 0.99993
216797 GGGTGAACCAAGAGCTTGGATTCTACTCATGTGACAGTCAAAAGTTATTAAAGATTTGTG -0.23068193 9.82e-02 0.99993
257919 TTGATCTACAGTCTGAGGAACAAGGAGGTAAAAGAGGCCATGAGGAAATTGATGGCATGA -0.13031364 9.83e-02 0.99993
54392 CTTTTCTTTCTGCCATACCCAAGGAAACACCTTTTATTTGGATAAAAATGTCCTAACATG -0.16190393 9.83e-02 0.99993
217316 TTCTGTGGCGTGCCCATGTGCGCGCACCATACACACACACAAATAAACGTTATTAAAAAA -0.19239237 9.83e-02 0.99993
209186 CCTGCATCTGAAGTGTTCCTGACAAATCTGTATGTAGTTTGCAATTTTCTTATCTGTTTT -0.16752719 9.83e-02 0.99993
674810 CAGGACCACTTTGTGCAGATGGTGGGGTCTCACCAATAAAATATTTCTACTAACAAAAAA -0.10859473 9.84e-02 0.99993
22598 AGGGAGTGAGTCTGGTACCTCACTCAGGATGATAGCATTTCCTTCAGATACATCCATTTG 0.15391873 9.84e-02 0.99993
19087 CCCTCAAAGTGATCCCGAATTTTCCTAAGGTCCTTTTCTATGGTATTGCTTTATTAAATA -0.15447622 9.85e-02 0.99993
317758 GGAGGCAGCCCTGAAGTACATGATCATCTTGTTTACTCACAAAGAAGACCTTGAGGATCA 0.24963313 9.86e-02 0.99993
68528 CAAGCAGCTATTTTCAAGTCCTTGACAGAGAAGGACACGAAATGTCAAATGAAGTAAAAC 0.16847364 9.86e-02 0.99993
68728 GTGTGTAACAGGATTCTGAATGTTAGGTTGTAATGCTATTCCTGTATGGGAGAAAAAATA 0.20307859 9.86e-02 0.99993
12931 TTCTTACATACCAACTACTCCCTCAAGTACAAGCTGAGGTGGTACGGTCAGGATAACACA -0.67849055 9.86e-02 0.99993
258687 AGCTTGAGGAACAAGGATGTAAAAAGTGCATTCACAAAGATTATATTGAGGTCAGGATGA -0.1381223 9.86e-02 0.99993
243961 AACATTGACCGGGCTCTCAAATTTTTCCTGGAGAGGTGATGGCTGGCCTGGACGGACCAG -0.22585383 9.87e-02 0.99993
317717 CCTGAGCTAAGAACAAGTACCTATTAAAGCATGAAAGTCCATTTGAGACGAATGAATCAT 0.17040717 9.87e-02 0.99993
20510 GTTCACAAGATCATTGGGGTCATCTTGTAACCAGCCACTTCACACACTGTGCTGTTAACT -0.162002 9.88e-02 0.99993
434174 GTTCTGAGTACCACCCAAAAATCAAAGGCGAACATCCAGGCTTATCCATTGGTGATGTTG -0.19204969 9.88e-02 0.99993
81016 AACCTCACTCCATGTGTTGTATAGGCAATGCCACCCCCAATAAAGATATCTGCTTCACTG 0.11200814 9.88e-02 0.99993
27386 GTCACATACATGGTTGTCTTTATGTAACTTAATTTTTTCATCCGCAGGTGCCATTTTCAT -0.31057395 9.88e-02 0.99993
21877 CCTCAGCTCTTAGTGAGCCACTTTTCTTGTGCAAAATGAACAATATTAAAGTTTACTACT 0.45644978 9.88e-02 0.99993
60504 TGCTGTGTAAACCTTGTTCCTTAATTTAATACCATTGGTTAAATAAAATTGGCTGCAACC 0.56155453 9.89e-02 0.99993
14706 TGTGGCTCATGTTGGCATCATCAACCGACAGAGTAGACCATAGTCCACAAAAGTCAAGAA -0.19360763 9.89e-02 0.99993
17274 ACTCGACTATGGGATCAAGTTCATGGAGACCAGTGCAAAGGCCAACATCAATGTGGAGAA 0.11976027 9.89e-02 0.99993
16190 ACCTGTTGGGAATTCCAACCCTCACCAGTCCCATCTCTTCATTCTATTAAAATTACTTAT 0.37959646 9.89e-02 0.99993
100503759 ACCAGAAATGAAGGTTTAGGGTGGTCATGTTTTCTCATAGTTCACACGGCTAAGATCTTG 0.11580269 9.89e-02 0.99993
66712 TCAAGACCATTTCATCTCTAGCTGCACCACGTGAGGCTCTCTCAGCTTTTGAAGAACATT -0.24863003 9.89e-02 0.99993
230233 ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT -0.11632209 9.89e-02 0.99993
56371 CACCCTGTGACACTCTTAACTGCGTTGACTCTGATTGCATTGCCACCCTTTGTCTGTGTG -0.10784825 9.89e-02 0.99993
234353 GATGTACAGGCATAGATCATGTCCTGGTTGAAACAAAACAATGTTGGAAATGAATACCAC -0.19812001 9.90e-02 0.99993
28105 GGCTCATTGTGTGGTCATAAGCACTTGTAGTGTGAATCAGTAAAGTACAAAATTCCTAGG 0.17084068 9.90e-02 0.99993
107526 AGATCTCACAAGTCAAATAATCCAGGTTGAACACAAGTTAGCAGCTCAGCAGGTGACATC 1.09584158 9.91e-02 0.99993
100043902 AATCTCCAATGAGGACATTCCGTTCTAAGGAAGCTTCCAGATAGGGGAAAGCCCTGTTTT 1.34372046 9.91e-02 0.99993
257973 AGTATTATAGTCTCCTATGTCCGTGTCCTCTTTGCCATCCTGAGAACAAAGTCTGAGAGG -0.11634274 9.92e-02 0.99993
108105 GGAAATAAATTATTGTCCCAGATGGTCACTTGAGTTTTAAAAAATGGCTGCACACAGTAA 0.15696326 9.92e-02 0.99993
69724 AGAAGCTGAGGAGGATCCTGAAAGACCGGGAAAAATCACCTCCTACTTCAGCCAGGGCCC -0.34937629 9.92e-02 0.99993
435815 ATGAGGCTGCCTTTCTGGAAATCAGACATAATTCTGGTTTAGAGGTTTCACCTATCCTAG 0.48633052 9.92e-02 0.99993
258105 AACAAGGATGTGAAGGATGCTTTCCAGAAATTAGTGAGCACAAAGATCCCTCTTCAGTGA -0.21447167 9.92e-02 0.99993
15220 TGTAACTTTACAGAGGATCAAAGCCGTTCTTTTCCATTTCTTGGCCAGGCCTGTACTCTC -0.24258091 9.92e-02 0.99993
19417 GAGACGCCTGCTTTAACTGTCTTATGTATTAATTGGGCTTCCACAGAAAAGCTCATCTAT -0.36163669 9.93e-02 0.99993
56878 GTGCATAAAACCCTTAAATTCATCTAGTAGCTGTTCCCCTGAACAGGTTTATTTTAGTAA 0.52207434 9.93e-02 0.99993
16391 GTCATGGACCCTAAACCTTTAGAAATGTGAGCTCCAAATTAAATTTTGCCTTTTCTAAGT 0.719852 9.94e-02 0.99993
231507 CTATTTGTAGTAAGACTCAACCCCAGACCACAGGACCGGTTCTGCCCAACCCTTTTGAAC 0.44942277 9.95e-02 0.99993
14086 GGCTCTTTGACTCAAAGCTAGCTAGGTGGCACTCCGTGTCGCTCCTGCACATTCTGGAAG 0.31478873 9.95e-02 0.99993
22017 CTTGAAGAGGTAGACGCTTTGGAAGAAAGGCATAAAGCCTGGGGTCTTGACTACCTTTTT -0.20817081 9.95e-02 0.99993
58518 CAGTCTGATGCACACAGGGAAGAATGTGAGACAGCATTTCCACAGTAATGTCATCCACTT -0.21709979 9.96e-02 0.99993
69724 CTACATAGTTCCACATCAGTCAAGGCTACATGATGAGGCCCTGATCAATAAATCAAAGCC -0.18619418 9.96e-02 0.99993
100041339 AGCCCAGAAGGGCAGACTCTTCAAACCATTTTTTGAAATATATGGACACACACGTTTTGT 0.10852469 9.97e-02 0.99993
16706 GTTCTCCGAGCACCCAAGTCTGCTCCAGCCGTCTCTTAAAACAGGCCACTCTCTGAGAAG -0.34760983 9.97e-02 0.99993
225659 CCCAATAAAGAAACGGATCAGCCTATAAGTGACTAATGTCATTGACAAAAATCATAAGAG -0.33161068 9.98e-02 0.99993
100039796 TTACATTCTCACTGGCAGCCCTGATTGTCACATTGCCAAGTGGTATTTTGGAAACAGGGA 0.80244275 9.98e-02 0.99993
243833 CCACAGTGAGTTTACCAGGAATAAAGTCTCTGCACTGGCATAGTGTGGAAATAACATATG -0.16537598 9.98e-02 0.99993
78239 CGTTCTCTAAGAGCATTGGCAACCAAGAACCTTGCTACGGATTGGAGATTGACCACTTTA 0.19839162 9.99e-02 0.99993
263876 AGAGTGAGCTGCACAAGTTCCTGCCCAACAGTCAGCTGAACTACAAGTCCGCCCCGTTCT -0.16001377 9.99e-02 0.99993
623272 CCTTATAGAGATTATCTGGAAAGGATCTTCGACCCCAAATGTCAGAGAGGCCATGTTCCA 0.12875159 9.99e-02 0.99993
16818 AATCTTATGTCTCTGTGTGTTCTGTCCTGGTGCCTAGCACACACCAGGAGCTCAATAAAA 0.72153821 9.99e-02 0.99993
64379 CAATCACTGTGTAACTTTCTTGCTGAAATGGTCTCCAAGGACTGTCTGTGTCTCCTTCCT -0.16848073 9.99e-02 0.99993
435366 TAAAGCCTTTTCACAGAAACGTAGTCTCCAAACACATATAAGAATGCATACTGGAGAAAA -0.11420829 1.00e-01 0.99993
19733 AGTTCAACTATCAATCAGCCTGATGATGGCAAATTGCTCTGGGGGTTGAAATGGGACTGT -0.1843282 1.00e-01 0.99993
192678 GCATGTGATTTCTTTTTTCGTGCATCAATGAGGTTTAGTGACATTGTCATCCAACACGCT 0.34193862 1.00e-01 0.99993
100042401 CCCTGTTGGATATCTATGGGTCTTTGACAACCTCAGTATCTTTGTCAATAAAATTTGTTT 0.33886549 1.00e-01 0.99993
100043314 TTTAATGTCCTGAGCTACAGAAGCCTAGAGAGCTTCATTGCTGTATCGAAGACTGGCTAA 0.43414849 1.00e-01 0.99993
212442 CGTCCTTTAGTTACAGATCAGTGAAGTTCTGTCTTGTTTTGCTTTTAGAAGATGGTATTT 0.17929294 1.00e-01 0.99993
240261 TCTAGGCTTTACAAACCTACCAAAGGCTGGGAAGAACGAACCAAAAAGATAGGTCCGTCA -0.15392445 1.00e-01 0.99993
18726 TGAGGCTTGGCAAAGCCATAGACAGACCCACCCTGCAGCTGGAAACTAATCTAAAGAGAA 0.36138632 1.00e-01 0.99993
258383 CGTGGCTGGGTGGCCTTGTGGTCTCGGCGATAAAGACAAAATGCATTGCAAGCCTGATCT -0.32765512 1.00e-01 0.99993
67432 GGCACTGCGCTTGGATTTCAGCAACAATGGCTGGCTTTAATGACAAGCAGGAGACGCCTG -0.2855299 1.00e-01 0.99993
26458 ATGTGCACCTGCCATTTGTCCTTGCAAACTAAGCTTCTTGGAGAGAGGGCCTTATTTTTT -0.75308287 1.00e-01 0.99993
117590 ATGGATTCTACTCTTCCCTCTTTGCCTTGGTGAGGCAGCCCAGGTCGCTGCAGCATCTCT -0.13890659 1.00e-01 0.99993
13019 TACCGCCCTAGGCTGGTCAATGGAGAGAGAAAGGCAGAAAAACATCTTTAAAGAGTTTTA -0.24569653 1.00e-01 0.99993
630322 ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT -0.88861427 1.00e-01 0.99993
16859 ATATTACCACCGCCTGAAGAACTTGCAGGATATCAACACTCTAGAAGTGGCGGGTGATAT 0.51955194 1.00e-01 0.99993
12862 AGCAATCTTCAAATTGGCCTTCTGCACACCGGCTCTGAGAGCCCCTGAGGTTCCAGTGGA 0.4109787 1.01e-01 0.99993
16189 GTCCAAGTCCACATCACTGAAAGACTTCCTGGAAAGCCTAAAGAGCATCATGCAAATGGA 0.22778387 1.01e-01 0.99993
140580 GCCCTCATATGAAAGAGAAAGGTGCCCTTAAACAAAACAAGGAGGTGCTTGAACTTGCTT 0.7180783 1.01e-01 0.99993
381812 TACGATGAAGAAATCCAGCATCTCTATGAGGAGATGGAGCAGCAGATCAAAAGTGAGAGG 0.14886319 1.01e-01 0.99993
380732 AAACATACTTAGGTTTTGTGGCCTTCCACCTTCTCCCTTCCCAACACAATTATCTTGGGG 0.15596778 1.01e-01 0.99993
258387 TTTATAGTCTGAGGAACAGAGATGTGGCAGGGGCTTTAAAGAGGGTGATAGCAAGACACA -0.12293328 1.01e-01 0.99993
26922 AGCTGATTATGTCCTCACAGAGGAAGAGTTAAGGATGCCCGAGACAAAAACCATCTTCAA -0.12588704 1.01e-01 0.99993
226470 TGGTTGAAGTCTTGGTGAAAGAAAATAGGATTTACAGCAGCGCTTCACAGATTAAGTTTA -0.12339862 1.01e-01 0.99993
12297 CTTAGCATCTGGTGAGACTGGGGAACTGGGGCATATTCAAGCCAAGAGCCAGCCTGGACT -0.13321218 1.01e-01 0.99993
320046 AGATGCACCTGCCATGTATGGTGAGTTCAATAAATGTTTCTTTCTTTTCTGGCTTAGGTT -0.78111243 1.01e-01 0.99993
100505195 TTGAATTTAGCAACTAAGTAAATCCGATCCTTCCACTGGGCACCTGACTCATAAGCTCCC -0.4528359 1.01e-01 0.99993
12671 GGATTTGACTCTTGGTTCTTGCAAAGTACTGTTTTGTGCAGTTCAAGTTTCATACAAATA -0.35155996 1.01e-01 0.99993
76681 CATAGCTAAGGGCTGTCACTTACATCAGGTGGGTAAAGACCATGTTAAGGGAAGATTCCA 1.21446549 1.01e-01 0.99993
277343 AGTTTGAGCTCCTGCAAAACGGACTTCAACTGTAAGGCGCATTTCAAGTGCTGCCAATTT -0.15842412 1.01e-01 0.99993
26942 GTGTATGAGCATCTCCTGTATCTGAGCAAAGCAGAGAGGTTTAAGACGATGCTGACACTA -0.1586768 1.01e-01 0.99993
105855 TAGTTGGAATGGGAAAATATAATTAGCCAGTTGATTAATTAGGGTCGTGCCCATGCTTCC 0.36940661 1.01e-01 0.99993
76041 CAAGCGAACCCTTATCACATGTCCTCCAAGAAATGTCTTAATATTTGTGTTGACATTTTT -0.12703831 1.01e-01 0.99993
66985 AAGTATGGACAGTGTATTCCTCCTGTGTATGTGCCTGCTATGTACCTCACTGTATGTGTG 0.21908369 1.01e-01 0.99993
80287 AAAGATACCTTCTTGTGCTATGAAGTGACTAGAAAGGACTGCGATTCACCCGTCTCCCTT 0.26830094 1.01e-01 0.99993
320981 ACTCTTTGCTAGGAATAGTGATATATCAAATGCAAGTTCCATACTTCAGTAGTTCAGAAG -0.3564256 1.01e-01 0.99993
72392 GGGGCTGTGGATATATTGGCCTGGGTATTGTTTACATTGTGAAATATCAAGATCTATTTC -0.17699878 1.01e-01 0.99993
56312 CAATGGATACAGGACATCACACCCAGCAATGGATACAGGACCTTGGAGAAATTAGGAGTT 0.37500425 1.01e-01 0.99993
433597 GGAGCCATATTACTCATTACAGTGCCATGCAATTTACATTTAGCAGTAAGAATAAGAGAT -0.14973041 1.01e-01 0.99993
16782 CCTCTGTATCTCCTTGTCTTTTCATGGATGTGTATTAAATAAAGGAGTGTTAGATGCTGG 0.6638545 1.01e-01 0.99993
230622 ACAAAAAAGTTGCTGTTGAAAATTGTTCAATCAAGTTCTCCAAGTTCCTCTGTGCGTCTA 0.20747632 1.01e-01 0.99993
22066 TATTATACCAAAGGAGAAACACGCCCACGAGGAGGACTCGAGCATAGACTATGACTTAAG -0.64224533 1.01e-01 0.99993
67899 CTTATGGTATTAAAATGCCGGAAAGAGAATTCTGCACTGAAAGACTGTCTAACTGCTTAC 0.12513206 1.01e-01 0.99993
16176 AGGTTCCTATAATATGGATGAGAATTTTTATGAATGAAGCACCAGCACATTGCTTTGATG 0.63301179 1.02e-01 0.99993
17857 ACTTTCCAAGGAAACTGGACGTTTCCACTTTAGCGCTTCCAATAAAATTCTTGCTAAGTG 0.97334845 1.02e-01 0.99993
22631 CTTACTCCTCAACAATTGAAGTGGACTTTTATGGGGTGGGGGGTGATTGGCAAAAGGTAA -0.1353475 1.02e-01 0.99993
69325 TCAATTAAGATACACGGGGGAGAAAAAAGGTTTTACCCTGTAATACTAATATGTACGTCA 0.35817039 1.02e-01 0.99993
227682 CTGGGCAAAGCTACAGACAACTTCTGTGAAGATGGACGGCTGATAGAGAAGACAACGTAT -0.15332038 1.02e-01 0.99993
13599 ATAGGTCCCACTGATGTGTTCTTGCTGATTAGTCTGGTCAATAAAGCTGCTGTACTATAT 1.15239024 1.02e-01 0.99993
212398 GAGGGCGCCTCTCCTGCTAAACCTGTCAGTTCTTGGTGAGTGACTGAAACTTTTTTAAAA -0.24171668 1.02e-01 0.99993
668253 TTTCAGGTTTTGTAACAGTTCAGTAGTTAAAAGCACTTGTGGGCTGGAGAGACACCTCGG -0.16743905 1.02e-01 0.99993
18073 TGGAACTGATCGGAGAACTGAGCTTCTATGATCGTACGGACATCACGTCGGTCTATGTGA 0.10467607 1.02e-01 0.99993
52118 CTTTTTCTTCCCAGACACTATTCTGACTTACGTCTCCATTACAAACATTTTATTGAACTA -0.20513738 1.02e-01 0.99993
319448 GCATTTGTGAGTTATTGGATGATCAGATTGAATTTTGTCATATCACATTGTACATCTCGC 0.21348833 1.02e-01 0.99993
268749 CTTACCAGGCCCGGCTATTACAGAAGCTGAGAGAAGAGGTACCCTTGGGACAGAGTATTG 0.23514483 1.02e-01 0.99993
14976 AGCTAACGGAAAACAATATCGTGAAGGAGGAGCTGGCTCTGCTGGATGGATCCAACGTGG 0.11860035 1.02e-01 0.99993
76376 TATCCCTCCTTGGAAGGTTGGAGGAAGGATGGATTCCCATGGGGACATTCACTTCACAGG -0.12623208 1.02e-01 0.99993
12652 ACAGGCAGCTTTCTAGAAGTTTCTCTTCCACCTTCTTATCCATGGGGCACAACTGCAATA 0.11905979 1.02e-01 0.99993
11614 GAGTGTGGTACTAGGCTAACAAGCTAATTTCATAAAAATAACATCTCTTTCCATTAACCC -0.14652094 1.02e-01 0.99993
103836 GGGCCTGCTCCTCCCCTCCTAGCCCCAGCGAATGGGAGGTCTGTAGGGTTGGCCCTGTAA -0.1277004 1.02e-01 0.99993
320435 AACGAACGGATGGGAACAAGAGAGACGGGAGATGCTGGGCTACTCCAGGAAAGCTTCTCC 0.45877792 1.02e-01 0.99993
56760 GGATGTCAGATAAGTGCTTGATCATGCAATAAAAGATCTGGACAAAAGAACTCCGCATTC 0.18966141 1.02e-01 0.99993
22032 TCTAGTGCTAGGTGGGCACAGCAGGGGAACTCTGATTTTTAATAAATCCTGAATTGTATT -0.22262682 1.02e-01 0.99993
11766 ACGGAAATAACAGACCCACGTAAATGGCGAAGTAAACTTTATTTAAAGGCAAACTGAGCG 0.3538745 1.02e-01 0.99993
234463 TTATGTACCGAATCTTCTGATTCATCTACCGAGTCTTCTGACCTATCTACGGACCCTTAA 0.12709871 1.02e-01 0.99993
319197 CATGATGAGCTGTTTCGTGATCGCTACAACCACACCTTCTGCTTTGAGAAGTTCCCCATG -0.20360312 1.02e-01 0.99993
19645 ATTTTCAGAGATCCTGCTTCGAGATTTCTTAAAGCTGCAGACACTGCACTATTGGTTTTG -0.19576834 1.02e-01 0.99993
19934 GCTGTAAACAACATTAACCCTGGGTTGATTAGCATATGCTTCTAAAAGATGGTCCCAGAT -0.26703465 1.02e-01 0.99993
15235 CTTTTGAGCCCTTAGAGATGTCAAGACTTCTCAAACATAAAGCGGCCTTTTCTCTCTGTC -0.17865089 1.02e-01 0.99993
258036 TTTATATACAGTCTGAGGAACAAAGAGGTAACAGCTGCTCTGCGAAGAAAAATGAAATAA 0.12249636 1.02e-01 0.99993
107769 AATTCAAAACAGCAATTGCAGGTTGGAGAAATGGCTTCATATGAAATGTATGAGTTGTTG 0.15347086 1.02e-01 0.99993
117147 CGGGAAATGAAGATCAAGCGAGGCTCCATAGGGAAGGCCATCTTACCCTTTGACTTGCAG -0.15831891 1.02e-01 0.99993
16619 CCCAATGCGCCAGGCGTCTTCACAAAACTTATTAAGTTTACCTCCTGGATAAAAGACACT -0.48375418 1.02e-01 0.99993
74243 TAGTCACCCTTGTACAGAGCTAAGATATTCTGACCTGGAATAGACGGGATTTGAATTGTT 0.23693181 1.02e-01 0.99993
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.60089517 1.02e-01 0.99993
73910 CTTTCAGAGTAAGTCTTCAGGGTATGACAATCATTTATGTGAACAAGCTTTTGTCGGTGT 0.3144013 1.03e-01 0.99993
98733 ATGAACGTGCCTACTTCACAGTTACCATCACAGATGTCTTCTCGTGGATCGTCTACCCCA -0.11504694 1.03e-01 0.99993
20112 TCTTTCAGTAATGTGAGGTTACCTGCTTTACACTCAGCCTACTCTTGCCAAAGGGATGGA 0.32906753 1.03e-01 0.99993
228866 CGCAGCTACTTCAGCAAACTGTGGCTCCTCTACCGCTATAGCTGTGTGGATGACTCTGCC -0.1831471 1.03e-01 0.99993
258519 GTTCAACAGTTTCTAGTTCTTCCAAGGAAAGTATGGTGGCTTCGGTAATGTATACAATGG -0.24262872 1.03e-01 0.99993
258448 TTCTGTGTGAAGTCCCATCTCTAATTCAACTCTCTTGTGGGGACACCACCTATAATGAGA 0.27590546 1.03e-01 0.99993
53877 ACAATGCAGATACCAAACGACAGGTTCAGTGAAGTACTACAGAGTAGCCTGTGAGAACAG -0.15695983 1.03e-01 0.99993
19726 AAGCAGAGTTTTCCAGCTTACTCTAACCCCATTGATACTGGGCTTAAGCTGAAATTTTAA -0.23867691 1.03e-01 0.99993
100043861 TCTGGTTGACTGTAATTTGAAAGGAGCCACTTTGCTGCTCATTCAAGATGAAGAAGAATT 0.28564624 1.03e-01 0.99993
67676 AACCCCGAGAACCAGGCGCTGGCTAGGTTTTACTGCCACACAGAGAAAACCATCGCGAAG -0.12059736 1.03e-01 0.99993
224805 GAGACTGTAAGAAACAAAAGCCAACTGAGAGGCAGCAACCTCAACAGATGTGAAGACCCG 0.88589866 1.03e-01 0.99993
75812 GCGCCGTGTGTACTATATTATGAAAGAATATGTAAAGAAAGTGTTCAGTAACACACAGTT 0.17269868 1.03e-01 0.99993
19888 GCATAGCTATGACTTTGTTATCAGGATATCAGAAATATGGTCAGGACAAGAAATATATCC -0.20774954 1.03e-01 0.99993
574428 TCTTCACTGAGAGCAGTGAGTACGGCTGTGTGATGGACGATCAGACTATGGCGGTGGCCA 0.31965365 1.03e-01 0.99993
68612 ACCTGCAAGAAACCTATTCAAAGCAGGTCTCCAGCCAAGATCCCTGATGCAAGCTGGCCG 0.29674769 1.03e-01 0.99993
103677 GAAGAATACCTTTCTTCTTTCTGTCCCACTTGGAACCCTGGTTTTGTTTCCTTAATAAAT -0.13094845 1.03e-01 0.99993
20467 ATGGTGGATTTCTAGACCTGTCACTCTGTTTTCTAGTTGACTTTCTACAGTAATAAAATG -0.18585647 1.03e-01 0.99993
242406 AACAGGTGCCTGTAGACACCTTCAGCTGGGACCTCCCCATCAAAGTGCTTCCTACAAGCC -0.17226812 1.03e-01 0.99993
57248 TAAAGAGCCGTTCTTGCCATCCTTTCTGCCCTGATGAAATTGAAAAGAAGTTTATCCTGG 0.43426005 1.03e-01 0.99993
258098 AGTGAGATGAAAGGGGCCATAGGAAAAGTGCTTACCAGAAAGTATCTTTCATGGAAAATG 0.18103398 1.03e-01 0.99993
622116 CTCTCTTGGGCTCCTGTCACACATTTGGCACAGTGCACACATATGCACACACATACACAC -0.15591629 1.03e-01 0.99993
74637 TCTCACCTGTCAGCTTGATAGCCCTGTCAGTTGAAGAGAACAGCTATAGCATGGTCTCCA -0.15291711 1.03e-01 0.99993
74204 TTCATAAGTCTCATGACCTTCTGCAGGAGGAGATCGGCATTGCCATTTACAACATGGCTT -0.12678488 1.03e-01 0.99993
26557 TGTGTCCAGCCAGTCACTGATTCTTTTTATCCTAATCCTTTTGGTCTGAATTTCATTTGC -0.41227973 1.03e-01 0.99993
14287 GGCATTTGGGGACTGTGTTGCTGGAACTAATTGAAGCTTTTAAACCCTTTTATTTTTTAT -0.18049212 1.03e-01 0.99993
320707 TTTTAATGAACACTAGTTCTACCATGTGTTCACCATTTGGGCTGTGCAATGCGGTAGGGG -0.22001358 1.03e-01 0.99993
212555 ATCTACCTACCTCAATCTGACTGTACTCTTGGTTACATCATAGTCAGGGGACCTAGGGTT 0.16241021 1.03e-01 0.99993
13717 ATACCGGAAGCCTTGACGATGGATTTGGTGACATGATCCCTCTCTCTTTGGTTCCCCTGT 0.15111615 1.03e-01 0.99993
55993 AAACTCTCAGTTGGAGCCAGACAGGTTACGGACATACCTGAGTAACCTCAAGAAGAAATA 0.12954677 1.03e-01 0.99993
19229 AAGCTGGTGAGATGAGGGCTGGACCTGGCTCTCTTGTACAGTGTACATTGGAATTTATTT -0.24597565 1.03e-01 0.99993
77038 AAAGCCATCTCGTCCGACATGTTCTTTGGTCGTGAGGTGGATTCTGAGTATGAAGCTAGG -0.12866963 1.03e-01 0.99993
76687 CATGTGTCTGTGCCATTTCCAGATACATACGAAATAACCAAGAGTTACTAAATTATTCTG 0.14143881 1.03e-01 0.99993
71619 AACAAAAAGAAAAGTAAGTTGCTGAGTCGGCAAACTTTTGGGGGTGGTTTCCACCCTGCT -0.20859832 1.03e-01 0.99993
21885 CAGAAACAACATCAAGAAACCTGAAGAAACCTGTTTCCAAATCTTGACACAGAACTGCTT -0.21009117 1.04e-01 0.99993
66626 CCAGATACACCTGATGAGGACTGCAAACCAGCTGAACATCAAACCAGAAAAGTGAACACT -0.16804228 1.04e-01 0.99993
99003 TCTTCGAGAATGTAGCGTTATTAAACACCACCAGCGGCCTTCAGTTACCCAGTCTATTCA -0.11829784 1.04e-01 0.99993
67204 ATGATGCCCAATGTTGGCTATAACTGCGTGAATAAAGCAAGGATCAGTGCCTCCTGTGTA -0.26494924 1.04e-01 0.99993
83436 CTGCTAGGTAAATTAACCCTGTTTTTAATTAGAAATTTGTAGCTCTAAGAGACTAGGAGG -0.33447084 1.04e-01 0.99993
74352 GGAGTGTGGGAAGGCCTTCGCGTGTCCTTCCTACTTTAACAGACACCAGAGGATTCACAC -0.12103601 1.04e-01 0.99993
75914 TGAAGCAGTGTCGACTACAACAGAGAAATATTTCTGCCACTGTCGATAAGCTAATGCTGT -0.19098314 1.04e-01 0.99993
71824 ACTTGAATCCCCAGGACTACATTGAATTCCATTTCTCCTTCACTTTATTGATTATTCCAC -0.16659564 1.04e-01 0.99993
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.15265363 1.04e-01 0.99993
223921 GTCCACAGGCCGAATCACCCACATACCTCTGTACTTTGTCAATGCTCAGTTTCCACGCTT -0.12470131 1.04e-01 0.99993
276742 GGGAGATTTACTGTAAATTACACACTTGTTTTGATGTATCTTTCTGTAGTTCTTCTATTT -0.15048575 1.04e-01 0.99993
71474 GTCCTTCAGTTGTAGAGGAGAAAGGCTGGGCCAAATTCACCGACTTCCAGCCTTTCTGCT -0.14436264 1.04e-01 0.99993
18128 TTGCTTCTTTCCAAAATCGAAAAGAAAGAAAAAAGAACGTGACAGGAGAAGGGAAGCTGG -0.12737329 1.04e-01 0.99993
30945 GCAGACTAACCTCATAGTGGTCAAGTACTCCACCTTAGGTGTTTCCTCTAAGTGTTACCA -0.16715592 1.04e-01 0.99993
59033 CCCTCTCCACACTTCATGTCGTAAATAGAACTGGGAATAAGATGTGCAATTGTGATCACC -0.32790775 1.04e-01 0.99993
78829 TGACAGGAAGGGTTCAATGGCCATCAGGCCAGAGCTACTGGTGAGGAGACATTCGACCAT 0.2539933 1.04e-01 0.99993
54638 CTTATATGTTCCCATATCTGATCAGGGTGACTGTCCAGCTGACCACAGTTTATTGGATGG 0.12126502 1.04e-01 0.99993
227835 CACTTACGATTCTTGCTCTGTTTGTTGGTGTAAAGATGTTTTAAATGGCTGGATTGTAAA -0.17724935 1.04e-01 0.99993
241950 CCCAGCTGTATAAGAACAGCAAGCACTTTTGAGTCATTTCTCCAGACTTAATAAATTTTA -0.23794282 1.04e-01 0.99993
171212 GAATGACTTATCCTGTTCAGTTGTGACTGTGGTTGTTCAATAAACCTCCAGACTTTCTCT 0.30506194 1.04e-01 0.99993
232174 GTTCGTGTGTCTCGTTGTGGTAGCATTAATGGGTGATGTAGTCTCACATTCCTAACTATT -0.5797773 1.04e-01 0.99993
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.5546451 1.04e-01 0.99993
12550 ACATTCTAACGGGAAAAAGGAGACAAGACCTTTGAGAGTTTTCATTCAAAATGCAAATCT 0.28271293 1.04e-01 0.99993
67543 AGATAGAAGACTTGGAGATAGAGGGAGCAGTTTGGATGGAAGAGGGTTAATCTGATTTTT -0.13371997 1.04e-01 0.99993
218397 GTATTTTTGTGTGAAGTATTCACAAGGGTTAAGTTAAAATAAACTAAGGGATAGCTTGCA -0.20038991 1.04e-01 0.99993
17527 CATTTATAATATTGCTGTCACTCTGGCCCTTAGCTGATGGGGACACACTATAAGAATTGT -0.23355595 1.04e-01 0.99993
69270 ACAAAACCAAGAACTCTTGGCTAGGAGCATAAGCTGCCAGCTCTTAAGCCTTTGTTACAG 0.18212369 1.04e-01 0.99993
75538 GACCAGAAATCAAGTCAGCTCAGCTCAGAGCCAGAGAGATGGAATTTTAAACTTAATAAA 0.19565207 1.04e-01 0.99993
15078 GATTCCATCCGTTCACTGTACTTTTCTAACTGGGTTGTCCTACATACAAGTACATGTTTT -0.10441805 1.04e-01 0.99993
216233 AGGTGTGAAGATGTAGCTAGGTATTTTAAAGTTCCCCTTAGGTAGTTTTAGCTGAATGAT -0.24452626 1.04e-01 0.99993
68519 GGAAGGAAACAACGTGACTCAAGATGAAGCTGTTTGTATGTATCCTTATCAAATATATTC 0.3704601 1.04e-01 0.99993
22704 TCTCAAACTCATTGATAGTAGAGCCTCTCGATTTTCATGAGATTCATTAAAATCGTGCAT 0.23519268 1.04e-01 0.99993
21331 CGCTGAGCAGACTCAGACATGAGGCTCCAGCCCATGGCTAGTCACTTCTTCTGACTCATG 0.1755739 1.04e-01 0.99993
21674 AGCTGACATCACTGGTGAGCATACACCATACCAGGAGCACCTCAGCACAGCCCTGTGGTT -0.1930841 1.04e-01 0.99993
67952 GTGTTTGTGAAAACTGAGCATTAAAACCTTACAGAGACCGTTTCTCGTTTACTTAAGAAA 0.1269085 1.04e-01 0.99993
19882 CAGCATGAGCCAGTGACATTTTTGTAGCATGTATTTATGTAATGTCTGTTTTGTACCTGT -0.28984258 1.04e-01 0.99993
18807 TGGGCCCAGACCTTTGGCCCACCCCCAAAGGGCCAAGATTATAAGTAAATAATTGTCTGT -0.17567951 1.04e-01 0.99993
12626 GATCCACATGAGGAGATACTGAAAGCATTTAAACTATTTGACGATGACGATTCAGGAAAG -0.13572923 1.04e-01 0.99993
70560 TCTATTAGGAATACTGGGAATTGTATCTACCAGGCCAATTGCCTGTTTAGCTCTGTGGTC -0.19730996 1.04e-01 0.99993
69009 TGACCAGAACTGCATCCACTGGGCTGGCCAAATGTTACAATAAAGTGGATGCTAGAAAGA -0.13049895 1.04e-01 0.99993
12525 CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT 0.46083044 1.04e-01 0.99993
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.56403418 1.05e-01 0.99993
276919 CGTACACAGTGAAAGGAGTACAAGAGCAGTGTAAAGAAATAGTTTTCTTAGATATTTGTC -0.12541022 1.05e-01 0.99993
268729 GCTGCATTGTTTTATAGGCTTTGGGTTTGGAGAATTAATGAACTATGCAATAAAACGACT 0.35419711 1.05e-01 0.99993
66912 ATCAAGGAGGTGGTGCTTTACGTCAAAGAGGAAATGAAAAGGAACGACCTTCCGGAAACA -0.12600543 1.05e-01 0.99993
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 0.70613903 1.05e-01 0.99993
14661 TGGCATTTTCCAAAGGTGGCATGGTCCTCAAATGAGTTATTGCTGTTTTACATCAAAAAA -0.15276071 1.05e-01 0.99993
66107 GAGCTCTGTGACCAAGAAAACAGTTGAAAATGGAGGCCATGTATGGAGATTACAAGCAGC -0.11419199 1.05e-01 0.99993
266815 TCGAGAGTCATTTTACCAGATGATGATAACTATTCCAGTTTTATCTTGATTCAAACACGG -0.20325739 1.05e-01 0.99993
212684 GCCGCATCGTCCATCTCTATACAACCTCGGATGACTTCTGCCTAGGCTTCAACATCAGAG -0.14236212 1.05e-01 0.99993
381272 GTATGTCTGAGAAAGCAGAAATAGTTTTTAGAAAGGCCTGTCCTAGTACGAAATGGAAAT 0.16620301 1.05e-01 0.99993
26357 CCTGGCTTGTATGATTATTATCTTCCTCACAATTGCCTACCTGAAATTGTTGTTTCTTAA 0.1949414 1.05e-01 0.99993
58237 CGGGGGACACTGCAGGACAGGGTGGCTACAACTGTGAGTTTGTAATATCTTTTCTTTTTT -0.2100101 1.05e-01 0.99993
76900 TCTAAACACACATATACACACACAAACTCAAAAGGACCTCAGAGAAGTGCAGGCCTCTGG 0.30978091 1.05e-01 0.99993
71586 ACTACCACACAGTCATGGATTAAAACCTCAAACTGCAAGCTACAATAAATCATTTCTTCC 0.58438633 1.05e-01 0.99993
28169 ACACCCATAACCTGATGCGGTATCCAATTAACTCAATTAAAAACAGAACACACAAGCGCG 0.15227042 1.05e-01 0.99993
68939 GTTGTTGTTTTTCTTCTTTAAACTGTGGCATCAGGTACAGAAAAAAGTGTTAGTTGATGG -0.42697254 1.05e-01 0.99993
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.16885826 1.05e-01 0.99993
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.13844367 1.05e-01 0.99993
140484 TGACCTGAAGGAAATCCAGCGGGCTGTGACGCTTTGGGTGAGAGCACTGAATGCCAGATC -0.19584635 1.05e-01 0.99993
12307 CTCAGTGAATGACTTAGAGGTATGAGCAGTTTTAAAGATTAGCCAACAATAAATCCTAGA 0.3865339 1.05e-01 0.99993
75456 AGTACAGCTAGTGTTCTTTGAGAAAGAAGACCCTGACTGTCTCTATTTGAGGACTCATCT 0.1512005 1.05e-01 0.99993
18571 ACCTGCAAGTGAAACATTTGAAATTAGCATACTTTATAAGATGCAGTTGGGACAAAGATG 0.15712634 1.05e-01 0.99993
14632 GGGGCTGTATTTAGTCTATGTATGTTCCAGGAAAGAACAAACTTTAATAATGACACAGTT -0.26286545 1.05e-01 0.99993
436583 ATTGCATCCCTGAGAGTGGAATGACTCCTTGTGGAGTTGGTCCTGGTCTGGGTGCAAACA -0.2024148 1.05e-01 0.99993
107589 AGGACATTTATCATGTTTCTTCCATCCTGAAACCAAGTTCCCCGGCTTGTGGATGACTCT -0.29224942 1.05e-01 0.99993
72075 ATGAGTGAGTCAGAGGAGTTGGCAAGGATTGAGGCCTCTGTTGAACCCCCAAAGCCTTAG 0.14044531 1.06e-01 0.99993
67693 TTGGACCTTGATGAAACTGTGTGAACAATCAGTATAAAGAAGTACCTAATGTTCAAATGC -0.16962798 1.06e-01 0.99993
622446 TTGTAGAGAAGGCAGAGAATGGAAGAGATGCACCTGGCAATAGGAACGGTCAAAATGAGG -0.20506897 1.06e-01 0.99993
75300 GCCTCTGTAGTAGTTCTGAGTCATGTGAGAGTTGATAGATTTAAAAAACAAAACGCACAT 0.16038489 1.06e-01 0.99993
21645 GCGGACCCTGAATCCTGGCCACTTCTCCTCACCCACTAACAACTGTACTGAGAATTCTGT -0.12177621 1.06e-01 0.99993
625276 AAGTAAACAGAAGTGGGACTGCTTCTGACATGGCTTCCCCGTGTTCTGGGGACCTCAGCC -0.20608992 1.06e-01 0.99993
21897 CAAGCATGGACTTTTTTGGGCAAACCTAAGAGCATCCATTAATGTTAAGCTGGTTAACCA 0.56019781 1.06e-01 0.99993
245944 CAGAGTGCCTAATCTTGTGGTTATAATGTACAATGAAATAATCTTGTGGGGGTTTTTTGT 0.13599908 1.06e-01 0.99993
13714 TGAGGACTCTGTACAGAAAATGCCTTAATTGGAGTCCAAGCTCCACCTCACTTCTTTTTT -0.15351537 1.06e-01 0.99993
19645 ATTTTCAGAGATCCTGCTTCGAGATTTCTTAAAGCTGCAGACACTGCACTATTGGTTTTG -0.19706439 1.06e-01 0.99993
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.4868168 1.06e-01 0.99993
12323 CCTGAAGCTCTGGGCAACCTGGTCGAAGGGATGGATTTCCACAGATTCTACTTTGAGAAC -0.18120656 1.06e-01 0.99993
93713 GACAGGCTCATTAGTGAAGAGAGCTGTGAGAAGAGTGAGCCTCTTCTGATACCTCATAAT -0.14974818 1.06e-01 0.99993
257985 GTGAAAGAAGTCTTCTGGGATGTATTACAAAAGACTTTGGGCTTTTCAAAACACAAAGTT -0.13545394 1.06e-01 0.99993
75497 CATGTTCTTCAGTAGTGATTCGAGATGCTTCCCCCAAAATAAAACTCATAATTATTAGAG 0.52919144 1.06e-01 0.99993
223726 AAAGATGGCGGCCTGCTCCTCAATCATTTTGGCATAACTTGATTGTGGCTGTAATTTTTT -0.25248865 1.06e-01 0.99993
228765 CTGGGTATTGCAGGGATGTGTCCCAGGTGATGTATATTGAGTCTGTCATTGCCGATTTTA 0.22391728 1.06e-01 0.99993
230793 CGAAGGTGAGCCCTTTCTGCACAAAACCAGCAATTGTAAATACTTTTTAAAATGTACAAA -0.15804872 1.06e-01 0.99993
65257 CCTCGAGTCAAGAAAAATCAAACATGATCAAATCAGTTATTTAGGGAATTGGAAACTAGC 0.15668728 1.06e-01 0.99993
330010 AGCCACTGTGAGGACTACAAGCTAAAGTGGTGTGAGATCAAGTGCAGGGACAACTACTGC -0.16357152 1.06e-01 0.99993
406186 TCTATACTCTAAGGAATACAGAAATGAAAAATGCTATACGAATGTCCTGGAAGCAAAAGG -0.2109241 1.06e-01 0.99993
29805 TGTGATTGGTGGAGAGCGAGATCGACTTTACCGGGCTCGGAAGAAGTGCCAGTTCCTGCT -0.16364021 1.06e-01 0.99993
57750 ATATTCCCCTACCACTTCCCATGTTGGGGCTTGAAAATGAATGGCTGAGAAGAGAAAAAA -0.12571898 1.06e-01 0.99993
100046496 AGCAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGTGCTCAAAATCTAGAACTTCCT -0.52942928 1.06e-01 0.99993
106869 TGAATTTAAAGATGAATTCATCAGACTGATTTATGGGTGAAAGGATAGAAAGGACGTTGC 0.29828675 1.06e-01 0.99993
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.33236326 1.06e-01 0.99993
93679 TTTTTTAAACCAAGAGTGATTTCTATAGACCCTCTTTCTAGCCGGAAGTTCAAGGCCACA -0.10469318 1.06e-01 0.99993
217344 TAAAGTAACGCTAACTTTGTACGGATGATGTCTCAAGTTTATTAAATGACATTCTTTATT 0.31356433 1.06e-01 0.99993
230801 CTAGAACTCCGTAGTAAAGCACACGAGGCCCTAATTTCAGTAATAAACACCACTTGGATC -0.14763224 1.06e-01 0.99993
14990 GTGGCCCATTATTCCCAAAGACACAATTCTGAATGTCATAACTGAAACATTTTAATCTCA 1.40076891 1.07e-01 0.99993
75351 GGGATATTCTGGAATTTATGGGTAACCTCCAATTATTCCTTTCTCTCTTTACTATGGAAA 0.1162607 1.07e-01 0.99993
258231 TTGGATGTTGTTTTCACTCTCTTAGTTATCTTAAACACTTACCTGCTTATTTTCATTGCT -0.27991075 1.07e-01 0.99993
67775 CTTTCCTGGACATGCTCTGAAAATAGCCTAAACCATGGCCCACACATAATGGACCCAATA 1.11101747 1.07e-01 0.99993
19201 GTGAGGCCCTGGATTGTAAAGTACACTCTTGTTTGTATCTAGGAAGATATGATGGGAGCT 0.15940687 1.07e-01 0.99993
16905 CAAGCTGGTGCGCTCACTGACCATGGTTGAGGACAATGAGGATGACGACGAGGATGGAGA -0.20398028 1.07e-01 0.99993
66917 CACTCTTATGGGTGATATCTGTCTCCCTGATGAAAAACTGTATCTGTTAAATTGTGAATG 0.18982649 1.07e-01 0.99993
18027 AATTTTTCTCTCTCTGATTTGGAAAGTTCTTCATACTACAGCATGAGTCCAGGAGCAATG -0.15349034 1.07e-01 0.99993
56187 CACTGTCCTGTGATTCTGTCTACCAAGACCCTCAGTGTTTATGGCTGGTCAGGACCAGGG -0.14638075 1.07e-01 0.99993
268482 GACGGAACCGTATGGGTTTAACAACACTAACTTTAATTAAAGATTAATGGCAATGAAGTG 0.9400759 1.07e-01 0.99993
69576 ATGGTAAAGAACCAGGCTCTACAGGATGGATTGCTTAGAGCTGTTCAGATCATCGAGAAG -0.20163975 1.07e-01 0.99993
72119 CGCCATGTTTGGAAACACACCTGATAACTAATGGATGCCGGGTGTTTTGAAGATGACTCT 0.26841934 1.07e-01 0.99993
27368 ATGGGACTCTGACTAGAAGTAATGACCAAGCTTTTGATATACTTTGTTTTCTGCACTCCG -0.15875608 1.07e-01 0.99993
68487 TATTTTGTTCAGTGCCTGTATATCAGAAAACCTACGTGGCAATGAGTTCTTCATTCTGTG 1.15425056 1.07e-01 0.99993
14103 GCAATGATGTCTGTGTGTTTGTATGTATGAGAGCAAACAGATTCTAAGGAGTCATATAAA 0.60827435 1.07e-01 0.99993
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.19827635 1.07e-01 0.99993
67803 TTTAAGAGTAAAGGCAACTACGATGAAGGGTTTGGTCGTAAACAGCACAAGGAGCTCTGG -0.22266856 1.07e-01 0.99993
70333 CAGAGGAAGTGGATGGTATAGTGGCTGACTCTCAGCCACAGGTCATTGTGGAAGCCCAGG -0.21694075 1.07e-01 0.99993
70603 CACCTTGGGGAGGTTATCCACATCTTCTCTCACATCAAACTGACGTATCAAGTATACAGT 0.49931188 1.07e-01 0.99993
84094 TTTCCAGCCTCCCTCTTAAAGGCCACTAGGGTTTCCAGATCCTATTTGAGAGTCTCCAGG 0.33724225 1.07e-01 0.99993
258822 AGGAATAAAGATGTGAAGGGGGCTCTGGTAAGAATCCTTAAAGTATATTCTTGTCCCTGA -0.12132524 1.07e-01 0.99993
171095 GCGAGGAATGGGACCTGGGACCCTGCACTACACTAGAATAAAAGCCGATACAGTATTCCT 0.56490994 1.07e-01 0.99993
18349 TACTGTCTGCGGAACAAGGAGGTCCAAGTAGCTCTTCACAGAACCATGCACTGGTCCTGA -0.17317691 1.07e-01 0.99993
75687 GGTCAGCTTGCCTTGCCTCATCACATCCCTTGGGTTTGTATTTTATTTACAGAGTTTTAC -0.16672296 1.07e-01 0.99993
70470 TTTAGAAAGATTGCTGAACATCTGGCAAGAACGAAGTGTGTACGGCGGCGAGTTCATACA 0.32126712 1.07e-01 0.99993
625360 GTGTCTTCGCAGCCATCTGGTTTGTGTTTGTTTGTTTGTTTGTTTGTTTGTTTACAGCTT 0.25294158 1.07e-01 0.99993
105283 ACATCCAAGTGCCTATATGCTCTCTTAACTAAACAAAACAAGCACATAGGCTGTAGAGTA 0.14431437 1.07e-01 0.99993
22376 GGGTTTCTTTCCCTCACAGTCCCTTTTGGCTTTGATCTTGCTTTGTGTGTTTTTATTGAG 0.41981611 1.07e-01 0.99993
403187 GAGCCTTTATTACATCTCTGAAGACCCTTTTTCTAAATGGAGACACACAGGCCCCAGGAT -0.13373273 1.07e-01 0.99993
27412 TCGAAATACTGTTCACTCTGAGCAACCGTTTTCGTTTTAGTTTTATGGAGTTAATGGCTT -0.22490079 1.07e-01 0.99993
320343 ACAGGGAACAGCATCTCTGTCACCAAACGCTGTGTCCCGCTGGAGGAGTGCTTATCCACA -0.1521023 1.07e-01 0.99993
272322 AAGCAGATTGAAGGTCAGCCTGGGATTCACGAAACCCTGTCTTTTAAAATAAATAAAAAA -0.29743572 1.07e-01 0.99993
11799 TGATTTGGCCCAGTGTTTTTTCTGCTTTAAGGAATTGGAAGGCTGGGAACCCGATGACAA 0.28656523 1.07e-01 0.99993
18198 GTTTAGTTCTTCCTTGCACAGAATATGTAACGTTGTATTTGCATTCTGGAATTGAGTATC 0.72885228 1.08e-01 0.99993
319655 TCATTGGTGTCATCTGCTTCATCATCATTGTGCTTGGCCTACTCTACAATTGTTGGCAGC -0.19417283 1.08e-01 0.99993
16956 GAACACCAACCCACATGCAAAACCCCACAAGTGTAGTCGTCATTCAATGTGATTCAGAAA 0.51653788 1.08e-01 0.99993
665097 GGACCCAGGAGTTAGAATTTAAATGCTGGACTTTCTCCAGGTAATCAGCTTAAGAAAAAA 0.17119508 1.08e-01 0.99993
627788 GGCCTCATTCTCTGTACAAGCCTGTGGTTATAAAATTAGTTAAACAGCTTACATTTGTAT -0.1186585 1.08e-01 0.99993
330401 AGCCAGGAGGCAGACAGAGTCAGAACAAAAGTTATCTAAAATGACCCACAATGCTCTGGA -0.24244512 1.08e-01 0.99993
17896 GTTACTGTTACGGAGTATTGGACTCACATGGCTTCTCTGACCCACAACCTTCCCTGGAAA 0.24659813 1.08e-01 0.99993
22343 CTTATGGTTATAGAGAAGCATACACTGTTTTTCTCACGAGAAAAAGTCAGAGTTGGTGAG -0.16122347 1.08e-01 0.99993
100503044 CTCTATGGTATGCACATACCTGCTCCCCAACACTAATTAAATAAATGCAAAAGAAATTAG 0.13534597 1.08e-01 0.99993
66756 TGAGCCGTGATGTATATGAGGATGCAGAGGCTTTAAAGAATGATTCAAGATGTGTGAAAT -0.23163921 1.08e-01 0.99993
24017 GCACTAACTTCTCACATGCATATACAATGTGAACAGATCACTATACTAAATAAACACAGC 0.21755408 1.08e-01 0.99993
22213 AAAGCAGTGCAGGCCTGTTGTCCCTGCCTCTCAGTTCCCAGGTGTCCCAGGAAGCATTTT -0.11700655 1.08e-01 0.99993
80861 GGAAGATGAACGCAGGAGAATTATTATGCCATGATGTTCTAAGAACTACAACATCCCTCC 0.54238029 1.08e-01 0.99993
107568 TGGTGACAGAAGAAAACAAAGATGAATGTATTGGTTTAATGACAGAATGGCGCTTTTCTC 0.17256481 1.08e-01 0.99993
432555 CAAGTAGAAGAGTTTCCCACGGTATAAGAACTATCTTCCATTTAAGTATCATGAATGAGA 0.14205645 1.08e-01 0.99993
666926 ACACCAAGGGAAAAATGTTCCAGGAAATGTATACAAGAACCACCTGGGAGAAAGGCTCTA 0.57359762 1.08e-01 0.99993
22158 AGTGTACCTGAACTTAAGAATTCAAAAACTTTGGGTCTACATTCAGTGGGTCCCCCACTC -0.09833761 1.08e-01 0.99993
26422 GTACATTTACCCAGGATGTGATGCTGGCATTAGAGCGATGGATTTATCCCATGACCAAAG -0.214723 1.08e-01 0.99993
20460 ATAGATACATGAAATTATATCGCATAGCTTCCACTAACCTAAGACCTGTCCTCCCTCCAT 0.15815942 1.08e-01 0.99993
20475 CCCACTGATACCCATTTCCCAAAATTTCCTGAGAGACCAGGGTGGCCTAGGGACAGCCCT -0.18594391 1.08e-01 0.99993
545527 GCCCTCTGCCATAATTCTGGCATACAGCAAAAAACAATGGAAACAATTATAGATCTAATA 0.28338698 1.08e-01 0.99993
14156 GGCAATCAATTGAATTGAGGTTTTGGGAGAAGAAACTGTTGTTCATAGGCTATTTCTATT 0.12587615 1.08e-01 0.99993
258649 CATCTCCTTCATTCCATGTATAATGCAAACATTCTTGTATCTGGCCTTTGCTTCCATAGA -0.16076925 1.08e-01 0.99993
71723 ACCCCAACTGAGGTACTAAGACATCGAAGGCAGCATGTCTGAGCCAGCACTGCTCCTGGA 0.13936512 1.08e-01 0.99993
67574 GTGTATTTAAATCCTTGTGCCTATGATGATATTGGAAGATGTAGATAGAATTCCCTGGAA -0.1745927 1.08e-01 0.99993
259018 TCCCCTTACTACCTTTGATCTGTTCACATGTAGAAGAGACAGAATTATTGACTATATTGT 0.1455393 1.08e-01 0.99993
622208 GGTTTCCAATGTTTTATGGTGAAGTGCTGAAGATCTTCAAATACAGCTTTAGGTACTCAT -0.12965901 1.08e-01 0.99993
70123 TTCACCTCCAGAATTTGGATGACTCTAGGACATTGGCAAGATCAGGTGGTAGACTTCTAG 0.17931542 1.08e-01 0.99993
67356 AATGGAAGACTATGTGTTTGTGTCTCAGCTCTGTGAAGATCAAGCTCTCTGCATAAAGAA 0.15879845 1.08e-01 0.99993
211378 GCCACTGTGGAAATATTTGTACTTCACAATATCTGTATGTGTGAATAAACCTTTAGCATG -0.14159265 1.08e-01 0.99993
17304 CTCTGGGTGGTTGACAGGTTGGCTGTGGGACCTCTGCTGGCTTGCTACCCAAGTTAACAA -0.29788444 1.08e-01 0.99993
268903 AGAGTCTCTCACAGGTTACAGTCAAAGAAGAGCTACTTCCCGCTGCAGAAACTAAAGCTT -0.13542356 1.08e-01 0.99993
18368 CAGATGTTAAAGATAGCACATTCCCAAAGAAAACTCTTTTAAATGTCATCCCTGTGAGAA 0.1155176 1.09e-01 0.99993
20423 AATTTATTATTGTGTGAACTGTACTCACAGTGAGGGAAAGATTATTTTGTGAGGCCAAGC 0.3810636 1.09e-01 0.99993
22408 TGCTGCCACGTCAGCTGCCGCAACTGCACGCACACGCGCGTTCTGCACGAGTGTCTATGA -0.15474573 1.09e-01 0.99993
245522 ATGAAAAAGAATTAGCTCCAGGACTCTATCCCTGCCAGGGGAGAAGAGGGAGCTATTTAT -0.11452877 1.09e-01 0.99993
16176 AGGTTCCTATAATATGGATGAGAATTTTTATGAATGAAGCACCAGCACATTGCTTTGATG 0.76875916 1.09e-01 0.99993
73526 GGCCAGAGCCATGTGCCTCAGTTTACTTGCAATAGACCATCAGTGATTGAGGAGAGCAAT 0.26808105 1.09e-01 0.99993
192197 TGTCTTCCAAATCCTGACTCATCCTTGGTCATCATCACAGTGTGCTGTCCATCATCTGTA -0.10695919 1.09e-01 0.99993
268970 TGTACTTCGGGGGTTTCTGTGTGTCCCTGTGCTTGACCGGTTTCTAGATTGCCCAGTGGG -0.22124235 1.09e-01 0.99993
226470 TGGTTGAAGTCTTGGTGAAAGAAAATAGGATTTACAGCAGCGCTTCACAGATTAAGTTTA -0.12609037 1.09e-01 0.99993
211712 GGGATAAATCTCTAATTATTGCTGTTTAACTGTTTGTTATCATAGTTGGTCAATGCCTGG -0.18835841 1.09e-01 0.99993
22283 AAGAATGCAAGATTTTCGATTGTACAATGTGTCACTTACAAACAGGGAGATTCTAGAGGT 0.15324074 1.09e-01 0.99993
387347 AAATGATTGGCTTTGGTATTCCTTTCTTCGTGTTCCTGGCTTCTATCATCTTACTCACAG -0.20143434 1.09e-01 0.99993
16011 CACATCACATATTACTGTAGCTCTCTATAGTGTTACGTTCAGACACCGTAGCTCTGTCCT -0.46585964 1.09e-01 0.99993
14537 TAAACATGTGTTTGTGTCACGTATCGAGTAGAGTTCATTTTAAGAGACTTGATTTCCCCT 0.84356675 1.09e-01 0.99993
232078 TGGAAAGATTGTGTAGTGAACCCCTCAGAATAGACAGGCTGGAATGGGATTGAAGACTCT -0.22127169 1.09e-01 0.99993
20677 TCAAGCACATGGCTGACTACCCTGACTACAAGTACCGGCCGCGAAAGAAGGTGAAGTCGG -0.24984804 1.09e-01 0.99993
56873 CAATATTTAATGTATATAGGCAGAAGTATTATAGGGTCTTTAAATATGTGAACATATGTA -0.13531159 1.09e-01 0.99993
69202 GAAGCTGCCCCCTCCCCTTTTTGTATAATTTAATAAAGAAACGGTCGCGCTTCTGTTTTT -0.1216697 1.09e-01 0.99993
14175 ACAGCCCCATGGACTGATGGGAATGATTGGGAGAGATATTAAAATGACAAACGTGTCTGC 0.18121456 1.09e-01 0.99993
27801 GCTACTTCTGGGCAGCAGTTATGTTTCTCCCATATGGGGACAGATCACAAACTGTTTTCT -0.20133497 1.09e-01 0.99993
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.19591581 1.09e-01 0.99993
231042 CCCATACTCCTCCCTAACTATGGCTTCTGAGATTGACTTGAATACGTTTATATATATATA -0.12229063 1.09e-01 0.99993
319564 GTGTAATTTATCGGCTCCTATTTATAAAGACTAGTAATGACGTAGTCACCCCCTACCCCC -0.14360816 1.09e-01 0.99993
320701 CACATCTGTAATGTGGGATTGATTGTATGTATTAAGAAATGTTGACAGTATACTTGCTGC 0.57783777 1.09e-01 0.99993
71638 GGTGTCTGCGGTAGAGATGATAATAGTAAACCCTACAGATTTGTTGTTTCTATATCCTCC -0.16611703 1.09e-01 0.99993
52064 TAAAACCAGCACGATTGCAATTCTCAAGTTTGTTCATAGTTTCTTCCATGACAGATGTTT -0.1385822 1.09e-01 0.99993
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.47453483 1.09e-01 0.99993
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.47215518 1.09e-01 0.99993
19650 ACACTGGAGGTTTAGCCTTCTGAAGAATCAGGTCGCTAGTGTTCACCTTTTCTTCTGTGT 0.25935533 1.09e-01 0.99993
245468 GCTTTCCTAGTGTACATCTAGGCCAGCTGCCTGCTGCTTGTTCTCTTGCAGATGTGTGTG -0.21665969 1.09e-01 0.99993
239570 TTGTCTGTAAAAGCTGGTATGTGTAGGCTTTCATGAAAGAAGGCATGCATCTGCCAGGGA 0.15027289 1.09e-01 0.99993
66932 CAGTGCCTGCATGCACCTTGTCATCTGGAAGATCCGAGAAGATGCCAAGACCAAGCGATG -0.14044904 1.10e-01 0.99993
73300 TTTTTTCTTGGAAGACTTGGATCTTTCTGGGTGTCATTAATACTGCACCACATAGCATAT -0.31239408 1.10e-01 0.99993
70450 CACCTGCCACCTAGAAATGTTCTCAGAGAAAATAAAAATAAAACATTATCCACTGCCCTC 0.45026559 1.10e-01 0.99993
13094 CAGACAAATTGTCAAAAAACAGCAGGAACTCCTCGACTACATTGCCCATAGTGTGGAGAA -0.15462614 1.10e-01 0.99993
240832 TTTTTTCTTTGACTTTTAAAAAATCTTTCTAGTCTGAACTTTGATAAAACTAACAATTGG -0.19733054 1.10e-01 0.99993
20965 TAGTCTTTAAGAGCTTTATTCTGAAGTCATCATTGCTGTGAATTTAGTGGCCTTATTGTG -0.49584574 1.10e-01 0.99993
67005 TAATCTAGGTGGGCAGCTTGTATCATCGATTGACTCTGAAATTATTGTGTGGGTATCTTG -0.1651261 1.10e-01 0.99993
228829 GTACATATGAGTGTTGCTTTCAAGCAATATTTGCAAAACATGCAAACTTCTGTATCTGGA -0.19051414 1.10e-01 0.99993
22784 GAATTTGAACCCGTAAGGGACACCTTGTTGTCCGTGCCGGGAGTCCGAGCAACCCATGAT -0.56569005 1.10e-01 0.99993
240087 CTGTGGGGAGTTGAAAGACTTGGAATCAGAAAGAGGAAGTGATTGTACATAATGCAGAAT -0.2023361 1.10e-01 0.99993
16855 AGCACCTTTTCGACTTCTCCCATCGGTTCCAAGCATTCCAAATGGTAGACACGCTGGAGA 0.36704298 1.10e-01 0.99993
74148 TTCAATGCAGAGGCCTAATTGAAGACACGAAAGTAAAGTGTGTAGGCATCAGCTCCAGCT -0.12887127 1.10e-01 0.99993
104086 TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA 0.24001029 1.10e-01 0.99993
103220 TTGATCTTGATCTTGATACTGACAGTACTATAGCAGGTTCGGGGTTAGACTCCATTCTCA 0.15897964 1.10e-01 0.99993
230233 ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT -0.11098397 1.10e-01 0.99993
223453 AAATTTTTTGAGCAATTTAGTACCCCAGCAGTGGATTTACAGTAAGCAGAACCCAGGCCA 0.20638762 1.10e-01 0.99993
229714 TAGGGAAGAAAATAATCTACTAAATAAAACTGGGCAAACAGCTTTTTCCCTCTTTGGCTT 0.1455294 1.10e-01 0.99993
791260 CATAGCACAGGCACACATGTGATATACATACATACAGACAAAACACTTTTAAGCATAACA 0.13563474 1.10e-01 0.99993
319713 AAATGTCCCCCCGGCCAGATGCGATCATTGAAACTGCCTCATTGTCACTGGTTAACAACT -0.23321266 1.10e-01 0.99993
101320 CGCCACCAATTTGTATTAGAGAAGGCACTTTGATTGTACAATACTTCACATTGCTTTTTT 0.38357366 1.10e-01 0.99993
19934 GGAGGAAGACGAGGATTAGGACACATTGGTCTGCAATGTTTTGTATTAATTCATAAATAA 0.15116634 1.10e-01 0.99993
75953 CTTAAGATGGGCATTATGCTGGTAGATAACATGTGTCAAGGTTTCAATTAAAAGTAACTC -0.12247781 1.10e-01 0.99993
545443 TATGTTAAACCCCTTGATCTATAGTCTCAGAAACAAAGATGTCAAGGAGTCAGTCAGAAA -0.14108644 1.10e-01 0.99993
54204 CGCTCTTCCCGCGTTCCAATTGGGTTTTCCTATTCCTCCAAGTTCTCCATCTAATAAAAA 0.32853668 1.10e-01 0.99993
71791 GGAAACAAATCCTATTAGACCATCATCATTGCTCTTTCTAGCTGCGTATTCTTCCTATTC 0.15889345 1.10e-01 0.99993
14812 TTTACCTCAGTATCTCTCATTTAAATGCCAACTGAAGGCCTTGTTTTCTTTCTAAAATGA -0.26453289 1.10e-01 0.99993
74386 GATCCTGCGAATTGGCTTTGCATATGAGTTATTTGTGTTATTGTTTTAAAGAGACTAGAC -0.15549398 1.10e-01 0.99993
99899 ATGAATTCATTAAGAGAGTAGTGAGAGAACAGGGAATGAAGAAGGCACAGAGACTGTGCC 0.85498705 1.10e-01 0.99993
258766 TGATCGGCTTAACAGAAAACCCTAATTGGCAGGTTCCTCTCTTTTTTCTTTTTTGCATAG 0.12284841 1.11e-01 0.99993
16525 CCTAACAAACTCAAGAGAAAATCGGTACGATATTCTGTTCCTGTATACATTTCTACCCTC -0.20655247 1.11e-01 0.99993
13542 CACCTAGCCACTGTCTCAGTCTCAGTGGTGGGTGACAGTGAACACAAGAGCTGCAGAGCT -0.16244179 1.11e-01 0.99993
17897 ACCTGTGCTTGCCTTTCTGTATCCACCCTGTGGCCTTATGAATAAATGGTTTCCTTCCTT -0.15795336 1.11e-01 0.99993
93883 CAGGCTGCTGCTGAAGAAAGAGAAAATGCTGTTGTGCGCAATAGCGTTGAATTCTATTAG -0.22389361 1.11e-01 0.99993
69469 CGGTCAATTCAGAAAATAGTGATGTTTGTGATCACACTCTACCAACTTTACAAGAAGGGC -0.2399201 1.11e-01 0.99993
100042840 TTTCCTTGGAGAGGGAATCTATTCTAGACGCCTGAGCTCTTCTGCACTTGTATTCCTTGT -0.14806331 1.11e-01 0.99993
19777 TGTTGTGAACTTCCTGGTTTAGATTGTGTATAAAATGTCTTTGATTTGTGTATAGGCCAC -0.15502205 1.11e-01 0.99993
67014 TAGGCATCCCAGACTCTGATAAAACGATACTTCGGACAAGTTTATTCAATGCAGTGTTGT 0.16401619 1.11e-01 0.99993
13003 TTGAGAACCAGACATGCTTCCCTCTCCCTGATAGCAGATTTGATGCCTACTGCTTTAAAC -0.22573814 1.11e-01 0.99993
330812 AAAGATCATCATGCAATCTACAAAGAGAAGGTCCAGTCTCTGCAGTGCTGAGGTACTGAG -0.6153323 1.11e-01 0.99993
208092 CGGAAACTTCACCCAGGAGGATGAGGACGCCATCCTGGAAGAGCTGAATGCAATCACTCA -0.13913743 1.11e-01 0.99993
19188 CCCGAAGGGTGAAGAAAAGCCATCGATGTACTGAGCTAAGGATTAGAAGGAAAATAAATG 0.48830412 1.11e-01 0.99993
50927 GGGGGGAGAAAGTGTGTTATTTTCTGTATAGAAAGGTTACTATATGTCAATAAGTGGAAT -0.15037279 1.11e-01 0.99993
16616 ATCTCCAGTGTGGGTTCATCAAGCCCCTGCCTAATGAAAATTGTGCCAAAGCCTACATAC -0.13799773 1.11e-01 0.99993
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.13551307 1.11e-01 0.99993
71835 GTGACTCTCCCCAGTATGTTTACTTATACTTGTTTGGTAGATACTATTATCTTTTTGACC -0.14839069 1.11e-01 0.99993
215690 ACTGCCTCAGACTACAGAGAGAGTGTCTCTGTGGTAACTATGGATACCATCGAGAATTTT -0.17474663 1.11e-01 0.99993
76178 TTATAGAAGATCCATGGGACTAAACAACTATGGGCTAAGAATGTGTCTGGGGAATTACCT 0.27675427 1.11e-01 0.99993
16898 TGATTTCTTCCTGGGTGCTTCCCTAAAGGATGAGGTTCTGAAAATCATGCCAGTGCAGAA -0.36093873 1.11e-01 0.99993
71349 AGTAAGAAATTTTAGGAAACGTTCTTAAATATGAAATATTAATAAAAAGAAAAAGAAATC 0.12971587 1.11e-01 0.99993
17721 ACTTGATCTGGTTAGAAAAAACCATCCCAAAATCCACCTCAACTCTTCACACAAACATAA 0.14137544 1.11e-01 0.99993
12479 TCTGGGGATGAAGGAGAGGAATCCTGAAGAAGTGAAGAGCAGCCAGTACGCTCTTTTCAA 0.15361083 1.11e-01 0.99993
107094 AGCAAAGGTGACAGCATTGAGGAGATTTTGGCTGACTCTGAGGATGAGGATGAGGAAGAA -0.14235651 1.11e-01 0.99993
218503 GGCTTCTTTGGATGAACTGAAAGTATCCATAGGGAATATAACATTGTCCCCAGCAGTATC -0.14138964 1.11e-01 0.99993
18519 CACCAGTGTCTATGTGAACATTTCCCATTTGCACTTCCAGAGTTTTGTTTGTCTGAGGTG 0.23588258 1.11e-01 0.99993
329972 ACATAGCTCTGACAGCAGAAAGTGGCTTAGCTCCATGCCAGCTCGAACCCACTGACCCTC 0.23341164 1.11e-01 0.99993
434179 TAAAGGGCTGCAATATATGTGCCGCCACTAGATAGTGCTAAACCTCTTTGTGCACAGCTT -0.20510059 1.11e-01 0.99993
70769 TTCGAAGTAAGCTTTTCTGACAGACATTTTGCAACAACTTGACTGTTGTATATTGACAAG -0.2546171 1.11e-01 0.99993
320684 ATTTCATATGAATAAATATGTGGGGGCTTACACTAAAATTCAGATCCCCTCACTTACTCT 0.16964673 1.11e-01 0.99993
434123 AAGTATCCTTCCTTCAAACAACGCCAGGAGCTGGCAAAAAGCGTTTGTGTGATGGAATAC 0.13519234 1.12e-01 0.99993
544696 CTGGACCACTCTCTGTGAAAAGCTGACCACATCTCTGTCTGATCCAGATCCTATGTTCAC -0.16006093 1.12e-01 0.99993
68058 AGTTTGGGTGATGTCCTTCTATTTCCTATCGACGATAAAGAGTCACGAGACAAGGGGCAA -0.1133476 1.12e-01 0.99993
11799 TGCTGATAATTTTGTCCTGATGAGTTTTCCTACCACGGGGTAACGGAATAAAATCACTTG 0.37826394 1.12e-01 0.99993
74411 TCTGAAGATCATTTTTCATTATAACATTCAGGCCAGACACTTGAAAGTGACTGTTTGTTC -0.11470216 1.12e-01 0.99993
18726 AAGAATGCATCTTTCTATGTTCTACACTCTGGGAAATATATCTGATGACCCAAAGTTGTC 0.43718049 1.12e-01 0.99993
74376 ACTTCCTCTGCCCCCCAGCCTTCTATGCCTGAGAAGACTAGGACTAGGGGAGTTGGAGAT -0.12492029 1.12e-01 0.99993
102954 GGACATAACTCAAACAAGATTGGCCTTTAAGATCATCTAAGCTCAGTGATAATTAAACGA -0.14096953 1.12e-01 0.99993
83674 GAGACGTCAGTTTGGGCTTCCCGAGTCTATAAGCTTGCTTCAGAAGAGGAGGTTCAGGGG -0.17232108 1.12e-01 0.99993
73660 AGAAATGGACCTCAATGGGGATGGCACCATAGACTTTGACGAGTTTGTAATGATGCTATC 0.16238675 1.12e-01 0.99993
208777 GCGACATCTGCCACCATGTGTATAAGAAAGTCTACAAAGTTCACCAGGACGTGTGCTTTA -0.14526074 1.12e-01 0.99993
102644 AACTTGAATTCCAGATTTTTAATGCAAAATATTTATCATTTGTACCAGAAATAAAAGTCT -0.17092758 1.12e-01 0.99993
76453 ATTTATTGGCTATATTGATACCCATATAAGACTGTATCTTACAGTGCACAGAATTCCCAC -0.25898033 1.12e-01 0.99993
226564 TTCTTGAATTGGTACAAGGTAAGCTACCGAGAAGATTTCCCCCTTACCGATTACTGTGGT 0.12687351 1.12e-01 0.99993
26874 CAAGGAAAATGAAGTATAGCTCCGGCTATCAAACTACTTATCTTTTCCTCAGAAAAGGTG -0.21641085 1.12e-01 0.99993
626359 ACTACCTGCTCTTGAAAGATATCTCCAAAAAGTGTACCATTTCTCAAATGGCTGTGAACT 0.1813796 1.12e-01 0.99993
330097 AGCCCACAATTAATTATTGAAGTCCAAGGCCTAGTGAAGTTGTATGGTAATCCAGAGAAT 0.31881471 1.12e-01 0.99993
12927 CACACCTCTGCACCAAGAAAAACCCTAAAGAACTATTTTTCACTATTGATTTTTCCAATC -0.13975893 1.12e-01 0.99993
258742 ACCCCCTGATTTACAGTCTTAGGAATAAGGACGTGAAAATTGCTCTGAAGAAAATGATTG 0.10271848 1.12e-01 0.99993
258937 CTCTTCATTCTCATTGTTCTCATCTTTCTGACAGCTTGGATTGGTAACCTGTCCATGATC -0.13097252 1.12e-01 0.99993
67115 CAGGGGGTACCATGACAGTACAACAGTGTCGTTAACCCTAACAAATAAATTTCCCACCAA -0.1476674 1.12e-01 0.99993
230935 TAAAAGCAGTTCGATTCTGTAATATTTATTTTTCTTTTTGAGGATGTTTCGTTGCCCCGC -0.13524277 1.12e-01 0.99993
68484 CTGGAGTTTATGATGTGACCTTGTTGAAGATATGCCCTTTAATGACCTTCAAATATAAGA -0.09221918 1.12e-01 0.99993
15978 CTTCCCTATACAGCTGAAAACTGTGACTACACCCGAATGACAAATAACTCGCTCATTTAT 1.26612956 1.12e-01 0.99993
70575 CTTCAGGCTGAGTTGTGGTCTCACAGGATGAGAAAACCCAACAGGAACTAGCTTGGTTGA -0.09942175 1.12e-01 0.99993
12566 GAAAAATAGGCCTAAGCCGTTTGTACCTTAGTTTTAGCGTTCGGCCTCACCTAGCAATCA -0.11966122 1.12e-01 0.99993
13041 AGTAAAGAAGGCACGGACCTCTTGTCCTCCCTGAAGGCAGCAGCCACTCTTCTGCTTCTC 0.67330374 1.12e-01 0.99993
230233 ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT -0.11999448 1.12e-01 0.99993
114679 TCCAAAGCAACGGAAATGGGGTGTGTGGGGGGAATCTCAATCCTCCCTTTCCTCTCCCCA -0.13905747 1.13e-01 0.99993
14675 TGCCTTTCTGGATACTAAGAATACACTGTTCTACCCTGAACACCAACGATGATGTGCTTC -0.23278119 1.13e-01 0.99993
20686 CAAGTTGAGAAATGTGAACAAGAATTAGCTAAGTCATCTGGAAGAGAAGAAACACCAGTC 0.24705902 1.13e-01 0.99993
68566 ACCAGCTACTTTGACATGCACACTGCCTGACGCTTCTCCACCCAGTGATTGTGCTCCTGT -0.15397486 1.13e-01 0.99993
232664 AAAGCCAAGAAAGACTTGTGTAAACTAGCTACTAATCCAGCAGCAGATCCTAGGGCAGAG -0.12550132 1.13e-01 0.99993
23918 AAACGGCTTTTCTGAAAACAGATCCAGTATATGCCTTGAATTTTTCAATAAAAGTTTGGG -0.12398716 1.13e-01 0.99993
12315 TGTGTTCAGTTCAAGCTGTGAAGAAAAATATATATCAATGTTTTCCAATAAAATACAGTG -0.349199 1.13e-01 0.99993
71059 GTTGGATCTTTAATGTCATCTAACTTTTTACACAGCAATTAAACAACCTTGTGAGAGCCA -0.16591417 1.13e-01 0.99993
19133 CTAGACCCATTTCTAACTATGCTGTCAACCATCGTATTAAGAGATATTAAAAACTATATT -0.18630297 1.13e-01 0.99993
434794 GAGGCATCAGAAAAACTTTACTGAGAATGTTTTGTTTGTGGAATTTATCGCACATGTAGT 0.61004814 1.13e-01 0.99993
76898 ATGGGGATTTTTACTTTTCACGTTTTGGCAGATGCTACTTCAGTTGTTTTCATGTAATGT -0.1972652 1.13e-01 0.99993
258173 ATTTACAGCCTGAGAAACAAGGATGTGAAAGGGGCTCTCAAGAGAATAACTACAAAATAA -0.24785211 1.13e-01 0.99993
114615 TATGACTGACTCAGTGCCTGGAACATCAGAGGCACTCAATAAAGAGTGTTGACTGGATCA -0.14238716 1.13e-01 0.99993
12006 TCCTGGGGGAACAGATTATTATTGCTACTCCAAATGCAAAAGCCACCCGAAGGCTCCAGA -0.12084688 1.13e-01 0.99993
112408 ATTCAACCAGAGTAGTCTCTGGTTTGCTACAAGTCTCAGCATCTTTTATTTTTTCAAGAT 0.12648926 1.13e-01 0.99993
100040235 ACAGTGATGTGTTGATAGGTAACTGGGTGCAGTACACCAGAAAAGGTGGTACCAAATGCT -0.17745488 1.13e-01 0.99993
319984 CTGATCCCTGGGACTAACTTTCCCTCTGGGGACAGAAAGCTGTACAAGAGGGGACTGTGG -0.15326937 1.13e-01 0.99993
66855 GTCCAGTCAGCCACGGAAACACAATCGCCCTCTTCTTCCGGTCCTTGTTGCCAAATTACA -0.10943974 1.13e-01 0.99993
272636 ACGGCTGGGTGAGATTCAGCTCACAGTGCGCTATGTGTGTCTCCGACACTGTCTCAGAGT -0.1301923 1.13e-01 0.99993
228413 CACAGTTTGTTATTAGTAGAATAATTAGAATTAGCCAACCAGGAACTGTCCGATCTTAGA -0.11680375 1.13e-01 0.99993
245670 GAGAAGAGGACTTAAGGCGTTTATCGCGTCCGCTAGAATGTTCTTGTTTCCGAACATCTA -0.1572439 1.13e-01 0.99993
258645 AGAAACAAAGAAGTCAAGGATGCCATTTACCGTGCTATTGGGAAAAAACCTCTTGCCTAG -0.18145793 1.13e-01 0.99993
17158 TAGAAGACATTGTAATTATCATCCCGTGTCTTTGCTGTACTCGTGCTGAAGTGTTTTCAC 0.31075266 1.13e-01 0.99993
65945 CTGGGACCTCCAGAGAAGCCGCACTGAGCGGACTTGTCGACAGAGGGTGAAAAATTACTC -0.10407577 1.13e-01 0.99993
546524 CAGTTGGTTGCCAGCCAGACATATAAATAATATTATACAAATTGTGCAGGCTGTGTTTAT -0.21205675 1.13e-01 0.99993
78826 CACCAAAAGGAGGAATTAAAAGAAAATTTCTTGGTTTTGGGGGAATGAGATAGTTCTGTA 0.78436983 1.13e-01 0.99993
16421 ATTTTTCAGAGTGACCTTCAGAGGGCAGCAGCCATTCCCACCACACGAAGGGCTGGTCCT 0.972244 1.13e-01 0.99993
78911 TAACACCAGATGGGCGTGGGAAGAACCGGGCTAAGTGGGGACTCCTGAAGAACATCCAGT -0.19052886 1.13e-01 0.99993
106504 GTATGTGCTGTAAAGAGAATTTGATTTCCCCAAGTTGATCAGAATGAAGGGGAAAAGCAG 0.35532902 1.13e-01 0.99993
101540 TGGAGGGGCCAGGGAAATAGACTCTTCCCAGGGCCATGATCTTAGTCCCTGATGCCTCAA -0.25975139 1.13e-01 0.99993
66753 GATTTGCCATACACTGTGAATTCTAGGCTAATCTAGAAAGAGTGAATGAGATGAGACACT -0.17700353 1.13e-01 0.99993
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.37396437 1.13e-01 0.99993
347740 CTAGGTATTAAAGAGGTTGCCAATGTATGACAAAAGTAGTTAGTAAACTCACACATTCTG -0.27990547 1.14e-01 0.99993
18407 TTGTCGACTGGAAAAAGGACAGGTGCAGTGAACAGGAAAAGAAGCATCTTGAGTTGGAGA -0.43187884 1.14e-01 0.99993
20973 GGATGGCCCTGCCCTCAGATTCTATAGACTAGTTTGGAGATGGAATAAACGGTTTTTCTC 0.46858552 1.14e-01 0.99993
18127 GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA 0.26850621 1.14e-01 0.99993
67733 GAAAGACTGTCACATTTGCAACCTTTCTTAAAAGACGATATGCTGAGTATTCTAAATAGG 0.12144498 1.14e-01 0.99993
100637 ATGATGCCTTTTAACGTGTTATTAATTAGTAACCCAGTTATTTAGGAGTGCAAAGCAAGG -0.10910251 1.14e-01 0.99993
434423 CTGCGCATTCTGATGTGAATCCCAAGGTTACCACTCTAAATAAAAAATAAAATTGAAGTG 0.41956662 1.14e-01 0.99993
213573 GAGCTAACCTCAGAGTAGTCAAGGCCTTCAGTCCTTCAGTCTTTATCCTGTCTTCCTTTT 0.16931978 1.14e-01 0.99993
98376 AGAAACGTTAGGGATGTCCTATTTTTAGACTATTGTCTAAGACATCTTCTGATAGTAAGG -0.12925234 1.14e-01 0.99993
16780 TGTATGAACACAAAACCCAATAAAAATCTTTGAATAGGAGCCTGGAAGCTCAAGAAGAAA 0.41122648 1.14e-01 0.99993
20848 CACTCTGTGAGCTGATACCCCAGGCTGGGAACTCCTGGCTCTGCACTTTCAACCTTGCTA 0.29093617 1.14e-01 0.99993
230935 TAAAAGCAGTTCGATTCTGTAATATTTATTTTTCTTTTTGAGGATGTTTCGTTGCCCCGC -0.13342349 1.14e-01 0.99993
76421 CAGACTCAGGAGAGTGATCACACTTTTTCAAATGGAGGATTAGTTAAACTTATTAACTTG -0.24569241 1.14e-01 0.99993
20510 GTTCACAAGATCATTGGGGTCATCTTGTAACCAGCCACTTCACACACTGTGCTGTTAACT -0.14442594 1.14e-01 0.99993
15493 TGAAGTATGGACACTATGCCCCTCCTTAGATTTGGGAACAAAACACCCATGGAAGGAGTT -0.22904501 1.14e-01 0.99993
216233 AGGTGTGAAGATGTAGCTAGGTATTTTAAAGTTCCCCTTAGGTAGTTTTAGCTGAATGAT -0.26635727 1.14e-01 0.99993
19260 ATGTGACAAACTTCCAGCAAACTTGTATTTTCATATTCCTTATATTTCACTGGGAACTGC 0.5561357 1.14e-01 0.99993
77058 GATTATTGTGAGGGAAAGCTTATCTACCTGGCTGAGCGCATGCAAACGTTGTCCAGAAAT -0.1110215 1.14e-01 0.99993
791299 ACTGTCCCTATGTAGGTTGAAAATCAGCCGTAGCAGCCACAAGACTGATAAGATCCCTAA 0.14664513 1.14e-01 0.99993
12365 CTGCCTCTTGCACAATGAAATGCTATAATTACTTTCGATTGGTGTAATGAGAATTCAGTA -0.23913707 1.14e-01 0.99993
109880 GAAGCTGTGCCCAGAAACCAGGCTCAGGGTATTGTGAGATTTTCTTTTTAAATAGAGAAT -0.12535916 1.14e-01 0.99993
53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT 0.61193083 1.14e-01 0.99993
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 0.72814516 1.14e-01 0.99993
67106 AATGGAAAACTAGTGAGTAGCAGTGGTCTCTAGATAATGAATTCCTCAGTTTTTGAGGAG 0.13463265 1.14e-01 0.99993
74517 TACTGATATTCGTCATTGGAAAGAGTAAAAGTGACCGATCCAAAGCTCTTAGATCAGTGA -0.2255616 1.14e-01 0.99993
70552 GGTATGCAGAAATGTGCTTTACTTTGCAAGCAATGGTTGGTTCAATAAATTATGAAGTTG -0.16773421 1.14e-01 0.99993
269717 GTTTGTCTTGCTAAAGAATGCTATAATCCTGGGTGGACAAGATGGCTCAGTGGGTAAAGG -0.39493401 1.14e-01 0.99993
69392 TATAATCTATAAAAATAGTCATAAAGTAAAACGCCCCCCGCTGCCCATCGCGGGCATGAC -0.11996354 1.15e-01 0.99993
212518 TGGCTAGACTGTGAGCCCCTTCCAGTGATCCTCTTGGCCTGTACAAAGTTGAGCTACAGC -0.38938007 1.15e-01 0.99993
66813 TACCTCTAAATGTTGAGAACGGAAACCATCCTGTTGCTACACCAGTGGAAGCATTCGTTC 0.75255705 1.15e-01 0.99993
12235 AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA 0.18817428 1.15e-01 0.99993
338362 AAATAAGTGGACCTTATTTTTTCTGTTATTTTGGTAGCTGGAAATTAAAGACTTCCTTTC -0.26535976 1.15e-01 0.99993
232790 TCTGTAATGTAAAATGACTTGAACTTGAATAAATGTTCCTGCCTCAGCCTCTTGAATACC 0.37950122 1.15e-01 0.99993
54160 TGTGGATGTTATCTTGGCTTCTGTGGGATAAGTTCTTGCTGGGAAGGGTGATGTTGCTAT -0.16253888 1.15e-01 0.99993
23989 GGAGGGACTTTATAGGGCCACAGTGTGTATATAAGTTTTATTTTTATAACCCATGAATGG -0.12258797 1.15e-01 0.99993
67808 GTGACCTCAGATGCACCTGTTTTCAGCCTGTGCTTTTGTTCTAGTAAAGACATTTAAACC -0.10451979 1.15e-01 0.99993
258731 TTGAGGAACAGAGATGTTAAGGAAGCGCTGAGGAAGGCAACTCTTAGAATATATTCATAG 0.13998019 1.15e-01 0.99993
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 0.7782218 1.15e-01 0.99993
258962 CCTATATCAGTCCTGCTTCCAGCTACAGCCCAGAAAGAAGCAAATTTACCTCAGTGCTAT -0.34633645 1.15e-01 0.99993
19212 TTGGAATACGATCTCTTTGGTACGGAACTCCTTAATTACCAGTTGAGCCCAGATATTGAT 0.1456723 1.15e-01 0.99993
11814 AAGCAGGCCTGAGGTCCAAGGCTTGTCCCCTGTCTTTTCCTGTCTCACCGACCTCATCTA -0.13577579 1.15e-01 0.99993
100189605 GCATCCCCAGTATAAATTCTGTGATCTGCATTCCATCCTGTCTCACTGAGAAGTCCAATT 0.17366095 1.15e-01 0.99993
630537 TAATCCTTCTGCTTTAACTCAGATAGTCTTTACAACCACTCAGCCGCGCCTGCTAATGGT 0.14342516 1.15e-01 0.99993
100043726 TGTCCTCAGGGGAAAGCTATTTTAGGTAGCAGTCAAAATAAAACTGAGATTAACCCAGAA 0.19803827 1.15e-01 0.99993
234413 TTCAAGTCCTAGAAAAGGTGAAAAGGACCAACTGCTTTAGGTTGCCTTCTGACCTCCACA -0.10812121 1.15e-01 0.99993
99045 TGCTCAAGCTGCAGGAGGAGGCAAAAAACTTCATCACTCGGGAGAACCTGGAGGCACGGA -0.11846264 1.15e-01 0.99993
268709 TGAGGTTTTATGCTGAAGATGTGTTTCCTAAATAAAGAAAGGGTTGGGGGTTGTCACCCT -0.31481288 1.15e-01 0.99993
208098 GACAAAGCCATAAGTTGAATCTTTAGGAGTCCAATACGCTTTTTATGATATAAACTGAGG -0.15793358 1.15e-01 0.99993
385454 AAATCACAGGCAAGCATCCTGGCTTATCCATTGGTGATCTTGCAAAGAAACTAGGAAAGA -0.21235811 1.15e-01 0.99993
380997 GAGAAGGCCAAGGGAAATCCTGAGAGCAGCTTCAATGATGAGAACCTGCGCATGGTGGTA -0.16556885 1.15e-01 0.99993
14299 CCTCCAAGATTCTTTCCAGTGTGTTTCTGCATTTACATGATCTAAAGATGCATGGGGACG -0.17185602 1.15e-01 0.99993
232493 GAGTCACCTTACTGTAACGGTACTTTTGTTGTCTAATTGGAAATTTCAATCTGTTAGAGA -0.26508302 1.15e-01 0.99993
104027 CGCTGCGAGGCTGAACTCTTTGGTCCTGCCTCCCGTTCTCAATACACTCTGTCTCAAATC -0.18571009 1.15e-01 0.99993
227682 TTGTTGGTGTCTGCAGTGTGAACACTAACAGGCTGATGATTGTTGGTGTCTGCAGTGTAA -0.13570913 1.15e-01 0.99993
230761 TATGGGACCTCCAGGCCACCATATTTAGAAATAGTTACCTTATTAAAAAAGAGAAAAGAG -0.12114645 1.16e-01 0.99993
76487 AGATTCGATGTATTTTCTTCCGTGATTGGATACAAATGTCTTTTAAGAAAGTAAAGGCCG -0.38195776 1.16e-01 0.99993
16407 ATAGGACAGCAGATATCACTGTGACCATCTCCAATTCCAATGAGAAGTCTTTGGCCAGAG 0.27792356 1.16e-01 0.99993
80913 ATCAGATTGGATTTCTGGTGAAGCACAGAATGCCTGTATATGATGTAACTGTGTCCCCCC -0.12663091 1.16e-01 0.99993
381318 TGAATTTGATGAGCTCATAGTAGATGTGGCAACCAAACGGAGGCAGTATCCCAGAAGGAT 0.11479582 1.16e-01 0.99993
98970 ATCGAAAATCTTTCCAAGCCTAGGTTGGCTTTGTGGATTCTACCAAAGGCCTCATAGCTG -0.92639126 1.16e-01 0.99993
545884 AAATTTTTCCGACCACGAGTACCTAATAATTATGTACCTTTTTGGCTTGGGCCCCGGAGA -0.14238075 1.16e-01 0.99993
20775 TGATTTCAGTATTTGGGGTGACTCATTGGGACAAGCCAATAAAATGAAGAGTGAACTCTT 0.14184175 1.16e-01 0.99993
327766 CAAAGATGTTTATTCAGGAAACTTCCTAAATTGGAGGCAACCATTAGACAATCAGTTGGG 0.18610728 1.16e-01 0.99993
170643 GCTTCTTGATTGAAGACGCCCATGAGAGTCGCTATGAGACAAACGTTGACTATTCCTTCT -0.12351299 1.16e-01 0.99993
68170 TGGGTTCCGGTACAAACGTGTGCGAACTCCATGACTGATGTCTCTGGGTTTAGTTTTATT 0.11559625 1.16e-01 0.99993
12307 GAAGTAGCAGTTCCTGATGAGGAATAAGGGTGGGGTTTCTGGATTCTTGGCAACATTCTA 0.44903307 1.16e-01 0.99993
381569 AAATGCTCCAAGTGTGGTGGGTCCTATGTTTATGATCTGGAGACCCAATGTTGCTTTTTT -0.18583644 1.16e-01 0.99993
626391 TGAATGTAGTCAACTTGATTAAGACTTTGCATATCAGAGTCTCCTCCTTTTGTATGAAAC 0.29981411 1.16e-01 0.99993
57265 TCACAGTCTACATGATCAAATACCTCATGACGCTCATCGTGGGCATCACGTCGGGCTTCT -0.38737122 1.16e-01 0.99993
67495 CTGTGCACCAGGGTTAGATGAACCCAGCTCCTATTTTATAGTGGAATCAGCACCTTTTTT -0.10657167 1.16e-01 0.99993
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.33704681 1.16e-01 0.99993
12181 CTGGAAGAGGGTGGGTGTGCCTCCACACAGAATCCTCAATAGAATCCCATTCTTCCTGTC -0.12504345 1.16e-01 0.99993
235606 GGTGGAATCAGACAGCTTCATGAACACTGTGCTTTGGCTACACACACACTTGGGCAGCTG 0.17488088 1.16e-01 0.99993
12165 AATCAGAGCCGGAAGGACTTCAAAACATCTGGACAACTCTCATTGACTGATGCTCCAACA 0.17621391 1.16e-01 0.99993
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.18475067 1.16e-01 0.99993
67328 AATCTACACTCGATGTAAACTGGCAAAAATCTTTGCAAAGGCCGGCCTGGACAATTACGG 0.18020973 1.16e-01 0.99993
58182 ATTTCCCAGAAAACACATTTCAAAGGACCATTTATGTATTCTTATTCAGCATGCAACAGG 0.13206085 1.16e-01 0.99993
108797 CCACTCGTTTATGTATATGTAGGTGACGTTACTTGAGCTTAAATGTACTTTACTGAGCAA -0.28683173 1.16e-01 0.99993
69894 TGGTTTCCTGGAATGTTTTTAGGGGGCATAGGGCTTCGGCTAAAAAGCACAAGCAAGAAT -0.12143485 1.17e-01 0.99993
258915 CTTGTGGGTCTATGGACGGGGCCCTACCACATTCCCTTCACACTCTGCATGACACAACTC -0.1328746 1.17e-01 0.99993
66871 TGATAGAGATACATTTTCTAAGTCGGATCCAATTTGTGTCCTATATACACAAGCAGTTGG -0.1405847 1.17e-01 0.99993
67917 GTACTGGGCCCAACGCGGGATAGACACTCTTATCAAGTCTTTCATTGAATCAAAACGGTA -0.1750384 1.17e-01 0.99993
75512 CAATCTACAGAGATCCTAATCTATCATTCAAAGCACTGGCCGGTTAAAAGAAGTGGGGAT 0.55778878 1.17e-01 0.99993
107766 CTGTCCCCATGTGCCCAGCAGCCTGACACTAAGAAATCTCTCAATAAAGGCATCCTGCTG 0.23647551 1.17e-01 0.99993
234463 CTTCTGACCTATCTACGGACCCTTAAAGCTGACATGTTAGCTCAAGATCTCTGTGCAGTT 0.10816046 1.17e-01 0.99993
67392 TCCTTTAGAACAACCAGAGAGAATCCGTCAACGGACACACTTTGTTATTAGCAACTACCG -0.27633981 1.17e-01 0.99993
71904 TCACTGTTTCCTGGGGCTCCAGGCTTTAGAACCGTTAGGAATTGTCAAGGAAAACTCAAA -0.20741342 1.17e-01 0.99993
66701 TAATAAAAGCAGTATTTTGGTTTGAGGAAAACCTGGTGAAACAGTTGAATATGTATGCGG 0.11713584 1.17e-01 0.99993
53324 TCATGTGCACTTTCCGTCTGAGGGAACTGCAGCTGCTGGAAGGCCAGCTGCTCAGACAAT 0.33240448 1.17e-01 0.99993
103406 GGAGTCTGTAGAATCATCCAGAACTTGGCTAGGGTGGGGAATAAAGCAGATCTGCCCGTG 0.11620286 1.17e-01 0.99993
75785 TGCTAGGCATCAAACAGCACTTCCAGGTGTATAAACTAATACCAGAGATGTTTCAAAATA -0.14095381 1.17e-01 0.99993
50913 AAGAACAACATCAAAAAGTTGCTGTGAATATAGTTTGAGCTTTTTGGGAGGGGGTATTCT 0.28668722 1.17e-01 0.99993
67223 TTTTTTCTTGAGCAGTAAACTGCAATTTTCTAGGATCCTTTGCTGTGGACACATGCCCAT -0.14006601 1.17e-01 0.99993
78286 ACACTGAAAATACTTCATGGGAAAGGATCCTCACTGTTGAAATATAAAGGGTTTAAATGG 0.14632454 1.17e-01 0.99993
381413 GATACAGCTTTTACTAAGGGGAAAAAACAATCTGTCAGAATATTGTATGTACCTGAGAAG 0.14996679 1.17e-01 0.99993
16582 GAGAGCAAGAGCATCTCTATCTACCCTCCTGAGGAGGGGAGCCCTCACAGGGCATGTATA -0.11951365 1.17e-01 0.99993
70315 GGTCATCCTAGGGAAAACGCTATCCTCTGAGATCCCAGATCATGAGTTTTTCACAGCATA -0.17123254 1.17e-01 0.99993
17961 CTGGTGGTCATGTTGATGTGTGCTAGGAAATACCCAGCATTGGCTTACAGCTAAATTTAT 0.19440787 1.17e-01 0.99993
100043706 CAAACAGGCAGGGAGGGGTAAGGGTAAATTATACATTTTATTCCCAATGTTCAAAATTTA 0.2171737 1.17e-01 0.99993
67392 AGTGTGGAATTGCTACAGACCCAAGACATTGCAGATGTTACTTCTGCGGAATGATTGTGC -0.36231655 1.17e-01 0.99993
116748 AGGAGTACTGCGAGTGTTTGGAGTGAATCACCTCTAACGTCCCGTTTCTTTTTGGCATTT -0.10373278 1.17e-01 0.99993
78416 TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC 0.47919355 1.17e-01 0.99993
23795 GTCAGGAGACCAGAAGGCAGAAGCACTGTGGACTTGCAGATTACAGTACAGTTTAATGTT -0.13936012 1.17e-01 0.99993
18720 TATGAAATATGACCTGAAGGGTTCAACTTACAAGCGGCGGGCTTCTCAGAAAGAACGAGA -0.1716317 1.17e-01 0.99993
208194 TTTGCTTTCTGTCTGCCGCCATAGAAACATATAAACCTCTGGAGACTGCTGTTCCTGTTG -0.14399434 1.17e-01 0.99993
328329 GGTTTACAGACTTTGCTTTTAACTGTCCCGTTTTCTTTAAAGCACAGCCAGCTGCTTGTT -0.25714536 1.17e-01 0.99993
76386 TTCATCAGTTCCAGTCCAAATGTAGCAAGAAGATTAGAAGGCCCAAGGTGCCTACCATGA -0.16472075 1.17e-01 0.99993
13850 TTTTTGAAGCAGCTGATTGGAGAGTAAAGATTTTCATTCAATAAAGCTAAACCTCAGGGC 0.12244961 1.17e-01 0.99993
213765 ACTTTTTCCTCTGTTGGAAAACATAGATCAGGTCACCATACTAGATGTTAAAGATGACAG -0.1280675 1.17e-01 0.99993
73225 CACGTCTATTCACGTCTATTGTGTCTGAAGACAGTGACAGTGTACTCATATAAATAAAAT -0.13306521 1.17e-01 0.99993
72615 AGGAGCAGGACATAGACCTGCGTATCTTTCTGACTCTCACTGAAAGCGATTTGAAGGAAA -0.10339453 1.18e-01 0.99993
209387 ATGTAACGTTTCAGCCTAAATGTGGCTACTGGGTTATAGGGATGAAGAATTCATCTGTAT 0.60325216 1.18e-01 0.99993
230233 ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT -0.11467768 1.18e-01 0.99993
14916 ATCCTCCCAGCATAAATGGATCCTTAGCAAGGCAATGTGGATGCAGAGTTGCCATATTTG 0.19356298 1.18e-01 0.99993
53622 AAACTACTCTAATCACACTTCTTGGGTTACCTCCCAGAAAATAGTTGCTCTCTGGGGAGG -0.15683202 1.18e-01 0.99993
109154 TCCGAGGATCCTCATTATATACCTAGTAGGAAGGACTCTGAACTCAGAGCAGTCACACTT 0.13192752 1.18e-01 0.99993
238690 AAAGTGGAGCTGTTAGACTCTGTGTTTGTCCTTGAAGACTTGGAGCTGATAGTCCTTGCT 0.16843953 1.18e-01 0.99993
77976 CCAGCTGATTGTGTCTGTTTAGTATTCCCCACCATGCAGTTGACTCCATTAGGAAAACCA -0.22634719 1.18e-01 0.99993
74386 GGTATGGAACACGTGGAGAACCTAAAGAAACGGTTGAATAAATAATTTGCCAGAATGCTA -0.13642963 1.18e-01 0.99993
15936 TTTGAGCGACGGTAGTGATGCCGGACTGGTACCAAGCAAGAAGGCCCGTCTAGAAGAGGT -0.16838748 1.18e-01 0.99993
229214 GAGTTGGAGACAGTTCAGCACTTCAGACTATCCACGGGAAAGAAATGTCCAAAATAGCCA -0.12759085 1.18e-01 0.99993
19645 ATTTTCAGAGATCCTGCTTCGAGATTTCTTAAAGCTGCAGACACTGCACTATTGGTTTTG -0.18002984 1.18e-01 0.99993
244425 AGAAACGTTTGTGAAACAGAAGATAGCTATTCTTATTTTTGTTTAACTGGGGCCATTAGC -0.17118597 1.18e-01 0.99993
328243 GAGACCCTATGAGGGTGCCATGGGAGAAGGTATTTTCAGAATAAAAGTTTTCTGTACTCC 0.15297689 1.18e-01 0.99993
71147 ACTATATCAGAATGGGAATGAAATCTAGACAGTGTGATTCTTTTCAAGCTGTGGTCACAC 0.14494394 1.18e-01 0.99993
19288 TGTTTATCTTGGCAAAATACTGAATACACAGTTGAAGGGAAGGCTTGAGAGAGGGCTCCG -0.42488885 1.18e-01 0.99993
238803 GTGTGGTGCTCCTGTTATCTTAATTAGTGACTATTTAGTTGCATTTATGAAGGTTACAGT -0.19013989 1.18e-01 0.99993
116748 AGGAGTACTGCGAGTGTTTGGAGTGAATCACCTCTAACGTCCCGTTTCTTTTTGGCATTT -0.13103445 1.18e-01 0.99993
16519 TTTGGCTGATAAGATAATCCTCCCTATGAAATCTGAGAGGTCTATCCTAGCCTGGCAAAT -0.35924792 1.18e-01 0.99993
68312 ATCAGCTTATGGACAACCGCATGGTGCTGGCGAGGCTTTGCTACAACGCTGACTTTGTGA -0.27033696 1.18e-01 0.99993
13608 CCCACCACTGAATATAGACCATACTGTGAGAGGACCATAATTAGGTCCTGAATTTTTAAT 0.12268862 1.18e-01 0.99993
13019 TACCGCCCTAGGCTGGTCAATGGAGAGAGAAAGGCAGAAAAACATCTTTAAAGAGTTTTA -0.23253727 1.18e-01 0.99993
18507 CTACTCTGCACCGACGCTGACAGGGATGGTGCCTGGGAGTGAATTTTCTGGAAGTCCCTA 0.14959192 1.18e-01 0.99993
71398 ATTCCTATGAATCCCAAGGCACTATTGTATTAATTTGATCAGAGGATGTGATGGAGGGAA 0.26437951 1.18e-01 0.99993
12182 AACCAGACGGTAATCCAGTTGTATTTACACTCATGATTCAAGAAACAAGGCATTCATCTA 0.50104144 1.18e-01 0.99993
14593 CCTTCACTAGTGGCTTTAGTCAAGCACTTAAGTAAGATGTTCACAGAAGAAAATGAATAA -0.16344801 1.18e-01 0.99993
68915 CAAGAAAATGTCCCACCTAGAAGGAACGCTCAGAAAAGCTGACATAGCACATTCTTGGCA -0.21628589 1.18e-01 0.99993
19309 TTTTATGTATGGATGGGGTCTAACCAAGTGCACCCACTCCCCAATAAATCGACTCTTCCT 0.3167028 1.18e-01 0.99993
74080 CTGACTGTTTTAGAAGATCTTTTGAATGTTTTATGACTGCCTGCTTGTTTGAATATTGGC 0.57366096 1.18e-01 0.99993
235379 CCATCAGTAACCACAGATTCTAAACGACCAGCAAGTAACAGTTGTAAGTAGTAAAATAAA -0.49875606 1.18e-01 0.99993
17711 CCAATCACACAAATTTTGTACTGAATCCTAGTAGCCAACCTACTTATCTTAACCTGAATT 0.1378958 1.18e-01 0.99993
20737 GTATTCATGTGGTTACAAATACATACATGTGGGCAAGATACCCATACGCATAAAAATAAG 0.42730459 1.18e-01 0.99993
22051 CCAACATCTACCCTTAGTGTTTGCCATCAAATGCTGTCTTTTCTTCCTCTCTTCATGAAA 0.13481663 1.18e-01 0.99993
18389 TAGCCCTGAACCTGCCTCTGGGGTAATGAAGGAGTTCTCATAATAAACACTTACCAGTGA -0.22539672 1.18e-01 0.99993
103534 GCCTTGAGCGGTTCTTCTTCCGAAGCGGGAACATCGAGCACCCGGAAGATAAGCTCTTCA -0.14936866 1.18e-01 0.99993
258693 ACATAAGTAGTAGATGCGCAGCTTGGTCTTTATGTGGGTCTTGAACAACTGAAGTGGAGG -0.1595872 1.19e-01 0.99993
14688 CTTGAGTAGTGGGATAAGTCACTGTTTTCTTTACAAAACAAAACAGTCCTGTTGGGAATG -0.10437694 1.19e-01 0.99993
22722 TGTCTTAATGGTTACCAAGGCTGATTCCAATGTGGAGTTGGAATTCACCACAGTAGGACT -0.11228764 1.19e-01 0.99993
83410 GTACAGAGTTTTCATTCCTAGGCTATTTTCCATCGACTTAGTTTTTTGTGCTAGTGTTAA -0.16020646 1.19e-01 0.99993
26450 CACATACATAAAATAAACTATGCCAGGTTAATTCTATAGAGTTCAGCCTCTTGTAGAGAG -0.11569774 1.19e-01 0.99993
268807 AAATGCCAGTGAATGCTTTTCAAAAATTCCATCCTTACCCCTTGAATCAATGTCAGAAAC 0.1113459 1.19e-01 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.10739495 1.19e-01 0.99993
22626 ACTTGAGCAGAGGCCATGGTTTAGCGGGTTGGAACTGAATAAATGAGATTTCTGCCTGTA 0.34761218 1.19e-01 0.99993
259067 CGAGAGGTAAAAGAAGCTCTAAAGAAATTGATTTATTGCCAGGTCATCCGATCTGACTAG -0.12186947 1.19e-01 0.99993
242570 GCTGTTAGTTTTCTGTGTCAGCTAATGGTTTGAAATGCTTTTCAAGATGCAAGCTTAATA -0.35491347 1.19e-01 0.99993
406219 TACCAGGAGGTGATGAACTCCAAGTTGGGGCTGGATGTCGAGATCATCACCTACAGGCGC -0.19212016 1.19e-01 0.99993
23945 AATTACTAAAGAAGCCAATGTGCACTACAGCTCACCGTAATAAAAACCACGTGCTTTTGG -0.13310954 1.19e-01 0.99993
75329 GTCGAAGTAAAAGAATATCTTCTGTGAACCATACCCCTTTAAACTCTTCAGAAAAAGCAG 0.15987531 1.19e-01 0.99993
74441 TAGATGTGGAGGGAAAGAACGTTGTTGGATCTATAATAAGAACATATTGGTCTACGAATT 0.14226856 1.19e-01 0.99993
13346 CCCGGGATGGAGAGGTTGTCAGCGAGGCTACACAGCAACAACATGAAGTGCTGTAAGCCA 0.12509705 1.19e-01 0.99993
257632 ACCTCCATTTTATTTAGCGTGAAAGCGGGTTAATATTTATAAATGGCACTGTTTTATTTT 0.4671806 1.19e-01 0.99993
22599 ACGTGGTGACTAAGGATTATCCTACATACGCACTAGCTGTCATTGGGCTTCTGGTAGCCT 0.14244016 1.19e-01 0.99993
234344 TCTAGTCACAGGCTCTCCAGTACCTGACATGTGTAACGTGTAATAAAGGCATATTAAATG -0.12347403 1.19e-01 0.99993
237806 ATGTATTGTCACTTTGCAAATGGCATTGGTGAGCCCAAGTACATGCCTGTGCAATCATGG -0.13338958 1.19e-01 0.99993
13858 GTGCATCAAACTACCTATGAGCATGGGATACAAAAGGTTTGAGATTCCTAGAAATGTGAC -0.23779355 1.19e-01 0.99993
12675 GGGTTTCAGATAAAAGACTGCGGTTCTCTGCCTTATGTTAAATAACTTAGAAGATGTTAT 0.15074762 1.19e-01 0.99993
234854 TGGGCACTAGCCTGGAATGAGTAGGCCTGGGAGATAACTCTTCTTGGAGACTAGGAGCTG -0.09864521 1.19e-01 0.99993
13644 GCTGAAGATGACAATGTAATAGTCTGAGAAACACCAGAGAGCTTCTCCCCTCACAAGTCA -0.22231415 1.19e-01 0.99993
624696 ATGGACATACCTTTATCCTGAGTGACCCTTCTAAGACTGGAATTGGTGCCCCTACTGTTA 0.70117123 1.19e-01 0.99993
69398 ATTTGGCTCGCGTTCAGGGCGCCATGGTCACAAAACTGCAAGTGAGGGCCTTTGAAAGGC 0.23620987 1.19e-01 0.99993
18645 CCTGCACTTTGTTACATCTGGGATACAGTCTAACTCATCTGACTTAATATGCATTTAAAA -0.18510986 1.19e-01 0.99993
258484 TCATCATTGTGTGTGCTGTGTTTGTGGTCATCATCTCTTATGGTTACATCACTGTCACCA -0.18211395 1.19e-01 0.99993
381318 CCCACTGTCAGTCTTCATAAGACAAACTGCAATGTATGAGCTTATTATATAAAACAATCC 0.15636775 1.19e-01 0.99993
14933 CATGGAAGAAAGCTGTGATGAAGTCAATTGGTTGGGTTACAACTCAGTCTCCAGAAAGTG -0.13241378 1.19e-01 0.99993
69724 AGTCAAGGCCAAAGCTGACTCCCTGTTCCCTGTGGTCAGTGCTGCCAGCATCTTTGCCAA 0.15510796 1.19e-01 0.99993
668661 AGCCCTGGAACTTCTGCCTTCGTGAGTTTCTATTAAATGGCTGGTTCATTGCCCTCAAAA -0.13779087 1.19e-01 0.99993
228714 GTTTATATAAATGTTAGTGGACTCTGATTTTTTCTTTATTTCTCCCTGTACTAACTTCTA -0.12982098 1.19e-01 0.99993
103220 CTGAGGAAAAGTTCCAACGTCAGGCTTCAGACTCACAAATATGGAATAGTCCAAGAAGAC 0.145891 1.19e-01 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.16939891 1.19e-01 0.99993
57251 TATATTGTGATATGGGTCCTTGGCTTCATCCCTTTCTCAGGGATCCTTTATTCATACTAT -0.13261188 1.20e-01 0.99993
384522 TACTTCAATGTTGGGCTTGAAATCCATGTGACTGGCAAAGTCATTACAGAGGAACAGTAA -0.14028926 1.20e-01 0.99993
107260 ACCTTCAAGGGCCTGCATGATTGAGGAGTACTGGGGTGAGAGATTCATGGGAGGAGGCTG -0.13933573 1.20e-01 0.99993
16423 TATCCAACCTCCTAGGAATAGGTGAAGGGAAGTGACGGACTGTAACTTGGAAGTCAGAAA 0.20209555 1.20e-01 0.99993
54638 CTTATATGTTCCCATATCTGATCAGGGTGACTGTCCAGCTGACCACAGTTTATTGGATGG 0.13128942 1.20e-01 0.99993
269336 ATGGTTTAGTGTTTGACACAACTCTTGATTAATTCCAAACTTGCTTCTCATGGTAAGTTC -0.21236544 1.20e-01 0.99993
30957 TGAAACTGAGGAATGTGCCGGGGACGTGAACCAGACAAAGCCCTCGTTGTCCAAGGCTGA -0.13763939 1.20e-01 0.99993
75013 TTCCAAGGTCAGGAATCCTGCTAGTGGCTTTGTTTATTGATTGAGAGACATGCAGAGGGA 0.19475712 1.20e-01 0.99993
12873 GCCAAGTATATCCTCAAGAATACTTCCTAATGAATTGCCCTTGTTTTGAAACGTGCTAAT 0.32604256 1.20e-01 0.99993
16068 AAACTCAAGCTTCACTTCTACCCTAGATTATCATAGTAATTAAGTCCTTAGAGTTCTTCC 0.90606457 1.20e-01 0.99993
241656 AGGAGAGTTGTGCTGCTGTCTCGATCTTCCTGAATGTTGATAAAAATGAATGACTACTAC -0.12152482 1.20e-01 0.99993
230735 AATCAGAAAGATTGGGCACATAGTGAAATGTCGTCTCAAACAAACCAACCAAATCAAAAC -0.33825742 1.20e-01 0.99993
84094 ATTCAAGAAAAGGATCCTGGAGTCTCAGCGGCTCCCTGTAGTCAACCCTGCTGCCCAACC 0.25096546 1.20e-01 0.99993
67420 TTACTGGATTGCTGTAAGCCATAAGGCCCCAGCATTCCTGTATGATATCTACCTCAGGAT 0.16423797 1.20e-01 0.99993
258887 CCAGCCATTTATACACTGAGAAATAAAGAGATGAAAAATGCTATGAAAAGGTTCATAGCC -0.12212537 1.20e-01 0.99993
14299 CCTCCAAGATTCTTTCCAGTGTGTTTCTGCATTTACATGATCTAAAGATGCATGGGGACG -0.15722545 1.20e-01 0.99993
67315 CTACGAACCATACCTGTGGATTTGATGTCAGAATCTGCCATTGTGTACCTCAAAGTAAAC 0.22010239 1.20e-01 0.99993
329514 CATCTTGGGGATAAATGAGAAAAGAAAGGTTCTAATTAAAAAGTGATAAGTTGGGCCTTG -0.39502238 1.20e-01 0.99993
433813 TCAAGATCCCTTGGGCAAGTATCAGGCTCGAGTTGCTCCAGCCCGTGGCCTGTTCTTGAA -0.16642538 1.20e-01 0.99993
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.50127723 1.20e-01 0.99993
225865 ATGCAGCTTATTGAGGGAATGTTTGGCAACATGACAGTGAAGCAGCGGGTGCTCCACTTC 0.74330942 1.20e-01 0.99993
211383 TATGAAAGCTCTGCTATGCAGTAGGTTCTGGAACATTCCACTGGTTTCCCTCAGCTGATA -0.25583833 1.20e-01 0.99993
18261 AGCCCCCATCTGGCAGACAAGGCCTTTAAAAATCACCCAATAAAATAATTTCTCATCATT 0.35420807 1.20e-01 0.99993
243958 CACGATCCTGGACTACATCAATGTGGTCCCCAAGACCAGGTCCCTGGCTCGGAATTGGAA 0.17790094 1.20e-01 0.99993
70884 CAACGCTTGAACCTACTATTTCCCGAGGAACATTTATTTGGAGTAGTTGAATATTTAGCG 0.22638468 1.20e-01 0.99993
258778 CCTTCCTCTGCTGTATCTATTGATCAAGGAAAAATCTCTTCCATTTTTTATACCATTGTG -0.54418671 1.20e-01 0.99993
13828 TAACATAGGACCTGAAAGAATAGACTAAACTTATCTATAGCTAGATCTTCATGAGTGCTG 0.2817894 1.20e-01 0.99993
16176 AGGTTCCTATAATATGGATGAGAATTTTTATGAATGAAGCACCAGCACATTGCTTTGATG 0.6904971 1.20e-01 0.99993
72415 GTGGACCTCAGGCTAGCCCTTTGTGTGGTCAGTCTACAGTGTAAATAAAGGTGTGAATAA 0.29641541 1.20e-01 0.99993
212508 GTTTTCTCCATCTCAAGTAAGAGACAAATGCTATCTCAGAGGAGTCTAAGTTATAATCTG -0.13707534 1.20e-01 0.99993
101602 ATGGCCTATCGAGAACTGAGTTTGTTCCAATATGGGAATGAAGATTTTTTCCCAGAGAAA 0.39930923 1.20e-01 0.99993
404710 GTGGCCTTAATCATGGTTTTAATTCTCACTTTCTGAACTCAGAGTTCTTGTCTTGCCATC 0.22382747 1.20e-01 0.99993
66526 GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA -0.10492553 1.20e-01 0.99993
94223 TACTTAACATTGAAAAAGCATATGGTAATGGTGGTATCTCTGCAGCCTCACCGACCCAGG -0.134848 1.20e-01 0.99993
100041995 GGGTTAAATTTGTTTGAGGTTTGCTTCCTCGCATGGAATTGGTTGGAGGTTAGTCTTGAA -0.22274628 1.21e-01 0.99993
320951 ACTGCTTTCTGCTCCCCAATTTCACCCGTCTGCTTTCTGGAAAAGTAAAATCATTTATAT 0.18668161 1.21e-01 0.99993
234967 AACTCTACATGCATAACAAGTGGTTTGTAATCATGGGAGAAGAGCGGTGAACCCTCTCCT -0.13431245 1.21e-01 0.99993
387314 GTGAAGTACTGTCCTGTCCATGATCCTCTTCAGTGCATTGAAAAGCACTGCTATGCATCT 0.24777497 1.21e-01 0.99993
22032 TCTAGTGCTAGGTGGGCACAGCAGGGGAACTCTGATTTTTAATAAATCCTGAATTGTATT -0.2098718 1.21e-01 0.99993
73266 TCTTATTACATTCAGTACATTTTCGCGGTGTGAATAGGAGGAAGCTAGTGAGCCAGCTGA 0.14146064 1.21e-01 0.99993
66205 TTGTGTAGTTTTCATTTGAGTACATGAAAGCTGCAAGTACAATAAAGCTGGTAAAACGCC 0.3020466 1.21e-01 0.99993
11496 GCTGCGCAGTGTTTTTAATTATCTTCTCCTTTAAGCTGAAAAGTTTTTTCTCAGCCTTCA 0.13179704 1.21e-01 0.99993
258738 CAAAACAAGGTGTTGTCTGTGTTTTACATGATAGCGATAGCAATCCCCATGTTGAACCCC -0.1413465 1.21e-01 0.99993
100038662 AACATGCATAACAGCAGAGGACTGTTGGGTCTGTGTTCATTCATAGATGACGTACCCAAC -0.20254978 1.21e-01 0.99993
387353 ACTTTTGCATGTCTGTACATCCATTTATCCTCATCACCAATAATCTCAGGTTCCGCGGCA -0.14464544 1.21e-01 0.99993
99980 AGAATTTTCCTAGGAATGGACCGGAAGCTGGAAGATAGGGAAGGGCGGGTGGATAGATGT 0.14410437 1.21e-01 0.99993
16765 ATCTCACCAGATGCTACTGTACTTGAATGGTTAATAAACTGCACAGTGCTGTTGGTGGCA 0.38011293 1.21e-01 0.99993
15382 AAATGCCATACTGTGAATGGCCACAACTGTGAAGTAAGAAAGGCCCTGTCAAAGCAAGAG -0.10046566 1.21e-01 0.99993
67442 TATGAGACCCTCAAAAATGCCTTCGTGGAAGTCTCTATGTCGGTGATCATGAAACTGTTC -0.32204486 1.21e-01 0.99993
13353 TCCCAGCCCTGGATGGAAGAAGCCAGAGGATGGCCTAGAAAATAAAGAACCCAGGACATG -0.1218044 1.21e-01 0.99993
18768 CAAGGATCAGTAGTCCCCATGAATTTTTAAAGTTTATGCTATGATGGAAAAGATGAGCAA -0.20091086 1.21e-01 0.99993
118449 GATATAACATGCATTTGCCATTTACCTTGTTCAAATCCACCTGTCAGCCCATTGCCTGTC 0.15298336 1.21e-01 0.99993
68127 GCATGGTTGTAAAGTCCTTATTCTTTGTGCTTACCTATAAAGCATTGAAACAAAATGGCT -0.1603416 1.21e-01 0.99993
328329 ATTTGAAAACACATCAATCAAAACGGGACCAGCCAGGAGAAACAGTTACAAGGGCCGGAT -0.21024457 1.21e-01 0.99993
21934 CCTTGAGAGCTAAGTTCAGGTGACCTTGTCCCCTGCCTGGTTTTGGTTTTGTTTCATTTT 0.14792124 1.21e-01 0.99993
77605 ATTATGGAAGTTCTGACAAATGCACAGAAATAAAGAAACTAGCACTAGTGTGACAAAGCC 0.22246595 1.21e-01 0.99993
214704 ACAAGTTTCCATGGTTTTAGAGGGAAGAGAAGGGGAGTTAATGGTTGAACAGTTATGGAG 0.15177004 1.21e-01 0.99993
269682 TTTGAGTTTCTCATTTTTATAAAAAGTTATCTCATAAGGGAGTCAGTCTTCACGTTGGGG -0.1364192 1.21e-01 0.99993
268345 TCTACATAGAAATCTAACCATTTCTTGGTCACGTGTTCATTTAGTTCTGGAAGGCTGTTA -0.61074425 1.21e-01 0.99993
21885 AAATGCAGCCTGTTCCTTTTCCCCCTGATGCCCTCATTGGACCTGGGATTCCCCGACATG -0.14908158 1.21e-01 0.99993
75964 TGGAAGTGGCTTTTAGAAACCCTTTAAAAGTTCCGCTTTTGCTGTCTGATTTGTCATTAC 0.1111453 1.21e-01 0.99993
170745 CTTCTAAGGTAGAGCCGCCATGGCAGTGCTATTAAAGCCTCTCATATCTTTGAAAACCTC 0.23299861 1.21e-01 0.99993
114675 AAACCTAATTCTCCCCAAAGGGTAGACCAAAAAGAAGTTCAAGGACCCCAATGCACCCAA -0.1970765 1.21e-01 0.99993
21973 TTCTTCTGATAGCTCTGACTCTGATTTTGAGAGAGCAATTTCTAAAGGTGCCACGAGCAA 0.30021436 1.22e-01 0.99993
69301 GCAGACTCTTGCAGCAGCTACAGGGTACATGGGACTTGATGGATTTCATCTCAAAGAATA -0.75978983 1.22e-01 0.99993
66374 TCAGCCAGGTGACTTCAGCCACCTCCTAGAGCCGAAGTTACACCTGATGTCCTTGGTCCA -0.16055707 1.22e-01 0.99993
16855 TCCTGGGGAAGGAAGCAGAAAGATCCCCGAGTTCCATCTAAGCTCCTAATAAAATGTTGA 0.48201972 1.22e-01 0.99993
226470 TGGTTGAAGTCTTGGTGAAAGAAAATAGGATTTACAGCAGCGCTTCACAGATTAAGTTTA -0.12000469 1.22e-01 0.99993
20512 GTTTACCCGGTGTGATATTTTTTATACTAACCATTTCTTACAGAAACAGATTCACAAGGG -0.21610162 1.22e-01 0.99993
17063 CCTCGTGTCTGTCTGACGTCTGGTCCTCTCGAAAGGTATTTTTGTTATTATTTGTTCTTA 0.33800582 1.22e-01 0.99993
75577 GACTTTTTGTTGTTCTAGCTTCCCTACTTGCAAGTTTCAATAAACCTAACCTTGCATGTC -0.16059544 1.22e-01 0.99993
50850 ATAGAACATCGCACTTCACAGGAAACAAGAGCTTTGGCTACAGGAACCCAGACTTCGTTT 0.15509025 1.22e-01 0.99993
11857 ATTGGACAGAATGAGTGCGTCTGTCCGTCCCTCCTGTCACCTTCCTCACCCACCAGAAGA 0.19336656 1.22e-01 0.99993
67845 TAGCAATCCACTGGACCAAGATAATAGAGCCAATGAGAGAGGTCACCAAACTCACACTGA -0.21335354 1.22e-01 0.99993
68031 CTAGTCGGGAGCTAGAAGATGCTTTTTCCAAAGGTAAAAAGAACACGGAAATGTTAATTG -0.155492 1.22e-01 0.99993
67014 TAGGCATCCCAGACTCTGATAAAACGATACTTCGGACAAGTTTATTCAATGCAGTGTTGT 0.14662499 1.22e-01 0.99993
11564 AGGATTGGTGGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT 0.11437326 1.22e-01 0.99993
67268 ATGTACCTTATAATACTGGAAATGGGACCTTCTGTCATTGTGATGAGAAAGTAAGTTCAT 0.22346157 1.22e-01 0.99993
230125 GCTGAGGAGGTGGGTCTGCATATATTTCTTCTTTTCGTTATTAAAAGTAGCTAAACACAA -0.20412025 1.22e-01 0.99993
229658 TGCTCCACCAAGTACTCTTTCCTTTATCAGTTTCAGGGATCTCATTTCAGGAAAGGAGAA 0.38715057 1.22e-01 0.99993
242748 CACATTCTGTCTTTACATGCTTGCTCATCCGTTAAATAGAATAATACCCACTGAGCGTGG -0.53218744 1.22e-01 0.99993
66075 CTTGGCTTGTTCAACCAAGTAGTGAATACTGACAACTTCACTCACTATCAATAATAAATC 0.09697674 1.22e-01 0.99993
24108 AGCCGATTTCCTCTGAGCTATTACCAATCACATCTCTTGATGATATAAAAAATTAACGAG 1.67135958 1.22e-01 0.99993
107526 ATTCATGATTCTCTTGCTCACCAGGAAGGATGACTTAGAAGACACTGATATCCATGAGTA 0.53372065 1.22e-01 0.99993
19016 GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG -0.15081659 1.22e-01 0.99993
11465 ACTGCTGAAAGGGAAATTGTTCGTGACATAAAGGAGAAGCTGTGCTATGTTGCCCTGGAT -0.13388348 1.22e-01 0.99993
208967 AATGCATCAGGCTATATTTTGGATCCACATACCGCTGTTGCAAAAGTGGTTGCAGACAAG -0.10859088 1.23e-01 0.99993
75209 CTGTTTCTCATCCCTGGGAAACAAATCTGTGTTTCAAAAACCTAAGGAGTATCTATTTTT 1.02260178 1.23e-01 0.99993
74126 GCTTCCTTCTTTTGGTTTTGTGTTACAGGAGTTTCTGGAGAGTTTCAGATGATTATTTAA -0.10342878 1.23e-01 0.99993
207215 CGAGAGGAAAGCGAGCTCTTTGGGTCTCGACTCTGTGCGTTGGGAATCTGGTTCTTCCCA 0.11015392 1.23e-01 0.99993
353188 AGAATCGAGATTTCTTAGGGATCAATCAAAAACGTGTTCATCCAAGTGCCACGGGAACGG 0.20830089 1.23e-01 0.99993
72240 AGGGCTTCCAGCGTGTTCCATGTGAGGAGCTGGGGTATCCAACTGTTTAATGTTTAAAAT 0.17777109 1.23e-01 0.99993
233726 CTATGCGCCCTTATTGATATGGAACAAATACCACAGGTTTTAAATCAGGTTTCAGGACAG -0.11287314 1.23e-01 0.99993
433323 TTGTAATGCTGGCTTATATTCACACAGGTGATTTTAGTTGGTTTGTCTGAAGCCTAATGA 0.6079913 1.23e-01 0.99993
16319 GGCTCTGTAGGCAGTACTCTGTAAATAAATAGATTGTTACAGTTCAGTTGAATGACTTTT 0.19649541 1.23e-01 0.99993
20846 AGTGCCTGCCTTGCACCAGGCACTATTCTAGATGCGTTGAAGGCACTAATAAAAGAAATG 0.6799393 1.23e-01 0.99993
110784 GACCAGCTGCCAAAGGTGGAATCCGGGAACGCCAAGCCCCTTTACTTTCACAGGAAGTGA -0.51519168 1.23e-01 0.99993
217866 CTACAAAGACTAAAGTGCGCCATCCCAGTGCCACAGAAGGCAGAGGGTAGTTGGTGGCCT -0.10589403 1.23e-01 0.99993
19374 CTTAAAGACAGTTGTCATCTCTGGAAATAGTCACATGTCATTCAAGGTCCAATACTGTGC 0.45993586 1.23e-01 0.99993
214523 GGTATTGCAATTGTCACCTCTGTGGTCAATATCATTAAACAGGTATGAGAATTCGCTGGC 0.51729094 1.23e-01 0.99993
75646 AAACTTGAGACATTTTGTAGGACGCCTGACAAAGCGTAGCCTTTTTCTTGTGTCAGGATG 0.40740342 1.23e-01 0.99993
14369 AGCCCCGACTTTACAGTCTTCATGATCAAGTACCTGATGACCATGATCGTGGGCATCACT -0.17111363 1.23e-01 0.99993
22326 TTCGAGCCTTACTCCCGGACCAACAATAAAGAAGGGGCCGAGAAAAAAGCGCTGGACTGA 0.2418502 1.23e-01 0.99993
545260 TTTGCAAGCTTCGATCTTTTTTCCGTAAACTCAATACCAGGCTGATGTCCCACCGGATCT -0.18096655 1.23e-01 0.99993
233274 ACAACAGTTAAATTCCCTTGCAGAGACATCCTCCAAAGTTGAAGAGGCTTTGACTTAGTT 0.2830295 1.23e-01 0.99993
93885 TATTCCTTGCATTTTTTGCTAACTATCTTTCCCTCAAGCACACAATATAGCTGCAAAATG -0.17973669 1.23e-01 0.99993
171275 GACTCTCAGTTCCTCAGTATTATGGGTAAGATCAGATCCCACCAAGAAGGTTAAGAATCT -0.17181867 1.23e-01 0.99993
240819 CGCTGTTTCTCTGAGGCACCACCGAATGCTTCACCTGAAGGAATAAAGATTCCTCACAGC -0.30883702 1.23e-01 0.99993
67849 TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA 0.34129892 1.23e-01 0.99993
66172 GCCCTGGAGTTTCAGAAGACTTGGCCCAATAAAAATAAATGTGTTCTTATAAGCACACAC 0.13497676 1.23e-01 0.99993
77652 AATTTGGCAGGCTATATTTGTAGACACTTTATAAAATTGCGGTGATTTATTGTGCACGTG -0.13529987 1.23e-01 0.99993
215512 AGTGGCCCTCAGGGCCAGAACACTTGACCAATCAGCTGTTGGCAGGGGACCATGAGATTT 0.16459269 1.23e-01 0.99993
226255 ACCTGCACACGGGAAAGTGTTTTTGCACAACCAAGGGGATCAAGGGTGACCAGTGCCAGC -0.13354153 1.23e-01 0.99993
11732 TGCATTGGAAATCCACTTAGTGCAGTATATTTTTCTAAGTTTTGGAAAGCGGGTTTTTTC 0.11797606 1.23e-01 0.99993
80749 GCCTTGAAATCAGAGTGCCGCTTGCTTCTGCCTGAGCCCTGGGAAAAATGACCTGTGCCA -0.16875597 1.23e-01 0.99993
319748 TGCCTGTCTCAAAGCCTTCAAGGATCCTGGCTACTTCCGGAAGCATCTGGCTGCCCATCA -0.12313216 1.23e-01 0.99993
230257 AATGCGACTTCATTACAGATAGCCCACATATTTGGAGTATGAGAAAGTGGGTTATTTTTT 0.15511018 1.23e-01 0.99993
64918 GCTTTATGCCAAACTTAATCACCAATGCTCAGGGAAACACTTGCTGATTAAAGCAAAACA -0.2196027 1.24e-01 0.99993
19255 AGGAGCAAAGTACACAAAAGGAGATTCAAATATACAGAAACGGTGGAAAGAACTTTCTAA 0.12472335 1.24e-01 0.99993
22232 TCGTCATTGGTGCTGTCTACCTCTACAGCCTTCCCCGAGGTGCAGTCAAAGCCATAGCCT -0.11822071 1.24e-01 0.99993
57908 TTGACCTCTTAGCTGGAGGAATGTTGTCTGAGGACGTAAAAGAAACTTCGCCACTACAGA -0.15453502 1.24e-01 0.99993
675921 ACAGGGAAGTGTTGGGGGGCAGACAGAACAAGGCAAAGATGTCCAGACAGTCCCCTCTAC -0.12617794 1.24e-01 0.99993
226856 AATCAGTGTTGAGACAGAGGATGGGTTTGGTTTAGGACAGTGAAACTCCTAAGCTTGAAA 0.13237425 1.24e-01 0.99993
80901 AATGTATAAAACAGAGCTTAAGACTTTAACAAATACAAGAGGACTCTGGTGGCTTTGCTC 1.07816026 1.24e-01 0.99993
52898 AGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTCATCG -0.18003768 1.24e-01 0.99993
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.15110104 1.24e-01 0.99993
328825 ACGATGGGATCATCCTTCCTGGAAAATCAACTTTTTCCAAAAAGCCAATAAAATTTTCTC 0.17700238 1.24e-01 0.99993
74365 AGAGATACTAATGTTACTGCATTCTTTCACTGACTTGAGGTCTCATTTCAAATGGTTCAG -0.22544354 1.24e-01 0.99993
140742 GACCCTGACTTTGAAGGTTATACAGCTCCTTAAAGAATAAAGCTGGAAAATATTTTAGTG -0.13326629 1.24e-01 0.99993
232313 AGGAGATGCTGCTTCCACTCTACCAGAAGTATAAAAGTGCCATCACATGGGGAGACCAGG 0.15754997 1.24e-01 0.99993
11475 GTTTTGTGGATCAGCGCCTCCAGTTCCTTTCCAAATCATTCCTGCCCAAAGCTTTGATTT 0.38292568 1.24e-01 0.99993
544881 GAGGAGTCCAGAAACAGAGACACATTAAAAACGTGTTGGTATATACACATTGTTTTCTTT -0.11056314 1.24e-01 0.99993
23874 ATTCTGGCAAAGATGTAGGTGCGAAAAACTACAGGCATCTCTGTGCTGTTTATTACAACA -0.10865165 1.24e-01 0.99993
223770 ATGAATCATCTGAGCCGGGTCCATGGGGAGCCAGCCAGTGACCTCAGTGACATTGACTGA -0.10852867 1.24e-01 0.99993
258538 TCATGCTTATCCACAAGTTAGATTTTTGTGCTTCCAATACCATTGATCACTTCTGCTGTG -0.2246248 1.24e-01 0.99993
407819 AATTTACTGATATGAACAAATAGAAGGTCCGTGTGAGCAGACGCTCAGAACAGAGCCCTT -0.09376146 1.24e-01 0.99993
382639 GTGCACAGTTACTGTGAAATTAACAAAGAATGGTGACTGGTTATATGTTTATAACTGGCA 0.17554334 1.24e-01 0.99993
16545 GCAGTTATTATAACATAGCATGCAAACTATCCAGCTCTTATTTTGATTATGATTTGGGGG 0.11872745 1.24e-01 0.99993
69597 ATAAATATGGAGTCTTTATATCAGAAATAAAGGTGGACATTGCACTTTTTTCCTGAGCAT 0.17103603 1.24e-01 0.99993
14588 TTGTTTTGTCCTAACGCCCAAGGTGTCCTGGCTGTATGCACTCACTGCCCTGGCTCTCCA -0.13076019 1.24e-01 0.99993
230233 ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT -0.14332931 1.24e-01 0.99993
230767 ATAGCGAATAGCGTGTACCCCCTCCTCATAGAATATTAAATAAAGGTTGCATAATAAAAC 0.18758866 1.24e-01 0.99993
100503304 TCTATTATAAAGTTCTCCCAGAAGACGAGCTGAGGCGTGTGTCCCTTGACTGTTTCAATC -0.26040882 1.24e-01 0.99993
215160 CCTTTGCCTAGTAGGTTTCGCTGCAGATCAACCTCCCTAGGGCTCTGAGGTGATACCTCA -0.26576823 1.24e-01 0.99993
68265 CCCCAGGCAGAGAAGCAAATCCAAGAAGAGAAATGTGAAACTCAAGAGGCAGATAGATCT -0.21110108 1.25e-01 0.99993
71660 GGCCCTGAGAACCAAATAAGCCCTAGACAGGACTTCACCTTACTCCCTGTACAGCTGTGG 0.26430156 1.25e-01 0.99993
329697 GCTTTAAATAGCACATTCTAGGCTTAAAGGACATAGGGAGACCTTGTCTTAAATAAACAA -0.16849012 1.25e-01 0.99993
22032 TCTAGTGCTAGGTGGGCACAGCAGGGGAACTCTGATTTTTAATAAATCCTGAATTGTATT -0.18753267 1.25e-01 0.99993
19713 CCATACCGTGTTGACTTGTTTTTGTAATCAAGGTGACTAAGGAAATAATTTCAGTTGTGT 0.47060068 1.25e-01 0.99993
330671 TTTGGCCTCTTTGGGATCTACAAATCAGACTTTGACAGAGTAGGAGGCATGAACACTGAG -0.20694068 1.25e-01 0.99993
237073 AGAGGAGGAGATCCGAAACATTCCTATGTTTTCTTCATATAATCCAGGGGAACCAAACAA 0.14532174 1.25e-01 0.99993
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.33704683 1.25e-01 0.99993
665211 CTGTGTTAAGAATGCTGTGGGATGTTGTGTAGGAGCTTGGAAGATAATGTTGAGAACCGT -0.13373547 1.25e-01 0.99993
15562 CAGGAATATGTTCTTGGAAAACACAGGGACCTTCACAGGTTTTGTTTTTAAACTGATTAA -0.3837794 1.25e-01 0.99993
75115 TGTTTTCAGTCTTGTCAGAAATATCACAGGAGGTGGGCTTAAATTTTCTTTCTATGTTAG 0.13513422 1.25e-01 0.99993
16855 TGGGGAAGGAAGCAGAAAGATCCCCGAGTTCCATCTAAGCTCCTAATAAAATGTTGAAGG 0.50096552 1.25e-01 0.99993
270210 ACATGTGGCAAAGCCTTCAAGAAACTGTGGTCTCTTCATGAGCACAACAAGATAGTGCAC -0.1663296 1.25e-01 0.99993
75657 GGTATAAAAGGTGATGATCTTTTGTGTCAATGATATTACTTACCCCATGGAAACACACTT -0.15811643 1.25e-01 0.99993
243078 ATTGGTCTCAGTTCAGGTCAAAATTCAGCTATTGGTGTATTTCAATTATACCAAGTTTGC 0.15895993 1.25e-01 0.99993
434794 GTCTAGTGCAGGGAGACTATAGTCATGGCTTCCAAAATCAAGGGCAGACCTCCCAAGCAA 0.38556202 1.25e-01 0.99993
216188 TAAATTGCCTTCCTTAAGTTTTGCTTTTTTGTTTCTGATTTCAGGATTTATATGGGGCGG -0.26924201 1.25e-01 0.99993
22044 GGGGTCACATCTTGTATATAACCCTGCTCTTGTTAATCTCAATGACAATAAAATATATCC 0.89651002 1.25e-01 0.99993
240216 TATAGCCCAGGCTGACCTGGAACTTGCTTTAAACTAACAATGAATGATCTTCACTTACTG 0.14519355 1.25e-01 0.99993
332221 TGGGAAGACTTTTGGACGCAGCTCGATCCTCAAGCTGCACATGCGCACTCACACAGACGA 0.10116238 1.25e-01 0.99993
12531 CCTCTTGTATGTGTGGTTTTTCTGTGTTGTACTAGTGACTTGAGTCTAGGCCCTTTGTTG -0.15069378 1.25e-01 0.99993
320163 AGGGAATGGGCCTCCCCATCCTTTATAAGCACATTCGCTACTAAACATTTGAGCCTTGAT -0.11432813 1.25e-01 0.99993
230991 CCCGTTCCCTGTGAGGCACTGGTCAGTTGCCAACATCTAAATGTCCATCACTCTCAGACC -0.16218661 1.25e-01 0.99993
360216 TGTTAAGCTCTTGAACTAAACCAACAGCCATAATTATTGTCCCAAGAAAGTGTAATGCCG -0.15812256 1.25e-01 0.99993
13797 TTGTCGGGCGAATGGTGTCTAAAAACTGAATTGTAATTTTATTCCTCTTTTAAAGACAGG -0.29434492 1.25e-01 0.99993
18390 GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT 0.31924357 1.25e-01 0.99993
53311 AGGCAGAGACTGGGACAAGGAGACAGCTTGGTCACATACCAGGACGCAGAAGGACACTAT 0.24280499 1.25e-01 0.99993
212531 TTGTATTTGTCTCTCAAGGCATTGGTGAAATCTCAGATTTTATATTCTGCTTTAAAGGGG 0.19470402 1.25e-01 0.99993
76547 GGGCAGGAATAATCCCAGTTCTCTGACTCTCGCTCTAGAGTTGAGAACAGGCAGGGCCTG -0.10114331 1.25e-01 0.99993
13446 TAATACAGAGCCTTCACTAAATCCCAGCCCTGCGTAGCTGCTCTTCTAAAGGGGCGGCCA -0.29174937 1.26e-01 0.99993
21939 GGGTTTCTACCTGTGTGTTACCATTTAGTTCTTGAATAAAAGACACACTCAACCTTTATA 0.79255026 1.26e-01 0.99993
12380 CCAGAAAGCCTTTACAAACCTTTGCACTTTATATATACAGTGCCTGTAAATCTCATTAGT 0.20311385 1.26e-01 0.99993
70100 TGTGAAAATGACAGGAGCTATTGCCGAAATGGAGCTAGTACTGAGAAGTATCTGGGGAGA -0.16957496 1.26e-01 0.99993
434008 ACGGAGACCTCCCCGTCTCACTGAGATTTCTAAGGATCATTTTAGAGACAAAGGGCATAT -0.11331435 1.26e-01 0.99993
16564 GGGCAGAAGCAGAAGCCGACACTGTGACGACGCTCCGTGTTCTTTATTAAAAACGATGTC -0.24393 1.26e-01 0.99993
230775 CTGTCCTGGGCTGGGGAGGGGGGAGGGAAACTTTGTTGGGAATAAACTTCACTCTGTGGA -0.16402803 1.26e-01 0.99993
269999 CCACCACCACCTGACACTGAGTTTTTGATGCACCTTGTTTTGTAAATAAAGTGTGTCTCA -0.36466207 1.26e-01 0.99993
18261 CAGCCAATTGAAGGATATCTTCCAGTTCATAGACAACGACCAGAGTGGATACCTGGATGA 0.18378947 1.26e-01 0.99993
66365 AAGTGACTTCCTATGTAAGTGGCGATTTTTTGTAGTGAATAATAAATTTTAAAATAATGT 0.13017145 1.26e-01 0.99993
433637 GGCTTGTCAGTAAAGTTAAGAATGCCTTAAATCATTCCTCTCTTACTCTATTCATAGAAG 0.33418932 1.26e-01 0.99993
214305 AGGAGTCATCTCATCCCCTTTGTGCCCAAGGAAAAGTTCATCCGGACGCCAGAGAGCACT -0.15434016 1.26e-01 0.99993
22173 ACGTAATCCTGGAAACCATGACAAAGCCAAAACCCCCAGGCTCCCATCTTCAGCAGATGT 0.15465231 1.26e-01 0.99993
74131 AACTCCACAGGATCAGGAGATTATCACAACTATTACTGGGGTACCCTTGACTCCAATAGC 0.47538237 1.26e-01 0.99993
52398 CGAGTAACTTGGTGTCTGTTATCGTAGTGTGGTGCCAGGTGACCTATGCATATATCACTA 0.15065329 1.26e-01 0.99993
56089 CTCAAGGGTTCTGTCTGCTGATGTCAGTTCTTTTTGATTAAAGTGTCTCCTTACACGTGG 1.00756065 1.26e-01 0.99993
380842 CTGTGTGTATCTTGTTTTAATTCTCTGTTGTTAAAGAATAAAGCAGTGCCTTGAAGTTGG 0.25694327 1.26e-01 0.99993
212032 AAGATCTGGGGCTGACTCTGACATCTGATGACGCCTTGATGGTCCTGGAAGTGTGCCAGG 0.56035163 1.26e-01 0.99993
245555 GAAAAAGGTTACTAATGGGTCTTCAGGAGCTACTAAGAATCACAGGTCAGTCAAAGCTGT -0.27599304 1.26e-01 0.99993
13996 CTCCCTTCTTAAACTGTCACTCTTGTCATTTCCAAATGAAGTGTAGAATTAAATGTAAGC -0.12310498 1.26e-01 0.99993
11670 CCTCTTGTTCTGCTGTTTGCTGAGCACAGAGACCAATAAAAAAGCCTCTAAAGAAAAGTC -0.29699672 1.26e-01 0.99993
232970 TAGAGGAGGGCTCCTCGTCTCCAAAGGTTTCGGAATGCGCCGTCGAGGTCCAGCCTCAAG -0.13229402 1.26e-01 0.99993
66929 TTCATGCATTCTGGCCCCATAGAGTCATCAGGGTTTGCTTTGACCACATGTTCATTCTCA 0.29871782 1.26e-01 0.99993
16599 CATTGTCGATCATGAAGCCTTGAGAGTAAGGAATCCACAGAAATATTTGTTCAGTCATGT -0.22652272 1.26e-01 0.99993
83885 CTCTTTTTGGTTTATGAGTACAGCAGAAAGATGATGATGAACATGGTGGAAGAATACTGA -0.14215704 1.27e-01 0.99993
381983 AGCCTGGCCCCTGGAGGGGGCCTCTGATTCAAACCTTCGCGTGACATTTTCACATTATTT -0.12727566 1.27e-01 0.99993
100017 TCTGGCATCCTGAATCTCAGCCAAACTAACAACATCTTTCCATCGCTTGTGAAAGCTGGT 0.25040278 1.27e-01 0.99993
54393 GATGTCTCCATTCTGCCCCAGCTGGAGCACTGCAGCTCCAAGAAGATGAATACATGGCTC -0.10440246 1.27e-01 0.99993
18438 GCTTTTCCTTTCATAAGGGCTGTGTTGAAATGACCTAGGACCAAACATTAAAGAAAATAA 0.25857319 1.27e-01 0.99993
638102 GACCAACATTCTCTTGAAATGATCAGGGTGAAATCATCTTCCGATGCTCGTAGTTCATAA -0.11083856 1.27e-01 0.99993
68312 AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT -0.20128296 1.27e-01 0.99993
210027 AGGAGAACTCAGTGCCTTCTACAGCATCTCTGTCCTATGTGAAGCGAGGTGACATTATAT 0.21759641 1.27e-01 0.99993
22230 CAGAGATACTCTGTTATTTATGGTTTGTTTAAAGTTACCTGAGAACTATCAAGCTTGTCC -0.16031505 1.27e-01 0.99993
260315 GCCAGTGTTTTCCTACTTACTGCATCTTGGATTAGTTTGCTGCCATTTTGAAGAGTTTGC -0.30625895 1.27e-01 0.99993
19012 ATTCTTACAAAGAGAGAAAGGAAGAGGATCCACACACGACTCTCCATGAAACCGCCAGTT 0.14545604 1.27e-01 0.99993
14084 TCCTGAAATGTTCTTTATGGTGTTTTTGTGTCATCTCCAGTCTTTATCCTAAGAGCTGAC -0.11632864 1.27e-01 0.99993
68224 GGAAGATAACAAGTTTTCTATGCCACCTTTACTAAAATGAACGTGCCTGCTCAATTAATT 0.11447496 1.27e-01 0.99993
211896 ATTGATGAAAGTGAGTATTCTAGCAGTACAAAGAAGAAAACCAAAGATCAACTGTTGAGC -0.15168607 1.27e-01 0.99993
241489 TGTCACTATGGCTGCTTCCTGTATGGTACTTTTCTGTTATGAGCCCTTCCTTTCCTTGCA -0.24685537 1.27e-01 0.99993
76074 GAGAAGTTGCTTCATTTATTTTTTCTCCCATTTCAATGATTGAAAAGGGTATAAGGTCCC 1.22101454 1.27e-01 0.99993
26465 AAACCTGCACACCACAAACTATAACCGATAGTAAAAGTCAGATATATGGGGGGTATTGAA -0.13136714 1.27e-01 0.99993
100039697 ACACAGCCAGGATCCCGACACCACCGCTTCATTCAGAAAAACCTGACTGGAGCTGGTGGA -0.11957926 1.27e-01 0.99993
71088 AAGAACTTATACACTGGGAAGAGATCTGGGGCAAAGAAGACAAAGGAGTTGCAGTTGGTA -0.15488632 1.27e-01 0.99993
100040851 GGGCAGGGGCTAATTGTATCCTAAGATGATGAGTCTGAGGCTAAGCTCCAGATATCAAAT -0.36813468 1.27e-01 0.99993
170787 GAGATCCAGGCTCTGATGTTTCTAAAAGCTCGGCTGGAGGCTCGCTGGAAATTGCTGCAG -0.15810183 1.27e-01 0.99993
68149 AGGCCAAGCCCTACAGCTTCCCTCAAGTGAAAACATTTCCCTAACATTAAACGTTTCTAT -0.26601716 1.27e-01 0.99993
14201 AGTTCAAGACTTTGGCGCCTTTTCTGAACCACTTCTGGGGCCCAACCCCTCCCTAGAACG -0.14673467 1.27e-01 0.99993
21345 CTTTGAAGGAGACCCAGCCCAGCCTCTACATCTTTTCCTGGAATATGTTTTTGGGTTGAA 0.39476798 1.27e-01 0.99993
74614 CTCTTTCCTGCTCCTTTGGGGCCTTTCCATCTAGACTTCTGACGTTTAGTGAATAAAAAT -0.12174077 1.27e-01 0.99993
100702 GAAATGTCAAGTTCAAAAGAATGAACTGTGTAAAGGAGAGAGAGAGATCTTGGTGCTGTT 0.82307055 1.27e-01 0.99993
380850 CATGCAATAACTCATTCAGGTGTGAAACACTGTTGGTGAGTATTAGTGCCTTCTTTTTTA -0.14609383 1.27e-01 0.99993
71445 CCCCCTAAGGAATTCTATGTATCTCAATTTCAAGAGTCTTCAGCCTTTATGTTATACATA 0.12018421 1.27e-01 0.99993
100043684 CTTTGGATGGCATCCCAAGAGATATCTTTTTACCATTAATATGATTTCCTTCATTTTCCC -0.17272918 1.27e-01 0.99993
22323 TGCCATGGTCACACCCACGCTGGCTGCTGATTGGATAAGGAGGTCCCACCCCTTTGTTTT 0.26351538 1.28e-01 0.99993
286940 GATGGGTACCCCTCTTATGACCCATGAGAGGCCTTAATGACCAAGACACTAGCACGTGCA -0.18303473 1.28e-01 0.99993
18784 CGGGACACATCCGATCTATATTTAGAGACCTTTAGTGTTCAAACATTTTCTAAATAAAGC 0.61608828 1.28e-01 0.99993
654810 GCCAGAGCCATACAGTGAGCAACTTAGACTGTCTTAAATTTTAACAAAACAAACCGATAG -0.09346084 1.28e-01 0.99993
170780 GAACACTCAACTTGGTCATATTTGGTGTCTATTTATCTACCCATCACTTGCTATTTATCC 0.14924245 1.28e-01 0.99993
60440 TGGGCTAGAGAGATGGCTCAGTAGATAAAGTAGAACTTGTAAGTTTGAAGACTTGAGTTC 1.08881353 1.28e-01 0.99993
22278 CTGCGAGCTCAGCTTCGGCACCACGGACTCGAGGTCGTCATCAAGAATGACAGCAACTAA -0.28620733 1.28e-01 0.99993
76265 TGTGGCGACGTTCCGAAAAAACAGCCCTGGCAAACCCTATGTGCGAATGTGCATTAGTGG -0.12496531 1.28e-01 0.99993
15416 TTCTGTTGTCTGCGCCTGAAAAGGGCGGAAGAGTTACAATAAAGTTTACAAGCGAGAACC 0.12694345 1.28e-01 0.99993
71743 GTTGATGGGTTTGGTGAAGTCTGGACCCAGTAACTGAATTAAAGATGTTTCCAAGTGCTG 0.17274162 1.28e-01 0.99993
12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG 0.43423421 1.28e-01 0.99993
83669 AACTGTATTTATTCTGACTTTAAGTGCCCAACATCTGTGAGGTCTTGTTTCTTTCCCAGT -0.29617977 1.28e-01 0.99993
232414 GCAATAGTCTGTAACGCTTTGCAGATTTCAGTTGACCTTGTCCATTGTGCCAAGGAAAAA 0.69589037 1.28e-01 0.99993
18530 AATGTGTTGGAATTGCTCATTGGGATTTTATCTTTCACCAGAAACAACCTAATGTTTGAG -0.63398018 1.28e-01 0.99993
235293 GGCTGATGTAATAAGATTGTACTTCCTATACAGAGGCACCTTACTCTCTGGGGCATTATC 0.38597457 1.28e-01 0.99993
14472 GAGAGTATATTCATTAGACGGGCTTAAAGGGGGCTACAGCCACACCAGAAGATACACTAA 0.4644813 1.28e-01 0.99993
18604 AGAGGGAGTGGGGGAAGATAGGGTCCACCCTTGACTCTGATCCTGCAGCCTCTATCTGTA -0.17490129 1.28e-01 0.99993
73862 GCCCAATGTCCCAAATGGTGACAACTGTGAAGCCCTACAACCCTTTTAACAAGAAGGAAA 0.13048759 1.28e-01 0.99993
20028 CCCTTGGCATTTTTATTTGGGCTTTTCAAACTGAATACTGCTTATAAACTGGTTTGTACA 0.12143016 1.28e-01 0.99993
111173 GAGCCCAGAGTTAAAGAAAGAGCGGGCCTTGAGAAAAGATGAAGCTTCCAAAATCACCAT -0.17279166 1.28e-01 0.99993
21778 GGATGCTCATTTGATATCAAGTGTAGTCTTCTTGCTGTTCATGAGTAATAAGAACATTTG 0.24983854 1.28e-01 0.99993
68473 CTAGGAACTGCCTTTTTCTCCATTTGATTTCTATAATGGCAATTACTACCAAGTACCAAT -0.13392809 1.28e-01 0.99993
226777 TCAGCAAAGGATGCCGGTACATTGTCATTGGCCTGCAAGGATTTGCCGCAGCGTACTCCG 0.20107609 1.28e-01 0.99993
245424 CAACAGACTCCTGCTTGGGGAATGAAGAGAGATTAACATTTGTGGTTTAAGTATTATTAA -0.61814553 1.28e-01 0.99993
241624 AGGGTGCTAGCTTCTCTGTTGTTATTTCCTTCTAGTAAATGTAAAATTTGAGTTCATTGG -0.16837727 1.28e-01 0.99993
67836 TCATCCTGTCTGGTTCTATCGATTCCAGTGTCCGATGTTGGGATTGTCGTTCTCGGAAGC 0.13186648 1.29e-01 0.99993
69627 TATGCGCTGGAGAATGGCTTCTTTGACGATGAGGAGGACTTCCAGGAGCAGGGCTCTCTG 0.1641577 1.29e-01 0.99993
215632 AGAGTAATCAGGGTAGCTTTTCTAGGGGGTGAAGGTGGTGACAGTTCTCCTTGGGAGTCT 0.20705667 1.29e-01 0.99993
107350 ACTGAGGGAGCTATCTTTCACAGAGTGTATTCAGTGGTATACGTGGAGCTCAGAAGTAGA 1.2748493 1.29e-01 0.99993
12364 TTGTTTTTGCCATTTATATGTCCATACCTCCTCACAAGAATAAAAGCCCCACGAGGGATC 0.19428815 1.29e-01 0.99993
16647 GAAGCTGTCCTCTGAATTTATTTCTATTTGGAATTTCATACCCTGTCATGTCCTGTAAAT 0.11248837 1.29e-01 0.99993
20698 AAGCTGTGCAGGGCCAAGTGCACCCAAACTACCTTTGGATGGTCTGTGGCAGCAGAGATG 0.22976581 1.29e-01 0.99993
320878 CCTTCAGCCTTTGATTTTCTACTATTATAGAATGTAGGACAATATGACACAGTGCTTCTA -0.49076772 1.29e-01 0.99993
98238 GCATTTGGATCTCCTCAACAACAGGCTGGTCACCCTGCCTGTCAGCTTTGCCCAGCTCAA -0.14985771 1.29e-01 0.99993
76757 ACAACCTGGAGAGAACCCTGGCAAAACAAACTCTCCAGGACAGAAGCAACAAGAACAATA -0.49633207 1.29e-01 0.99993
219144 ATCAACTGTTCTTCAAGTAACAATAGTCAGAGGGAATATAAAAATTCTCACAATACCCCG 0.21486109 1.29e-01 0.99993
72723 AGAGTATCAGTCAGGATTCTCCAATAGGACACTCATCCATATATGTATGCTACATGTAAC -0.13414284 1.29e-01 0.99993
66494 ACCCTGAACAATATTTAGCACATAACAGGCACTCAATAAACACATGATTTGATTAGCCCC 0.11557644 1.29e-01 0.99993
70941 CTGAAAAATCCAAAAATAAAGACAATTGACCTTCGTCCAGCAGTGACAGTACATACTTCC -0.12441524 1.29e-01 0.99993
56044 GTTCCATTTCTCCTGGTTGGTAACAAGTCAGATCTAGAAGATAAAAGGCAGGTTTCTGTA 0.09148222 1.29e-01 0.99993
627214 GGATGACCCTTCTCCTGGAAAGATTGAGCTCAAAAGTTTCATACAAAACTAAGTAAAAAA 0.20280271 1.29e-01 0.99993
17181 GGGGGAAGGAATCCTGAATTCTGAGTTTACCATGAGAATAAATAAGCTGCGCAGTGTAGT -0.55183982 1.29e-01 0.99993
210108 GTGAGCACAGACATTCCCAAGCTCTGAAATATGCTCCTAATGAGGGGAAAGTGGTCGGTC -0.17359338 1.29e-01 0.99993
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 0.6233677 1.29e-01 0.99993
75140 CTGAAGTACTCATCTACATTCCCATCTTGAGAATAATGAAGCATGCAAATTTTTCACTTG 0.13073811 1.29e-01 0.99993
15900 AACAGACAGGGTCGACAGAGTGTGTGATACATGCAAACAGAATCCTTGGAGTGTGTGATA 0.78194499 1.29e-01 0.99993
238076 AAAGTAAATGATATTGGGAAGGATTTATTGCTACGGCTTACGCATCATTCTATATTTGCC -0.53352677 1.29e-01 0.99993
240063 GTAACCCGTATGTATGTTCTCAATGTGAGAAAGTTGTGAGTTCTGAGAGCTCTTTGCGGA 0.24721631 1.29e-01 0.99993
20821 GTGTCTTTGTTACATAAAAGTTACCTTGAGAAAGATCTCCAAGTATTGGTTCCAATTCTG 0.84320981 1.29e-01 0.99993
73852 AAGATCTGTGTCTATTATTTATATTAGTATTATTAACTGTGAAAATCAATATGCTGATAC 0.18419348 1.29e-01 0.99993
216233 AGGTGTGAAGATGTAGCTAGGTATTTTAAAGTTCCCCTTAGGTAGTTTTAGCTGAATGAT -0.20715326 1.30e-01 0.99993
16160 GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT 0.51704793 1.30e-01 0.99993
20847 CTGAATAGTTAGAAAGAACTGTTGTCCTGAAGTCCTTCGTACGTCATAATAAACTTTTGT 0.54874978 1.30e-01 0.99993
67460 GCTACAGATGGACCGTGGTCTTCCACTTGTCTTGGGGGTTAATAAATTGTTTGCTTGATG 0.17753571 1.30e-01 0.99993
71885 TCTGCACCCTGATGGGAAATACCGTCACCCAAGAACTCAGGCCATGGAGACACAGGGTTT -0.1386098 1.30e-01 0.99993
233280 ACTTGGATTCATTATGAAAAACACCTGCTTTCTGTTTCAGGCAGTATTGTGTCCATTCAG 0.12456005 1.30e-01 0.99993
14299 CCTCCAAGATTCTTTCCAGTGTGTTTCTGCATTTACATGATCTAAAGATGCATGGGGACG -0.15478903 1.30e-01 0.99993
74206 CCCTGTCTTGAGATTTCTGGCATGTTTCAGGAGGTTTCAAAGGAAATAAACGTTTCATAG -0.29921025 1.30e-01 0.99993
21926 TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG 0.45939851 1.30e-01 0.99993
22117 CTTCAGGGAGGTTGGTGTGACCTGCTGTAGGTTCACCTTTTAGGCTACGGATATTGACAG -0.19197687 1.30e-01 0.99993
56696 TTTCTCCTGATTCTGTCTGTTGTCCCCATCTCTTGGGGTGGAATTAAAAGGATGCATCAC 0.94217271 1.30e-01 0.99993
258345 TTTGGCCTGTGCCACACAAATGTGCTTCTTCCTAATGTTGGCAGCCACTGAAAGTATTTT -0.14432868 1.30e-01 0.99993
20274 GAATTGTGCATGTAACTCTACAGGGAATAATCATTATTGCAATCAAGGGTGACTTAATGA 0.17841334 1.30e-01 0.99993
12879 ACTGCTTTTGCTATGAAAATGAAGCTGTTTCTATTTTGATAACACAAATATTAAAAATGC -0.3856121 1.30e-01 0.99993
69785 CTACGAACCGTATCTGTTGATTTGATATCAGAATGGGCCATTATTGACCTCCAAGTAAAT -0.10812764 1.30e-01 0.99993
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 0.76524437 1.30e-01 0.99993
259019 GTGAAGGCCGCTTTAAAGAGATTCATGACAAGTCCATGTGATTCTTTTAAATCACTGTAA 0.13233411 1.30e-01 0.99993
257633 AGAGTCAGAGGTGACAGTGAGAAGAGGTGAAATAAAGACACACCGTGTAGTGCTTCTCTG -0.22100586 1.30e-01 0.99993
234593 GCCTAATTTTGTGTATTCTGTTTGGTGGCTGATAAAGAGACTTTGAGATTACAAAATGCA 0.17885581 1.30e-01 0.99993
16154 GTCATGACCCTAATCTGGTACGAGAGCTCCTTCTGGAACTGGGCAAGCTCTTTGAGACCC 0.53660192 1.30e-01 0.99993
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.34312799 1.30e-01 0.99993
74204 TTCATAAGTCTCATGACCTTCTGCAGGAGGAGATCGGCATTGCCATTTACAACATGGCTT -0.10654505 1.30e-01 0.99993
19645 ATTTTCAGAGATCCTGCTTCGAGATTTCTTAAAGCTGCAGACACTGCACTATTGGTTTTG -0.18013337 1.30e-01 0.99993
54607 GTCACTGTATTAATGATGAAGGTTGAGATGACTTCATGTTTCAAAAATATGCACATGTCC 0.14467946 1.30e-01 0.99993
11920 GAAGACGGTGCACATAGAAGATACAGGCCAAATGATTTCAGTGCCAATCAGTGCCAAAAG -0.19428242 1.30e-01 0.99993
227682 TTGTTGGTGTCTGCAGTGTGAACACTAACAGGCTGATGATTGTTGGTGTCTGCAGTGTAA -0.16166249 1.30e-01 0.99993
330409 ACTTGCTGGTAAAAGGCTCTCGATTACCTTTTTCTGTTTGAGCACACTGAACTCCTTAGA -0.18869667 1.30e-01 0.99993
67290 GGGCCTGTAGCAACTGACCCTAAAGGTTTTGTCACCATAGCCATTCATGCCAAACCTGGC -0.13059796 1.30e-01 0.99993
12978 GTGCTCCTCTCCAAGCTGACTCGTCCTCATTAACTGTCAACATTAAACTAACAGCATTAA 0.30009479 1.30e-01 0.99993
15110 AAATAAAAGCGTTCCCATTCGTTGCTGAATTTGTAACGTATTTAAACTACCTATCATGCC 0.10749035 1.30e-01 0.99993
74185 TGTCCGTATACTGTTTCAGTAGACGCTGATATTTCACTCTTCTGAAGACTTGAAGTGGTC 0.19580227 1.31e-01 0.99993
17686 AATCCACACTTATTGGTGAAGATGTGAATCCTCTCATCAGGCTGGATGATTCTGTAAATA 0.21818596 1.31e-01 0.99993
22184 AGTCTGACAGGAAGAGCAGTAGCAGACACAGGGTGAAGAAATCTCACAGATATGGAATGA -0.10185673 1.31e-01 0.99993
235472 TGACACTGCCACAGTTTTCATCGTCATTCTAAGTTTTGTGCCAAATTGGACTTTCTTAGA -0.29381458 1.31e-01 0.99993
228807 GCCTGGCAAGTGCTCAATAAATCTCAATAAATGTTTTTACCAACCTCATGGGTCCAAACC -0.13188938 1.31e-01 0.99993
116746 CTGCCGCAGAAAATAGATAAAAGGACCAAGAACCAGCAATGTGAATAAGTGCCAGAATTT 0.28439853 1.31e-01 0.99993
58205 ATCCTGGCAGCCTCTGAAGTTCTAATTAACTGGAAGCATTTAAGCAACACGTCAAGTGCC 0.39909007 1.31e-01 0.99993
210029 TCTAATTTCCCCTTCATTTTATTTTCTATTTTAAAAGACCATCTTTGCCGTTGAGAACCT -0.20831062 1.31e-01 0.99993
330890 GCACAAAGTGTCCACAAGGAACCAAGTCTGGAATTAGCCAATAATCTTTTCTACCTCTGA 0.1193383 1.31e-01 0.99993
23964 CTGGCAGACAGTAGCAGCAACATCCAGTTCTTAAGACAGAATGAGATGGGAAAGAGGTAA -0.18938021 1.31e-01 0.99993
12960 ATAAGATCTGCCTGTTCGAAGGGGCCAACTTCAAGGGCAACACCATGGAGATCCAAGAGG 0.3737476 1.31e-01 0.99993
20280 TAGATTTGTTGCTAATTGGGTGTGGTCAATTGTGTTTCCCCGAAGCTGGGAGGTACATAG 0.13517754 1.31e-01 0.99993
12394 CAGGAGGGCCCTTGGAGGCCACCAGGAAGAATCCCGGAGGGAAACTGTGAATGCTTCTGA 0.32291976 1.31e-01 0.99993
218820 TAACTATTTTTAATTTTTAAGTCCACCCGCTGAGAAGGGGACAAGGTTTACGTCATGTGC 0.55890283 1.31e-01 0.99993
244694 AAAGCCACTTGAGAGTCACAGATGACCTCTCAAAGTTGATGTGTTACACAGTGTCTCACC 0.23179153 1.31e-01 0.99993
237954 ACAACAAGGTCATCTTGGCGATATCTGTGACCGTCATAGTGACAGTTTTGATTATCATTT -0.14493985 1.31e-01 0.99993
104444 AAGAAGAGGAAAATTATAGAAAATGGAGAAACTGAGAAGCCTGTGAGTTGATGCCGGTTC 0.11823596 1.31e-01 0.99993
16633 CATTGTGGGCCTTAGTGTGAGACTCTGTTATGAAATATAATTATGATGATGATGATGATG 0.47539903 1.31e-01 0.99993
404346 TGTGTTACAAATCCGCTCCGCTGCAGGGCGGCAGAAGGCATTCAACACGTGTGGTTCACA -0.12859454 1.31e-01 0.99993
319468 CTGTCACCTTTGTGCAAGGGTATCTGGGATGACACTTGAATTAAAGTGAATTTGAATTGC 0.30172941 1.31e-01 0.99993
11758 ATTCTCAGAGTGGTTGACTCTCTCCAGCTGACAGGCACAAAGCCGGTTGCCACCCCAGTT -0.21119866 1.31e-01 0.99993
57444 AAGATGCCAGGGCCACAATGGAGCTCTACAAAATCTCTCAGCGACTCAGAGCCCAGCGAG 0.54916471 1.31e-01 0.99993
100042497 TAGTTGCCTATGAGAACTAGGTCCCTCTGCTTAGAAAGCATCTCACATCTTGGTTGCACA -0.36293149 1.31e-01 0.99993
18226 TGTCTATTTTATTTCTCTGCACTCTATTGTAGCCTTTGTGGTCCCTGATCAAAATGTTTG -0.11859093 1.31e-01 0.99993
17057 CTTTCACGTTTCTCAAGTTTCCAACACTTGGGAGGAAGGTCTAGTTGATTGTGATGGAAA 0.41256873 1.31e-01 0.99993
14805 GCTCACATAGATATTACTTGAGGAGTGAAACTGAATCTTTTCAGATGAATTTGTATGCAC 0.40889039 1.31e-01 0.99993
380912 AACATCTACTTCTCAGTCTAAGGCACACTAAGTACTAGTAGCAAGCCTGTGAGCCTAGGA 0.11002002 1.31e-01 0.99993
240322 TGATGCACTGTATCGATGTACACTGAATCACCATTGCGCTGTTGGTGAAGGTGTAGAGAA 0.47364802 1.31e-01 0.99993
67504 AGATGAGGGGTACGCAGGGCCAAAGTGTCTTATAGAGGAGTTAAATAAACACTGAACCCA -0.33060781 1.31e-01 0.99993
17308 GTGTCCTTGTTTGTTGCCTGATCTTAGTTTCATGGAAGAAAATGGAATCTACAGAATTAT 0.10113997 1.31e-01 0.99993
407819 AATTTACTGATATGAACAAATAGAAGGTCCGTGTGAGCAGACGCTCAGAACAGAGCCCTT -0.09822588 1.31e-01 0.99993
67213 GAGAAGTGTATTTCTACGTTGCTTATATCTGATCACTTTTGTATTTGTTGATTTAAAGCC 0.21049755 1.32e-01 0.99993
73192 CATCCCCTAGAATCTTTTTCTGATTTTTAACTCCAGGAGAGATAGCATTTTCCTTACATT -0.15508109 1.32e-01 0.99993
233168 CACAACACAGTTATCTCCGAACACATAAAAGAACACATACTAGAGAGAAACCCTATAAAT 0.21317035 1.32e-01 0.99993
114564 TGTGTCTATCTCTATGGAGTCCCTACAAACAATGACCAATAAACAATGGTAAGGCGTACC 0.57002786 1.32e-01 0.99993
214601 TTCAGTGCCAAAGAGGCCATGCTGAGTTAGATAGTTGGGTATTGCCCAGAAATATATTTC 0.1258948 1.32e-01 0.99993
240888 ACTGCACTTGCCCACCCAAGAGGAGGAGCTCCGTGACATTTGAGGACGAAGTGGAACAGA -0.22581465 1.32e-01 0.99993
100043123 GAAACCCATAGATCTGATGCCCTGGACGGAGAGAAACACTTCCCAGGAGATGAAAAATAA -0.14275176 1.32e-01 0.99993
26938 ATACCTAGTACAGTGCCTTGCACACAATAGGCGCTCAATAAATGTCTGTTGTTGGTGTTC -0.38383531 1.32e-01 0.99993
235184 AAAGCCATTGGATACCCCTTAAAATTTAACAACTGAGTGTCATCCTTCATAAGGATTTGG -0.13822951 1.32e-01 0.99993
381654 AACACATTGATGCCAGGAATGTAACAATTAAATCTGGGGAAGATGGGTAAAGTTATCTGC 0.14738924 1.32e-01 0.99993
67391 GGTGTGTAGCTTAACAAGAATGTTCCTTTTCCCCTATGTAAGATCCTTTTCCAAACTCAA 0.14664133 1.32e-01 0.99993
16578 ATGCCAAAGTCAAGACAGATCAGAAGCACAATTATATGAAAACCATGGTGGGCCTCCAAC 0.19986357 1.32e-01 0.99993
100515 TCTTACTTTGGGGGACCAGAAATGAAAGGATCTTCTTATATTTATGATATAGGCAAGTAG -0.15873005 1.32e-01 0.99993
218820 TAACTATTTTTAATTTTTAAGTCCACCCGCTGAGAAGGGGACAAGGTTTACGTCATGTGC 0.54462603 1.32e-01 0.99993
68952 ATTTATTCACCCATATCAAACTAATTTGTTGGGGTGAGGGGAGGAAGGCAGTTGCTCCCC -0.20449237 1.32e-01 0.99993
671927 TCGGGAAACCCAGTGGTTCAAGGAGTGAACGGCTTCAAGGCTGAGTTCAGCAAGAGCGAC 0.09912132 1.32e-01 0.99993
246727 ACTAGACACCCTAGGAACCAGACATCTCTAGATCTTCTAGTCTGCTGTTCATCTACCATG 0.26864128 1.32e-01 0.99993
280645 GGGACTAGTTGGTGGGCGACGCTATGAACGTCCGTTGGTAAAAAATGGCAAAGTTGTTGG -0.24907299 1.32e-01 0.99993
64095 GAAGACGGGAGGTAGAAAATGAAGGACAATCTTTACACAAAAGCTGCAAAATTAGCACAC 0.29465605 1.32e-01 0.99993
77684 GGTGTTCATTGACTGAAAATTACAACCAAGATGGAAAATGGAAGCAATGTTCTCCTAACA -0.11549028 1.32e-01 0.99993
239250 GCGTTTCTACAGGTAAGTGTTCTGAGCTTCCTCAGGAGAGGGACAGTGTAGCTTTATTTT 0.72344972 1.32e-01 0.99993
52064 TAAAACCAGCACGATTGCAATTCTCAAGTTTGTTCATAGTTTCTTCCATGACAGATGTTT -0.15149273 1.32e-01 0.99993
93737 TGTTTCCATGTTGCTGCAGTGATCTGGAATGTGCTTTACTAAGACAAATATTACAGAACC 0.26723297 1.32e-01 0.99993
171244 AAACTATCCTCATCCTGGTGTGCACATTTATCATCTCTTATACAATCTCTTCTCTACGTG -0.15287503 1.32e-01 0.99993
258941 GAGACATGAAAGAAGCTATGGGTAAACTTTTTGGTGGTGGAAAAACAGTTTTCTTATTGT 0.56268722 1.32e-01 0.99993
16169 AAACCATGGAAACAGTACCAATGACTGTGAGGGCCAGCAGCAAGGAGGATGAAGACACAG 0.33170973 1.32e-01 0.99993
64706 GTTGACATATCAAGTTAACCCACTGAAGGGCTTCAGGTTTCATTTTTTAATCTTCTCAAA -0.24613477 1.32e-01 0.99993
18115 GGAGGGACCAACATTGTTCTGATGTGGAGGATTTTCATATTTGGTGATGATATTAAATAA -0.19171557 1.32e-01 0.99993
50887 TGGCAGCAGAAGCCAAAGATGATGAGCTAAAAGCAAACATTCAAGATGTGGAGAAAGATG -0.36750565 1.32e-01 0.99993
19317 GTTGGGGTGGAAATGTTATTGCTCTTTGTTTTCTTTATGCCCTTCTTACGTATTGTTTAT -0.20711004 1.32e-01 0.99993
68434 TATAACTCACTGGTGAATTGCTTAATGTTCAAGGATGTGGGTTCGATTCTCACGCACTAC -0.20225642 1.32e-01 0.99993
234396 TGAGCCATCAAGGTGTCTGAGCATCTGGCTGGTTCCTAACTGTTCCCAGCTCTAGCTTCA 0.19022541 1.32e-01 0.99993
109042 TACTTATAGAGTGCAGCACTTACATCCAAATAAGGAGAGAATCCTGCATCCACTGCCCAG -0.16925589 1.32e-01 0.99993
56228 ACTAAATGACTCACAAGACGATTTACCTACAACATTCCAGGGTGCTACAGCAAGCACATC 0.11059052 1.32e-01 0.99993
259005 TATCTTTTATGGAACTGGCTTCTTCAGTTACATGCGTCTGGGTTCTGTCTCAGCCTCAGA -0.1224442 1.32e-01 0.99993
17850 AGGATTATGAATTTCTGTATGAAGTTGGTGTTTCCAACGTCTTTGGTCCTGGAACCCGGA -0.29116327 1.33e-01 0.99993
75691 AGATTCTACAGGAAACCATTCACAACTTCCACTCTTCCTTTGAAAGCAGTGCCAGCAACA -0.10563346 1.33e-01 0.99993
217337 CAAGCAGAGCGCTCTATTTTTAACTATGTTACACTCGTAAATGACAAAACCAAATCTTCT 0.24506288 1.33e-01 0.99993
13853 AGACTTTTCTCAGAAGTTCGGGAAGGTTCACTCTTCCATATGCGCTTTGTAGGTGATCAG -0.15053715 1.33e-01 0.99993
234678 AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC -0.11887533 1.33e-01 0.99993
52815 AACTGAAGCACCTTCTTCAAGCTGTTATGGTGGACAATAGAAATACAGATGAACTAACCT -0.25900151 1.33e-01 0.99993
26918 ATGATGTCCGGCCTGGCCCATCTACATTCCTTACACATAGTACACCGTGACCTAAAGCCA 0.10680419 1.33e-01 0.99993
208643 TTATTTTCTGAAATCACTCTTGGGACTGCCGTCCTCGCTGCTGGGGGCATATGCCCCAGC -0.12513613 1.33e-01 0.99993
637515 CTGTTGTCACGTGAGGAGTCTTCGGGTGAACATGAAAGGACAGCAGGGACATAAGCTGAC 0.16263432 1.33e-01 0.99993
75502 TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA -0.3892027 1.33e-01 0.99993
69902 ACCACTCTAGAGGGAACAGCTATTTATTTTGCTATGGACAAAGACAAGGGAGGGTGCTAG -0.11376445 1.33e-01 0.99993
194588 AAACATTTTGATGAGTGCCAGTACCCAAAGGAGAAGAAAATTGTGGAGCTGGCTGTATTG -0.16628497 1.33e-01 0.99993
54123 GCATAAGGTGTACGAACTTAGCCGGGAGCTTGGATCTACTGTGGGCCCAGCCACGGAAAA 0.89409329 1.33e-01 0.99993
107476 GCTTCAGTCCAATGCACTCTTCTCACGTTTTGTTGAAATAAACCTCCACATTTGTAGAAG -0.08820298 1.33e-01 0.99993
12763 CAGGACAATGTTTTCAGCTTTTCAGAGAGCTCTTGGCACCATCTACTTCCCATCTCACTA 0.13236761 1.33e-01 0.99993
386454 TGTTTGTACCACCAGTGTTGGGAAACAGTCCTAATTTACCTCCAATCCCAAAAGGCTCAG -0.41153927 1.33e-01 0.99993
78334 GAAAGCCAGTGATTAGCTGTCACAAAAGGCATCTATGCATATTTGAAATGTTCACAGCAG 0.3039595 1.33e-01 0.99993
224813 GCATTAGTCCAGAGCTGCAACAACAGATTTGTGACCTCCTATCTGAGGGGGAGGAAGAGG -0.14502857 1.33e-01 0.99993
232288 CCTTCTTACCGATCCTCAGCTCACTATGGATATGACCGCCAGAGGGACTACAGCAGGTCT 0.14852593 1.33e-01 0.99993
11833 CCCAAAGATCTTGCTTCCTCAGCTCCCAATCTGACTTTGTAATAAATGGCTTAGCATTTC 0.18304917 1.33e-01 0.99993
109901 GTATGTGAACGTGCAGAAGATTGTGTCACACCCCTACTGGAACAAGAACAACGTGGTTGC -0.37472522 1.33e-01 0.99993
69291 TTCTTTGCCAAGTGTTTCTTTCTGTGGTGTTCAGTTTTGCCTCAGGCCTACAGCCATAAG -0.56480798 1.33e-01 0.99993
67573 ACACACAGATGATCCTTCTAGGTCTTATAATGCCAACAAAGGTTGCTCACTATGGGCTGC -0.18605549 1.33e-01 0.99993
72123 ACTGTTATGTCTTAAGTGCATTAGAATGCAATTGTTTGTAATGGAACTGAAGTGTTTCCC -0.35845177 1.33e-01 0.99993
71059 CACACATAAATATGTAAAGACGAAATCCTGCAAAAAATAAAAAGAACTTGTGGCCTGGGA -0.16226636 1.33e-01 0.99993
54613 AATGGTGATCAACTTGACTTAAAATTGACCCTATGGATCCAAAAGATGATGATGCTAAAC 0.22659798 1.33e-01 0.99993
93790 GGCTTCCCCCTTACCCTCGCAGATATAATTTATGTCTGTTTTATGTACTGTATGTCTTAT 0.10598382 1.33e-01 0.99993
216225 GCTGAACATATGATGTAGACACATTGGGTAGGGCTGAGGTTGAGAAACACTGAAGAACTC -0.1140833 1.33e-01 0.99993
66358 GTGATTTTCGCCTCATTATCTTGTCTGCTTTGTAGAAAGTGAACGATACTGTTTTATGTT 0.08576681 1.33e-01 0.99993
66975 ATTATCTCTTATTGGGAAAATTGATTTATTTGTACACAAATATGGTGTTATTTTTAGTAT -0.3543515 1.33e-01 0.99993
20200 TAACAAGGATCAGGAAGTAAACTTCCAGGAGTATGTCGCCTTCCTGGGGGCCTTGGCTTT -0.41201733 1.33e-01 0.99993
74849 GCTATAACTAGTTATGTTCAAAATGTCCTGTAGTTCTGATCCTTTTAAAGCCATGATTGG -0.13409445 1.33e-01 0.99993
13508 AGGAAACAATCCCTACGCAAAATCTTACACCTTGGTATAACACATGGCACCTGATGGACA 0.41324317 1.33e-01 0.99993
232089 ACCCTGGCTGAGAGGCAAAGGAAACTCACCCACCAGCAGTTTTAGAATAAAGGAATTGTT -0.15111969 1.33e-01 0.99993
381536 TCAGCAGAGACTAAGAGTGAGAAGAAAGTAGGAGAGCGCATTTCTAGAAAACCACCGAGA -0.1210981 1.34e-01 0.99993
67014 TAGGCATCCCAGACTCTGATAAAACGATACTTCGGACAAGTTTATTCAATGCAGTGTTGT 0.17082693 1.34e-01 0.99993
56046 GGACCCTGAAGAAGGTGGCCTGAACTGACTTGTGAACAGTACCTGTTGAATACTCAGCCC 0.14138401 1.34e-01 0.99993
432868 TAATGCTTTCTCTGTGCCAGACATAATGCCAAGGGCTTGGCATGCTAGTCCTTAAGCAAA -0.13277117 1.34e-01 0.99993
68014 GTCTCAAAAGGAAAGACAAAAAGAATCCCTGGGAAACATTTTCAGCTTTTTCAGTTTGTT 0.12828082 1.34e-01 0.99993
433586 TTGCAGCATTCCAATCAGAGTGGAATGGGCATCCCACACAACCAATCCCAGGGACCCAGG -0.1687924 1.34e-01 0.99993
20020 CCCACCTACAGCCTCACCAGCCCAGCCATCAGCCCAGATGACAGCGATGAGGAGAACTGA -0.10835175 1.34e-01 0.99993
258490 AGTGGAACTCTCTTGTTCTGATATCAATGTTTCTGTAGTCATTACCACAATTTTTTCTGC 0.24122456 1.34e-01 0.99993
74351 GTGGTATTGATATCCAAGATGTGTCTATGGTTGTCAACTATGATATGGCCAAAAATATTG -0.13965061 1.34e-01 0.99993
18786 GCCTACTATAGAATTTGAAGTACCTCACATGCTAAAACATTTCCTATAACCCTTCTGTAT 0.21084764 1.34e-01 0.99993
57357 AGAAGCACATTTGTCTCCTACCCAAAGCATAGGAAAGCGTTCCTCCCATTTTTGTTTTAA 0.11904669 1.34e-01 0.99993
76770 CTTCTAAGCAGCAAATTCTAAAGTGTCCTGACTCTTCTCCTTGTAAACAGATTTGGCCAT 0.13281653 1.34e-01 0.99993
20971 TTGTTCCAAATTTCCAGAATAGAATATAGGACCAGTTTAGATCCTGTAGTAAACATGTCC -0.27468028 1.34e-01 0.99993
107227 AGCTTTGAGAGGTCTCAGAAGCCTACAGCTTGTTCCAGCCTGGCCATCACAGGGTTCTGT -0.32103958 1.34e-01 0.99993
100040926 CTTTCCGGGAAGTGGGACACAAGATGGCTGCCACAAAGTCACAGCCAGAGATGGATGCCT 0.11181575 1.34e-01 0.99993
99586 TGAATGTCTGGTGAATGGCCCACTTTCACTGAGCACAGACAGCTAGATCTGCTTCTTTTA -0.28213558 1.34e-01 0.99993
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 0.59194093 1.34e-01 0.99993
67247 TGCCAGAGGTGGTTTAGGAATGTGAGGCTGTATAAATTTTAGATAATGAGGTTTTTAGAA 0.16904472 1.34e-01 0.99993
212531 CTAGTTGGTGTTAAGCCCGATCCACGTAAAATTCCATTTGATAAATCCCAGGGAGTTTCC 0.19753991 1.34e-01 0.99993
231225 GCACTAACAGAATCTAAAGATAGCTGTTGGAGATACTATATATTTATGCCTTGTAAAGCC -0.10029713 1.34e-01 0.99993
243274 GAATGATGCTTTGGTTCAACTTAGGAGGTTTAGTATGCATGGCAAGATGTTGTCAAACCT -0.28140174 1.34e-01 0.99993
56722 CTGTTCATACAATGATCCGGAAGTGCTAGCCATTATTTTTGCAGTGAATTATGGATACCA 0.30747108 1.34e-01 0.99993
100043644 GAAAAATCCATGCAAATAGCCAGCGCCATGAAGAACGAAGTAAACAAGCCAGTCTCCAGT -0.12311356 1.34e-01 0.99993
19188 AATCTTTTCCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCC 0.47020589 1.34e-01 0.99993
16006 AAAGTTCCGATGCTGATTGTGTAACCAAAGCTGAACGTGGAAAGCTGCGTCCCATACATT -0.14452956 1.34e-01 0.99993
545378 AATAATGAGAAGCGGCTTCTGTCCAGGAGCGAGAAGACTGAACTTAGAGGCGAATGTTTA -0.14749676 1.34e-01 0.99993
72795 CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA -0.18386529 1.34e-01 0.99993
22032 TCTAGTGCTAGGTGGGCACAGCAGGGGAACTCTGATTTTTAATAAATCCTGAATTGTATT -0.18853653 1.34e-01 0.99993
11920 GAAGACGGTGCACATAGAAGATACAGGCCAAATGATTTCAGTGCCAATCAGTGCCAAAAG -0.24630708 1.34e-01 0.99993
15930 TAAAATATATTTATGATTGAAATACAACAATGAGACCCAGTAAATAAAAGTTATTGTGAA 1.04164646 1.34e-01 0.99993
11541 GTGGTCCCCATGAGCTACATGGTGTATTTCAACTTCTTTGGGTGTGTCCTTCCTCCACTG -0.14817626 1.34e-01 0.99993
16412 TGGACGCTTACTGCAGGAAAGAGAACAGTTCGGAAATCTGCAGTAACAATGGAGAATGTG 0.21309469 1.35e-01 0.99993
12919 AGCTGGAGCCATTTGAGCTAGAAACCTCGACCGGAAACAGCATCCCAGAATACTGTTTGT -0.35083794 1.35e-01 0.99993
574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA 0.61539628 1.35e-01 0.99993
258931 TTCTTCCTTCAGAAGTTTTCCTTCTTAGAAATCTCTCTGACATCTACTTGCATCCCTAGG -0.10980744 1.35e-01 0.99993
15235 AGTAGGCCTGCTTTTGAGCCCTTAGAGATGTCAAGACTTTTCAAACATAAAGCGGCCTTT -0.12727088 1.35e-01 0.99993
13360 TCAGAGGCCATTGAAGAAGGGAGGCTTTTTTGTTTAGGTTCTTGATTTTTTGTTTCTTTG 0.13292266 1.35e-01 0.99993
22066 GGAGTGTTTACCATACCTATACATATTTTCCATAGTGCTCTGGGCAGGCAAAATGTTTGA -0.60524046 1.35e-01 0.99993
330409 TGTAGTATTAATGTTTTTGGAGCTGGGTCCAGTTTACAGAAGTTTCATGTTGCCTTTTTT -0.21150265 1.35e-01 0.99993
329239 ACCACAGCCTGTGACGTCGATAGCCTGACTATTGTCTATACTCGACAGATGGGGAAACTG -0.15711265 1.35e-01 0.99993
77305 TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA -0.12206829 1.35e-01 0.99993
109229 GCTCTTGTTGCAGTTTTGTACTCCACTTGGTTTTTCAATTGAGCTTATGGCTTTTTTAAA -0.13086411 1.35e-01 0.99993
58861 CAGCTTGGTTGTGACTAAAATATGATATTCATTGACAAAGTTTTGCTGAAGGCCACTTTT 0.16111371 1.35e-01 0.99993
26943 GTTCAAAATGGGCTCCAGCTGGTTGTGCCTCCTCCTTTACCTCTGGACTCTTGTGGCTCC 0.11724492 1.35e-01 0.99993
81497 AGTTAATTTGTTCATCTGGCCATGGGCACCTATTCTATTCTATGTCTTGGCTGTTGTGAT 0.17883086 1.35e-01 0.99993
20423 AATTTATTATTGTGTGAACTGTACTCACAGTGAGGGAAAGATTATTTTGTGAGGCCAAGC 0.21675385 1.35e-01 0.99993
22192 ATCGGGTCCACCTACTTCGAGCGCTGCCTGAAATAGGGTTAGCAATTACCCATCCCTGCC 0.28803955 1.35e-01 0.99993
110312 TGTCTGTTTTAAAAGGACCTGGTTAAGATATGTAATAATGTAAGCGATATGCTTGACGTG -0.27354594 1.35e-01 0.99993
246048 AGCTGAACAGAAGTTAATAGAGAGCATGCTTCAGAACCTGACAAAACCCGGAACAGGTAT -0.16320994 1.35e-01 0.99993
210094 GCCGTGTGTTCCAATTCATGGGGAGTGTTGAGACCACCACACCAATAAACGCCTTTTTCC -0.17644415 1.35e-01 0.99993
320808 AGAAGACATTCTGTTCTGTTGAAGTAGGTAACAATGGAGAGAAGAAAATATCAAACTTCC -0.10441021 1.35e-01 0.99993
242418 TAAAATGTACTCTTGATTACCATGTTAAAGTCAGTTTAGTGACACTGTAGAGTAAGGCTG -0.13201833 1.35e-01 0.99993
276891 ACTTCTTTTCACATTCAAGTTTCTTTAAAGTTGACTATAGTGCCTTCTGAACTCTTGCAG 0.31952418 1.35e-01 0.99993
14724 TTATTTCTGGCCAGGCGGCAGAATTGTGGTCTGTTGCTGTAGACTCAGGCAGGCTCTCGG 0.3337744 1.35e-01 0.99993
330820 GAACATCGGAGAGCACAGACATAGACATCAAGGATGTTATAGCCCTAGAAACCAACAGTC 0.14979409 1.35e-01 0.99993
20256 AAGCGTGACCATGAATACATTTTAATCAGAAGAGGTTTTTTATTTTAGATACTGGCACCC -0.21492531 1.35e-01 0.99993
18935 CTCGTTGGGACTATGTTTGTGAACATGAGCGTCATAAGTTATGTTTCAGATTTTCAAATT -0.14587914 1.35e-01 0.99993
76551 TTTGCATTGAGGTTACCTATCTACCTTTCCCTCCTCGTCGTGTCGTGAATGTTCGTCGGA -0.17077904 1.35e-01 0.99993
20510 GTTCACAAGATCATTGGGGTCATCTTGTAACCAGCCACTTCACACACTGTGCTGTTAACT -0.15921686 1.35e-01 0.99993
21950 CAAGACTTTATATAATTCACTAGATAGCATTAGTAAACTGCTGGGCAGCTGCTAGATAAA 0.38781365 1.35e-01 0.99993
227619 AAGCAGGAAACCTGAGAGCTAGAGTCCCTGCTTAATTAAATGTCTAAATGGTCTCAGCAA -0.09883455 1.35e-01 0.99993
71472 GCCTGCAGGAGTTTGTGTTGGTAGCCTCCAAGGAGCTGGAATGTGCTGAAGATCCAGGCT -0.16775124 1.35e-01 0.99993
12371 CCAGGGGAATCTTCATTTCTTACGTGATACACTCTTGTGTTCCTTTTATAAGCAATATTT -0.26756793 1.35e-01 0.99993
381353 AGAAGGGCAAGTGCTTTCGAACCAAGTAAAATAGAACTTGAATGTAGCTGCTGCTAATAA -0.13857441 1.36e-01 0.99993
240753 AATTTGACTTTACTGTCAACTTTAGGAAGCAGACCAAGGGATGCCAAGCACGTGAGGGAA 0.19372577 1.36e-01 0.99993
68732 CTTGGGCCTGGCCTGCAATCATAGCCTGAAGGGAGTCTCTCTGGATCTCAGCAACTGTGA 0.13980022 1.36e-01 0.99993
665769 AACAGAGGAGTCTAGCAGCCCTTGGAGAGAAAGCTAGGACAGCCTTTGTGCCTGAGAAGT 0.09707597 1.36e-01 0.99993
18176 ACTAATCAGAAGGGGGAACAAACATTTGCTATGCTCCTGAGTGCTAACACTGGGCTCATT -0.1202397 1.36e-01 0.99993
110751 TTGTCCCCTCCTCAGATTTACAGGCTTGCATCAATAAAGAAATGAGACATGGGCCTCAGA 0.14236564 1.36e-01 0.99993
60533 TTGATGAGTCTCATGTTAATGTCTTGTTTGTATGAAGTTTAAGAAAATATCGGGTTGGGC 1.34974046 1.36e-01 0.99993
14400 TCGCTTGTTTTTTAACCCCACAGATTCCCAACAGCGGTAACTGCTGTGGTTTTTGAGGTA -0.33925544 1.36e-01 0.99993
77220 GAGAGGCACCCTGCTTCGTAGAAGCTCAAGCCTGTGTGTTATAATAGACTAAGCTCAATA -0.69489724 1.36e-01 0.99993
13796 AATGACTAGGGGAACAATCAAGAGCCCACAAGGGCAGGGCATTGCTTGCTGCTGGCCAAG -0.43141527 1.36e-01 0.99993
71819 ATCGGTTCAGTTTACTGATATTGAGACTTTAAAACAAGAATTGCCAACTGGTAGTCGGAA 0.23336261 1.36e-01 0.99993
13798 CTGCTTACGACCGTGTATATATTTAATTTCAGGTAAGGAAAACAAATATGTGTAGCGATC -0.12287743 1.36e-01 0.99993
30925 CCCAAAACCTATCAAAAATGACTCCATGACAATTTACTCCATAGTTAATCATTCCAGAGA 0.27128131 1.36e-01 0.99993
20755 GTTCCCATGGAAACCAACATCATTGTATAAACCTTTGTGATATCAACTTCCTATAGATGA 0.17700131 1.36e-01 0.99993
260315 TGCCGTGCGCTCCTCCTGAAGGGCGCTACCCTCACTTAGGGTATGAGTCATGGGTTTTAT -0.11638649 1.36e-01 0.99993
218581 AGGTTGAGCTGGATGAAGTCTTTGGTTCCCTTAGACCTGCAAACCTGAATTCAGTCTGTT 0.17892704 1.36e-01 0.99993
212517 AGTTTCTGAAAACTCCTCAATTCCGAGGCTCACGTTTTCCCAAACAACTCAGTCAGGGAA -0.19172557 1.36e-01 0.99993
545205 ATTTATGCACTGAGGAATAAGGACATCAAAGAGGCTGTGAAGGCCATAGGGAGAAAGTGG -0.55869054 1.36e-01 0.99993
258410 GAAGTCAAAGGAGCTCTAAGAAAAGTTTTACATCTTCGGATATGTTCACAGACAGCATGA 0.14552927 1.36e-01 0.99993
667373 TGCTTGCTTTTCTACAGCCATAATTTATGGTTGAGGGCCTATGAGTGTGTGACAGGAGTG -0.25539619 1.36e-01 0.99993
108068 AGGAAGTTGGCTGGAGCCTTGCAATAACACCTACCCCATGCCTGCCCCCAAAGTCACCTA -0.17929784 1.36e-01 0.99993
245450 CAATCGGAACCAGACTACCTCGAAGTTCTGGAAAAACAAACTGCAATCAGTCAGCTGTGA -0.15259792 1.36e-01 0.99993
320225 CTAAGGAACTAGACTTCTTGGTGCTCCTTGATACAGTGACATACACCAACACTCCTATGA -0.17756428 1.36e-01 0.99993
546672 TAAGTTATGGGTCCAGATTCTACTACCCAACCTACATGGCTTCTAGTTCCTGCCAACCAT -0.17536032 1.36e-01 0.99993
320148 TCAGGGAACCCCAGGTGATAGCTAACCTCTCCTTTATGCCTCAGGGGCATCTCAGGTCAC -0.16231667 1.37e-01 0.99993
213211 ATTTAGTCGGTCGGACTGCCCAGTTTCTATGAATAAAGTTCTCTTGACAGCTCTAAAAAA -0.11858301 1.37e-01 0.99993
385658 GGCTGTCATGAAATATATGCCGAAATCAGACGTGAAACCAGATCAGAAGTTAATAAAATT -0.23571245 1.37e-01 0.99993
242109 GCGAGGATGACTTACGTGCTCTGATTTATATCATAAAGCAAGAAGACTGAGCATTCTTAC -0.19551355 1.37e-01 0.99993
69397 CTGGAACGTTTTGGACTCTCATGATTCACTTCTGCATCTTCTCTCCGGGTTTGCTATGTA -0.1444569 1.37e-01 0.99993
13367 TCACTGCTGTCACCTCTGCTTTTCCTCCTGGCAATTATTTATTACTAGTGCTGTGGCATT -0.10450185 1.37e-01 0.99993
16647 GCTATGTGCTTTGCTATTCTGTGTTCTTGTAGATTTGTCTTACTGTTTCTCTACTAAGAA 0.11361855 1.37e-01 0.99993
100042784 GAGCAGAAGCCCATGCTGCATGTGGTGGACCATGGCTCTGAGTTCTACCCAGACATGTAG -0.26745409 1.37e-01 0.99993
234839 GCCTGGCTCTCCCTTCCCACAAGTACTGTAGGGTTTTCTAAGTAAAACATTTTTATTTAT 0.16302309 1.37e-01 0.99993
433347 ATCTTACAAGGTGATGCAGAAGGTAACAGGTAAAGTTAGTTCCCTTAACTCAATGAAAAA -0.18066426 1.37e-01 0.99993
234366 TCACTGTGTCATGGGGAAGTCTGAAACCCTGAAGGACAATAAAGAAATGGACCAAATGTC -0.29487368 1.37e-01 0.99993
19221 AGAGAAAACTTTATAGAAGGTTGGGTATTTTTCCTAATCACAAAAATCTCCCGCTGAAAG 0.3643703 1.37e-01 0.99993
21948 TTTGGAGTTCAGTGGATATGCCCTTGACCACAACTCCAGGATGACTTGTGAATATTTTTT 0.31356571 1.37e-01 0.99993
215095 CAGCGAGGAAGGGCACTTCATGTGGGAAAAGGTAGAAATAAAGTTGGGTGTTTGCTTCAT -0.66621163 1.37e-01 0.99993
75485 CTACCTCTGTAAGATGGAAGCATGTGTGGTGGCGATGCTTGTGAGAGTTCCCAGAGCTGA -0.14433241 1.37e-01 0.99993
665725 CAAGCTTGTGACACTTGGGAGTGTTCTCACTTATCTTATGGTTATAATGTAAGTCTCAAA 0.1415785 1.37e-01 0.99993
11806 TTCAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAA -0.11999746 1.37e-01 0.99993
17425 TAACACTTAGTGCTTTAAAAGCAGTGGTACCCAATACGATGGGAATCCGAGTTCCAGAGA -0.14549406 1.37e-01 0.99993
14164 GACCGAGAGGTTCAACCTGCCTCTAGGAAACTACAAAAAGCCCAAACTGCTCTACTGCAG 0.13345952 1.37e-01 0.99993
73693 ATAAGAACAAGATCTTGACTAAGAGCCTCGAAGGATAAAGGACAGATCTCTTGTTTGAGC 0.19318282 1.37e-01 0.99993
50776 AGCAATGTGTAGGTCTTCATATTCTCTAATAAATATTCTCTGTTGAGTTCATTCGCTTAC -0.16165647 1.37e-01 0.99993
56421 CAAACTGAAGGGGTCCCAGGGCACAGGGAAAAAATTTGTTAGCGATGATTCCATTTGTGT 0.18116887 1.37e-01 0.99993
67749 CTTTCTCTTACTTTGTTCTATGTAAGACCAGATTACTGGGTTTGCTGTGAACTCATTTAA 0.32250416 1.37e-01 0.99993
233332 GGTAAAAGGACGGAATCCCAGCGACCTCTCTTGGTCATCCTGTAGTCGAGATGACCTTGA -0.25165948 1.37e-01 0.99993
216635 GGCACTATCCTGGAGACTTCAGCGGCGAAAAAGATGCATGTCTCCTTGGACACGTGTCTG -0.6159724 1.37e-01 0.99993
80782 TCTCCCAAAGGCAGGAACTTGACATTGACATAGGAGAGAGGAACCCAAAAGACATTTTTT 0.38114994 1.37e-01 0.99993
14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA 0.69917996 1.37e-01 0.99993
107581 TTCTGGAGAAAGGAGAAAAGGGGGACCAGGGCATCCCTGGCGTGCCAGGTTTTGACAACT -0.210377 1.37e-01 0.99993
94216 GGCAAAGCATAACAAGTACATTCTGAGCTCTTGTTATCACCTCCTAGATAAGTAACAAAT -0.3739365 1.37e-01 0.99993
100503619 GCCAGTCTGATGTTTTAATATTTTTAGATGGTGATGCTTTGAGTTTAAATGGCCTTTGAC -0.20495971 1.37e-01 0.99993
66533 AAACCGGACAACTGCTTCCCTAGTTCTTAACTTTGCTCTTTTATCAAGGCATCCTGCCAG -0.12034681 1.37e-01 0.99993
71027 TCTTTTGCCATCCTGACGATTCACTTGATGCTGAAAAGGAGTAAACTGAATTTCCTGTAG 0.16259042 1.37e-01 0.99993
319478 GGAGATTAACAGTTTGTACACAACACTATGGTTCTGCAAGTTAAAAATCTGGAGCAATAA 0.3539085 1.38e-01 0.99993
18050 TGTGCCAAAGCCCACATAGAGAAGGTGACAGATGCCATGCTGTGTGCAGGAGAGATGGAA -0.65962829 1.38e-01 0.99993
216874 CACTTTCTACTTGTGCATGGGCTTGGTTTATACGAATTGCCATTAAACGTCTCTGCACCA -0.37593359 1.38e-01 0.99993
14419 TGTTGATGTGCCCCTGCCTGAGAGCAACATTGTCCGCACTATAATGGAGTTTCTCAGTTT -0.15267257 1.38e-01 0.99993
15444 TTCTGGGGTCTGCACTGTGTGTGTGTGTGGGCCTCTGGAGAAGTGAAACCTGCAAGGAAG -0.21795838 1.38e-01 0.99993
259023 AACCAAGAGGTGAAGCAGGCCTTGAATAGAAAATGGAAAATGTGTGTGAATATTCTATTT -0.41289353 1.38e-01 0.99993
73533 TGTTTCAAAGCCCCAACCAGATCTGTAAACGGGGAACTTTGGTACAAAGCAATATGGTAA -0.15655217 1.38e-01 0.99993
210044 ATCCTGCAGACGCTTGGCTACACGTGTACATGTCGAGGTATCATCAACGTGAAGGGGAAA -0.28835824 1.38e-01 0.99993
269180 TCCAACACATTACCTGTTGCATGTGACTTCAGGGTTGTTCCTAATCCAAGCACTAGTGAG 0.31938128 1.38e-01 0.99993
238123 GACTACTTTAAACACTTTGAATGCATGGATTTTGTTTTTGACAACACTGAAGCTATTGCC -0.1849911 1.38e-01 0.99993
269338 CAGGCTGTTTATACTGCCAGTGTTTTCTCCAGGAGTCTCCCTGCTTATCCCTTCCGTTTT -0.15542115 1.38e-01 0.99993
14344 GCCTACTCTGTCCATCTGAGAAGAACTGAGTGAGTAGAATTCAGATGCATGTCCACTTCT -0.12836967 1.38e-01 0.99993
70876 GACACAAACATGTCTTTTTCTGCTCATGGTAGTGTGCCACTACATTTAATTCCTTATATA 0.11617752 1.38e-01 0.99993
77305 TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA -0.1272306 1.38e-01 0.99993
207607 AGAAAGAGAGACCATTCAAATGCAGGAAAAGCTGATGGAACTCTCTGAGGAAAAGGCCAC 0.36722907 1.38e-01 0.99993
73914 TTACCACCGGCACTTAATGCTAGTCTTTCTGCTAGGGATACTGACAGTCTATTTGCTTCC 0.15497889 1.38e-01 0.99993
209488 GGTGCCAGCTAAGGGAGCTGATTGTCCTAATAATAATAGAATTACTGCTACCTCTTTAGG 0.18156416 1.38e-01 0.99993
68861 CAGCAGTGATCTTTACATTTTCTTTGCTGAAAAAGCACTGACAAAACTAAACCACCAAAA -0.30547949 1.38e-01 0.99993
217666 CAAAATAACTATCATGATAGAAGCAATCCTTACTCCATTTGGGTCTGTATTGTATATCCC -0.1307377 1.38e-01 0.99993
101604 AGAGATATTCCAGGAGTGTGGGGGATGGTCTTAAAGGCACCAACATAGAGGGTGAAATAT -0.10199519 1.38e-01 0.99993
15586 AATAGTCACATAGTGAATCAGAGTTTAGGACAGGCACTATCCATTCTGAGCCTAGAAGGA -0.14508836 1.38e-01 0.99993
434156 CTACATAGTACGTACATATATCAGCATCTGAGGTTTGATATGTTCAGTTATCATGGAAGT -0.17533971 1.38e-01 0.99993
258392 CAGGTGCCCTTGTTCTTGTTTTTTCTGGTGATCTATCTCATTACTATTGTAGGGAACCTT -0.19224411 1.38e-01 0.99993
67470 ACACGGTGGCAAAGACAAATCCAGTTGTCTCAGCTTACAAAGTGTTTTGTGATGGAATCA -0.13406552 1.38e-01 0.99993
72083 CCTCAAACCCTTCTGAGGAGCTGAATGTCTGTAGCTTTTTGATACTATTAAAAAATTTAG -0.15006775 1.38e-01 0.99993
11984 TAGTTGGTCTTGTAAATGTGCAGTGTCCTAGTGCCCATTGTCTGTCGCCCCCGCCTTGCC -0.12342292 1.38e-01 0.99993
19363 GGACTGCGCTGCTTGGAAAAAGGAAACGGAAGCCAACATAATGAGGATTAATTGGTTGGT 0.48662049 1.38e-01 0.99993
258582 GTCATCAATGCTATGAAACAGGTGATCAAGGGGAATTTCTGTCAGAAAATTTTGGTTTAA 0.1515246 1.38e-01 0.99993
258962 CCTATATCAGTCCTGCTTCCAGCTACAGCCCAGAAAGAAGCAAATTTACCTCAGTGCTAT -0.29319395 1.38e-01 0.99993
78631 GCCATCGTCACGATGTTATGGGCAAATTTTACAGCATGATAGTCATAGATAGGATGATGA 0.59596297 1.38e-01 0.99993
18439 TTCACTTCTCTCTTTAAAGGGAACCATCTTCTAAACTCTTCCTAATTTCGTGTAAGGGTT 0.27933235 1.38e-01 0.99993
16682 CGGGCAGAGATTGAGAACATCAAGAAGCAGAGCCAGACTCCGCAGGCATCTGTGGCTGAT -0.1033574 1.38e-01 0.99993
279706 CTCCAAATTGCTCCTTTTGGATTACTCATTAACCCTGAGTTCTGATGATATTAAATAGAG 0.62669808 1.38e-01 0.99993
11815 TATCACCCCACAAGTTCACTTAGTTCCTGTTGTATAGTCTGTTGTATGCTTTTCATTTAA 0.28409869 1.38e-01 0.99993
19229 ATTGGTCTTCCAGGGAAAGCTGAGAAGAGTCCATCCCCCTTGCCACTTTGCACGACACCC -0.23627972 1.38e-01 0.99993
16184 GTGGCTTCTGTTTGATCTCTCTCAATGATAGATTGTGACCTAGAAGTATAAGCTAAAATA 0.5119551 1.39e-01 0.99993
70465 GCTGTTGAATTGTGGGAGCTAGATGAGAACGAGACACTTATAGTCAGCAAGTTCTGCAAG -0.17454289 1.39e-01 0.99993
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 0.71331201 1.39e-01 0.99993
56032 GATGAAGAACCTTATCCGGAGACTACAGAAATATCCAGTCCGAGTGTCTCGGGAGGAGCG -0.10642399 1.39e-01 0.99993
99035 GGAAAGGCCAGCGGGAAGTGGGTATGATCAAAATGCACAGTTTACACTTAGGAAAATTTC -0.14691734 1.39e-01 0.99993
103573 GATTATTTGTCGACCAAAATGATGCCAATTTGTAAATTAAAATGTCACCTAGTGGCCCTT 0.11143536 1.39e-01 0.99993
330956 AGAACCTAACAGAACCAAAGGGACCTTACTGTCCAAACAGCAGCATTTTGGAGCAATCTC 0.11410277 1.39e-01 0.99993
171198 GTCACAATCAGTCCCAGTACCTCCTTGTTGGCAAAATTTAAAAATAAAGTAAAAACACAC 0.11700135 1.39e-01 0.99993
14186 GAGAGACGAGAAGCCTGTGGGAACGACAGAAGAACATGGCATTTTTATAAATTATTTTTT -0.2394944 1.39e-01 0.99993
24004 CATTGCCACAAAGTGCTTTGATGATGTAATACCTAATAAAGGGTAGGATGAATATTTCAC 0.17589224 1.39e-01 0.99993
18198 ATCCTGCAGCGCATGTGCGAGAGAGCAGAGGGAACGACAGATGGCAGAGCCCATTTCTTT 0.16889161 1.39e-01 0.99993
100039307 CAGCCTTGGCTGTAATGTGAACCTCTTAGGTCGTTTACAAGACTCTCCAACATCAATGAT 0.27047083 1.39e-01 0.99993
17428 AAAGAGGTGGCCCTTGTTTACAGTGAGGACTTGGTCACTGTGTCTCTGTTTCCTGAAATA -0.1884117 1.39e-01 0.99993
231103 GAGGAAGAGTCCTGTTCTCAGCTGGATCATTTCCATTTTTACTGGCATCTTCTGATCTTA 0.46772582 1.39e-01 0.99993
319997 GGGGTTCCAGAACATAGAGCTTCCTGCAGGATCTCACACCTCCTGTGTCTGGACCAACCA 0.2120349 1.39e-01 0.99993
70530 TCAGCACTGGCAAGTATTTGTGGAGTTTCCATGGTGATGTTTACATCCAGGGACAGTCTT -0.36144238 1.39e-01 0.99993
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 0.72936386 1.39e-01 0.99993
15891 TGCTACAGCCCCAGAGTGATTTCCGCAAATGCTTTTGTTTGTAGTGGGCTTCTTCTTTTA -0.23250458 1.39e-01 0.99993
20185 AACTAATTATGGCACTGTAGGATCACCTTTATTCATTAAGAATTGCTTGCTGTGATTCAG -0.13322275 1.39e-01 0.99993
666955 GATTTGTTATGTAACTCACAGCTAATGGATACATTTGGTCTACCTGCTCCTGGTTCCTGC -0.13730801 1.39e-01 0.99993
100233175 ACCTGTGCTCTAGTTGGGGAACTCATTTCTTTTGTTTGATTGGAACAAGTTCATCACAGA -0.11004851 1.39e-01 0.99993
194854 TTTCAGATTTGATACTCTTCCGGTTTCCCTGTGCATATGGTCCATCCACACAGGCAAGAA -0.10620253 1.39e-01 0.99993
242557 GCCTTAAGTGTGCTGTGAGTTTACTTAAAGACAAACTTGTGATATAAGAGTGTAAGAGCT 0.16228842 1.39e-01 0.99993
56533 AGCTTTTGTGGAAAGTACCACCAGCTGTACTTCTGAATCCTAATTTTCAGTTGACAGGCC 0.22290276 1.39e-01 0.99993
258767 TCTCATATGTTGTCATATTCACCACTGTTATCAAGATCCCCACTAAAGGAGCACTACAAA 0.18806802 1.39e-01 0.99993
16576 GTATCCTACCTGGAACTCTACAAGGAAGAGTTCCGAGATCTGCTAGAAGTTGGCACTGCC -0.2058825 1.39e-01 0.99993
100042680 GGTTAGCCATCCGTATAAGGTTAGGAAAGGATCATTACAGATATAACGTTTTAAAAACTC -0.12010652 1.39e-01 0.99993
195531 CAAGTGCTTTCCCCAAAAATCCTATCTTAGTATTCATCCGAGAATTCATAAAGGAGAGAA 0.50854102 1.39e-01 0.99993
103012 GTGGGGGGCCTCAAAGCTTCCTTTCCTTTCTGTTTGTCTTGCTATGTTTTTATATTCCTT 0.12566483 1.39e-01 0.99993
94212 AAATCTGACTTGGGAATCCTGAAAGTACCAGACTTTCACTGATGTCTAGTGACCCCTCTA -0.2087795 1.40e-01 0.99993
29812 GAATGTAATTCTCGCCTCGACCCTATAAATACAACTTTGCTAAAGGTAGTGTATTTGCTC -0.16037568 1.40e-01 0.99993
234594 TTGGCCAAAATTTAGAAGATGCTGTGAATATCATTTTGAACTTGTGTAAATATATGAAAG -0.11494023 1.40e-01 0.99993
56878 GCAGCAGCCTAGGGCTTTTAAAAGGTAGTCAATAAAAGTTGCTGAAATTTTGGCTTTTTT 0.42549757 1.40e-01 0.99993
434484 ATGAAAAGAGTTGACTAAAATCAGAGACATGGCTGGTGTCACCTGGCCATGTCTGTCTCA 0.34018099 1.40e-01 0.99993
329065 TCTGAGAACACATTGTGCTGTGGGGGCTCCAGAAGTTACTGAGTTACTAAGTATTGAGAG -0.13868447 1.40e-01 0.99993
218734 TGGCTACTGAATTCTGACAGGCTTATTTGAAGATTACCAACGTTGTGAAAACAAATACCC 0.14675582 1.40e-01 0.99993
258487 GCAGCAGAATGTGACCTGGATAAAGATTTTAGAGCATTTTTTAGGTAGCTTTAGTTATTG 0.12272807 1.40e-01 0.99993
104027 GTTAAAGGTAAAGGGATGATGCGATTTTGGAGTGATTAGTAGATTTGCCCACATATCAGG 0.19533284 1.40e-01 0.99993
83925 TTAACCAGTCTGTGACTGTTCCAGCAAATGAAGTTCAAATTACCTTCCTGATGCTATGTT -0.20431445 1.40e-01 0.99993
17395 CCAACCTTTTCCAGCTACTTTAGTCAATCAGCTTATCTGTAGTTGCAGATGCATCCGAGC -0.20453777 1.40e-01 0.99993
74490 TTCTAGTTAGAGGTGAGAGGACCAGAAGCTACTAGTGAGAGGTGACTACAAACTCCCTAT 0.14889714 1.40e-01 0.99993
71846 AGGCATGCTGATATTGTTTTTTATAGTTCTGTAACCCAACACAAAGCCACCAATGCTCTT -0.60746726 1.40e-01 0.99993
21917 TGCACATTTTTAATAATCGAATAGACAAGGCAGTGTACAGTTTTATGTCTGATAGAGGAG -0.10743948 1.40e-01 0.99993
66053 AAGAAGACACAGCATCAGGTGGATCCAGAGGCCAAGGTCAAGATGAGTCAGCCCCAGCCT -0.10144557 1.40e-01 0.99993
13014 TGATGTTGGTGGAGATAAATGCGTGCACTTGAGGGTGTTTCAACCCCTCCCCCATGAAAA 0.10413995 1.40e-01 0.99993
66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT 0.61085948 1.40e-01 0.99993
30059 GGACTTGTCACGCTGGTTTGTGACTGTGTATGTGTGTATATGTATATATCTTATTAAAAC -0.14297184 1.40e-01 0.99993
69706 CCATATGGCCCTGATATAATTCCTTACCATCTTTGTCAAGATTTGGATACTGCCAAAACC 0.40741033 1.40e-01 0.99993
67057 TTCATTGGCACAGTGGTACTCTTGTAACGTGCTAGTTGTGAATAGTTTATTGCATACAGT -0.19629941 1.40e-01 0.99993
230674 CTTCATACCTTGCTCTGTATACAGGAGTCAGATTTATAATACTTCCCCTTTTTTGTTACG -0.13506872 1.40e-01 0.99993
27361 TCACTAAAGCTTGTGCCTGTCTGTTCTGGGCTCTGCAGGACATGGACTGCGAATGGCCTG 0.12191571 1.40e-01 0.99993
258498 CTTGACCTCTTTAACCTTTCAATTAGTCTACTGTGCATCCAACCAAGTGGACTATTTCTT 0.14612858 1.40e-01 0.99993
57776 GCAGAGTCAAAAGGGAAATTTATTGTCTGGGGAACAATATGTATGTAGTTCTCATTTGTT -0.13034755 1.40e-01 0.99993
234730 CTGGGGGTAGTGGGTTCTCAACACCCGCATCCTTGGAATAAATTCTAATTTTCAAGTTTG -0.15250624 1.40e-01 0.99993
68957 AGGGCCAGACTGTGCCTCTTGTCAGCAGCTCTGTATCTACTCACTGCTGCCTGTCTTGCT -0.26298077 1.40e-01 0.99993
54638 CTTATATGTTCCCATATCTGATCAGGGTGACTGTCCAGCTGACCACAGTTTATTGGATGG 0.11519046 1.40e-01 0.99993
546747 ATTTGCAATCCACTACGCTACCCTGTTATTATGACCAACCAGCTCTGTGGAGTAATGGCT 0.16005205 1.40e-01 0.99993
276852 AGAAACACTTTACATTTGTACCAGGTCGCGAAGGGTGCAAATAATAAAACTGCTGAAATC -0.18904875 1.40e-01 0.99993
320832 GAACAAGCAGAAGTCATTGAAACCCATACTGTGCTGGTCACTGAACATCAGAGAGTGAAA 0.38626492 1.40e-01 0.99993
16971 TGGGGTTAGTTCAGGGGAGGTGGAGTCCTCTGCTGACCCTGTCTGGAAGATTTGGCTCTA -0.11298618 1.41e-01 0.99993
231510 CCGGAGCAACCCTGTGTAGAAAGTGAACTGTCTTACTGACTATGAATAAATTTTATATTT 0.55817168 1.41e-01 0.99993
83771 TTATCCTTGATCCTATTATGCCCACCTAAGGCCTGCCCAGGTGACCCACAAAAGGTTCTT -0.13039828 1.41e-01 0.99993
219132 CCATGGGTTTATGCTCACTATCATATCACATTGCCAATATTTAGCACACTTAATAAATGC 1.00629806 1.41e-01 0.99993
29873 TTCTAAACCTCTGCTGGCACTCAGCTGACTTTTTGTTTTGTACTTTGACCCGCCTTTTTT -0.13517083 1.41e-01 0.99993
20667 ATTTAAGGTGGTGTGCTCCATAAATTGTGTTCCTTCATTTCCAGAGTAGGAAGCTGGGGA -0.20530759 1.41e-01 0.99993
320155 TAAATTCATGGACATTTTAAACCAAAATTCAATTCTGATGTACAATGTATTAAAAGGAGA 0.18539098 1.41e-01 0.99993
58804 TGCTGACCTCCAGCTGGACGACGTCATCGGTCTGTAGTGTCATAATTCCCTCAACCCCTC 0.17089925 1.41e-01 0.99993
68767 TAACTGTAGACCTGAACCCAAGCCAACAGTGGCCTTTAATAAATGAAGAGTAGCCATGCG 0.09815442 1.41e-01 0.99993
24110 CCAAGCTGGTTGGAGCCTCCAGCCTTCAAAATTCTGAATCTAATAAACATTAATGCACAC 0.92774599 1.41e-01 0.99993
66082 TTTAGCTTCTGTGCATAACACAGACAACAAGAAGCTGAACTGAGGCTGTTGCCACAGCTT -0.16533601 1.41e-01 0.99993
100040475 AGAGCTGGGTACTAAGTCTTTCAGGTTTCTGTTTTAATAGCAATTTCATAGCGGCAATGA 0.20556817 1.41e-01 0.99993
384813 TCGGTGCCAGAATCAGATTCTGGTGATAAAAATCTCACTAGAAAACAACAGGATCTCTGA 0.11955929 1.41e-01 0.99993
11475 GTTTTGTGGATCAGCGCCTCCAGTTCCTTTCCAAATCATTCCTGCCCAAAGCTTTGATTT 0.37923355 1.41e-01 0.99993
231842 TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG 0.33028179 1.41e-01 0.99993
631105 CTCCAACTTCTAGAAGCCCCGCATGAATGCAGCAAGGGGTGACTCCAACTTCCAGAAGCC 0.16530068 1.41e-01 0.99993
631784 CCACATGTAATCAGTGTTGAATATAGAGCTATCTATCTCAAAGATGATTAAATGCATGGC -0.11971208 1.41e-01 0.99993
77011 CAGGAATTCTTGGGGGACATATTTAAGATGTAAGCCATAATGAGATTACTCCTGTTTATT 0.20572661 1.41e-01 0.99993
76123 CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT -0.1795178 1.41e-01 0.99993
22339 CAGATCGGTGACAGTCACTAGCTTGTCCTGAGAAGATATTTAATTTTGCTAACACTCAGC 0.42081903 1.41e-01 0.99993
574438 ACGCCTTAGTCATTCATTCTCTTATCCTTGCCCTATGCTGTATTTATTAAAATGAATGCT -0.12139676 1.41e-01 0.99993
110078 CCTGAAATCCTGCACGTAGCTGAGTGAGCTTAAGCCTTTAGTTTGGGGTGTGAATAGGGA -0.28482081 1.41e-01 0.99993
12316 GGATACCTGGAGCAGTTTTTACTGTCAGTGTAAACTGTTTAGATATGACTTTGTGTAAAA 0.32575998 1.41e-01 0.99993
76629 TTCAGGCAGTGACCAGGCCCGCCAGCTTCCGGAAGTCATCATAACCTGTGCTCTGAGTTT -0.15519937 1.41e-01 0.99993
72278 ATGGCAATCTGGAGAAGTTGGACGGATGTATATATAGACACTTTGGGCATGTTTTTGCCC -0.17417149 1.41e-01 0.99993
14160 CATGTAAATACGTAGTGCTTGTAAATAGATCCAGAATTTGCTTTTCTACTGGGCTCAAAA 0.36813978 1.41e-01 0.99993
70552 GAAATGTGCTTTACTTTGCAAGCAATGGTTGGTTCAATAAATTATGAAGTTGTCACTGCC -0.12766959 1.41e-01 0.99993
14723 GGAGCACTATCCCTAAATATCATGAGTATTTTTTCCCTGTTTAACACTTTCTGGTTTTCT 0.16251626 1.41e-01 0.99993
381306 CGTCAACAAGAATTGGTTGCTAGAGCAACATACTTTGGAGGCATTTACTCAGTTTGCTGA 0.20051835 1.41e-01 0.99993
76933 CCAAAAGGCACCTTCAGAACCCTCACTGATGTCAAAGAATGATGAAAACAACAAAGTATA 1.0513006 1.41e-01 0.99993
105892 GCCCTACTGCGTGCAGAAAGAGTTCAGGGGCTGGAATGCTACCAGTGTTTTGATGTCCCA 0.97779691 1.41e-01 0.99993
72117 CGAACATTCAGTGAACTCATTTACTGTCCTCAACAATTCAAGACATATGAGTTAAGTATG -0.1832252 1.41e-01 0.99993
12057 AGCCTTGGCTGACCTGGAATATAATCACATTTCCAAGAGAATAAAAGACACATAAGCCCT -0.10891938 1.41e-01 0.99993
83922 CCCACCAATGGATGTTAGTGTTGGAAATGACTGTATATACGTACAGAGACTGTTTCGGCA 0.10066027 1.41e-01 0.99993
19888 CACTTAGAACTGTTTGGTCAAGTTTACTTGTTAGATATTTGCCAAGTTGAGAAACCCTTA -0.1411811 1.41e-01 0.99993
67078 AGGATGTGAAGAGCAATCAGGAAAGTGACTGCATGTTCAAGAAGAAAATGGTCCCTGACT -0.11251666 1.41e-01 0.99993
238323 TTTGAAAACAGAATAAAGCGCTTTATTCTCTGGCTGGCTCTCCTGTGTCAGAAGAGCTCG -0.1481076 1.41e-01 0.99993
544696 AAGATACTCTGTATATACCTCTTAGGTTCATTTGCTCTGTGGCATTTCTTTGTTTGTTTG 0.11848551 1.41e-01 0.99993
106869 CCTCACTTACAGAAACTTTGCGACGGCATCAACAAAATGTTAGATGAAGAGAACATATGA 0.26718648 1.41e-01 0.99993
723792 AATGGAGTCTGAGCATTGGCCCTGCTATTGACTACCTCAGGGGATAAAATGAAATAGTTG 0.15821953 1.41e-01 0.99993
259302 AACAACTGTCGTCTTTCCTTCTCTTCAGTGCTAACTTCTCACCTTGAAGCGCCTTTTGAG -1.33308235 1.41e-01 0.99993
69216 GCCTTCTCATCTGCTGCTCACCCGGGGTTGGTAGGGAAATGGCCAGGAAATGACTACTGT -0.14644925 1.41e-01 0.99993
380794 GTGGAGCTGAAGCAGAAGATCTCCCCTGACTACAGAAACATGATTGGGCAGGGAGCCTAG -0.1340342 1.41e-01 0.99993
53872 GGGCAGTTTTCTTCCATGTTTAGTTTTTGTCTCAACATTTGGAAGCTATTGAAGGTTTTA 0.14570641 1.41e-01 0.99993
67157 GTCCAGTGTATCTCAGTGGAAGCGCCATTCCATGTGGGATTGGAACAAATACTTCACAGA -0.117596 1.41e-01 0.99993
18117 ACGGAAGCATATTTTTACATTTATAGAGGAATAGTAGGTTAGCCGGAAGGGAAGCTGCAA 0.11516487 1.41e-01 0.99993
240444 TCTCAGGACCCTGAGACCGCAGGCGCGGCAGGGAGCTTGCCGGGCCGGGTGGGACCCTGA -0.58558321 1.41e-01 0.99993
71096 GATACAGCTGCCATCATGTTTGGTGACAAGGATTGATTGGTGTAAAGTATGTAAATAATA -0.11077106 1.42e-01 0.99993
68262 CCGGAGACAGAGTGAAAAGTGCTTTGGGTAAGATGACTAAATTATGCCTCCAAATAAGAA -0.20727403 1.42e-01 0.99993
50911 AAGCTAAAGTGGTGGATCTCTGTGTGTGTGTGTGTGTATACATACTCAGTGCTAACAGCT -0.49508178 1.42e-01 0.99993
13821 ACTACAGCATCCAGACATGCTGGTAACCAAAGCTGTTGTCTATAGAGAAACAGACCCATC -0.19908904 1.42e-01 0.99993
27027 CCTACCATGGCTTGGATAGAAAAGGCAGATACTCCCTGACACCACCAAGATCCCATGGTT 0.22618273 1.42e-01 0.99993
330319 ATGTTCTTTATATTTTATTGAAGTTCCCTGCTGTGGATTTATTCCTTTGTACCTAATAAA -0.33045635 1.42e-01 0.99993
231506 GGGGAGGGTTTGGTCTATAATTTTTAAGCCCTATTTACATCCTAAGGTAGAAAGATTATA -0.1061766 1.42e-01 0.99993
229900 GGAGAAGAATAGCTCATTGGGTGCAAAAATCCTTGATGGGTTTGGAGATGTATTAATTTC 1.04395096 1.42e-01 0.99993
260297 GAATTTCTCCTTCATCTCCCTGGCCGTGGGCATCGCAGCCATGGTGCTTTGTACCATCCT -0.20294689 1.42e-01 0.99993
626578 AATATGATTTATTTAAGGTGTACCCACCCCAGCTCCTCTAAGACATCCTCAAATTACCCT 0.59015196 1.42e-01 0.99993
66995 CTGTGTGCCTCGGTATATATGTATTGATAAAAGTGATCACATATAAGTGCTGTTCTATAG -0.11787732 1.42e-01 0.99993
15978 CTTCCCTATACAGCTGAAAACTGTGACTACACCCGAATGACAAATAACTCGCTCATTTAT 1.18757505 1.42e-01 0.99993
75906 TATCATGCGGGCAGATTTTAATAAGACTAATGAGCTACTCACGGAAATAAATGCAGCTTT 0.1768404 1.42e-01 0.99993
56224 CACTCCTTGGGTTTACGTGGCTCTGCATGTTTGTATCGGTGTCTGTTTTTAGGTAGAGAT -0.16291499 1.42e-01 0.99993
170461 GGCATTAACCTTGTACAGAGTACGTAAAATATTTTGTCAAAGTAAGAACTTCACTGGACA -0.20170507 1.42e-01 0.99993
75029 GAAGAAGTTTCTCCTCTTTTGGGCCCTCTGTTATTAGTAATACCTCTAATAGTTTATACT -0.14163284 1.42e-01 0.99993
258508 TATAGTCTGAGAAATAAGGATGTTAAGAGTTCATTGAGGAGAATCCTAAACATGGAGTAG 0.15621297 1.42e-01 0.99993
22059 CCTTAGAGTTAAAGGATGCCCATGCTACAGAGGAGTCTGGAGACAGCAGGGCTCACTCCA -0.15812378 1.42e-01 0.99993
226470 TGGTTGAAGTCTTGGTGAAAGAAAATAGGATTTACAGCAGCGCTTCACAGATTAAGTTTA -0.11270937 1.42e-01 0.99993
670764 ACTTTAGTGTTGATCTTCAGAGATCCTAAAGATCCTTGTTCTGTGCTCTTCAAATGTTGA -0.21320873 1.42e-01 0.99993
257910 GTTCTTCCACTGGTGTTTCTCCTACTGAGGCTACCCTACTGTGGCCATCAAAGCATTCCT 0.41910864 1.42e-01 0.99993
14812 AAGGTGTTTATCTAAGGAAGGCCATTGAACCTCCTGCTCCTAAGAGAGAAGAGGCTTTCT -0.22814997 1.42e-01 0.99993
215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG 0.71693929 1.42e-01 0.99993
619941 TGCTTGGGTTGCTGTCTACTGCAGCTTTGCCAACTCTCGGAGCTCGGAGGACACTAAGCA 0.50260502 1.42e-01 0.99993
22084 CAGAAACAAGAGAGGTAATAACTTAGGGGACGGATAAAGGAGAAGTGTAGCTTAGCCCTC -0.13647681 1.42e-01 0.99993
68636 ATTAAAGAAAACGATGAGATCGAGGCCGGCATAGATGGGGTGGTTAGTATGAGGTTCAAG 0.14038025 1.42e-01 0.99993
14651 TTAAGTTTGCACGCCACGTGGAGCCCGGCAATGCTGCCATTCAAGAGAAACTAGCCTGGG 0.11154697 1.43e-01 0.99993
234479 TTTCAGCTTGTAGAATAAATGAGAAATGCCTGTTGGTTTAATTAAAAGAACCGCATTGGC 0.18337313 1.43e-01 0.99993
66634 GCAGGCATTCAGCTAATGCAAAAACAGATTAGTATGTGTTCAGGTGAACTTTTACTTAAA 0.1837298 1.43e-01 0.99993
223732 AAACAATTACCAGGGGTTTCTGGCTGAGCTCCGCAGAACCTACAAGTCCCCGCTGAGGCA -0.10231249 1.43e-01 0.99993
11853 GTTTCTGCTTTGGGTAGTAGCCTTGTTATTTGACTTAACTTGGTGGGGACATGAATAAAG 0.20642126 1.43e-01 0.99993
209003 AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC -0.14544709 1.43e-01 0.99993
18263 AAAGTATCTTGAAATAACTGGGCATCGGGGAATGTTTGCAAGTATCCTTAAAGAAGGCAC 0.18953005 1.43e-01 0.99993
228482 CTCGAAGCACAGAAGTCTACGTCTTGTAATAAATCAAGTGTTGAGTTAACTTCTAAATCT 0.13930307 1.43e-01 0.99993
105727 TGACCACCTTTGTAGCTCTGTTTGTACTGTTTAAAAAATACATCAGTTTAGTTTGCAAGC 0.23711397 1.43e-01 0.99993
94176 GAGTAACGAGTATGACATCCTCGTCTTTGATGCTTTGATCTATATAATAGGACTCATTGC 0.25629028 1.43e-01 0.99993
171184 CTTCTATTTTTGGTCTCTCAATTTGTCATTCAGCATTAACCACATCATCTATACTGGTGC -0.19296328 1.43e-01 0.99993
14583 ATTGTCTCATTTTCAATAATACATGGGGGAATTTGATTCATAGAATTTAAGTCTAAACCT -0.15546354 1.43e-01 0.99993
114873 TATTCCAAATCCTACACCCTGGTGTAGGATGGCCGACAAATGGAGAAGGGCTCCACACTG -0.35187206 1.43e-01 0.99993
22589 TTAATCATGACTCCTTCTAACTACCAGCAGATTGATATGAGAGGAATGTATCAGTCAGTG -0.11859472 1.43e-01 0.99993
110382 CATCCCTTGGTAAGCACAGAGTCTTCTTCAGTAATAAAGACAGCCAATCTCTAGGAAATG -0.12456278 1.43e-01 0.99993
66284 AATTCACCTTTAAGATGGTCCATCAACTGGCTTCATCTTTTCAAAGAAATATACCTTTGG 0.10924078 1.43e-01 0.99993
72112 GTCAGCTGTAGTTTTGTCTAATGCTTTTCCTTAGCAGCCAAGATAAACCTTTAGGAACCC 0.2031637 1.43e-01 0.99993
404237 TCTGGTTTCTGTCACCCTGGATTGAGGATCGTTTCATTGTACTAGATTATAGACTTTTTT -0.10805626 1.43e-01 0.99993
100039888 AATCTCACCAGATGCTACTGTACTTGAATGGTTAATAAACTGCACAGTGCTGTTAAAAAA 0.37412968 1.43e-01 0.99993
108903 GGGCTTTTGCACGTGCCTATGAACCTCAGGAGTTGACACCTTTTGTGACTGCCATTTCAA -0.11226173 1.43e-01 0.99993
68107 ACTCAGGGTACAAAAAATTCCAAATTTCCTTTGAACAGTGTTTTGTATTCCAGTTTCAGG 0.19790744 1.43e-01 0.99993
68889 CAAAGGAGTGAATTGGAATAAAGAAAAAAGTTGCTTCAGAGACTTAGTGGGGCTGTGCAG -0.17736413 1.44e-01 0.99993
26943 GTCAGATATGTCACCCAAGTAAATGCTTTGTAGATCTGATTAAAATGAAAAGCTCACTTG 0.12765482 1.44e-01 0.99993
232798 CATTACCTACTTACCCCATAGCTGTGTGTAGACTTTATTAAAATCTGGGTTTTTGCTTTT -0.15768536 1.44e-01 0.99993
58205 CTGGCAGCCTCTGAAGTTCTAATTAACTGGAAGCATTTAAGCAACACGTTAAGTACCCCC 0.45825345 1.44e-01 0.99993
217258 TATTGTGGCCTTTCAGAATTCTGGAGAGATGGGTTTGTGGCTCTTCAAGCTGCCATTAAC 0.38941734 1.44e-01 0.99993
51944 TTCACAATAATCCTAGAGGAAATGGAGCAGCTCTTAGAAATGTAGCTCAAGGCAGGTGGC 0.16624864 1.44e-01 0.99993
74153 ATTCCTACATCTTCAGCTCACAGCAGATACTTCAACAATAAAAACTTGTTGACGGAAGGC 0.97293345 1.44e-01 0.99993
14299 CCTCCAAGATTCTTTCCAGTGTGTTTCTGCATTTACATGATCTAAAGATGCATGGGGACG -0.1472878 1.44e-01