/data/wwwroot/iBAD/data/iBAD_0000173/gene_expression_table/logFC.1_DE.txt

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 136

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 137

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 138

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 139

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 140

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 141

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

"ID" "adj.P.Val" "P.Value" "t" "B" "logFC" "GENE_ID" "SEQUENCE" "36844" "1" "0.00035" "-5.9340336" "-2.99" "-0.66069248" "245038" "ACAGATTCTGTTTTCTCCTTGTATTCACATCCATGGTAGGCTACAGGAGTGTGCTTCACA" "31934" "1" "0.000474" "5.6691427" "-3.03" "0.5714706" "" "CATGGATCTTTTGCTGAAATCCTGTCCCCAAGGCTGTTTTTCAGAGAAGTCACCATGTCT" "5298" "1" "0.000771" "5.257668" "-3.1" "0.52981926" "214763" "AGCCTTTTCCAGTGGTCTGTAGCTGTTCCCTGTGTAACAAATAATGTCTGCCATGTATGT" "32718" "1" "0.000942" "5.0939206" "-3.13" "1.65387706" "236312" "CTGATAAAAGCAAGCTCTTTGGTTTAGGAAATGGCACTTATTCTTTCTACAGTTTTAGCA" "17294" "1" "0.001228" "4.8815279" "-3.18" "0.42260189" "667567" "TTCAATAAAAGGGAGAAAAAGTTCTCCTTGCACATCGCAGACTCTCAGCCTGGAGACTCA" "62223" "1" "0.001452" "4.7503055" "-3.2" "1.08917237" "12966" "GACTGGGGCTCTGTAGATGCTAAGGCGGGCTCTTTGCGGAGGGTGGTAGATTTATACTAA" "48861" "1" "0.001785" "4.5906498" "-3.24" "0.52732105" "237759" "TTCAGCACGCTTCCAGAAGCCACCCTGACACGGGAGCTTGTATTCTCGGACCTTGGGAAA" "7312" "1" "0.001785" "-4.5906468" "-3.24" "-0.38344686" "67876" "AACCGCACTTGGTAAAGGCATCTTGTACTGATGGGAAACTTTTCAATCATTTGGAGACTA" "27988" "1" "0.001818" "-4.576616" "-3.24" "-0.53052114" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "910" "1" "0.001999" "4.5046423" "-3.26" "1.21747063" "216859" "ATCTCGACATATTCCGAGACTTCTCCCTCATGGCGTCGGACGACCCAGAGAAACTGAGCC" "38321" "1" "0.002094" "-4.469434" "-3.27" "-0.38858682" "" "GTTCTCTTGCTGCGGATTGTAACTCAGTAAAATAAAACTCTAGAGGCTTGTGATTTATCA" "38657" "1" "0.002471" "4.3451725" "-3.3" "0.62642984" "107221" "ACAACATGTCGCTGTTCAGGAACGAATGGAGGAAGATTTTTTGCTGCTTCTTTTTTCCAG" "42177" "1" "0.002475" "-4.3439126" "-3.3" "-0.46372393" "100294583" "CCATAATTCCTTTGCATTTTCTATGTTGCTGACAGTTTACAATATGCATCAGTGAATCAG" "43431" "1" "0.002678" "-4.2856617" "-3.32" "-0.61771847" "67498" "GAGTGTATCAAAGTCTCTTGCACTATGAACATTGTCTAGCTGTATCTTTGTATTTGTTTC" "34712" "1" "0.002688" "4.2828356" "-3.32" "0.57356599" "" "GAAGAACACTGGATTAGGTATGCTAGACTGGTCCTGGCTTTGACTGAAGAGATTACACAT" "18649" "1" "0.002747" "-4.2668389" "-3.32" "-0.41531188" "380601" "GTGTAACCCTGGTTGTACTCTAGTTGTATGTTTTGCTCAGAATAAATAAGCATCTTCAAA" "53494" "1" "0.002856" "-4.2380636" "-3.33" "-0.51359445" "" "CTTTGGCCATTCTGCATAGAGTCCAGGCACTTGTCTCCATCCTCTGGGAGGGGCTCTAGA" "56752" "1" "0.002866" "4.2356391" "-3.33" "0.75763457" "" "GAGGAAATCATGACCTGACTCCACATCTTGTTCCAAGACTCGGCTTTTCCTCACTTCATA" "18190" "1" "0.00325" "-4.1433988" "-3.35" "-0.4306138" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "5724" "1" "0.003442" "-4.1017469" "-3.37" "-0.37748491" "74729" "AGAATGTCCATCAATACACTCTCTCCCAGAATACTTGTCTTTGTAGCTAAGTGTGGGTAA" "17157" "1" "0.003598" "-4.0696257" "-3.38" "-0.32462956" "24135" "GCTTTGTGAGTGCTCAGATTAAATGTATGTGCTACTATGCCCACCCATAGAATTTTAAGG" "16721" "1" "0.00363" "4.06333" "-3.38" "0.75868159" "" "CGTTCATCCTAAATAAAATGTGGACGTCTGTGTTTGTCTGCATGGATGTCAAGAAACATC" "36155" "1" "0.003763" "4.0372695" "-3.38" "0.83624784" "100043861" "TCTGGTTGACTGTAATTTGAAAGGAGCCACTTTGCTGCTCATTCAAGATGAAGAAGAATT" "710" "1" "0.003864" "-4.0183728" "-3.39" "-0.47338824" "" "GACTGGTTGCAGCACTGTAACAGGCTTTAGGCTTTGTCTTTGGTTCAGAAATGCATTTGT" "55336" "1" "0.004132" "-3.9701988" "-3.4" "-0.4224801" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "10383" "1" "0.00421" "3.9568003" "-3.41" "0.46695026" "22169" "GAAACTCCATAGTAGAACATGGTATTGAATATTCTATCCTTGGGTTCAGAATCTGGGGTC" "55901" "1" "0.004244" "-3.9510732" "-3.41" "-0.34058609" "75533" "TCTCCTACTGGAAAGAACTTATGGGACCAAGTAACAGTTTAGTAGCCAAGGAGACACACC" "8359" "1" "0.004307" "-3.9405585" "-3.41" "-0.43399185" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "38984" "1" "0.004493" "-3.9104633" "-3.42" "-0.3351179" "100043063" "GGTGTAACTGAAATGGTGGCAGTGAGTGGGATGTAAAGTTAATAAATAAACCAATATCTT" "22952" "1" "0.004611" "3.8921658" "-3.43" "0.59689456" "14256" "ATACTGACTTTAAGAAAAACAGAAAGGAAGAAGGGGGGTGCGTTGTAGCCCTGTGTGGTT" "17894" "1" "0.004964" "-3.8399339" "-3.44" "-0.69955413" "52840" "ATGCCGCAGGGTGATTGTGGGGTGTGGGTTGAAATTGTAATAAATTTGTTTAGATGGATT" "39420" "1" "0.005129" "3.8169288" "-3.45" "0.41802939" "53311" "AGGCAGAGACTGGGACAAGGAGACAGCTTGGTCACATACCAGGACGCAGAAGGACACTAT" "28642" "1" "0.005284" "3.795982" "-3.46" "0.70913233" "19885" "TGTGGGGTAGATGGGATAGAGATAGGATGACCAAGTCAAATAAAAAACAGACTGACAATC" "499" "1" "0.005381" "-3.7832043" "-3.46" "-0.61231032" "" "CGAGTCACCCGGGATATTTAAAATATTCTAGTAGCCACGTAGTTTAACAGAAAGAAAAAA" "18928" "1" "0.005546" "-3.7620091" "-3.47" "-0.36125967" "66441" "GGTTCTCTTATTGATGTAAATCAGTCAAAGGATCCTGAAGGCCTTCGTGTATTTTACTAT" "10944" "1" "0.005615" "3.7533849" "-3.47" "0.6401809" "14805" "GCTCACATAGATATTACTTGAGGAGTGAAACTGAATCTTTTCAGATGAATTTGTATGCAC" "18003" "1" "0.005616" "-3.7531503" "-3.47" "-0.32263158" "22648" "GTGTATGTGATATTTTAATCCACCCTTTTTGCACTTAACCCAGAAATTACAAAGGATGTG" "885" "1" "0.005631" "3.7513587" "-3.47" "1.32938607" "" "GTGGGGCCAGTGTGATTTCTTTTAACTCCCAGAATAAAAGATAAATAAATCTCTTTTGAG" "59458" "1" "0.005724" "-3.7398567" "-3.47" "-0.58919712" "68971" "ACAAAATGTGGAAAGGGTGGATGAGTAAAGCGTCCTGACTTGACTGATGTTGTGTTACGT" "51492" "1" "0.005821" "-3.7281089" "-3.48" "-0.55572998" "353187" "CTGTGAGGGGAGCTCAGATAGATGTATCTTTTTGCAATATAAAGTTTGCTGAATGTAAAA" "61436" "1" "0.005858" "3.7237772" "-3.48" "0.48764593" "67905" "CTTCTTGAAACCTCTGGGCAGTCTCACATTTGCTTAATTTAATTAAGATTAAAGCGATCT" "1669" "1" "0.005921" "-3.716255" "-3.48" "-0.87309482" "" "TTCCTCCAGTTTATGCTCTAACCATTCTCCCGCGTGCGGACGGTCTGGCACAACGGAACT" "6574" "1" "0.005952" "-3.7126584" "-3.48" "-0.39226661" "78251" "GCAGTATACCATGCCTTGGTTGGACTGCTTAGTTTTCTGTCTCTTTTGCCTTTTATTTAT" "32970" "1" "0.005996" "-3.7074853" "-3.48" "-0.35223178" "258552" "TTCAAATCCACAGTCCAGTCATATCCTACGTGGGCTGCCTCACTCAGATGTCTCTTTTTA" "31197" "1" "0.006025" "3.7041313" "-3.49" "0.70979382" "67849" "TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA" "25311" "1" "0.006036" "-3.702927" "-3.49" "-0.4686868" "209550" "GAATGATTTACTTGTTGCTTTGTATAAGTGTTTTCCTCCAGCTGCAGATTTTGTGTTGTA" "17137" "1" "0.006158" "3.6889491" "-3.49" "1.71777123" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "26777" "1" "0.006234" "-3.6803943" "-3.49" "-0.32631456" "211586" "CCATTGCTGTAAGAGAAGAAAACATCTGAAATGAGTATGTTGAGCTTGAGGAAAATTGTA" "62012" "1" "0.00642" "-3.6600596" "-3.5" "-0.48607948" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "41848" "1" "0.006608" "-3.6400105" "-3.51" "-0.37256063" "98376" "AGAAACGTTAGGGATGTCCTATTTTTAGACTATTGTCTAAGACATCTTCTGATAGTAAGG" "7341" "1" "0.006676" "-3.6329812" "-3.51" "-0.3640658" "218763" "CCCCCCATTAATTGTGACCTCTGGTTCCTGAGTAACAAACTCTCTGAACATTAGTTAGAC" "23481" "1" "0.006776" "-3.6226899" "-3.51" "-0.32521841" "69642" "AGATGAACCAGCCAGGACTGAAAGCAACTCCAAGGCCAGCGTGTTAGACCTACCAGTGGA" "25828" "1" "0.006903" "-3.609887" "-3.52" "-0.4066306" "" "ATGAGGGAGGAAGAACCACGGACTAGTACCTCGGTGGAAAAGCTTTAAATTAAATTAAAA" "24358" "1" "0.006954" "3.604833" "-3.52" "1.58261154" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "27645" "1" "0.006962" "3.6040462" "-3.52" "0.3815514" "71522" "ACCACATTTCCTGGTACCCACACTGATGGAATTTCTGACTTTTCTATCAAATAAAGACCA" "1707" "1" "0.006963" "3.6039134" "-3.52" "0.50282055" "" "TATCTGGCAATCACGGTTCTCAGCCATCGGCACAGGCTGTCCGGGATCACCGTATTACAC" "34109" "1" "0.007039" "-3.5964468" "-3.52" "-0.36514679" "19183" "AAAGAGATTCAGGAGTTAAAGAAGGAGTGTGCTCAATACACAGAGAGACTGAAGAACATC" "24465" "1" "0.007188" "-3.5819614" "-3.53" "-0.511849" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "6669" "1" "0.007203" "-3.5805517" "-3.53" "-0.27950179" "229277" "ACATACTTGAGGGCATTGGTGGCATCAGCTATGGCAACAATAAGAAGGTCACTGCTAAAG" "18237" "1" "0.007217" "3.579191" "-3.53" "0.36702751" "317677" "TGTGATTATTCATCCCGGCTGGAAGGAAGACGATGACCTAAACCCACGGACAAATTTTGA" "19143" "1" "0.007326" "3.5689321" "-3.53" "0.51104857" "622459" "GAATGTTCTAAAGCCTAAGGCCAGTCTGGGCTATATATAGAAGAATGAGTTTCCTGCCTC" "3420" "1" "0.007327" "-3.5687972" "-3.53" "-0.4544179" "12778" "TGGACATGTGTACAGTAGAATCTTCTGTGTTTCTTCAAGTTTTTACTTGGTGACTTTTTG" "59697" "1" "0.007355" "-3.5662318" "-3.53" "-0.31382242" "638531" "CACCAAGGAGATGACAAACCTACTGCAGCCCTTTTCTTTGTCAAGTCTAGATTTCTCCTT" "26058" "1" "0.007477" "-3.5549065" "-3.53" "-0.44061728" "" "AATTCTAGATTCCTGATTTGTTCCCAAGAGAGTGAGTTGTTATAAGAGCAAGCCTGATTG" "45102" "1" "0.00758" "3.5455088" "-3.54" "0.60858899" "" "CACCCATTACATCAATTTGTGAGAAAACTACGCAATAAATGGCATCTCTTACTGTTCCTG" "18889" "1" "0.007587" "3.5449083" "-3.54" "1.36859525" "80782" "CACATGGACTCTGAAAACACTGGGATTCTTAAAGGTTCTTCATTGTATAAATGGAAGTGT" "40475" "1" "0.007735" "3.53168" "-3.54" "0.85777729" "20847" "CTGAATAGTTAGAAAGAACTGTTGTCCTGAAGTCCTTCGTACGTCATAATAAACTTTTGT" "33162" "1" "0.007749" "3.5303563" "-3.54" "0.77121972" "" "TGCTCGGAACATATTTGGAAGATGAGTCCCCTCGTATCAGTGCACATTCCTCAGCAAAAA" "44933" "1" "0.007879" "3.5190039" "-3.55" "0.33215262" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "53589" "1" "0.007952" "-3.5127009" "-3.55" "-0.38206064" "74918" "CTATTGTTGGTACACTCGCTCTTTATTAACCCATACGCATTGTATATTTTGTTGCACATA" "38200" "1" "0.008203" "3.4914957" "-3.56" "0.63673214" "18073" "CAGATGTATACAAGTATTGGATGATTCCTCAAGTTTACAGCTGTACAAATATTAGTGCAG" "9721" "1" "0.008341" "3.4800693" "-3.56" "0.37710007" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "60957" "1" "0.008377" "-3.4771533" "-3.56" "-0.41823641" "210719" "ATATTTTGTACGTATATTTTTACTTTGTTTTCTCAAGTGCTGTTGGCAGTTGCAGTTGCC" "5967" "1" "0.008481" "3.4687575" "-3.56" "0.36395319" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "19888" "1" "0.008697" "-3.4516559" "-3.57" "-0.33174028" "72500" "ACTCGGGGCTGAGCTGGGGACGAGCAGAGGCTGATGTTTTATAAATTGTAAAATAAAAAA" "35141" "1" "0.008876" "3.4377745" "-3.58" "0.64341692" "" "CATAGGATACCTACCGTGTTTACTTGCTCTTCAATAAAGGTTGTGACTTCTCATTTAAAA" "28401" "1" "0.008904" "3.4356537" "-3.58" "0.52171712" "" "TCTAAAGCCTAAGGCCAGTCTGGGCTATATATAGAAGAATGAGTTTCCTGCCTCAAAAAA" "57214" "1" "0.008936" "-3.4332471" "-3.58" "-0.51315305" "665033" "CATCAAGCCATTTGTTCATTCGATCAGACGTGCTATCAACAAATATCCCGGCAGAGACCT" "22754" "1" "0.008993" "-3.4288739" "-3.58" "-1.29017619" "17926" "CAGTAAGACCCTGACCATCCCATTCACGAATCGCTACAAGTACAGCAGTATGATTGACTA" "32566" "1" "0.009005" "-3.4279883" "-3.58" "-0.37142898" "56349" "GGCAGCTACAGATACACAGATTACTGTTAAATTGGAGACTTTAAAAAGGTATTTTCATGG" "3769" "1" "0.009036" "-3.4256456" "-3.58" "-0.3173951" "266459" "TGGTTGGTCTACAAGACTATCAAGATAACAAAGCTGATGTACTCTTAAAGTATAATCCAG" "13165" "1" "0.009217" "-3.412192" "-3.58" "-0.6219962" "59289" "GCCAGCTTTCACCTCACGGGGCCCAATATTCAAATTGTACAGGGGACAAAAATGTTGAAT" "19050" "1" "0.00934" "-3.403253" "-3.59" "-0.3034126" "" "TTTAAGAGAAGTGAATGCACACCGCAGAGGCATTGCCTGATGCCAGGATGACTAAGTTAA" "2648" "1" "0.009515" "3.3906349" "-3.59" "1.10608806" "171170" "CAGATGTTTGGACTTTTTCAAGTTATAGTGTTGTATGCCTGTTTGTGTTTAGAAGTGTTC" "29333" "1" "0.009609" "-3.3840047" "-3.59" "-0.37126281" "105005" "TCATGGTTGCAAGCAATTGGATACTATGGTTTCATTGAACAGCAAACACTATGTCCAAAG" "5561" "1" "0.009703" "-3.3774335" "-3.6" "-0.28496139" "17532" "CCCATCCCCAGTGTCTGAGCTCTTGTGTCTTTTGTAGATTTTTAAATTATTTGAGTAATG" "49922" "1" "0.009735" "-3.3752261" "-3.6" "-0.37128726" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "22793" "1" "0.009779" "-3.3721373" "-3.6" "-0.30659246" "625353" "GAATCTCTCACAGCACCTTGGGATTAAGGTGAAGTTAGGAAAGTTCAGCCAATATGTTTC" "52535" "1" "0.00979" "3.3713826" "-3.6" "0.6041986" "17064" "ACAACATAACATTCTGAGGGGAGTCACAGGGTTGCCTTTAAAAAGTGGGAGCTATGTCAT" "25063" "1" "0.0098" "-3.3706975" "-3.6" "-0.28712626" "20807" "CCAGCTGCTTTACTTAAGAGTTGATTTTGAACTTTTTATTTGAGGAGATGACGTGAAAAC" "57160" "1" "0.009842" "-3.3678322" "-3.6" "-0.57483335" "93873" "TCCTTCAGAGTTCAGAGACAGAGAATGATACAAACCCTAGTTACAGGAATAGTTTTGAAT" "40947" "1" "0.009898" "3.3639692" "-3.6" "0.69462233" "67849" "TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA" "10294" "1" "0.009902" "-3.3637384" "-3.6" "-0.27720212" "" "ATGTACAACAAATCACCTAAGGTGGGTTCTAGACTTGAGCAAGTACAGGTGGGTGCAGAA" "14355" "1" "0.010126" "3.3486066" "-3.61" "0.94591629" "27052" "GCTTCCAAAATAAACTGTCTGCACTCCAATATTTGCCTCAATAAAGTCAAAGTTCTAAGG" "11099" "1" "0.010178" "3.3452119" "-3.61" "0.44058432" "224024" "TCTGGGACCTTCTGGATGGGCTCCTCATAGCAGGCCAAAGCTTTCTTTAATAAAATGCTT" "62602" "1" "0.010224" "-3.3421247" "-3.61" "-0.31814206" "353187" "CCAGAACTGTTAGTATTGCTTGTGATGCTTTAGTTAGGGTTAGTATATACATGTATACAC" "7458" "1" "0.010385" "-3.3316435" "-3.61" "-0.25402685" "67574" "GTGTATTTAAATCCTTGTGCCTATGATGATATTGGAAGATGTAGATAGAATTCCCTGGAA" "4415" "1" "0.010546" "3.3212996" "-3.62" "3.05267439" "100039796" "AGAGGATTCATGCTTTCCCTTCTCCTGATCCAGAAGATCACCATGGCAAAGGCTTATAGT" "59094" "1" "0.01055" "-3.3210048" "-3.62" "-0.49107859" "27411" "AGATCTTTATAACTGCCCGTTGTAGCATTAAAGGAAGCTGGTGTGCCCTTGCTGGAATTG" "48502" "1" "0.010551" "-3.3209468" "-3.62" "-0.34544515" "22746" "AACCTCAGTTTTGTCAAGTGAAAAGAACACAAGGACTAGTGATTTTATCAGAAGAACAAG" "17801" "1" "0.010851" "3.3021006" "-3.62" "0.32350419" "12628" "TTACCTTTTATGTCAATAGAATATTTGTTGTGGCTCCTTGCAGGAACATTCTCTATTCCG" "42034" "1" "0.010882" "3.3002258" "-3.62" "0.50561473" "108907" "AGGGAGGCTGGAAGACCACATTTTTGTTCAGTAGCCTGGAAAATCTATTAGTCTTATTGA" "18097" "1" "0.010931" "-3.2971739" "-3.63" "-0.36198525" "241656" "AGGAGAGTTGTGCTGCTGTCTCGATCTTCCTGAATGTTGATAAAAATGAATGACTACTAC" "36433" "1" "0.010933" "3.2970659" "-3.63" "1.14615388" "13449" "TATAGATGTTTTGTTCCTGGGACAACCCTGGCTTCTGGTTAGCAGCGAGAGTAGCTGTTG" "40323" "1" "0.010941" "-3.2965419" "-3.63" "-0.25112804" "" "ATAAGGAAAACAGGTTTATTTTCTTCGCTTTGAGAAGGTGCTGACGGGAAGACTGGGGAG" "25238" "1" "0.011103" "-3.2867186" "-3.63" "-0.26652965" "" "CAATCATCAGAGTATCTGTTGGTCAGTTAATGTGAACAGCATCTCTAGGAGACTTAGTAT" "46756" "1" "0.01116" "3.2832709" "-3.63" "0.36096812" "" "GTAACTGGAGTATATAATTCTTCAGGTCTCCAAGTTTAAATTGCTTGGTAAAATTTCCCC" "52596" "1" "0.011182" "3.2819571" "-3.63" "0.42906894" "98256" "CTTGCTATGGTAGAGCTGAGAATGAGAGACAAGGTGTTCTGAAGAGTTCCAGGATATATC" "37841" "1" "0.011186" "3.2817271" "-3.63" "0.64835449" "11766" "ACGGAAATAACAGACCCACGTAAATGGCGAAGTAAACTTTATTTAAAGGCAAACTGAGCG" "35786" "1" "0.011395" "3.2693257" "-3.64" "1.19419832" "26411" "AGACGCACTAGTGGTCATGACATGACCTTATCTCCCAATAAACTTGACTTTAGTCTTGTC" "27359" "1" "0.011405" "-3.2687505" "-3.64" "-0.3691558" "109136" "CATTATCATGGAGGCATATAGGAAATATTGTTTGCTGTTTTATGCTAAAGTTGTGGATCC" "34863" "1" "0.011426" "3.267467" "-3.64" "1.23824882" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "39673" "1" "0.011458" "-3.2656003" "-3.64" "-0.39677461" "72003" "GAAGAATCATAACTATAGGGACCTGTTGGCTTTAATCATGAGAGAATAAAGGTTAAATGC" "26880" "1" "0.011513" "-3.2624225" "-3.64" "-0.2459229" "" "TGAGACTCTATGTAAACTTTGGCAGTAAAGCACTTTCCTGAAATAGTAAAGTAGTGCATA" "60470" "1" "0.011516" "-3.2622522" "-3.64" "-0.92267795" "20840" "CTGACATGTTTAAATGTGACTTTGGGATTATTGTTGCTTCAATTTATTTTGCCACTGAGC" "26533" "1" "0.011556" "-3.2598898" "-3.64" "-0.3330268" "207911" "TTCGCACGGTCAGCAATGCTCAGACAGCTGACGAGGAGAGGACAGAAAGCAAAGGCACCT" "32525" "1" "0.0116" "3.2573642" "-3.64" "0.3501665" "666190" "AGGGAGAAGATGAGGAAGGCAAGGCCTCCATCGAGGTTGCCACTAAAAGCCGTTACCAGG" "26916" "1" "0.011612" "-3.2566642" "-3.64" "-0.48205041" "67576" "CTTGTTTCATAGAAATGTAAATCTCATGACAGAGAAAATGGCCCCACAAATTAGAGCTTT" "27355" "1" "0.011714" "-3.2508486" "-3.64" "-0.2589562" "" "TAAGGTTGGGCGCTGCCTGGGGCGCAGAGGAGCAGTGCAGGGTTGGGGTGTCTTTGGGTC" "36845" "1" "0.011724" "-3.2502673" "-3.64" "-0.28022802" "22643" "GTATAACTATAAACTGTGTGGTCAACTTGCCTTTATTGTGAGGTATGGAAAAAGTTTGGG" "36971" "1" "0.011812" "-3.2452657" "-3.64" "-0.60084053" "17195" "CTTTAGGGTACTCCTGACGTCCGCAGTTTGTTCTGAAAAATAAAATATGGGAAAATATAA" "6121" "1" "0.011882" "3.2412942" "-3.65" "0.28804778" "" "ATGAGCCCCGACTCGAGGATAAAGAGACCTCTGAAAGGGAACAAGGTTCTAAATAAATAA" "13390" "1" "0.011967" "-3.2365363" "-3.65" "-0.31506642" "12361" "CCAGTTTAGGCATTTGCTACAAACTGAATTATTCCCAAAAGAAATAATCTATAACAGCCC" "54667" "1" "0.011974" "3.2361594" "-3.65" "0.27314783" "16196" "AAGATAGAAATGCACTTATTCCAAAGATACTGAACCTTAGTATTCAGTCGCTTTTGACAC" "2575" "1" "0.012009" "-3.2342101" "-3.65" "-0.36642739" "212276" "CCCTTTGTAGTGACTAGACATTTATTTGTGTCTATAGATAGCTAACAACACATGTCATTC" "10883" "1" "0.012093" "3.2295389" "-3.65" "0.72319237" "17952" "CAGAAGTGTTCTTTGTGCATCTAGTGCTTACCTAAAATTCATGTAAACTGATGTAAGTCT" "12768" "1" "0.012112" "3.2285231" "-3.65" "0.45583652" "12442" "CCTAGGCACTGGACTCCGATCCTGCGCTTCTCAGATCCTGTATGTATTTTATTCTAGTTT" "36597" "1" "0.012289" "-3.2188353" "-3.65" "-0.45345507" "240119" "GGTAGTCTTGCCAGGCTTCCAGACCCTTCGGTGTCCAGTAACCAGCCCCAACAATACACA" "12041" "1" "0.012348" "3.2156138" "-3.66" "0.52694962" "70873" "CCTGCCTCAATATAAGAATGCAGGGGTCCTTATTTAGAACAAATAAAGTAGGTTCGGATT" "10020" "1" "0.012378" "-3.2140203" "-3.66" "-0.3922245" "114249" "AAAGGCGTGGTCACACGGGGGAGATTGGATTGGATGATGTGAGCTTGAAAAGAGGTCGCT" "21239" "1" "0.012408" "3.2123769" "-3.66" "0.28361754" "" "GGACTACAAACTTAACTGTTATTTTATGCAGGCCTTTTACTTAGCTAAGATTGTACAGAG" "12174" "1" "0.012487" "3.2081753" "-3.66" "0.66196555" "16193" "CTGTTACCTAGCCAGATGGTTTCTTGGAATGTATAAGTTTACCTCAATGAATTGCTAATT" "11932" "1" "0.012662" "-3.1988759" "-3.66" "-0.31695157" "73680" "TGCTGTTGGCATGACAGATGATCAATTACCCTTTCTGTTATTACAGATACCATTTCCTTT" "1181" "1" "0.012682" "3.1978528" "-3.66" "0.80318574" "12370" "GTGAAGAACTGCGTTTCCTACCGAGATCCTGTGAATGGAACCTGGTATATTCAGTCACTT" "55703" "1" "0.012744" "-3.1946101" "-3.66" "-0.36648827" "" "TCTGTTACTAGTTTTGTAGGCTTTAATCCTAGTGTGCGTTAAATATTGGGCAAATTGCAC" "45289" "1" "0.012749" "-3.1943628" "-3.66" "-0.2896657" "224530" "TGGTCCTTGGAGGATGTTGACCTGTTTGAAATCAATGAAGCCTATGCAGCTCTCTCTGTT" "705" "1" "0.012759" "3.1938165" "-3.66" "1.32526856" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "45641" "1" "0.012764" "3.1935419" "-3.66" "0.32675632" "" "" "43378" "1" "0.012775" "-3.1929858" "-3.66" "-0.29880621" "235459" "TACCAGAGAAATTGAAGAGGGGCTTGAAAAAGGTGTCCTTCAATAAAATTTTGTTTACCT" "58902" "1" "0.012806" "3.1913644" "-3.67" "0.37642651" "333088" "TTATGCCAGTCCTCCAGACATCCACAGTGTGAAAACACAAGAATAAACTCTACACTTGCC" "37736" "1" "0.012909" "-3.1860213" "-3.67" "-0.314253" "231506" "GGGGAGGGTTTGGTCTATAATTTTTAAGCCCTATTTACATCCTAAGGTAGAAAGATTATA" "14607" "1" "0.012942" "3.1843203" "-3.67" "0.50519161" "70568" "ATTACGATTTCAGCAGAAGAAATAAAGGATAACAGAGTGGTATTGTTTGAAATGGAAGCC" "51264" "1" "0.013027" "3.1799839" "-3.67" "0.34633544" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "20007" "1" "0.013055" "-3.1785607" "-3.67" "-0.30135005" "11459" "ACATCGACATCAGGAAGGACCTGTACGCCAACAACGTCATGTCAGGGGGCACCACCATGT" "32886" "1" "0.013171" "3.1726881" "-3.67" "0.47845213" "15975" "GCTCTACCTCAAGAGACTAAGAGGGTGAACACAGTTTGTACTTTTCATCTTCCTTACAGA" "53317" "1" "0.013218" "-3.1703007" "-3.67" "-0.37950095" "" "ACCTCATAGGCTGAGAATCTGGTTATTTTACTTCAGGCACTAACCCGGATCTGTTCTTCA" "9911" "1" "0.01326" "3.1681802" "-3.67" "0.61502577" "56791" "TGAATGAATACTGCAATGCAAATGTGCTATTGTTAGAGGCTCTTAGAAACTGTCTTGAGA" "10128" "1" "0.013299" "3.1662424" "-3.67" "0.61942579" "" "CCCTGGTCACTTCCGGGTGCTGTCCTGCAGATGCCTTTAATAAATGTTTTTATTTCCTCA" "1704" "1" "0.013354" "-3.1635123" "-3.68" "-0.33236273" "66226" "ATTCAAAAGCATATGTCATAGTTAATATTTGTTAGATTGATTAAAGACTGAAAAGTTCTG" "2842" "1" "0.013386" "3.1619258" "-3.68" "0.26227491" "" "GTGAACATAAAACATCTGATGCCATAAACATTAGTGAAGGTTATCTCATAGAACACACAC" "47790" "1" "0.013508" "-3.1559017" "-3.68" "-0.26534294" "66296" "GCTTTGTGAACTTTTCCAGATTACAACAGATCTCAGATATTCAAGCTGAAATCTACCAGA" "27004" "1" "0.013606" "-3.1510965" "-3.68" "-0.30440854" "73212" "CTGGCGGTTCCAGAAGACAAGACAGACGTGGCTCCTGCTGCACATGTATGATGAGGACAA" "17960" "1" "0.01366" "-3.1484845" "-3.68" "-0.37207611" "80892" "CCGTATTACGGTAATAACATGGTTTCGAAAACTTTCTGTTTTTATTTTGTCACAGAGCTG" "10810" "1" "0.013775" "-3.1428995" "-3.68" "-0.24177913" "171282" "TGCTGGATGACATGAAATTCATGTTTAGGGCATTAATGGCTTATAAGTCACTGTACTGAA" "4092" "1" "0.013824" "-3.1405456" "-3.68" "-0.40678837" "13711" "TGTCTAGTGACCGGCACTGAATAGCAATGCAGGCTGAAGACCTCCAGGTTTAGAATTTAA" "39475" "1" "0.014011" "-3.1316192" "-3.69" "-0.29005351" "109349" "ATGGTTCAAGGCTGTTGATGGAGAAGTGGGCGGATGACAGCCGGGACTGTGGTCATCACT" "4356" "1" "0.014065" "-3.1290894" "-3.69" "-0.51237343" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "50399" "1" "0.014137" "3.1257101" "-3.69" "0.29353721" "" "" "41294" "1" "0.014143" "-3.1254483" "-3.69" "-0.23386393" "75422" "GACTGCTTTGGGAATGGCAAGAACAGCAGTATATTCTTTACACAAGTCCTCAACTAGGGA" "38510" "1" "0.014164" "-3.1244605" "-3.69" "-0.30118768" "74915" "TGGGGTGTCATCTTCCTCTGCAGCCCTTTCCTAGCTTTGAATAGCTAAGAGTGTTATACA" "39187" "1" "0.014203" "-3.1226153" "-3.69" "-0.31148625" "71970" "CTAAATACAGAAGTAGACTTGTGGTGGAAGATGATCTTCGCTGTGCTCTTGCAAAGACCA" "44440" "1" "0.014247" "-3.1205719" "-3.69" "-0.40881712" "56219" "TGAATGGAGTTAAAGACTACGGATAAAATGTCCAGCTAGAGGGTCACTGGTGTGTGCAGA" "9866" "1" "0.014268" "-3.119602" "-3.69" "-0.35434743" "171253" "TAGAACTTGGTTATGTTAGTTTCAGTCCCTATGTTCTTATCAGTAGATATATCCATCCTC" "59330" "1" "0.014281" "3.1189843" "-3.69" "0.52935727" "18439" "GGTCAAAAAGCTCCCCAATCCATGCAACAATCACAAAATTAATGTTAGAGTTTCTTTTAG" "8161" "1" "0.014314" "3.117462" "-3.69" "0.48679551" "16426" "ACTATATTGTTCCCAGCTTGTTCTGAGTAGCATGTCAGCTGCTGATGAAGTAGAAGGCCT" "34720" "1" "0.014416" "-3.1127613" "-3.7" "-0.28556748" "240064" "GTTAAATGCCAGGAAACATAAAAAGTGAGTTGTTTTCAAGCCTTTGAGATTAATGAGTGG" "30421" "1" "0.014434" "3.1119519" "-3.7" "0.64485215" "319997" "GGGGTTCCAGAACATAGAGCTTCCTGCAGGATCTCACACCTCCTGTGTCTGGACCAACCA" "55698" "1" "0.014583" "3.1051263" "-3.7" "0.40176886" "" "GGACGTGAAGCTTGGGAAGTCAGATCACGCTCCAAGAATGGAGTCGTATGAGGAGGATTC" "35314" "1" "0.014658" "-3.1017526" "-3.7" "-0.29693663" "68585" "ACTCTTCAGTATTCCTGTTATATATGAACGGCATCAGGCGCAGATAGATCATTATCTAGG" "56430" "1" "0.01467" "-3.1012239" "-3.7" "-0.28210678" "622139" "GGTGGAGAATTTGGTTAAAGCATTGCATGTTTGTGACACGTAACTCTATACTCTATTAAA" "14899" "1" "0.0147" "-3.0998494" "-3.7" "-0.30717617" "" "ATCCAAACGTCATCTGAAGGCCTATGATAGTTCTGGAGTGTGGGAAATGTCTCCTGTAAG" "6808" "1" "0.014706" "3.0995764" "-3.7" "0.34391842" "14871" "ACTATAATCACTACTTTCCCCTTGAGTCTGGGTAATAAACTGGGGCTTGATTTGGGCTTT" "55511" "1" "0.014822" "3.0943827" "-3.7" "0.72680589" "100038909" "TCTTTCAATGTTCTACACGCTGGGAAATAAAGCTGATGACCCAAAGTTTTCTGTCAAAAG" "59369" "1" "0.014837" "-3.0937144" "-3.7" "-0.31406385" "211896" "ATTGATGAAAGTGAGTATTCTAGCAGTACAAAGAAGAAAACCAAAGATCAACTGTTGAGC" "15707" "1" "0.014863" "3.0925645" "-3.7" "0.29159164" "74183" "AGGGTTGGATATTCTCCAAGAGCCCCGGACAGGATATCCATAGAATGTAATAGCATCCTA" "1322" "1" "0.0149" "3.0909357" "-3.7" "0.40132646" "232157" "CACAAGGCATAAATCACAGGCATATGTGGACTGAGATAACCAAAGTTATTTTAAATGACT" "25148" "1" "0.01491" "3.0905034" "-3.7" "0.88875002" "12095" "AAACCAGTATGGCTTAAAGACCGCCTACAGACGCATCTACGGTATCACTATTTAGGACCT" "58798" "1" "0.014947" "-3.0888628" "-3.7" "-0.28316707" "331461" "GTTTTATAGTCGTTTCATAAGTCTGTTGCTCTCTATGAGTATGCTCTCTATATATCCTGT" "43032" "1" "0.015019" "3.0856924" "-3.71" "0.44223998" "" "GCATTGTAGTAAATCCTTTGACTCTCATCATGGACTTCAAATTCATGAAAGAAGTCATAC" "43977" "1" "0.015023" "-3.0855154" "-3.71" "-0.36370782" "70441" "TCCGCACAAAACCTGCTTTTGAGCCCTTTGGCTTTCTTCAGGCGAGCGCAGTCCGTCCAT" "43568" "1" "0.015062" "-3.0837934" "-3.71" "-0.26914787" "66448" "TCAGTGACACGGCCCCAAACTGTCCTGTAAAGATTGTATAAATAAAGCCTTTGCAGTGTT" "61759" "1" "0.015549" "-3.0627773" "-3.71" "-0.37843172" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "23370" "1" "0.015565" "3.0620997" "-3.72" "0.48838761" "19222" "CAGTTGCTGACTTTGTAAATGATCCAAATACCACTGAATGGATAATTTGCTGTGAATGAT" "30671" "1" "0.015646" "-3.0586965" "-3.72" "-0.43044611" "72003" "CTGTGATGTTGAAAGCAGTTTAGCACAAAATAGGCTGTCTTAAATACTATCTGTAACTAG" "57484" "1" "0.015755" "-3.0541233" "-3.72" "-0.29203092" "11514" "GGAGATATATGTGAAGGGCATCAGTGAACAAGAAGGGAAAATCAAAACATACTTTCTCCT" "17148" "1" "0.015784" "-3.0528864" "-3.72" "-0.3921118" "" "CGTGATGTTCTGTTATATGTCTTGCCTAACCTATTATTTTAAAACTTCCAACGCTTCCAA" "6705" "1" "0.015904" "3.0479164" "-3.72" "2.52859261" "20307" "ACCAGAAGTCTCAAATTCTGCAGCCTTGAACCTTCACACCTGAGTTAAGAGACAGCCAAA" "25303" "1" "0.015909" "-3.0476996" "-3.72" "-0.29169576" "54160" "ATGCTTCTATTTAATGTGTGAAAAACTCTTGGCAATGCTGGAAAATTTTATCCCAGAAGG" "1760" "1" "0.015944" "3.0462465" "-3.72" "0.34803266" "268288" "ACAGCATGCGGATAAGGATCATTGAGTTTCTCCAGGCAGATATGACTAAGTACCTGGAAG" "25902" "1" "0.015954" "-3.0458588" "-3.72" "-0.28784567" "" "GTAGGCAATAATCCCTCTTCTTTGGCTTCTGTGAGGATTAAGTAAATCAAGAAGCCATCA" "21747" "1" "0.015974" "3.0449972" "-3.72" "0.69351844" "" "GCAAAAGGAAGACCCTCAGACTGAGGTTGAGAGTACTAATTTATGTGAATAAATACAATT" "13486" "1" "0.015984" "-3.0445889" "-3.72" "-0.36454413" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "18967" "1" "0.016" "-3.0439471" "-3.72" "-0.57827073" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "3834" "1" "0.016003" "3.0438052" "-3.72" "0.65971596" "94045" "GCTCTCAGAAGCCCAGCCTTGATGTGCTAATGAGATAAAGGATAATTTTCACTGAAAAGC" "61533" "1" "0.016017" "-3.0432589" "-3.72" "-0.38952668" "" "AGGTCGGTCAGACCTGGTGCTCCTCCTTACAATCAATGTCTCCCAGATCTGTAACTAGAG" "52297" "1" "0.016022" "3.0430554" "-3.72" "0.28260724" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "51987" "1" "0.016058" "-3.041543" "-3.72" "-0.28302731" "18701" "TGTCATTTCAACATGATGTGATTGTAGCTTTTTAACTATGAAACCCCTGAGAGATTGTAC" "17460" "1" "0.016112" "3.0393426" "-3.72" "0.26710581" "" "CATTAGACAGAATCAGAGAATCCACATAGGAGAGAAAGAACTGAACACTACAGAGTGTGA" "39390" "1" "0.016157" "-3.0375093" "-3.72" "-0.32714491" "22685" "TACTCTGGTTTCTCATATGGGTAGAGTGTCTAATGCAATTCTGCCAGTGTTGTTAGAATT" "28670" "1" "0.016187" "-3.0362787" "-3.73" "-0.30986215" "78197" "CCAGTGTGACTACAGACCATGGACACCTTCATGGCCCTCAGTGGCAGTACAGGTCATGGA" "41876" "1" "0.016301" "3.0316755" "-3.73" "0.33793133" "338467" "TTTACTGTATTATGAATGTAAGTGTTTTTTAGCCTGGAGTTAATCATAAATGGGCCTGGG" "16341" "1" "0.016362" "3.0292086" "-3.73" "0.90083566" "22163" "GGCTTTCCTATGTATGCTATGCATACTACCTGCCTGGTGGTGCTCCTAATAAACATGCTA" "11830" "1" "0.016385" "-3.0282882" "-3.73" "-0.26162388" "57339" "TTGAATATTGGGTTGGCCATTCTTTTTGTTCACTTTCTGACTTGATTGGAATTAGGACAG" "33859" "1" "0.016461" "-3.0252365" "-3.73" "-0.29917386" "" "GAGCACTGTGTAAGGACTGGACAATGCAGTTCCTGAAAAGAAATGGAGGTTTTGTCAACA" "27852" "1" "0.016537" "-3.0221968" "-3.73" "-0.29512637" "22685" "TTTCCCAAAACCACAGATTTCGGTGACTCTTTAAAGTTATTTCACCAACATTGAAAGTGG" "55380" "1" "0.016542" "-3.0220067" "-3.73" "-0.2325096" "321003" "TGTTAGATAACAATAAAATTAAATATATGGGATGCATTCAGTAGTTATGAATACCCTATG" "1548" "1" "0.016593" "3.0200111" "-3.73" "0.30750538" "" "GAAGACCAAAAGGAGAAAAAGATAGAGATGATATTGCCTTCCTTTGTTTGCTATTGAAAC" "47803" "1" "0.016718" "3.015052" "-3.73" "0.37488903" "68328" "GCTGCTTTTGTTAGAGTATTCTCAGTGTTGCACAAAGAAATACATGAACAAGGTGAGAGT" "30710" "1" "0.016752" "-3.0137209" "-3.73" "-0.38810219" "" "CAAATACACAGGAGAACTCATACCGGAGAGAAGCCATATAAATGTAGTCAATGTAGTAAA" "53562" "1" "0.016874" "-3.0089509" "-3.74" "-0.31755041" "320127" "CTGTACCTCACGATTCTACTGTAACCACCCATCGATTTAGAAACTATGCTTTCGTCTCTT" "32611" "1" "0.016883" "-3.0086173" "-3.74" "-0.38534736" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "17915" "1" "0.016885" "-3.0085107" "-3.74" "-0.86418941" "211232" "CACTGCTGGAAGTTAAAGGCACCTGGAGCTCTGAACCTGACCAGGAGGGCCATCTAGGTT" "56052" "1" "0.016959" "-3.0056406" "-3.74" "-0.36857689" "66259" "ATCTTTGAATGAACCCCATTTTAAAGCAGAAAGTAACTTTTCTACGGACTGATGCTTTGG" "30229" "1" "0.016972" "3.0051403" "-3.74" "0.55810685" "" "AGCTTCCATCCTTGGCTGAGAGAATAGACTGTATGTACCAGATAAAACGGTTCACAGATT" "3037" "1" "0.017007" "3.0037822" "-3.74" "0.32230308" "381485" "AACCAATGAGCAGGCAGCAGTGAGTGGTAAGGAGTCTAGTTCAACTGCAGCTACCTCTCA" "47140" "1" "0.017134" "2.9988972" "-3.74" "0.32614417" "" "ATATCACTCGCTGCATCGTCTGTCACACAAGTTCCCAAGCCTTTCGACTGCTCCTTTTCA" "29642" "1" "0.017138" "-2.9987707" "-3.74" "-0.2453608" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "29737" "1" "0.017264" "2.9939606" "-3.74" "0.72773669" "12842" "TGACCAACTGAACGTGACCAAAAACCAAAAGTGCATTCAACCTTACCAAAAAAGAAAAAA" "36273" "1" "0.017359" "-2.9903313" "-3.74" "-0.33294959" "" "GCATCTAAAGGACATTCGTTCCAAATGAAAATTTGCTTTTCTGGCAGTTTTCATAATGGA" "13085" "1" "0.017427" "-2.9877815" "-3.74" "-0.32122715" "74129" "AAACCTTTCCATTGCTTCCCAAACAGAATGGTTTGATGAATTAATGATTTGCATTGTCCA" "14876" "1" "0.017532" "-2.9838198" "-3.75" "-0.30462416" "" "TGTGATGAGTTCAGGAAGATTAAGCTAAAGAACTCCAAACAAGCAGAAATAGAAGAGAAG" "4108" "1" "0.017541" "2.9835064" "-3.75" "0.40736508" "15312" "AATAAAAATTGGAATGTCTGTACTCTGCTCCTCGACCAATAAAATCTGTTGTGAAAGAGT" "46284" "1" "0.017579" "2.9820938" "-3.75" "0.27808792" "" "CCTGTACCAGTTAGGCATGCTTAAATGTGTGTTTCTTTGTTCATTTTAGAGCATGTAATA" "20710" "1" "0.017637" "-2.9799193" "-3.75" "-0.26150286" "17168" "CATGCCTGTGTGTGGATGGAAACAACCTCCCTTCTGCCGCAGAGTTCCTGACTGGCCTTA" "18362" "1" "0.017645" "-2.979621" "-3.75" "-0.28832786" "235584" "CACACATATATATCCCGAGCCAGCAACGGGACGTTGTTTATATTGCAAATAAATATTATT" "27321" "1" "0.017756" "2.9755178" "-3.75" "0.38309492" "17454" "ATGCTAGGCAAGCACTCTGCCCCTGAGCTGCTTTAAGAAAAACAAAATGCTGTTCTATGC" "33039" "1" "0.017768" "-2.9750516" "-3.75" "-0.3215468" "73610" "GAAACAGTAAAGCTTTGGCACATCAGTGTAATCTTCAGATGCATCAAAAAACTTATACTG" "35053" "1" "0.017851" "-2.9720271" "-3.75" "-0.30244977" "13101" "TTCCAGTCATGGTAGGCAGGGCAGGCTGAGCCATGCAAAATAAACCAATCTTGTGGCTGC" "33119" "1" "0.017991" "-2.9669019" "-3.75" "-0.58196374" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "2857" "1" "0.018017" "2.9659446" "-3.75" "2.70517912" "20304" "TCTCAGCTGCTCCGAGGCTCTGCACAGCAAACCCAAGAAATCAGCATTTCATTGAAATTT" "2419" "1" "0.018069" "-2.9640558" "-3.75" "-0.2695475" "" "ATTGCCACCATAGCCAGGTCGGCTGCACCTGCCATTTATCTGGAGAGAATAACAAACTAA" "41340" "1" "0.01815" "2.9611327" "-3.76" "0.46191131" "15042" "AATGTAAATAGTTTACAGCTCAAGGCAGACCTGGCCATGATCCTCAGAGGACACAGGTTT" "1049" "1" "0.018152" "2.9610455" "-3.76" "1.28269166" "" "GTAGCCAGCTTGAGCAATGGTGCTGGGATTTCTCCGGGAGCAGAGTGTTAGCGATTAAAA" "39124" "1" "0.018168" "2.9604583" "-3.76" "0.73761776" "18712" "CCTTGGGATCCTGCTCTATGACATGGTCTGCGGAGATATTCCGTTTGAGCACGATGAAGA" "27371" "1" "0.018215" "2.9587665" "-3.76" "0.40902146" "" "AAGGCTTTGCAGCAGCTCTCCCCAGAGTCAACCTCTATGCAGAGCCAAAGCCTCCCAAGT" "40751" "1" "0.018349" "-2.9539844" "-3.76" "-0.63725886" "216441" "AGACTCCTGGATAGCGTGTCTCCAGAACAACTCTTTGTGAGTGTCCAGGATGCTGCTGCA" "23503" "1" "0.018359" "-2.9536183" "-3.76" "-0.28908158" "" "AGCATGGTAGAACAGTGAGGATTGGTTTGGTCTCAGAACCAAGTTAGAGTGAAGACACTG" "38863" "1" "0.018372" "2.9531513" "-3.76" "0.45663756" "" "GATATCCCCACTGGTGTGTCTCTCACAGTGCGGTGTAGTATGAGGACACTCAGTGTGAAG" "59091" "1" "0.018393" "2.9523989" "-3.76" "0.44864495" "15312" "TCTGAAGAAGAGAAAGAAGCTAAGTCCGACTAAGCATCCATCACGTCTGACAGTGGTCCC" "17653" "1" "0.018425" "2.9512737" "-3.76" "0.33931554" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "43972" "1" "0.018495" "-2.948801" "-3.76" "-0.2431151" "231125" "AAGTCCCCCAGGGAGTACTATGTGCAGCAGGAGGTCATCGTGCTGTTCTGTGAGACAGTG" "12354" "1" "0.018537" "2.9473008" "-3.76" "0.4386274" "224405" "TTCATCTTGGTGACAAAAGCATGTTCAAATCCAGGAGAGGCTGAAAGGCCAGCATCTATG" "12633" "1" "0.018568" "-2.9462113" "-3.76" "-0.27316546" "" "CCCCCACACACACACGTTACTAAACTATAAAGAAATAAAATGGAATGCCCTTACATTTGC" "24266" "1" "0.018634" "-2.9438767" "-3.76" "-0.22317388" "67062" "TGTTTGTTTTCTTTTAATAGTGGATTTAGTTTTGTGCTAATTATGATGCCAATGATAATA" "40252" "1" "0.01864" "-2.9436807" "-3.76" "-0.58768772" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "16552" "1" "0.01869" "2.9419123" "-3.76" "0.3298371" "22268" "CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG" "3087" "1" "0.018699" "-2.9416233" "-3.76" "-0.29121423" "74155" "CTCCGCACTGTGTGTACAGTATTGGACAAAGGATTTATTCATTTTGTTGCATTATTTTGA" "50594" "1" "0.018797" "2.9381791" "-3.76" "0.47563885" "215705" "GGGGTAGGGCGGCAGAGATCTGGGCCTGGAGAGACTGTATAAATAAAGCGCTTTATTTGT" "1635" "1" "0.018816" "-2.9375198" "-3.77" "-0.24744374" "13637" "GGGGGGAGTGGGGTGGACTTTTTAGGATAGAAGCAACACTTTGCAATAAACTCATTTTTT" "26473" "1" "0.018835" "-2.9368792" "-3.77" "-0.35129026" "56484" "GTCTATAGCCAAGTTTTGTAGAGCCAGTGGCATCTGGTTTTGTTGTTGTTTTGGTTTTTT" "16156" "1" "0.01885" "-2.9363495" "-3.77" "-0.25148634" "14373" "ACAGCCCAGAGCTCAGATGGAAAGTGTGCAGGAGCTGATCCCTCTGGCCAAGGAGATGAT" "40176" "1" "0.018878" "-2.9353952" "-3.77" "-0.31484108" "14406" "TAACACTGTCAATATGGATATATATTACACATCATCTAAGTCTCAATCATCAGCTGCTCC" "55780" "1" "0.019008" "2.9308809" "-3.77" "0.47289473" "14256" "CTATATACAACAAGGCTTTCTTTTCTTCTTTCTTGGTGCTAGAGTTGGGAACCAAAACAA" "6712" "1" "0.019032" "-2.9300595" "-3.77" "-0.28138383" "22762" "TCAAATGAACTAACTGAGTTACTAAAGAAAGCAGTCACCTTTGGTACCCGTGTTTAGTAT" "23330" "1" "0.019078" "-2.9284717" "-3.77" "-0.42423971" "" "AAGAGCAGCATGAACACACAGAAACAGCCTTCATAATTAACCCCACATGGGTCTGAAGTC" "17291" "1" "0.019116" "2.9271994" "-3.77" "0.25111415" "" "" "4482" "1" "0.019132" "2.9266407" "-3.77" "0.60729702" "" "AGCTGCACGCATGAGCGAATGCCACAATGTGCTTACATCAGAACTTCTAAAAGTGTAATG" "31634" "1" "0.019145" "-2.9261975" "-3.77" "-0.39965409" "" "GCTGTGTTCTTTCTCTTCCTCCATTGTCTGCAAAATCTCCTATTGTAGCAGGGACACTTA" "30028" "1" "0.019173" "-2.9252541" "-3.77" "-0.31215924" "381802" "AAACCTTGAAATACTGAGTGACGGGTGCATTCTCAGTGAACTCACTATTTGACAGGTTGG" "17171" "1" "0.019196" "-2.9244486" "-3.77" "-0.35789275" "19088" "TCTGTCTATATTGCATATCATTCGACCTTATCCCTAGCTTTAAAGTAAACTCACAGTCAA" "40387" "1" "0.01922" "2.9236318" "-3.77" "0.55346953" "237759" "ACACGCCCAGTAGTGAAGCTGCTCACTGTGAATGCCAGCTGAGGAAACCCTGCTCTGGAT" "48343" "1" "0.019223" "2.9235339" "-3.77" "0.34241318" "14087" "TACACTAGAAAATAGATTACCAATCTCCTTGATTGCTCTAGTTAGGAAAAGAAATATTAA" "18854" "1" "0.019231" "-2.92327" "-3.77" "-0.33263599" "382019" "GCACAAACCATGTAGCTGCTCTAATCATAGTGTAGATGTAGAACATACTATTTGCAAATA" "3680" "1" "0.01924" "-2.9229483" "-3.77" "-0.24847289" "100045796" "TTTCTTTCTTACAGATGGAAATAGCTGTTTTTCTAGAAGAGACTCAGGTAGTAGCTCTGG" "56670" "1" "0.019261" "-2.9222517" "-3.77" "-0.24242321" "" "GGCCTTCACTCTGAGCCATCTGTCAGCTCTGCCAAGCTGAATTTTTAATAAAAGCCCATT" "11725" "1" "0.01931" "2.9205698" "-3.77" "0.31169094" "16153" "GGAAAACCTCGTTTGTACCTCTCTCCGAAATATTTATTACCTCTGATACCTCAGTTCCCA" "16255" "1" "0.019439" "2.9162254" "-3.77" "0.59929086" "52377" "AACTCTGAATGTCAACAGCACAAGCTAACCTGTCCTGCCTAGGAGCAATAAAAGCTGTTG" "37799" "1" "0.01944" "-2.9161965" "-3.77" "-0.27344449" "81898" "ACACTTCTCAACTAAGACCTTTTCTTTAGCACTTTGATGTTTCTTAAGGTGAAACTTAGG" "12855" "1" "0.019475" "2.9150334" "-3.77" "0.70163173" "14411" "ACAGCTTGTCACCTCTCAGTCCTTTCCAAGTGAGCTCTAGGAAGCTGAGTCTGCCAAGTG" "25357" "1" "0.019487" "2.9146174" "-3.77" "0.36144923" "73673" "CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC" "19104" "1" "0.019516" "-2.9136389" "-3.77" "-0.27115541" "100043757" "CGGGTGGAGCTCAGCGATACCAGCAGTGACGATGAAGACAGACTGGTCATTGAGATCTGA" "37678" "1" "0.019531" "2.9131614" "-3.78" "0.52044188" "" "CCGTATTAGGTTATGCGTTTACCTGTGTATTAGGACTATTTATATTGCAAGTGACAAATC" "40807" "1" "0.019543" "-2.912739" "-3.78" "-0.52782281" "69430" "TCAATCAATATGTAACTGGTGAGCTTTCAAATGCTTCTTCATGCATCTTTAGGCTTGGTT" "13030" "1" "0.019578" "-2.9115867" "-3.78" "-0.30805775" "258552" "TTCAAATCCACAGTCCAGTCATATCCTACGTGGGCTGCCTCACTCAGATGTCTCTTTTTA" "59584" "1" "0.019594" "-2.911052" "-3.78" "-0.38037131" "74430" "CCATGGAGTCAAAAGGAATGGAGAGAAGGGCTTTGTAAATAGCATTTAATGTTAAGAACA" "29478" "1" "0.019612" "-2.910455" "-3.78" "-0.39935713" "171244" "AAACTATCCTCATCCTGGTGTGCACATTTATCATCTCTTATACAATCTCTTCTCTACGTG" "40206" "1" "0.019735" "-2.9063583" "-3.78" "-0.56163034" "258951" "GGCTCTGTGTTCTTCTAGTAGTAATATCATGGGCCTTATCTTTAACCAATGCTCTTGCGC" "31169" "1" "0.019867" "-2.9019984" "-3.78" "-0.28726885" "78908" "CAATTTGTATCTTATCTCTTCCTTCAGCCGGAGTTGTTGGAACCACTTTATAGTCAAGAT" "19721" "1" "0.019881" "2.901538" "-3.78" "0.67616929" "" "AAGATGAGGTTGGGGAGTGAGGTATCTTCTACCTATGCCGGCCTGGCACAGCATCCTCAG" "19416" "1" "0.019908" "2.9006765" "-3.78" "0.31632399" "18241" "GCTGTAATGCTAAGTGCCAGATCCAAATCCATGAGAAAATAGTTAAATAAAGTCATTGTG" "19629" "1" "0.019975" "2.8984761" "-3.78" "0.310214" "66832" "CAGATGTGGTTTAAGGGCTTCTGCCTTTTTGTGACACAATAAATTATAAACCTGGAAAGA" "30720" "1" "0.01998" "2.8983174" "-3.78" "0.89005929" "12525" "CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT" "35062" "1" "0.019998" "-2.8977142" "-3.78" "-0.30795457" "225160" "GATCACAGAATTCACTGTCCAAAGGAACTCATCACCTTTACTACTTTGTATTTCTTTTGT" "13362" "1" "0.019999" "-2.8976864" "-3.78" "-0.56032768" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "4424" "1" "0.020052" "-2.8959728" "-3.78" "-0.43012994" "" "GGCTATTCAGGCTGTCTTCTCTAGCACACTTCTTGCTCACTTATAGACTGTATTCCTACC" "27439" "1" "0.020155" "-2.8926312" "-3.78" "-0.31057573" "71837" "AAGTGCTTTGGAAGCCCATGGTTATTTCAGAAACCATGAAGCTGGTTCCTGGTGTGAGTA" "39189" "1" "0.020184" "-2.8916812" "-3.78" "-0.35121517" "16525" "CCTAACAAACTCAAGAGAAAATCGGTACGATATTCTGTTCCTGTATACATTTCTACCCTC" "39096" "1" "0.020189" "-2.8915199" "-3.78" "-0.70160236" "16528" "AGACCAGTTTCTGAGGGACCATCCCTGTGTGAGCCAGAAGAGCCTGGAGGATTTCATCAA" "51184" "1" "0.02035" "-2.8863272" "-3.79" "-0.55400178" "216166" "CTGATGGGTAGGGGTCTTTGATTATTTATAGTATGACTATTCAAGCTAGAATTTTGTTGG" "53549" "1" "0.020356" "2.8861423" "-3.79" "0.48271794" "" "TTACACTGTAGACTGTAAACAACGTGGGCTTGTGTTTGCACACTTGTGAGTGCTTCCACA" "37395" "1" "0.020471" "2.8824744" "-3.79" "2.64868268" "15945" "GCTTTGCATTGTATATGGAAGAACTTGTGTCATCAAGTATGTATCAATGGGTAGTTAAAG" "32844" "1" "0.020482" "-2.882111" "-3.79" "-0.23141656" "" "GGTAAATGTGGAATGGAGATGTTCTTAACATGGCTAGGACTCAATAAATCTAATACACTA" "60726" "1" "0.0206" "-2.8783803" "-3.79" "-0.26261516" "" "" "22567" "1" "0.020691" "-2.8755113" "-3.79" "-0.36187403" "" "TGATACTGATGATTTAGATGAACTAGACACTGACCAGTTGCTGGAGGCAGAACTGGAGGA" "4497" "1" "0.020718" "-2.8746494" "-3.79" "-0.71121233" "75426" "CACACTTATGAGTGTCATGGGTAAACAATGTGTGATGCATTGTCTGAAATGTTCACCAAT" "51116" "1" "0.020733" "-2.8741846" "-3.79" "-0.24169447" "" "ACTCTGTGTGTAAAATAGTCTCCTGGTCGCTGATGCATGTGGAGAAGTCCAGATTTACCA" "26078" "1" "0.020761" "-2.8733037" "-3.79" "-0.24840229" "" "GATTGTATCTTGCCCAAGGAAGATATGATCCTTCTCATGGATATTTCTCTTTCATGAATT" "30734" "1" "0.020761" "-2.873301" "-3.79" "-0.27826169" "50525" "GGTTTGGATGCTAATGCAGAAGCTAAGATAGGCTGTTAGGTTTGGTTTTCTAAGAATGTA" "53809" "1" "0.020788" "2.8724389" "-3.79" "0.61811887" "195046" "AACCTGCGGAGCCACACACGTGCACCTTTCTACTGGACCAGAGATTATTCGGCGGGAATC" "57988" "1" "0.020833" "2.8710422" "-3.79" "0.36142122" "" "ATGGAAGACATGGTGGTTGGTAGTTCTATTCTCAGGGGTAGAAATGATACTACTAGATGG" "12217" "1" "0.020843" "2.8707432" "-3.79" "0.75599087" "" "AATTTCACGTTCCTTTTTCTACTCTTTGGAGGCCCCTGAAGGAGTTATCTCTGGGCTTCA" "38668" "1" "0.020911" "-2.8686217" "-3.79" "-0.27203222" "242418" "GACATTGAGCACAGTAATAGCATTCTCATAACTTTTAGAAACTCTTGCAACAAGATAGCT" "6646" "1" "0.020951" "-2.8673595" "-3.79" "-0.40234328" "105364" "CCTGGGGAAAACAATGCTATTCTTACTGAAACAAAAATCACCTTTTCAGTAAAGAGAAAC" "28689" "1" "0.020962" "-2.8670176" "-3.79" "-0.2452981" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "21605" "1" "0.02102" "-2.86522" "-3.79" "-0.22844563" "" "ATATGCTGTGAGTGAACAATTTGCTGGATGAGATGGCCTACAGTGGAAAGAACATCAAAT" "20669" "1" "0.021058" "-2.8640547" "-3.8" "-0.23080248" "" "CCTTCACCTCACGCTGTGCCTCAGTTTTCGTTTACATAATTTTTTGAGATTATAATGTAA" "34292" "1" "0.021066" "2.8638054" "-3.8" "0.4360315" "" "GCCTTTACATACAAACACACACATACCCATACAGTCTTTACATTGACATCCTTTGTCTTT" "31107" "1" "0.021171" "-2.8605521" "-3.8" "-0.24285122" "" "AGGTACATCCTTTCACATTCCCTTGTAAGTATTCTTAACCCAGGTATGACTAGGCTTCTG" "61047" "1" "0.021178" "-2.8603514" "-3.8" "-0.28148985" "69601" "AAGAAGGATCATGCAGAGATGCAAGCAGCTGTAGATTCCAAACAGAAGATCATCGATGCC" "13176" "1" "0.021207" "2.8594588" "-3.8" "0.30483284" "414095" "GCCACCTCTGAATGCTGTGATACAGTGGTAACATGGGAAAATAAAGTCTAGCTATTAGGA" "51663" "1" "0.021237" "-2.8585208" "-3.8" "-0.30240345" "30050" "ATTTGGGCTGGCAGATAGATGATTCTGTTCAGGACTCATTGCACTGGAAGAAGGTTTATT" "54187" "1" "0.021239" "-2.8584727" "-3.8" "-0.23916065" "73162" "TGGGTTCCTTGTACCGATTCTTGAAGTCGCTCAGCACAATCATTAGAGACCTTCAGTGAC" "40296" "1" "0.021271" "-2.8575004" "-3.8" "-0.40384513" "213006" "GTTCATCTCCATCCCAGTCTCCTCAAGAATGAGGCCAGCCACCATGGTGTTCATCAATGT" "5608" "1" "0.021287" "2.8570006" "-3.8" "0.34479795" "18707" "TGTGCAACCTTGACCCAACAGGTAAAGACAGGTGAAAAGAAATAAAAACGTTTTTATGTT" "49189" "1" "0.021327" "-2.8557811" "-3.8" "-0.46146405" "237403" "GACTTTCCCATCACATACAAACTGATTGACAGGACACGAATGACTGGGTTGACTGGCATT" "45855" "1" "0.021338" "-2.8554359" "-3.8" "-0.34507603" "108797" "CCACTCGTTTATGTATATGTAGGTGACGTTACTTGAGCTTAAATGTACTTTACTGAGCAA" "39876" "1" "0.021366" "2.854603" "-3.8" "2.01979587" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "61793" "1" "0.021426" "2.852768" "-3.8" "0.3114696" "107753" "ACCAGAACCACAGCCTTTAGGGTCTGTGCTTTTCCCCAAGGTCAAGGTCAAATAAAAGAA" "29288" "1" "0.021441" "-2.8523157" "-3.8" "-0.4477026" "14403" "AGGCCTTTTCTCTGTGGGATCAGGATCAGAGAGAAAAACAAGTGGGGGTGGATGACCACT" "24647" "1" "0.021512" "-2.8501621" "-3.8" "-0.221097" "276919" "CGTACACAGTGAAAGGAGTACAAGAGCAGTGTAAAGAAATAGTTTTCTTAGATATTTGTC" "1966" "1" "0.021512" "2.8501613" "-3.8" "0.39092814" "" "AGAATGGCCATCAGTTTTTCCTTTCAGCTTAGCAAACTAGCAAGCAGTGAGAGCTGCACA" "9724" "1" "0.021569" "-2.8484356" "-3.8" "-0.21151277" "" "GCTCTGACTGAGTGCAAGATTAAAGATAGAACCCATCTTTTCACTAACATTTCTTTTAGT" "39893" "1" "0.021657" "-2.8457929" "-3.8" "-0.26112977" "" "TTTTCCCTTCCTTGACCGATCTCTGGAACTTCGAAATACATTCAACCGCCTTTTCTGAGA" "48200" "1" "0.021706" "-2.8443177" "-3.8" "-0.26837507" "17168" "AAATTCCGCAGTGTGCTGGTGGTGACCACCCATGAGGACCCTGTTATTGCCGTCTTCCAG" "51055" "1" "0.021766" "2.8425228" "-3.8" "0.29434382" "12154" "GTCGTCACCTACAAGTTTAAATATGAAGGGATGGCTGTGTCTGAGTGTGGCTGTAGATAG" "56946" "1" "0.021768" "2.8424543" "-3.8" "0.47175161" "14955" "TAGTCTGGAAGCAGTTCCATCATAAAGTGTTCAACATGCCCTACTTCATCCTTTGCCCCT" "25900" "1" "0.02179" "-2.8417919" "-3.8" "-0.26488926" "258832" "ACTTACTGAATTTGGTTGGAAATGGAGTTATATTAATGATCGTCACTCTGGAAAGAAGAC" "33168" "1" "0.021801" "2.8414667" "-3.8" "0.50796708" "320189" "ATGAGCCTGGGCATGAACTCTGGAGATGTGATGTGGTCTACTGTCTGGATTCTTTATGAA" "51312" "1" "0.021872" "2.8393656" "-3.81" "0.25046871" "67307" "GTTTAGGAAACAAATCCTTTGTATTTTGAACTCAGCTAGGAGTAACAATCAGGACAAACC" "33559" "1" "0.021929" "2.8376754" "-3.81" "0.38547387" "22051" "CCAACATCTACCCTTAGTGTTTGCCATCAAATGCTGTCTTTTCTTCCTCTCTTCATGAAA" "62518" "1" "0.022026" "-2.8347781" "-3.81" "-0.53011281" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "14885" "1" "0.022056" "-2.833901" "-3.81" "-0.26490896" "432450" "TGGGTGACCTGGAATGTATTTGTTATCTGCTTCTATTTGGAGGCTGGAGATCTCTCAAAG" "37198" "1" "0.02206" "-2.8337909" "-3.81" "-0.27297065" "" "TCAAAGCATTAGGAGTCACAGTGGGTTAGTGCCTATCAAGGCAATCCACAATGTCCAGAT" "53200" "1" "0.022066" "2.8336179" "-3.81" "0.26197942" "218518" "CCTGGCAATACTCTTGCAGACTAACTTTTGTAGTGAGACCTTGTCTCAGAGCACGAAACA" "59276" "1" "0.02209" "-2.8328936" "-3.81" "-0.53813242" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "24552" "1" "0.022296" "2.8268694" "-3.81" "0.27886412" "" "ACTCAAAAAGATCTTGGCTAAAACAGATTCCATATTGTGGGAAGCCGCCCTCACATTCGC" "6125" "1" "0.0223" "2.8267564" "-3.81" "0.33391852" "353346" "GCCCATCTATTTCTATGGGCCTACATATATAGAAAACTGTTATCTATAACATAGACATGC" "45832" "1" "0.022323" "-2.8260756" "-3.81" "-0.26248676" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "16242" "1" "0.022346" "-2.8254083" "-3.81" "-0.24789534" "70478" "TAGCATGAGGAAAGGAATCATTGCATGGACTTAGGTGGTTTTCCTGCCATTAAAGTCAAG" "33273" "1" "0.022381" "-2.8244026" "-3.81" "-0.29601342" "" "ACGTGAAATATTCTCTTTGGAACTTCCGGATGCTGAGGCTAAGAGGTTACTCGTGACACA" "11716" "1" "0.02243" "-2.82297" "-3.81" "-0.29325597" "448987" "TGTCGTGCTGTATGACTCTAGAAAGCCTTAATTTACTTCCACCAAGAAATAAAGCAATAT" "12396" "1" "0.022465" "-2.8219702" "-3.81" "-0.21905851" "" "ACCAAGCACTGTCATTGGACAGCAGAGAATATGACAAAAGTCAACGGGCGATCTGAACAA" "39159" "1" "0.022488" "2.8212801" "-3.81" "0.36959031" "16775" "TTGGATGTAGACTCAGAAGTGAACCATGTAGTTGGGCCGTTGAATCCAAAGCCAGTTGAT" "38864" "1" "0.022576" "2.818743" "-3.81" "0.41694342" "380608" "TAGATGCAAAGGGTGTCTGCGTACATCCCTTCATGCATGCACTTCTGTATGTTGTTTTTT" "26609" "1" "0.022636" "-2.8170272" "-3.82" "-0.59421968" "226413" "CTCATTTCAGGGTTTGATGGTAGACTCAAGAGCACGGACTTCCTTTAGTAAGAACCAGTC" "57247" "1" "0.022704" "-2.8150955" "-3.82" "-0.33721969" "" "GCTAAAGGAAAACCTGATGCTGCGAAAAAGGGGTTGGTCAAGGCTGAAAAACAAGAAAAT" "60803" "1" "0.02273" "-2.8143469" "-3.82" "-0.24656096" "243574" "GCCACTTTTAAAATGACTTTAGAAAAGGTCCTAGGAAACTTAAGATTAGTGATGTGTGTG" "50644" "1" "0.022767" "-2.8132757" "-3.82" "-0.24936778" "66645" "AATGGTTCATTCCTGACTGTTTAGAAAAACATTCAATGGTATGTCTTTACACCATGTCTG" "30641" "1" "0.022769" "-2.8132127" "-3.82" "-0.39868652" "52715" "ATACTTAAAAGTATATAGTTGGTGGTTAAGCTTATGAGATGAGTGAATGGAAAACCTGGG" "22787" "1" "0.022778" "-2.8129752" "-3.82" "-0.28581755" "" "CTTTAGGGGTCAACTGCTAACTTTCCTATTTTTAAGACTGTGCAGTTTTGACATAATTTC" "29580" "1" "0.022799" "-2.8123591" "-3.82" "-0.31713315" "20602" "GAAATGGACTTGATGCGTATTCTGTGGCCGCTCTCTGTGCACGGCGGCATTCTGTCATTT" "44924" "1" "0.022824" "-2.8116428" "-3.82" "-0.26201424" "" "TCCACATGAATACTGTTGGGGGAAGTAACCACGTGAAGACTTTAGAAAAAGACCCCCTTG" "22159" "1" "0.022868" "2.8104041" "-3.82" "0.50760103" "20911" "TCACATCCTTACTCCAACCCGCTTCCTCGATGACCTCAAGACACTGGATCAGAAGCTGGA" "61845" "1" "0.022901" "2.8094578" "-3.82" "0.6986389" "17069" "TATCATTGTACCCACCTTGTACTCTGTTCAGGAGGCTGCCCATGGAGGACTGCCACCCCT" "38715" "1" "0.022927" "2.8087321" "-3.82" "0.35103077" "15932" "CCCAAATGACTCTAGCTTGTAATAAACTGAAATAAAGCCACCCCAATCTTGCCACACATT" "15214" "1" "0.022933" "-2.80857" "-3.82" "-0.222826" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "52942" "1" "0.022962" "-2.8077385" "-3.82" "-0.51056117" "" "AAAGCACCATTTCATCACATCAGCACTTTCTGTTGGGGTAGGGCCTTCATACCACTTGAT" "49142" "1" "0.02299" "-2.8069608" "-3.82" "-0.79115807" "399548" "TTCCTATCTAACTTTATAGGCAATACAGTGGTGGGCCGTGGGAGCCTCCAGGAGGCACCG" "102" "1" "0.023001" "2.8066374" "-3.82" "0.3872886" "226250" "GGCATTTATTTCCTGTATCATAAACACTTGGTGACCTTTATCAAGTGGTGAGTTAGAATT" "16142" "1" "0.02303" "-2.8058294" "-3.82" "-0.47395057" "68498" "TGTCTTAGAGATCACTCTCCATAAAGATGGGAGTCACACCATGTGGGGATCACACTGTAT" "39813" "1" "0.023043" "2.8054591" "-3.82" "2.89768164" "17329" "ATGGGATTTCATTATTAACTTGATCCCATCTTCAGAGCTTATTCTAAGTTTGCCTCTTCA" "30877" "1" "0.023047" "-2.8053525" "-3.82" "-0.53856911" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "39188" "1" "0.023075" "-2.8045489" "-3.82" "-0.29311197" "67179" "CAGGGCATTCGTTTCCTTACTTTGGAATAGTATTTATGTTGAATTGTAAACCCACAGTTG" "56237" "1" "0.02309" "-2.8041261" "-3.82" "-0.29791221" "100502705" "CTGTCTGTGTTAGGGCCTGGAAATCTTGTTTCACATAGATAATGTAATCTAAGCTTTAAT" "30299" "1" "0.023357" "-2.796669" "-3.82" "-0.27952194" "" "CTAACCTCTGCAGTATATCCCTTGCTGACTTTTCAAAGGGTTGGTTGCTTGATATTTTTA" "23431" "1" "0.023395" "-2.7956108" "-3.82" "-0.22617524" "" "TCTTTTCTTTAGTAGCTGTGGAATGTTGGCACGGGTCTTCCTTTGCTCCCTCACATGGGT" "49784" "1" "0.023407" "-2.7952892" "-3.82" "-0.56161907" "100043699" "AAACTCCTCCTGCTGCACTCAATACCTGCACCAAACAAAGAAAATTGTGTTTGCCAGGCT" "61587" "1" "0.023484" "2.7931592" "-3.83" "0.3686089" "" "CAGTGAAAGTGAGTCAACATGCAGATACATGTGCTCTGGTACTATTACTTTAAAATTAGT" "36672" "1" "0.023495" "-2.7928422" "-3.83" "-0.28529813" "" "CAACACTTGAAGCTCTACACTAGAGAATTATTACATATGCGAGGAAGTTGGAAAAACATT" "46697" "1" "0.023572" "-2.7907208" "-3.83" "-0.26304572" "100043772" "GATCAGAGCACTCATATTCTTAAGTCTATGACTGAAAAGATTGTGGGAAGAACTTTAGGA" "21226" "1" "0.023579" "2.7905233" "-3.83" "0.41794172" "" "GGTGTGAAAACTTGTCTTTTAACCTTCTACATCAACACCTGGAAACAAATATTGTCCATA" "25342" "1" "0.023765" "2.7854221" "-3.83" "1.22370917" "11630" "GGTAAGATATCCTATAAACGCCTGTTGAGTTTGTCTCTTGAATTAAACTTATTCCTGGTT" "16866" "1" "0.023786" "-2.7848602" "-3.83" "-0.2232219" "269470" "AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG" "62821" "1" "0.023799" "2.7844931" "-3.83" "0.26719762" "107849" "GGTTCTTGCAATCTGACAATGAAGATGCTCGCATTCGTTCTTCATATGGCATGATCAGCT" "60471" "1" "0.023829" "2.7836715" "-3.83" "0.20987877" "" "" "28581" "1" "0.023867" "2.7826507" "-3.83" "0.34019953" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "40364" "1" "0.023882" "-2.7822307" "-3.83" "-0.33626891" "" "CAAGTGGCAGTAAAACCTTTATAGTCTTTACAACAGTATGCAGTTTGTTTATACCACAGA" "44499" "1" "0.0239" "2.7817546" "-3.83" "0.21415324" "" "AAGCATGATTAGTAGGACCTCAGTAAGCATGATTAGTAGGACCTCAGTAAGCATGATTAG" "25009" "1" "0.023963" "-2.7800582" "-3.83" "-0.22248307" "" "GACTTACTTATTGTGACTGATTGCAGTAGGAATAGCTGATGCTACAACCTAGTTTTTATT" "24223" "1" "0.024062" "-2.7773794" "-3.83" "-0.4538964" "" "TGTGTCTGATACTAATCAGCATCCTGGCCTTTTGGTGCATTTGCCATATGCAAATTTCAT" "3935" "1" "0.024081" "-2.776871" "-3.83" "-0.61814773" "77963" "TCCTTGCCCAGTAATTCTTAACCACTTAAAATAACAAGAATTTCACAATGATTTGGGGTC" "61283" "1" "0.024128" "-2.775605" "-3.83" "-0.25047349" "212892" "TTACTTAGAGATGGGAGGTAGTGTTATCCAGACACTTTAGACTTACGTTCTCTATCACTC" "48111" "1" "0.024128" "2.7755942" "-3.83" "0.32843865" "382075" "GTACCTCCGGTCATCCTGTACTGGCTATATAGCCCATGACATCTCCATGTTCCAGGAGCC" "35351" "1" "0.024138" "2.7753376" "-3.83" "0.47391787" "67547" "GTGATGAGAATTAGTAATAGAAGCCAAGTTATCTCAGGAATTATGTTTTCCTATAAGCCC" "225" "1" "0.02416" "-2.7747277" "-3.83" "-0.50140307" "13841" "CAGTTAGGCTGCAGTGTAAATATATAAAGACATTGTTCTGAGAGCAGTACGATTTCATGG" "41351" "1" "0.024174" "2.7743571" "-3.83" "1.34075415" "21822" "CATTAATAACCCCATGTGCTAACCAAACCCAGGCTCTTTGCTGACCATGGTAGTATTGGT" "4042" "1" "0.024184" "2.7740888" "-3.83" "0.40158727" "16857" "ATCGGTTCCAAGCTTTACGAAAGATAAACACGCTGGAGATCAATGGTGACCTCACCTTGT" "40242" "1" "0.024197" "2.7737524" "-3.83" "0.47366117" "" "CTTGACTCCAGAAGGACCAGAAGAAAAGCCATTTTCATTGCGTCACGTAGGAGCTAAAAG" "27358" "1" "0.024206" "-2.7734911" "-3.83" "-0.38017976" "" "TGTTTTATGGACATCTGTAATTCCTGTCTGTGTACGTCTGGGCTGTAAGGAACCACTTGC" "137" "1" "0.024212" "2.7733484" "-3.83" "0.7172773" "" "GGCAATGATGAACGCCCCACTCAGTTGCCTAATGAAGTCAATGCTGCTTTTCCCCTTGAA" "52516" "1" "0.024303" "2.7708966" "-3.83" "0.34220138" "" "GACTACAGGTGGAAAGGGACTGAGGTACGGAACCCATTCAATAAACTCCAGAAACAGAAA" "10669" "1" "0.024318" "-2.7705168" "-3.83" "-0.21758015" "66714" "AATGTTCATTTATACATAATTCTGGTAATTATTTAAATTGTTACTTCATCCTGGAAAAAA" "61711" "1" "0.024367" "2.7692023" "-3.84" "0.52446461" "" "GAGACGTTATTTGGTATTGGTTGAGTTATAAGTAAAGGAGAATGTCCTTAAAATGGTTGC" "27462" "1" "0.02437" "2.769121" "-3.84" "1.90256116" "64380" "ATCAGCAGTCTAACTCTGAACACTATCACCTCTGTGTTGGCTGCAACTGCAAGCATAATG" "8522" "1" "0.02438" "2.7688658" "-3.84" "0.3350225" "" "CGGAAGCAGGACCAGATGGAGTCATTCATTGCCACAGTTGAGGAACTCTGCTGTAGCTGT" "54011" "1" "0.024384" "2.7687606" "-3.84" "0.22490813" "241303" "ATTTTGAGTTTTGAGATTAGATTGAGCGCTCTGCACTGGGTCCTGCAACCTCCATCCTTT" "22946" "1" "0.024429" "-2.76756" "-3.84" "-0.22184746" "53975" "CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG" "59176" "1" "0.024445" "-2.7671373" "-3.84" "-0.33524039" "66164" "GAAGGTGGGGACATTGCTGACCTTTGTAGTCCTCTACAATGGATTAAAATTTTTTAAACT" "58783" "1" "0.024458" "2.7667749" "-3.84" "2.09053389" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "47533" "1" "0.024472" "-2.7664241" "-3.84" "-0.33654112" "80892" "GACAGTGAGCTGAGCCAGAAGCTACAAGACTTAGATAATTCTTTGGAAGTGAAAGCTAAA" "7076" "1" "0.024523" "2.7650742" "-3.84" "1.13563393" "16428" "ACTGCAGGTATGTCTTACCCTCTGTGGGGGCCACAAGTCAATCATTGCTTATGGAAAAAA" "37670" "1" "0.024533" "2.764806" "-3.84" "2.30164939" "60361" "CACTTCATTGCACTGGCTTTTGAGGTGAATATTAGATTTACTGTAAGTATGTAAGTCAAG" "43244" "1" "0.024565" "-2.7639569" "-3.84" "-0.26914984" "50927" "GGGGGGAGAAAGTGTGTTATTTTCTGTATAGAAAGGTTACTATATGTCAATAAGTGGAAT" "14687" "1" "0.024651" "-2.7616941" "-3.84" "-0.23953948" "" "" "24391" "1" "0.02467" "-2.7611849" "-3.84" "-0.32123818" "12064" "GTAAATGTCTGTGGCCTTGTTCTCTCTATGGTAAAGATATTATTCACCATGTAAAACAAG" "53557" "1" "0.024676" "2.7610448" "-3.84" "0.23968194" "239985" "GGAAAATCCAACCATGAAGACTTGAATTTAATTCAACAGGAAAGACCATCGAGTCTACCA" "4256" "1" "0.02472" "-2.7598844" "-3.84" "-0.30811956" "433424" "GGATCTGGGATAGATTATACCTTGAAGTCTCCGCAAACGCTTTAGTGGAAGAAATGAAAT" "4362" "1" "0.024777" "-2.7583939" "-3.84" "-0.22179635" "276919" "CTGAAGCCTTTTGCCCAGGAACTTCAGCTCTCTGTTCTTTCTTTGAGAGTGTTCCAGTTT" "6723" "1" "0.024873" "-2.7558946" "-3.84" "-0.31215307" "213006" "GATTTCTAGGATGGTATATAAACCCACAAGGAAGTTTCCAGTTTAAGAAGAAAAGTCTAG" "27515" "1" "0.025035" "-2.7516857" "-3.84" "-0.41009243" "" "GAACGTGGCAGATTTCCTCTCTGTGGATCACTTCTTAAAACCTCCTCTGCTGCAGAAGCA" "25714" "1" "0.025069" "-2.7507895" "-3.84" "-0.26920194" "" "TTGCACCAGTGGCTGGTACTCATATGGCCTCTGAACGTGGAGAAGTGGAGTATTGATCTT" "27882" "1" "0.025107" "-2.7498152" "-3.84" "-0.5214568" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "22218" "1" "0.025123" "2.7494146" "-3.84" "0.63138351" "381822" "CGGAAGCAACCTGAGGCGTCCTCTTTGTCTGTAAAGATAGAGAGTCCATTGTGGAAGGGG" "47917" "1" "0.025188" "2.7477377" "-3.84" "0.84786584" "16635" "GTATTTGTGGGAAGAGATTGGACAAATTCCCTCATTGACTCTCCAGTGAGTGTTAAAAGT" "48935" "1" "0.025206" "2.7472712" "-3.84" "0.51733554" "230073" "AGTTCTTGATAGTGGTTACTGGTAAAATTCTTAGTGCAATAAAATGAATTTGCCGAGAGC" "53481" "1" "0.025208" "-2.7472288" "-3.84" "-0.26061958" "" "CATGGCACCCCTGTTAACTTTCAAAGGTCACCTGTAATAAAAGCACAGTGATAAAAACAA" "33500" "1" "0.025257" "-2.7459563" "-3.85" "-0.31024111" "328232" "AAAGATGTGTGTTATAAAGTAAAACAGAGTCTATATTTTATATATAATGTAGATAGTAAA" "6942" "1" "0.025384" "2.7427038" "-3.85" "0.23345421" "" "TGTTGTTGTTTCTATTTAAAATGTTTAATTTTTTACAGTTCATCACTAGACTCCCCCTTA" "44669" "1" "0.025464" "2.7406755" "-3.85" "0.50576137" "17996" "GAAGCCTGGGACAAAGACAAGACCCAGATCCACATCATGCCTGATACACCAGAAATCATG" "49689" "1" "0.025476" "-2.740358" "-3.85" "-0.24302375" "75624" "TGAAGCCTGGTGTTCGATACAGAGAACTGGGAAAAATCATTCAGAAACACGCCCAAGCAA" "26423" "1" "0.025509" "2.7395321" "-3.85" "0.62406181" "" "ATATAAGTGACCTGAGATGAAAGTCCCTGAATTTGTTTTCTGTAGCTTCTATCTTCCCCG" "40462" "1" "0.025603" "-2.7371439" "-3.85" "-0.35083664" "11479" "AATTCTCCAGACTCAAACGCACATAGTTCAGTCACTGGAAACGCTTGTCTTTGCACCTGA" "8711" "1" "0.025651" "-2.7359351" "-3.85" "-0.3065792" "330119" "TCTAAGGAAGAAAAGAGCCTAGAGCCGATTGTGCATATCAGCTGTTCTGTTCATTTGTTG" "25684" "1" "0.025656" "2.7358129" "-3.85" "0.36908174" "22268" "CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG" "6287" "1" "0.025664" "2.7356095" "-3.85" "0.59299215" "" "ATTAAAGTCATTTGCACCTAGGCAAGAACAGAGAGCCTTTGCCTCCACAAAGGACAGCTT" "22342" "1" "0.02571" "-2.7344559" "-3.85" "-0.296201" "" "TATTCCATAATGAAGGCAAAGTGAGAAAGCCAGAAGAATGTGGTATTGTGTAACAGATTC" "18262" "1" "0.025767" "2.7330206" "-3.85" "0.55493474" "" "ATCAGAGAGCAGACACTGATGTTTGGGATGCCCACGGGACCTTGTCTGGAGATGGAGGTG" "60113" "1" "0.025768" "-2.7329912" "-3.85" "-0.38593119" "332397" "AAAGTTTCATATAACACTTTGATAAAGTTGGCTTCTGCCTAAGAAAGCACTGTGGATCTG" "31720" "1" "0.025793" "2.7323712" "-3.85" "0.66352371" "" "TCTTACATGGTTCATTAGCCAGAAGCGTATATTCTTCTCTTTAGACGACCTCTTCCAAAA" "39727" "1" "0.025794" "2.7323349" "-3.85" "0.95877789" "" "CTCCAGGGAAACATTACCATGAAGAAATCTAAAAGGGAGACAAATTAATTTCATTATCGC" "26794" "1" "0.025821" "-2.7316682" "-3.85" "-0.20150517" "22694" "TTGCTCCCCATGGTACTGTAGTATAAAAAAGGCTATGAGAAATACACTCACTGCTGGCGT" "12900" "1" "0.025843" "-2.7311007" "-3.85" "-0.32145148" "80914" "GTGCCAACTAGTACTGGTGATGCCTAATTATGAACCCAACGTGTAACCAGTTATAAATAC" "2189" "1" "0.025853" "2.7308694" "-3.85" "0.30713987" "16618" "ATTTGTGATGGTATTCTCCAAGGAACCACATCAAATGGCCCTGAACCATGCGGTAAACCT" "44320" "1" "0.02592" "2.729188" "-3.85" "0.29736667" "" "TTCCTGTTCTATTAAGTGACAGGTAGCTAGGATGGACGGATATGCTAAATTTATCCCTTT" "5003" "1" "0.025928" "2.7289829" "-3.85" "0.39394697" "192236" "TGGACTCCTCCACAAAGGCTGAGGAGCAAGCCTTCTCTGAAGGGCAGGGATGCCATGATT" "37475" "1" "0.025941" "2.7286646" "-3.85" "0.58547356" "94176" "GAGTAACGAGTATGACATCCTCGTCTTTGATGCTTTGATCTATATAATAGGACTCATTGC" "42668" "1" "0.02598" "-2.7276768" "-3.85" "-0.26639703" "69310" "TCAGATCCTGCCAATCCTGAACATCTTTAAGAACATGAATGTGAACTCCGGGGATGGCAT" "44423" "1" "0.025986" "2.7275338" "-3.85" "0.26311679" "" "CTGAACAACAATCCAAGGGGAACCAAACCGATACTCAAGCTATAACCCTCAATTAAAAAA" "24814" "1" "0.026021" "-2.7266791" "-3.85" "-0.31720728" "320802" "GTTCGGGACAAGAAGCTCTTGAATGACCTGAATGGAGCTGTGGAGGATGCCAAGACAGCA" "41364" "1" "0.026064" "2.7255924" "-3.85" "0.51535779" "224754" "ATTTTACCCTGCTGAAATCACCCTAACCTGGGAAAGGGACAAAAGCAATCAAACCCTGGA" "26907" "1" "0.026098" "-2.7247606" "-3.85" "-0.55809403" "" "TCCAAACATCCTCCACTGCTGCTAAAAGCTCGACCTTGGCCAATTGCTTCCCTGGCTGCC" "35700" "1" "0.026129" "2.7239906" "-3.85" "0.83409352" "236749" "AATATGATGTACTAAGAGGAGTATACCAAGCAGTATGGAGCCATAGCTGTCCACAGCAGC" "18453" "1" "0.026188" "2.7225384" "-3.86" "0.24104264" "" "TCTGAGTGAAAAAGAGGCCGTGTGAAACATCTGCGAGGAAAAGAAAAAGAGTTGCTCTGG" "39628" "1" "0.026215" "2.7218536" "-3.86" "2.00379147" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "44562" "1" "0.026251" "-2.7209769" "-3.86" "-0.36488801" "19401" "TCCTGCTGGGTTTCCACTGAGATCTACTGGAGAAAGAATAAAGTTCTATTTATTCTATAA" "9063" "1" "0.026256" "-2.7208476" "-3.86" "-0.24221886" "320127" "CAGGGCACTGTTCTCTCCTTCACTACGCAGCTAAGACCGGCAATGGGGACATTGTGAAGT" "1205" "1" "0.026431" "-2.7165573" "-3.86" "-0.69377399" "" "CGCACGCACAATTAAAAATAAATCTTGGCAAAGATCACATGAAATTGGGAGAGAATAGTA" "32358" "1" "0.026534" "2.7140364" "-3.86" "0.38665938" "73673" "CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC" "47342" "1" "0.026552" "2.7135964" "-3.86" "0.38613429" "75547" "AAGTCGTCTCCAAATGCTGTATGAACATTTCTGTACTAAGCCCTATTAAATAAAAAGTCG" "30434" "1" "0.026626" "-2.7117968" "-3.86" "-0.28232767" "" "GTTGAAAGATCACCGTTTACCGGTTGTATGATGATTGCATCTCTGTGAAAATAAATTCTC" "3877" "1" "0.026698" "-2.7100635" "-3.86" "-0.35956927" "73293" "AGGAGCTGCTAGAACTGTATGGAGTCCATTGATAGGACTGTTTGCCCTCAGCATTCCTCA" "17051" "1" "0.026713" "-2.7096804" "-3.86" "-0.33862964" "73049" "GGCAATGGGCCTTTGAAGTTGTAATCAGTTTAAAGGAGTGAAATTAATGTAAAACAAAGC" "15657" "1" "0.026736" "-2.7091388" "-3.86" "-0.27162142" "74901" "AAATCTGATCCGGTGCCAAGGAAAGGGTATGTGCTGCCAGAGACCCCAGGGCAAACCTCA" "57670" "1" "0.026749" "-2.708821" "-3.86" "-0.29401993" "219189" "AGCATTGTCCTTCTGACTCTTAGACGCTGATAGTCCCTAATCTGCTGTAGACACTACTAA" "16316" "1" "0.026762" "-2.7085112" "-3.86" "-0.28935798" "66632" "GCATCATTACACTCCTATAACACAATAGTTTTACTGTCTTAAGAATCATGCGTAGCCAGG" "43709" "1" "0.026763" "2.7084829" "-3.86" "0.31339357" "236546" "TTTCAGCAAAGAGCAAAGCCATTGCTCTGAGGATGGCTGGATTGCCAATTGGGATCTATA" "42717" "1" "0.02677" "-2.7083147" "-3.86" "-0.38613834" "" "TTGCTTTACCTCTAAGCCTGTTTGCCAAAACTAGAAAGAGTAATAAAGGCTTCCTATAAC" "27493" "1" "0.026792" "-2.7077868" "-3.86" "-0.23478704" "" "TTTCCTACCTTGCCAAAAGCTCTCATTTCCTTCAGTGTTCTCTCTGTCATGAACAATTCA" "189" "1" "0.026832" "-2.7068099" "-3.86" "-0.26705157" "20610" "GACTCAAGATAGGTTTTGAATGGTGAGCCCCTGTAAAATAAACAAGTTACTCTGACATAC" "29037" "1" "0.026845" "-2.706496" "-3.86" "-0.5018268" "66412" "CATCAGAGTGGACTACTCCTTAGCTGTAATCCAAGCTTCTTGAATCATTAAAAATACATA" "11698" "1" "0.026861" "-2.706111" "-3.86" "-0.3044667" "" "GAGTTTCTTGTGAAATGGGAGATTTCATAAAGTGAGATTCAGATGTATGCCTAAGATTTC" "10750" "1" "0.02687" "-2.7059135" "-3.86" "-0.47277386" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "53354" "1" "0.026875" "-2.7057864" "-3.86" "-0.49651826" "68861" "GCCCATTAATAGACGCAGTGAAATATTTTTGAATCAAAACATTTGGGGTTTGTATGTGCA" "23289" "1" "0.026877" "-2.705736" "-3.86" "-0.26048435" "" "GGATGAGTCCGTCGTGCAGAAAGATGGTCTCCTCCTTCACCGAGAGCCACTGCGCCGAGT" "55265" "1" "0.026901" "-2.7051463" "-3.86" "-0.42806648" "241528" "TGGTCTCAGTTAGGGGCTTGATGTAATGTATTTGAAGAGATCAGGACTTGAATTTCATTC" "12506" "1" "0.026902" "2.7051327" "-3.86" "0.50397429" "13601" "GTCCAAGGAAGAATGAGTCACCCTGAGCCTCAGAGGATTAGATGGGGGAACTCCGCCCTA" "33562" "1" "0.026918" "2.704759" "-3.86" "2.61204612" "17472" "GTGTATATCAGCTATTATTTAAGCTACCTTGTGATATTGTTTCCACGGTACTGAGAGATA" "34708" "1" "0.026948" "2.7040366" "-3.86" "2.00622549" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "1923" "1" "0.026955" "2.7038531" "-3.86" "0.57276947" "20652" "TAAGACTGCAAACTACTTAGCATTCAAAGAGCGTCTTAGGACAACCTCAAAAATACAAAA" "33950" "1" "0.026994" "2.7029197" "-3.86" "0.61819455" "23876" "TTAAGAGTTTTTACCCAACTGTGTTGGAAGACAGAGGTATCCAGACTGATTAAATATTTG" "27517" "1" "0.027105" "-2.700273" "-3.87" "-0.25275607" "230789" "TTTTCTTGATAAAGGAATGATGGTAGCCTAGCTAGTTCTTGTAAAAGTGATGCCTCTTTG" "59492" "1" "0.027133" "-2.699617" "-3.87" "-0.28145945" "494448" "TCAGACCCGTATGCCTGTGCTTAGCTTGCCTCAGATGGCTCAGTGTTGACCCAGGGATAG" "52057" "1" "0.02716" "-2.6989751" "-3.87" "-0.257887" "" "TCAGTCACCAGCTGCCCATTCCCAACGCAGTAAAATGGGTCGCTCAGCTTCGCTTTACCA" "2012" "1" "0.02719" "2.6982397" "-3.87" "0.43901044" "216864" "CGGGTCCCCTCCTCCTTCCTTCATAACTAGTGTCGCAACAATAAAATTTGAGCTTTAATC" "24399" "1" "0.027199" "-2.6980296" "-3.87" "-0.28498509" "668501" "CTGGAACGCCATGTAAAAAAGCAATGATTGATTCTGACGCTGATTCATTAAAACTGGATG" "1471" "1" "0.027223" "2.6974671" "-3.87" "0.23818714" "" "CCTATGGTCTAGTCTTCAAAAGAAACTTTATTGTGTTATAAACTGTGCGGGTAATACTTG" "36464" "1" "0.027309" "-2.6954351" "-3.87" "-0.28937706" "" "AGGATTTACAGACCCGTGGCCCAACTAACAACAGCAAATAAAGAGAGGACCCAGAGTAAT" "60438" "1" "0.027328" "2.6949846" "-3.87" "0.34766238" "23928" "CCCCAGGTCCCAGAGGAACTGATTGTGATTCTGAGGAAATAAAGGACCCTTTTCCTGTGC" "48417" "1" "0.02734" "-2.6946867" "-3.87" "-0.23836624" "100504389" "GGACAATGCATGCTCATCTACACATGTCCATGTATACACACATAAATGTAATAAATCCTT" "36531" "1" "0.027341" "-2.6946778" "-3.87" "-0.27600952" "100233175" "ACCTGTGCTCTAGTTGGGGAACTCATTTCTTTTGTTTGATTGGAACAAGTTCATCACAGA" "45721" "1" "0.027351" "-2.6944271" "-3.87" "-0.22860539" "56298" "GCGTGTGGGCTATATATGTAAAGCTACCATTTTTCCAGTACTTATAACCTCCTTTACAGA" "10723" "1" "0.02741" "-2.6930374" "-3.87" "-0.43616347" "19272" "AAAGGACTTGATCAGTTTCTGTGACTGTATGAGAGCATCCACATTTCATGCCACCTAATT" "53993" "1" "0.027428" "-2.6926133" "-3.87" "-0.23603908" "75541" "TTGTACAATTGCAGAGAATACGTGACTGATCCTTTGATATAGCCCAATATTGGGCCATAG" "6776" "1" "0.027446" "-2.6921993" "-3.87" "-0.40119821" "80334" "TTTACGACTGTCTGCAACAATAAATCAGGTATCTATTCTGGTGTAGAGATAGGATGTTGA" "3718" "1" "0.027482" "2.6913453" "-3.87" "0.41843216" "16443" "TTTAACTAGACTGTGGGGTTGCTACAGATTAATATGAAATGGCGCTCCTGGTCCGTGTGT" "51709" "1" "0.027483" "-2.69133" "-3.87" "-0.29215842" "320714" "TTTGTTCAGTCCTTGAGCACAGATGTTTACACTGTAAGAATAAAAATTCTTTCTTGTGGC" "19209" "1" "0.027581" "2.6890333" "-3.87" "0.44916704" "13185" "AGGGAAACTGAGAAGACTTAGCTGAGTCACCTGACAGTGAGTTCCCAGAGAATGTACTTT" "54315" "1" "0.027631" "-2.6878514" "-3.87" "-0.47312965" "243274" "GAATGATGCTTTGGTTCAACTTAGGAGGTTTAGTATGCATGGCAAGATGTTGTCAAACCT" "48311" "1" "0.027652" "-2.687371" "-3.87" "-0.2814262" "16987" "CGCTTAAAGTTCTTGGACTAGCTTCAGTGAGAAAGGGAAGAAGATGAGCCTTGAGATCCA" "4316" "1" "0.027682" "-2.6866625" "-3.87" "-0.23688902" "93881" "GTATGCATGTCCTCCATTACCAAAGTGTTTACTTAGTTCACAATATCCACTGTACTTAAT" "46000" "1" "0.027717" "2.6858429" "-3.87" "0.43114227" "105785" "ACTGCTTCATGACTTCAAGCCAAGACTTGGGACTTCATGTTAGAGTGACTGGTGTGAATT" "2930" "1" "0.027723" "-2.6857072" "-3.87" "-0.29258268" "" "ATATGCCAGTGTTTTTCTACATTGACCCTGAATTTGCAGAAGATCTGAGAATGGCGAATG" "49596" "1" "0.027732" "2.6854889" "-3.87" "0.93867228" "16188" "AGCTCTTGAAGACTGCGAGGTGACGCCTGTGACAGACGCCTGAGAACTGTGTGGGGGCTG" "4786" "1" "0.027779" "-2.6843953" "-3.87" "-0.29322519" "230597" "CTCAGTGAAGGCCCTGTCGTCATGGAACTCATCTTTTATATTCTGGAAAACATCGCATAG" "3498" "1" "0.027815" "2.6835622" "-3.87" "0.28252974" "767814" "CTACGATTGAATCAATGTGTTGTCATGGATGAGTTGGTTATTCAAGATCTAATCAGTAGT" "9906" "1" "0.027843" "-2.6829113" "-3.87" "-0.34993801" "" "TTTTTGCATGCATTCATTTTCTGTTCTATCTCGTCCATTTTAAGGCAGCGGCGACGGCGA" "7778" "1" "0.027856" "2.6826254" "-3.87" "0.56950194" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "42253" "1" "0.027927" "-2.6809728" "-3.87" "-0.29579488" "" "CTATCTAGCATAATGGCCTGTAGTGATGTATGGGATTGAGCACAGTAGAATAGACTCAAT" "46303" "1" "0.028024" "2.6787324" "-3.87" "0.22465122" "68026" "TATAGATATAGTAGTAACTGTTTTGAGATAGGATCTCATTATATAGCCTCTTAGGTGGCC" "25915" "1" "0.028032" "-2.6785476" "-3.87" "-0.22148561" "" "TTCACTCCTGCATGCGTTTGATCTGACTCCACCAGAAGGTCCAGTCGCCAACGCCTAGCT" "7887" "1" "0.028067" "2.6777455" "-3.87" "0.33427045" "100689" "CCACAGGAGGAACAAACGAAGAGGGGCAGTTTTTCGAAACTTGGCCCTTGTGTGTCGTTG" "46631" "1" "0.028129" "2.6763151" "-3.88" "0.28697955" "" "TTTCCCGTCCGGCTCTTCCGTGTCTACGAGGGGCGGTACGTCGTTACGGGTTTTTGACCC" "45320" "1" "0.028201" "2.6746781" "-3.88" "0.30388008" "" "TTATGGCAAATAGCTCAGCTGGGGTGTAAACAAAAGTTTCCGGGATTGTGTGTTACTTCC" "61351" "1" "0.028235" "2.6738985" "-3.88" "0.32649765" "110948" "TCATAAACGAGTACCATCTTTATCCAGCTTCTGTAGTCAGGGCCAACTCCAGAAACCAGA" "23520" "1" "0.028251" "2.6735186" "-3.88" "0.40676697" "234311" "TTTAAAGAAAACATGTAGCTAATATTTTTCTTCATTTTAATTGTATATAAATGACTGTTG" "46709" "1" "0.028252" "-2.6734984" "-3.88" "-0.38188452" "11752" "ATCCTCTGATCGTGGTCTCCGAGCCTGAAGAACATGACAGAACTCTTCTCAATATTCGTT" "19220" "1" "0.028256" "2.6734111" "-3.88" "0.37567859" "16992" "AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC" "18593" "1" "0.028305" "2.6722855" "-3.88" "0.23321953" "" "CCTGACAGGTTTTGGCTAATTGAGCAAAATAAAAATCTGTTTGGAAATGAGAAGTTGATC" "26027" "1" "0.028359" "2.6710566" "-3.88" "0.24425644" "71780" "CAGGCACCAACACCAAAGCTGTCCACTGCTTAAATCAAGTGACCGGACCGGACCCTTCTA" "28198" "1" "0.02836" "-2.6710459" "-3.88" "-0.38589998" "75288" "CACTCAAATGACACTATCAACTCTGAGTTTAAATAACCCATATGTGAAATATCGCCAACA" "37221" "1" "0.028379" "2.6705972" "-3.88" "0.27873309" "224432" "TTAGCCAAGTGGGAACCATAGACACTGTCTCAGAACTTAATAAGGGGGAGGCCATGGCCC" "50508" "1" "0.028391" "2.6703387" "-3.88" "0.41803828" "104103" "ATAGTCTGTTGAGTTCAAAGCCGGACTGATCTACATTCAGAGTTCTTGGACAACCAGGGA" "1254" "1" "0.028414" "-2.6698112" "-3.88" "-0.274417" "232854" "CATCCCCTTTTCTCACTGAATATGTATGGGTCTGTATTTTGTCTAAACGAACCTGGTCTG" "53542" "1" "0.028425" "2.6695653" "-3.88" "0.36812004" "13650" "CCGACAACCACCTCATGTGGTCAATAAATGGACTGGGAGCGTTTTAGCTGCCACTAACTC" "48491" "1" "0.028448" "2.6690406" "-3.88" "0.3982512" "209378" "CCCAGTATTGCTACTCTATAGCTAATGTCTAGATCTATTCACATGCACAAATATTTACCA" "17904" "1" "0.028449" "-2.6690131" "-3.88" "-0.4395255" "64659" "GTGCTGATGGTTGCACGGGATCTGTTTTCATTAAGGATTGTAGGATTTTCTAATTCTATC" "34285" "1" "0.028475" "-2.6684349" "-3.88" "-0.33036172" "66975" "ATTATCTCTTATTGGGAAAATTGATTTATTTGTACACAAATATGGTGTTATTTTTAGTAT" "3082" "1" "0.028555" "-2.6666256" "-3.88" "-0.21859752" "" "GTCATCAAGAGTTACTGGAACGAGATTGTGGATAGCTTCAATGACATGAATCGATGAGAG" "15165" "1" "0.028566" "-2.6663592" "-3.88" "-0.24231835" "75579" "GTCCTTAGCCTTTCTGAACCCCTTAGCTATCACATCTGTAAAACACATAAAGTTAGGTGT" "57465" "1" "0.028662" "-2.6642099" "-3.88" "-0.3145516" "382077" "AGGCCCTACCGGACTTCCTTGGTGGTACTTCAGACAAGTTTAACCTCCTGGCCAAGCTAG" "5532" "1" "0.028706" "-2.66322" "-3.88" "-0.55047343" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "62697" "1" "0.028723" "2.6628176" "-3.88" "0.70919692" "" "GTTGTATAGCTGTTTCTGATTTGTCCATGTTTCTGTAGGTACCTCTTCACACATGCTTAT" "21396" "1" "0.028734" "2.6625755" "-3.88" "0.4652926" "630322" "ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT" "26628" "1" "0.028863" "-2.6596914" "-3.88" "-0.50996038" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "24628" "1" "0.028968" "2.6573585" "-3.88" "0.76483848" "235587" "TTCAAACAACGCCATTCTTTAAGGCTGACTAGTAGGCCCGTTTGTGTTCACGTCCTCTTT" "44569" "1" "0.028974" "2.657203" "-3.88" "0.44006398" "27387" "CATCTTACTGTAAATAAGTCTGGTGTAAATGTATGTACAGAAGCCATGCTCTCTTTCATA" "36166" "1" "0.029037" "2.6558149" "-3.88" "1.9085246" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "25965" "1" "0.02907" "2.6550856" "-3.88" "0.44712896" "626391" "TGAATGTAGTCAACTTGATTAAGACTTTGCATATCAGAGTCTCCTCCTTTTGTATGAAAC" "34738" "1" "0.029071" "-2.6550582" "-3.88" "-0.27021265" "" "AATAGACTTCCCAGTTATAAGCGTGTTTCCAGACTCTGAATCCTGAGACTGAGGTGCCAA" "52589" "1" "0.029084" "-2.6547709" "-3.88" "-0.50842014" "" "CTGTGGGTGTGGACTGCATACACAACACTGTTTTCTGTAAAATCTTGATGATTAAAAATA" "48445" "1" "0.029198" "-2.6522523" "-3.89" "-0.57635342" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "27948" "1" "0.029265" "-2.6507752" "-3.89" "-0.56477256" "" "TTTTGTTTCCATGCCTCTAGGGCAGAGTGAGATGACCTAATGTTTGTACTTGGTGGTGAG" "47580" "1" "0.029282" "-2.6503968" "-3.89" "-0.36187427" "" "AATCTGTTGAACAGTGATGCACCAACGTGATAAGGACACGGCGATTAGCAAAACAAAAAA" "55837" "1" "0.029288" "2.6502627" "-3.89" "0.26591302" "" "ACACACTAGAGCTTCCCTCAGACTCGCAGTCAAACCTGAGAATGGCGGACCGGAAGTTCC" "25449" "1" "0.029291" "2.6502006" "-3.89" "0.31625928" "12525" "CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT" "52317" "1" "0.029295" "-2.6501085" "-3.89" "-0.29185903" "59057" "CCGGCACTCTCAAATATAGGTGTTCCCCAGATTTTTAAATATGGAGAAACCTGTTTTCCC" "23825" "1" "0.029297" "-2.6500664" "-3.89" "-0.23525734" "" "CTGTCATTTTCACCCCAGCCTAAGACATCTTTATCGGGGTCAGACCACAAAAGATCACAA" "29500" "1" "0.029389" "-2.6480483" "-3.89" "-0.29941904" "241128" "AGTTCTAGCTGTATTTTGGGGGCTCCTGGGGCTTGTATGTTCACGTAATAAACATTTTTT" "4479" "1" "0.029392" "-2.6479725" "-3.89" "-0.37825566" "" "AACGATCCTTTGAAGCCCAGGACGAAGAATCCGTTTAGAAGTGAAAAAGGCAAGTTAGGT" "5135" "1" "0.029441" "2.6469091" "-3.89" "1.36727378" "" "TCTCTAACCATCAGCAGCCTGGAGTCTGACGATACAGCAACTTATTACTGTCTACAGCAT" "11125" "1" "0.029442" "2.6468732" "-3.89" "0.80019228" "171207" "TTCTAGGTCTCTTGGGAGGTAGCAAAGGAAGGAAGCTGGAGATGAGCTCCTCTTATGCCT" "1407" "1" "0.029451" "-2.6466736" "-3.89" "-0.22326748" "230484" "CTGTACATAGAACATCAACTTAGATGTGTGACCTTTAACTTTTTTAAAAACTGGGAGGTC" "51352" "1" "0.029543" "-2.6446693" "-3.89" "-0.25184776" "69241" "TATTGATGCTGTAGGTGCTATCTTCACAGTGACTGTTAGACCATAACTACCATCTGCGCT" "57930" "1" "0.029581" "-2.6438314" "-3.89" "-0.27196074" "234515" "GTAGAGTTGAATCTTTGTTATTTTTACTTGGACTGTTGCTGCAACTCTGCATTGAACAAA" "53266" "1" "0.029592" "-2.6436008" "-3.89" "-0.21023384" "" "AGTTGGAGCCAGTGTTCTAAAGAGAATGCATTTGTGTTAAATAAAATAGGGAAGATGTTG" "3670" "1" "0.029618" "2.643025" "-3.89" "0.25500352" "" "" "13943" "1" "0.029654" "-2.6422465" "-3.89" "-0.1995587" "" "TCCTTGGAGGAGTTCCTCAGTCTCCCAAACCCCATCATCATGATCATCATGGCTAATTTA" "57424" "1" "0.029667" "2.641977" "-3.89" "0.42017962" "" "GTGTAATAAGAATTGGAATGTCTGTACTCTGCTCCTTGACTGATAAAATCTGTTGTGAAA" "35570" "1" "0.029704" "-2.6411641" "-3.89" "-0.32110553" "11782" "CCAGTGCCATAACTTTTAAAGGATATTGCAAAGAAACTGGGAAAGGGTGAAAAAATGATC" "1895" "1" "0.029732" "-2.6405459" "-3.89" "-0.26010645" "12560" "TATTTTCCCTGTTATGTGCTGTAGATGGAGAGTGATGACAATCGTGTAAATGTACTAGAA" "27861" "1" "0.029745" "-2.6402701" "-3.89" "-0.24121642" "12780" "ATTTCTTAGTTACTTTTGTTCTTGTGACTGTGTCATAGGGGCACAGATACACAGTTTGTT" "2415" "1" "0.029804" "2.6389943" "-3.89" "0.29864309" "" "GCCGCGCGCGTCGGGCAGGAGCTCGGGCGGACCGCGCAGCGAGCGCTCCACGTTGCCTAG" "43380" "1" "0.029813" "2.6388089" "-3.89" "2.1374348" "17329" "AAGTCGTCGTCGTTCAAGGAAGACTACATAAGAGACCATTACTTTACCAACAAGCACCCT" "51481" "1" "0.02982" "-2.6386401" "-3.89" "-0.35295947" "72123" "ACTGTTATGTCTTAAGTGCATTAGAATGCAATTGTTTGTAATGGAACTGAAGTGTTTCCC" "37721" "1" "0.029878" "2.63739" "-3.89" "0.29359486" "14284" "GCTATGGAGGAAAGAACATATTAAAAACTTATTTTCCCTCGGGTTTGTTCTCGTTTTATG" "47567" "1" "0.029881" "-2.6373274" "-3.89" "-1.23935927" "67320" "TCTATGACATAAAGGAAACAAGGAAACAACAGCAAAAGGAAAAGGAAAAGGAAGAGGAAG" "21801" "1" "0.029958" "-2.6356654" "-3.89" "-0.37650103" "" "TGTATCTATATCTATATATATGTGGAGTTAGGAGGGCAGGATATAACTCTAACCCCCTCC" "57708" "1" "0.029998" "2.634803" "-3.89" "0.27146939" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "5042" "1" "0.029999" "-2.6347938" "-3.89" "-0.2603168" "17524" "AGGAGGCAGGACTGAAGTTTGTTACTGGAGACATTATCCAGATAATCAACAAAGATGACA" "54021" "1" "0.03002" "2.6343352" "-3.89" "0.34187112" "" "CGTTTGACTGGGAATCCTTTTTTACACTGCTCCATATTTGTCCATTTCAAAAATGAGAAT" "47688" "1" "0.03006" "-2.6334913" "-3.89" "-0.39948729" "212448" "CGGAGCCAGTATCATTAGACTGCCTTAATAATGACAGGAGGAAGTAATAAATTTATTTTG" "53180" "1" "0.030081" "-2.6330293" "-3.89" "-0.32807866" "320145" "AAACATTGTCTTGTTATGTCTAAGTGCATTTAAGCAATGGGTGTTCCTTGAGCCATACTT" "44168" "1" "0.030087" "2.6328994" "-3.89" "0.5178378" "69073" "AGCAGTTCATATTGATTATTGGCTATTCTATACTGTTAACATGACCCTAGTTGCAAGCAC" "17977" "1" "0.030122" "-2.6321499" "-3.89" "-0.23889047" "" "CTGTTGTGCAGGAAGATGTTACAACAGTAACAAACTGAGAATGTATACAATGAAGAGAAG" "25484" "1" "0.030134" "-2.6319058" "-3.9" "-0.32809002" "" "CAAAGGAAAGTGATCCTGGTAGAGGAGTATTTATTCTGCAACAATGCCAAATAAAATTTG" "21277" "1" "0.030137" "-2.6318219" "-3.9" "-0.21646158" "" "GAATCATTTCAGGGTTCACAAAGTATTCTGAGACTATTAATGTGCTTGCTTAATGGAAGA" "51923" "1" "0.030152" "2.6315209" "-3.9" "0.54999935" "67374" "TTCGTGATTTCTGTATGTGGCCTTGGCACATGCTATGCTCAGAGGAAAGGCTACTTTTCA" "13507" "1" "0.030191" "-2.6306805" "-3.9" "-0.21534291" "18329" "CACCTGACAGTCGTCAATCTCTTCTATGGGCCCCTTGTCTACACCTACATGTTACCTGCT" "11181" "1" "0.030203" "-2.6304216" "-3.9" "-0.31614382" "68725" "GGTTTGCTTTAAACTTCTCAAAGCTAATGACCCTGTCATTAAAGAAAATCATCTGAAGTG" "59044" "1" "0.030351" "-2.6272779" "-3.9" "-0.22379971" "22003" "CCTTAGGGCCAGGCACAGACTGCTTTCTATTGTACAGAAGCAATTCGCCCAGTGTAAAAT" "10934" "1" "0.030384" "-2.6265657" "-3.9" "-0.24900382" "17122" "AAATATCATTTCTACAAATCTCGGCAGGATCCGTGTAGGGGCCTTAATGACCACCATAGG" "24643" "1" "0.030424" "-2.6257317" "-3.9" "-0.50051392" "242800" "CAGGGCTCCTCCTTGGAGTTCTACCTCCACAGCCATGAGAAATAAATCTCACTTGATAAG" "20218" "1" "0.03045" "2.625171" "-3.9" "0.21830559" "" "TTTCTGGCTCAGGTTACGGTGAGCGCGGCTGCCAATGTCAGCATACAAAATGGCATGGCG" "37064" "1" "0.030478" "-2.6245815" "-3.9" "-0.25700182" "13549" "TGTTTTCTATTTATTGTACCAAAGACAGTGGTGGTCCGGTAGAGGGGAGATTCCCCCTTA" "11236" "1" "0.030527" "-2.623548" "-3.9" "-0.24155332" "100233208" "CCTTATGTTGAGCGTGTGCATTTTGAAAGGAAGAACCATAAATATTAAGATCACACCTAT" "2601" "1" "0.030532" "2.6234481" "-3.9" "0.30218575" "22268" "CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG" "34205" "1" "0.030576" "-2.6225054" "-3.9" "-0.28475776" "270210" "ACATGTGGCAAAGCCTTCAAGAAACTGTGGTCTCTTCATGAGCACAACAAGATAGTGCAC" "47553" "1" "0.030601" "2.6219774" "-3.9" "0.27649386" "" "TTTCCCGTCCGGCTCTTCCGTGTCTACGAGGGGCGGTACGTCGTTACGGGTTTTTGACCC" "13792" "1" "0.030619" "-2.6216069" "-3.9" "-0.21825419" "" "" "53136" "1" "0.030633" "-2.6213162" "-3.9" "-0.5583585" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "40361" "1" "0.030678" "2.6203638" "-3.9" "0.49386741" "14062" "TTTCCAAATACTGTAGAGTCGCTTCCACGAAAGTCCTATGGTTGTATGGTTAACTTGGTT" "56611" "1" "0.030685" "2.6202281" "-3.9" "0.99655467" "22371" "CAAGTGAGGCCTGTGCAGCTACAGCGGATTCCTACTGATACCCATGCTATGACCTGGCTA" "24585" "1" "0.030835" "2.6170793" "-3.9" "0.50126768" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "43840" "1" "0.03088" "2.6161293" "-3.9" "1.0965017" "17057" "CTTTCACGTTTCTCAAGTTTCCAACACTTGGGAGGAAGGTCTAGTTGATTGTGATGGAAA" "4428" "1" "0.030883" "-2.6160824" "-3.9" "-0.9620417" "" "TGCTAAGGATCTCTTCGCTAACCTCACTGGCGTGTGTCAACAGTATAATTATGAACTTCA" "48397" "1" "0.030901" "-2.6156956" "-3.9" "-0.37486178" "" "CCACCTGGAGTTCCTGTACTTCATTCTGCTTGCAGAATATTTATTAAAGTTGTTTAATGT" "27751" "1" "0.030936" "2.6149776" "-3.9" "0.36930322" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "5604" "1" "0.030961" "-2.6144564" "-3.9" "-0.2455248" "330902" "TTATCTACATTCAGCGGAATTCAAATGTACTGTCTGAATGATCCAGACATACCCAAAAAA" "30286" "1" "0.030981" "-2.6140297" "-3.9" "-0.36238794" "14394" "AGACCATGATATAAGCCTTTTAGCATAATGGCCAAATAAGACAATTAGAATCCATACCTG" "36898" "1" "0.030996" "-2.6137276" "-3.9" "-0.48201667" "243274" "CAGATGCCTGTTCGCAAATCCCTCCACGTGTAGAATGTATTGTAGATTGTAAGAATGTAA" "36124" "1" "0.031004" "-2.6135497" "-3.9" "-0.21903689" "52023" "TCAAGCAAAGACTTTGAATATGCCAAGAGAACATGAAGAGAATATATTTATACCCAAGCC" "25993" "1" "0.031016" "-2.6133017" "-3.9" "-0.5440072" "100043316" "TATAAAAGAGTGAGAGGCCCAGGCTAGAGGGAGGATTATTATTCAAGAGAGGATTACTAT" "32410" "1" "0.031078" "2.6120202" "-3.9" "0.25438538" "22353" "GGATAAAAGAGATATGTGGCAAAAGGATTTTCAGAATTGTATTTCTCCAGTGATAGGTAC" "19479" "1" "0.031156" "-2.6103995" "-3.9" "-0.61869125" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "58128" "1" "0.031174" "2.6100341" "-3.9" "1.2290231" "22035" "GGGAAATGTTAAACTTTGTAAACTCTGAAACGCACAAAGTGTTGCTTTGAATTTCACCTT" "5436" "1" "0.031178" "2.609959" "-3.9" "0.51647526" "" "GGGAACACGTTTGCTGGGTGTGACCATGCTACCACTCAATAAAGTTGCCCTGTGACCAAA" "50097" "1" "0.031229" "-2.6088995" "-3.91" "-0.27637136" "" "TGTAAAAGGTGGCTACTGTTCATGACACTCCTCTCTCTGGATTGTCCATCCTGACTTTGT" "45752" "1" "0.031265" "2.6081489" "-3.91" "0.41956527" "" "TGGGACAAATTACCTGGCTGTGCCAACAGTGTGCATGGCAGAAGTCTGTGTACAGAGAGC" "56737" "1" "0.031268" "-2.608093" "-3.91" "-0.21879139" "30050" "GGTGCTATGTTATAGCAACTTTTCTCACATGGGGTTTAGATTTTAAAAGAGCCATTGTTA" "1284" "1" "0.031311" "2.6072107" "-3.91" "0.36273292" "" "" "23531" "1" "0.031333" "-2.6067533" "-3.91" "-0.29344149" "218544" "TGCATTAGAGAGGAAATAAGTAGGAACAGAGAGTAGATGCCCCATGGAACAGATCCTGGA" "14093" "1" "0.031345" "-2.6065164" "-3.91" "-0.58033505" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "31110" "1" "0.031379" "2.6058024" "-3.91" "0.40991478" "328795" "GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC" "49793" "1" "0.031383" "-2.6057284" "-3.91" "-0.2353169" "" "" "9753" "1" "0.031447" "-2.6044217" "-3.91" "-0.32860834" "380930" "GGCCTAACTCTAATTTTCCATTTCTGTAGGGGAAAATGTCTATAAACATTTCAGCTCAAT" "16446" "1" "0.03145" "-2.6043543" "-3.91" "-0.36525145" "231070" "ACAGCATAGAACACAACACGTGGGACCTAACTTGCAAGGATTGGGTCTTCAACTTCAAGT" "1871" "1" "0.031547" "2.6023623" "-3.91" "0.28862444" "13019" "TACCGCCCTAGGCTGGTCAATGGAGAGAGAAAGGCAGAAAAACATCTTTAAAGAGTTTTA" "37257" "1" "0.03157" "-2.6019021" "-3.91" "-0.28979923" "" "" "2237" "1" "0.031579" "-2.6017175" "-3.91" "-0.66996078" "22393" "ATCTCTTCTGAGTACCCCAGGACTTGGGAAATAATGCAAGAGTGTCCCTTTCAGTACACA" "39566" "1" "0.031625" "-2.600779" "-3.91" "-0.23467445" "" "ATTGTTCTCTAGGCCTTCTGTCCCTTCTTGTGTCATTAAGAAATTCAAGCTCGGGCTGGT" "17026" "1" "0.03167" "2.5998688" "-3.91" "0.35893393" "330260" "TTCAAAAGGTATCTGAGGCTTGAAGAGATGGCTCCCTTGGTATGGTGTTCCTTAAGCAAG" "40613" "1" "0.031726" "2.5987171" "-3.91" "0.46325478" "121022" "CTGCTAGGTTGTTGTCTAGGATACTTTAGCCCATGACCATTTTGCTGCAGGAGGTAGAAA" "33994" "1" "0.031768" "2.5978846" "-3.91" "0.363586" "68612" "ATAAGTGGTCTGCACTATATGATGTCAGGACTATCTTGCTCTCTATCCAGAGCCTGCTAG" "23453" "1" "0.031797" "2.5972834" "-3.91" "1.87575865" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "53910" "1" "0.031805" "2.5971167" "-3.91" "0.81164127" "" "TTTGAATTGACTTCCACTGAAGATGTGTGCCTCCTGAGGTCTGTAAGGCACAGTTACATG" "335" "1" "0.031839" "2.5964382" "-3.91" "0.96124069" "208154" "GCCAATCACATAGCATTTATGCTCTTATTCCTACTTAGTAAATATGTATGTTGTAGCTCC" "25150" "1" "0.031865" "-2.5959076" "-3.91" "-0.21561658" "" "ATTCTTAGCTCCAGCCTATTTTGTACCACCCACACAGATGATGCTCCATCAGAAGGTCTA" "36412" "1" "0.031876" "-2.5956963" "-3.91" "-0.22010688" "75746" "GGTAGGATTATGGTTGATGATTTTTTCCTTCCTATCTTCTTGCCCTCTTTACACTGCAAT" "35125" "1" "0.031893" "2.5953443" "-3.91" "2.22456264" "107350" "ACTGAGGGAGCTATCTTTCACAGAGTGTATTCAGTGGTATACGTGGAGCTCAGAAGTAGA" "25012" "1" "0.031907" "-2.5950632" "-3.91" "-0.21664359" "56538" "GTTTTGTTTTGTTTTGTTCCCAGCTTTGAAGACAGTCCCTGGCATATCCCAGGGTTTCAA" "23745" "1" "0.031912" "2.5949682" "-3.91" "0.56712406" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "31621" "1" "0.031961" "2.5939832" "-3.91" "0.5316148" "407800" "CTCTAGCTTTGGGATCTACCTTAGTTTCTTTTCCTGTTACTGTGATAAAAATACCTCAAT" "44022" "1" "0.032001" "-2.5931761" "-3.91" "-0.25172164" "" "AAGCGGGCATTTTGCCATCTGTGTGATTAAAGTCTTTACTCTGTATGTAGCCTGACCCCT" "8005" "1" "0.03201" "2.5929903" "-3.91" "0.3568714" "67768" "CAGAGGAATTTTTTGTGTTTATCTTCCTACTAAATTGCTCAGTGATCATGGATATCACCA" "58481" "1" "0.032021" "2.5927598" "-3.91" "0.37163622" "" "AGCCTGACACGGAGAGAGTTTCCTTTTGAAGACATCACTCAGGTAGGCTCATATAACTGA" "18591" "1" "0.032061" "-2.5919557" "-3.91" "-0.33769119" "59046" "AGTCAGACTTGTATTCTTGATCTGAATATCACAGTCTTATCAAAACTGAACTATCAACCC" "40246" "1" "0.032094" "2.5913025" "-3.91" "0.48935518" "171095" "GCGAGGAATGGGACCTGGGACCCTGCACTACACTAGAATAAAAGCCGATACAGTATTCCT" "48334" "1" "0.032098" "-2.5912292" "-3.91" "-0.31947892" "93876" "TGAAGTTTTCCACTAGTTTAACCTACTTATATCTCTTACAGTGCTGATAGTTTCTTTCTT" "39591" "1" "0.032102" "2.5911408" "-3.91" "1.35521504" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "947" "1" "0.032136" "2.5904496" "-3.91" "0.48793448" "667214" "AGCCAGTCCTGGATACCGCAACACACCGGAAGAGCAAGATTCAGATTCAAAATCATATCT" "60125" "1" "0.032157" "2.5900423" "-3.91" "0.28157666" "13184" "AACTATAATGACAACAAGGACGGTCAAGTGTATGGCTCAACTGCCGGGAAGGAAATGGTA" "9215" "1" "0.032168" "2.5898097" "-3.91" "0.28648847" "18432" "TTTCCCTGCCCTAGAGACTCCTATTTTTTCACCAATATTTTAATAAACAATCCATGATGC" "15362" "1" "0.0322" "-2.5891835" "-3.91" "-0.28045934" "211914" "CAGCGCAACTGTATATACTGTATAACCTAAACGGATTATTTTCATTGTCTTAATGCAGTG" "34416" "1" "0.032232" "-2.5885354" "-3.91" "-0.31631162" "231125" "GTAATTCAAAACCATTTCCATAAATCTATTTAAGGATTGCACACGCTCTGGCGTCTTCTA" "46400" "1" "0.032243" "-2.5883192" "-3.91" "-0.22890856" "106021" "TTTTTTGAGAGTTATTCTGGAAGTGTGTTACAAGCTAGGAGAATGCTTTTGGACAGTTAT" "25058" "1" "0.032249" "-2.5882072" "-3.91" "-0.21071195" "" "TTGATTGCCCTCAGTCCTTCAGTGTGTGAGGCGAGACTCACTGTTCTGTATGTATTAGAA" "44272" "1" "0.032252" "-2.5881355" "-3.91" "-0.30040117" "" "AGAATATTGCGGCTACAGAGCTAAAGGAAAACCTGATGCAGCGAAAAAGGGTGTGGTCAA" "3471" "1" "0.032281" "2.5875691" "-3.91" "1.93557646" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "4881" "1" "0.032282" "-2.5875505" "-3.91" "-0.45219355" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "21958" "1" "0.032303" "-2.5871232" "-3.91" "-0.53958296" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "15670" "1" "0.032379" "2.5856146" "-3.92" "0.36430773" "15360" "CAAAATCCATAAGGTTGGCCAGGCATGATCATGCAGAACTGAAATCTCAGCACTTGGGAA" "48232" "1" "0.032434" "2.5845135" "-3.92" "0.22599378" "" "GGACTGAAGGGAAGGTTCTCCAGTCACTTAGTGCAAAATGTGAGTCCACATTTGTTTCCA" "35768" "1" "0.032482" "2.5835632" "-3.92" "1.99967209" "" "GGATTCAGTTCTCTTTCAATGATCTGTGCATGGCATTTTTGCAATTATTTCCTGTAAAGT" "61851" "1" "0.032503" "-2.5831461" "-3.92" "-0.45741498" "" "TCCTTCTTGGCTGTGTTTTCTGGTTGTTCTCATGAACCTTCTTTTGCATGACGCCTGTGA" "46587" "1" "0.032542" "-2.5823703" "-3.92" "-0.29966691" "16904" "CTGGGAAGGGACTAGGTGTGCCTCTGAGGACCAATAAATCCTGATATATCTGTTGAGTCC" "7313" "1" "0.032565" "-2.5819308" "-3.92" "-0.3184354" "12386" "AAGAAACACATTTCACCTGTGCAGGCTTTAAGTGAATTCAAGGCAATGGATTCCTTCTAG" "45881" "1" "0.032581" "2.5815977" "-3.92" "0.30956138" "100038683" "GAGAAATAAACCTGTACAATTACCAGGTATTCCTTGTGACTTTGCACTTCCTTGTGACTC" "30076" "1" "0.03267" "-2.5798602" "-3.92" "-0.31434916" "" "TCTTATTCCGTTACGGCAAAGGGCTGCTGGCTTTTCGGCTACATAAATAAGACCCCTTCT" "59465" "1" "0.032682" "2.579612" "-3.92" "0.21396307" "" "" "23529" "1" "0.032698" "-2.5792961" "-3.92" "-0.26257542" "74386" "GGTATGGAACACGTGGAGAACCTAAAGAAACGGTTGAATAAATAATTTGCCAGAATGCTA" "62270" "1" "0.032705" "-2.5791643" "-3.92" "-0.37162639" "212190" "ATTCCACTTACCCCCAAGTGTACAATTCTGCCCTTGATCTAGGTAGGAGCCTATAAAAAA" "23548" "1" "0.032722" "-2.5788235" "-3.92" "-0.54691851" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "60448" "1" "0.032745" "-2.5783695" "-3.92" "-0.31188466" "76469" "CTTTTTTCACAAGAAAATGTCACCTTACTTCACTAGAGGATAATGAACCCTAGTCATTAG" "52481" "1" "0.03286" "2.5761289" "-3.92" "0.2680585" "20928" "ATTGCGTTGCTTGGGCTACCTCCGATGACAGAAACGTGCTTTTACTGTAGGTAAAACCAT" "35668" "1" "0.032901" "-2.5753094" "-3.92" "-0.26348122" "20677" "AATCCTGTCCGTCACTGCCTGTCAGGTTGTTCCTATATACCTTCTGTAAATAACTTTTTT" "41736" "1" "0.032914" "2.5750656" "-3.92" "0.5527423" "11799" "TGCTGATAATTTTGTCCTGATGAGTTTTCCTACCACGGGGTAACGGAATAAAATCACTTG" "60174" "1" "0.03295" "-2.5743686" "-3.92" "-0.42056476" "78752" "TAAGCAGAGCCAGTATCTCCTTTGTACACACTTATTTATTGTAAAGACCAGTGACCATGG" "34405" "1" "0.032995" "-2.5734865" "-3.92" "-0.27002451" "" "CTAGAATTGAAATCTGTTCAAGAAGTTTGGAACCAAAAGTAAAGTGCAAGTGTATATGTT" "35794" "1" "0.033004" "-2.5733136" "-3.92" "-0.18819522" "234740" "AGTATTCAGGGAGAAAAACTCTCTGGTACTAGTTTCTCCGACTTAACACAGCTGATTATG" "25561" "1" "0.033009" "-2.5732112" "-3.92" "-0.29463742" "" "CAGATTCAAAGTGTGATTTGAAACAGCTTGTGTTGGAGTTGTTTATGGTCGGGATGTAAG" "49139" "1" "0.033038" "2.5726375" "-3.92" "2.45995712" "15953" "TACCACCTGCCTCTGTGTTAAGAGATAACCTGTTTCTGATCCATTTGTACCAATAAAAAA" "41256" "1" "0.03307" "-2.5720136" "-3.92" "-0.5635342" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "2721" "1" "0.033091" "-2.571603" "-3.92" "-0.22097613" "192198" "GGTGGGAGATGCCAACAAAAGAACACTGATTGTAATGTGAGAAAAGTGTATTTTTGTATT" "15031" "1" "0.033093" "-2.5715777" "-3.92" "-0.47892503" "232966" "TGCTTCCGTTTCGTACTGATGCAAGAATGGTGGGAATGGCTGGTTACAAGTCACAAAAAA" "50597" "1" "0.033189" "2.5697092" "-3.92" "0.51040423" "" "CTGATTTTAATTGGGTTCAGAAGACTGGATGTCTATAGTCCCATACCATGGACTATAGTT" "25538" "1" "0.033219" "-2.569129" "-3.92" "-0.4051634" "26381" "GGCAGTCTTATGTGCAAAGATCGTGAATGGACAAAACAAAAAATTAAACTGCTTACAATG" "38758" "1" "0.033254" "2.5684489" "-3.92" "0.95674888" "16160" "GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT" "58133" "1" "0.033346" "-2.5666637" "-3.92" "-0.22290103" "72404" "TTGTGATCTAAATTGTGGACTTATTCTTTACTTTGTAAGTGTATATATATATAATTTTTT" "36022" "1" "0.033397" "-2.5656989" "-3.92" "-0.31496536" "" "GGGTGGAAAGTGGCCTGCCTTCTCAGCACACCTCACACCCATGGTACCTCAGGGATTAAA" "37787" "1" "0.033423" "2.5651974" "-3.92" "1.10219712" "100033459" "CCATAACTTGAGAGATGGTGAATTACTACAAGCAAATTGTTCTTCTGTCTGGATTAGAAT" "39184" "1" "0.033464" "-2.5643946" "-3.93" "-0.63170039" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "31848" "1" "0.033516" "2.5633987" "-3.93" "0.38646394" "" "TATCAGTGTGCCAAGTGAGAGTGTGCTCACTCGGCTGTCTGTTTCTGTTACTGGGTGCCA" "9137" "1" "0.03359" "2.561981" "-3.93" "0.2949972" "382639" "GTGCACAGTTACTGTGAAATTAACAAAGAATGGTGACTGGTTATATGTTTATAACTGGCA" "11589" "1" "0.033691" "-2.5600576" "-3.93" "-0.33094137" "219022" "TGCATACTACTGGGCCCATTTGGTTTTGTTTTTTGTTTTTCCAGTAGTAGGGCTTATAAG" "35265" "1" "0.033691" "2.5600435" "-3.93" "2.04007937" "80901" "ACAGAGCTTAAGACTTTAACAAATACAAGAGGACTCTGGTGGCTTTGCTCATCTAAAAAA" "14034" "1" "0.033698" "2.5599088" "-3.93" "1.96986735" "72310" "TCTCCATATTAGTGGCTATGGCAGTGTACACCAGTATGAGATGGAGCCAGACTCCATTTT" "25349" "1" "0.033731" "-2.5592952" "-3.93" "-0.30671425" "" "GGTATGATCCCTCTTCCTTGCCCACATACTAGGATGATACGTATAAGGAACTATGAGGGA" "15006" "1" "0.033742" "2.5590814" "-3.93" "0.56198691" "" "AAACATACACTTTGTCCTTCAAGGCATGTCACTGAGGACCCTGAAGAATGCTCACTGTCT" "48639" "1" "0.033761" "-2.5587159" "-3.93" "-0.22434537" "19364" "CTGTTTGGGGAAAGGCGTGTGCTTTATAAATATGTATTGGAAAGTACTTAGCAAATGAGT" "40810" "1" "0.033811" "-2.557771" "-3.93" "-0.32216232" "75847" "GTGAGCCGTTCTTGTTTAGACAGCTTGACTGTTATGTAAGTCTATGCTAATATCAGTCAT" "56739" "1" "0.033823" "-2.5575362" "-3.93" "-0.22173682" "211586" "CCAGATGTCACTACTTTTGTCTTTATTTCAAGAATATGGCCATCACTGTTCTCTTATACA" "35782" "1" "0.033831" "2.5573756" "-3.93" "0.91127852" "15894" "CCTCTTATGTTTATAACCGCCAGAGAAAGATCAGGATATACAAGTTACAGAAGGCTCAGG" "51475" "1" "0.033845" "2.5571192" "-3.93" "0.3272182" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "27840" "1" "0.033874" "2.5565697" "-3.93" "1.23635455" "434223" "TTCCTCAAAGAAGCCATGAGCAAAGCTTTGGATCCTGCAATGAGGGAAGTAGAAGCGTAT" "2961" "1" "0.033874" "2.5565628" "-3.93" "0.70920878" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "56960" "1" "0.033902" "2.5560435" "-3.93" "0.33829692" "" "AGTGCTTAATGACATCACCATGCATAGGGTCATAATCTCTGACAGAAAGAGAGAAGCTTC" "27161" "1" "0.033981" "2.5545464" "-3.93" "0.41160393" "328795" "GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC" "19768" "1" "0.033985" "2.5544645" "-3.93" "0.27963037" "73061" "GCAGAGCCATGGGATTGGCATACATATCTGCCATATTGTTTTTATTAAGTGCTATAATTT" "20692" "1" "0.03411" "2.5520986" "-3.93" "0.25140711" "214597" "TGCTACGGTTGCAATTGTTTTCTATGAACGAGTACATTCAATAAAGACAACCAGACCTGG" "23250" "1" "0.034167" "-2.5510353" "-3.93" "-0.20825635" "208151" "TTGTTAGTTGTTTGTGAATCTCCTGGGGGTACAGTTCTGAGGGAAGAAAGGCTCCAATAC" "7442" "1" "0.034209" "2.5502307" "-3.93" "0.25565154" "" "TCACTGTAAACTGTTAGCCACTGGGGTGATAAAGAGATAGAAGATTGAAGCTTTGCTTAC" "23957" "1" "0.034311" "-2.5483214" "-3.93" "-0.33127227" "15490" "TCAGTCCTCAATAAGGTCTTCGATAGTTATTTAATCTAAAATTTCATCATATCCCTCGGG" "57159" "1" "0.034314" "-2.5482675" "-3.93" "-0.26558909" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "37789" "1" "0.034321" "2.5481385" "-3.93" "1.12798173" "" "GGACATATATAATCGGTTAGCCTGGTATCAGCAGAAACCAGGAAATGCTCCTAGGCTCTT" "42274" "1" "0.034356" "2.5474825" "-3.93" "0.3541155" "26456" "CTCTTGGGTGAGGATGACTGTTATTTTTGTAGCTGAGAACGTGGAACCCCACGAGTTTTT" "45998" "1" "0.034372" "-2.5471781" "-3.93" "-0.25100137" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "32308" "1" "0.034398" "2.5466929" "-3.93" "0.35464807" "382301" "GTTCTCTTCTACTTTCCCATCTTCAGAAAAATGAAGCATGAAAAATTTTCACTTGCTGGT" "31942" "1" "0.034535" "-2.5441405" "-3.93" "-0.3772598" "12837" "CAGTTGTCCTCAAATATTTTACAGAAACAAAGAATGATGAAAAGACCGGTAACTTGCTTG" "30437" "1" "0.034541" "-2.5440336" "-3.93" "-0.27652067" "75894" "GAAGTTGGCATTGCATCTTGCCGAGATTCCAAACAGGGAAAAAGAAAATCAGATGCTGCT" "61314" "1" "0.034549" "-2.543878" "-3.93" "-0.45500353" "109264" "ACCCAGCTTAATCCTTTTTATTCCAACTCCAGAATCAGTAAATATACCCAGAGAAGACAA" "8673" "1" "0.034644" "-2.5421136" "-3.94" "-0.28186789" "15289" "CCTACAGAACTAAAGGAAAACCTGATGCAGTGAAAATGGGGGTGGTCAAGGCTGAAAAGA" "9471" "1" "0.034678" "-2.5414792" "-3.94" "-0.24682438" "109910" "AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC" "58641" "1" "0.034698" "2.5411108" "-3.94" "0.65444883" "79554" "ACTGAGAACTTAGAGCGACTGGCCAGAAAGTAAAGATACAACAGTTGATATGTGTGCCAC" "42345" "1" "0.034793" "2.5393625" "-3.94" "1.63995868" "16421" "ATTTTTCAGAGTGACCTTCAGAGGGCAGCAGCCATTCCCACCACACGAAGGGCTGGTCCT" "52983" "1" "0.034814" "-2.5389721" "-3.94" "-0.43515418" "20620" "TGTGGTTGGAAAAGTGCATTCCTTGTTAATAAACTTTTTATTTATTACAGCCCCAAGAGC" "15733" "1" "0.0349" "-2.537384" "-3.94" "-0.23962106" "" "TCTCTTGAGACTGAGAAGAAACCCTTAAGGCATCTTTTTGGCAAGTGGGCAAATGGCAGT" "36724" "1" "0.03496" "-2.5362829" "-3.94" "-0.23665613" "282619" "CCACCATGCCCTAAACTGATGCCCAGGCAACAGAATGCTCCGGTTGTCACACCAGCTGAA" "3817" "1" "0.034992" "2.5356818" "-3.94" "0.44253968" "20658" "CCAGCCGCTATTTTGTTGACTGAGGAAGTTTATGTTAATTTTTTAGGGTCTGATAGAATA" "58792" "1" "0.035045" "2.5347143" "-3.94" "1.50676563" "12507" "GACCAGTGGGGTTGGCTTTCTCCTTGGACTCTGACGCCATTGAACAAATGAGGAGGCGAT" "1746" "1" "0.035106" "2.5335962" "-3.94" "0.24214359" "" "GTTTGTGTTCCGTAAGTCATAGATCAGAATTGAACCACTGGCTAGTCCAGCATAGACGTA" "1014" "1" "0.035121" "-2.5333161" "-3.94" "-0.31130676" "386753" "CCAGACTTAGTCACTGAGTGCTTGTGAGGTAAGGTAGTTTTCTTGTTTCTAGAATTCAGT" "27962" "1" "0.035132" "-2.5331309" "-3.94" "-0.30101019" "68312" "AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT" "39791" "1" "0.035135" "2.5330752" "-3.94" "0.4878944" "432729" "TCTTCCATATTTCTCCAACACAGCTATACATTGGTACCGGCAAAAAGCAAAAAAGTTTGA" "13406" "1" "0.035181" "-2.5322253" "-3.94" "-0.52409524" "67392" "AGTGTGGAATTGCTACAGACCCAAGACATTGCAGATGTTACTTCTGCGGAATGATTGTGC" "62347" "1" "0.035217" "-2.5315674" "-3.94" "-0.52755884" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "25382" "1" "0.03525" "-2.5309601" "-3.94" "-0.26821661" "" "GGCTTTTAACGGACTTCAAATATGGTATCAACAACACAGACAGAAAATAGTTTATTCACC" "18083" "1" "0.035318" "-2.5297228" "-3.94" "-0.39667906" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "47130" "1" "0.035349" "2.5291705" "-3.94" "1.15961866" "84544" "TCTTTTTCTGCACACTATTGTTTGGGCTTGGAGTAAGAAAATGGTATCGGTATCAAAATG" "24495" "1" "0.035358" "-2.5290003" "-3.94" "-0.2790897" "" "TTACAGGAAGAATGCTTGTGCGAAGGGACCTAGAAGACTTGGTTGTACTTCCCATCATTC" "27574" "1" "0.035366" "2.5288487" "-3.94" "1.29395496" "327957" "GCAGGGATCCTTCAATACAATTCCTTATTTGTGGTGATCCTCAACCATAAAATTATTTTG" "38801" "1" "0.035413" "2.5280083" "-3.94" "0.48024118" "192192" "CTTAACGAAACTTCCTTTTGAATCTAGCCACCAATGTGCCTTCATGTGGACTGGTCCCAG" "7843" "1" "0.035423" "2.5278195" "-3.94" "1.93270516" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "29235" "1" "0.035445" "-2.5274254" "-3.94" "-0.3287137" "67238" "AATGGAGCACAGCTTTCTTCCCTGCAAGAGTGGTGAAGGCTCATGGTATTTATAAGCAAT" "18303" "1" "0.035479" "-2.5268124" "-3.94" "-0.18619927" "" "TTTTGCTTTAAATGACTTAATGTACCGTCTATATAATTTGATTGACAGCATGATAGTAAC" "17714" "1" "0.035482" "2.5267516" "-3.94" "0.33291092" "13508" "AGGAAACAATCCCTACGCAAAATCTTACACCTTGGTATAACACATGGCACCTGATGGACA" "9654" "1" "0.035486" "-2.5266742" "-3.94" "-0.50327545" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "14402" "1" "0.035499" "2.5264373" "-3.94" "0.82500327" "229003" "AGTGAAATATACACCAGGACATCTGGGGCTTCTAAGGCCTGGCTGCAGAACCTCCTGTGA" "1104" "1" "0.035549" "2.5255424" "-3.94" "0.31458192" "" "TCTCCTGAATTAAACTAAACTTAACCTACAAATGTCTGGTCCTAGCTGATTTTGACAAGA" "9259" "1" "0.035557" "-2.5253925" "-3.94" "-0.21099809" "" "CAGGCCTGTAAGATCTACCTAAAGAATACAAGGTCAAGGAAGCAAAGGAAGCAGAGGAAA" "41732" "1" "0.035674" "-2.5232762" "-3.94" "-0.20474948" "100043431" "ACATTGAATAAAAGGACTGGTTTGTTAAAAGGTTGTTAGTGTCCTGCCAATTAAAACAAT" "12844" "1" "0.035706" "-2.5227012" "-3.94" "-0.20875649" "66830" "GTGATAACTACAGCAGCTTCATCAGCGACACTTGCAACAAGATAGAACCGGACATGATGA" "4737" "1" "0.035976" "-2.5178658" "-3.95" "-0.27134473" "18514" "TTTCAAGAGGAAGCCAATATTTATGCTGCCAAAACGGCTGTCACAGCCACCAATGTGTCA" "55086" "1" "0.036012" "-2.5172324" "-3.95" "-0.28022576" "" "ATTATTTTTAGATCAGTTACATTTTATACGGGGCATAAACTATTAAGGTGATCTGATGAG" "39683" "1" "0.036035" "-2.5168095" "-3.95" "-0.35722629" "66648" "CTCCTTCACCCCCAATTCCTTTTGAGTAAGTTACTTGTTAAAATAAATCCTTAAGGTTCA" "30140" "1" "0.036049" "2.5165705" "-3.95" "2.27546515" "24108" "AGCCGATTTCCTCTGAGCTATTACCAATCACATCTCTTGATGATATAAAAAATTAACGAG" "25728" "1" "0.036081" "-2.5159984" "-3.95" "-0.27261878" "" "CACAGTAACTCCCTTTGCTGTTAAGTATAATAAAATGCAGTTTCTGGCATAGGTGGCATT" "49" "1" "0.036107" "2.5155333" "-3.95" "1.78880175" "69816" "TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA" "42392" "1" "0.036158" "-2.5146239" "-3.95" "-0.28598981" "227835" "CACTTACGATTCTTGCTCTGTTTGTTGGTGTAAAGATGTTTTAAATGGCTGGATTGTAAA" "32852" "1" "0.036162" "-2.5145576" "-3.95" "-0.23415285" "75623" "AAGCCATGTTCTGAATAAAAGTACGGTTGGTTAATTTGATAAAGTATACCTCTCACTCAG" "27184" "1" "0.03618" "-2.5142249" "-3.95" "-0.21290431" "" "" "56232" "1" "0.036192" "-2.5140223" "-3.95" "-0.21547857" "" "AGAAATAAAATACAGGTGTATAGGGGTTTGGGAAGCTGAGCACCTCAGAGTCAGAGCTGT" "29463" "1" "0.036251" "2.5129769" "-3.95" "1.91888607" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "35528" "1" "0.03627" "-2.5126428" "-3.95" "-0.24812341" "" "GCCCTTGACGTAGCAGTCAAAAACAGCACCCCCGAGAGACCCATGGCTGTGAAGTGTTTG" "35754" "1" "0.036278" "-2.5125041" "-3.95" "-0.44105133" "432995" "GCAATGGTGTGGATAACTTGGCCCTGGAACCTTAATGCTAACTTGCCCTTGGCATGGGTC" "49662" "1" "0.036289" "-2.5123032" "-3.95" "-0.26293984" "" "GTCGGAACAAATACCAATGAATATCTGCAGTATCTGGTATGTGTGTATTCTGTTCACCAG" "19674" "1" "0.036295" "-2.5121905" "-3.95" "-0.54037007" "76161" "TAGCTTTCTTATTCCTGATGGTTTAATTTTGATTCTCTGACTTTGTAAGTCTACAGCACG" "29455" "1" "0.03633" "-2.5115772" "-3.95" "-0.21110052" "212772" "GTGGTCAGAAAGGTACCTGTTAAATGTTACTAACGAAACAAATGCTCTTCAGACTACTTT" "47859" "1" "0.036363" "2.5109995" "-3.95" "0.5341496" "113868" "CCCTGGTTGCAAAGCCATTTGTACCTTTGAGGGAGGGATGCAGTAAATGTGTACTGTCTC" "4595" "1" "0.03641" "-2.5101694" "-3.95" "-0.27458252" "75678" "TCCTATGGTAGGCTGTACAGATTGATTATTTATATCATCCTTTTGAGAGACTAATGAAGG" "26468" "1" "0.036411" "2.5101402" "-3.95" "0.24122136" "78913" "TTACTGCTTACCATCAACTAGTCAAAATGACTGTTATTGAAATAGTCTGAAAGTGGACAG" "21890" "1" "0.036423" "2.5099245" "-3.95" "0.23741134" "" "CACCCCCCAGAATGAACCAAGAAAGCACTGCTGTTGGCTATCCGTTGATGTTGGTGGCTT" "33542" "1" "0.036424" "-2.509909" "-3.95" "-0.23513237" "18861" "CCCTTGTAGCATAGAGTTTATTACAGATTGTTCGGTTTGCAAAGAGAAGGTTTTAAGTAA" "13120" "1" "0.036437" "-2.5096774" "-3.95" "-0.26882613" "" "GCCCCAGCTTAGCTCATCCATCAGGTTTATTCACACAATTCTATAAAATGTGTCTTTTTT" "7937" "1" "0.036481" "2.5089177" "-3.95" "0.24123615" "" "" "51602" "1" "0.036497" "2.5086243" "-3.95" "0.4321467" "12335" "TTCTGAAACTGTCTACTTAGCTTGTACTGGGTTGTCCATAGCACCTGTAGATGGCTCTCA" "15317" "1" "0.036547" "-2.5077457" "-3.95" "-0.30669685" "233335" "GTAAGCTAACACTGGAAAGGAAAATAGGTGCGTTTTTCTCTTTCCTACATCTTAAAAACA" "32518" "1" "0.036558" "-2.5075481" "-3.95" "-0.55065894" "19210" "GGAGGCAAGTTCATATTTTGCAGTTGACCTTAGGATAATACGTATGTATGTGTGTTCTAT" "34797" "1" "0.036562" "-2.5074833" "-3.95" "-0.2306742" "" "CAACAGAGATACTACAGGCAGATGTTCCTCCTACTATAGTTGGTGAAGAGTACCCTAGGA" "43472" "1" "0.036575" "-2.507257" "-3.95" "-0.32732491" "69721" "TGATGGCTTTGTTCTTGTGTATAGTGTGAATAACCTTGAGTCCTTCCAAAGAGTGGAGCT" "1459" "1" "0.036576" "2.5072378" "-3.95" "0.26686645" "319166" "CTTTTCAGAGCCATTCACTTAATTCAGTAAAGTGCTGAAATACTATAAGCCTTAAGTGGA" "8148" "1" "0.036608" "-2.5066825" "-3.95" "-0.211707" "" "CTCAGAATTGTACAAGCAAAGGAGGTTAAATAAGGGTGGGCTGAAGGGGTCAAGAGACAT" "18318" "1" "0.036638" "-2.5061546" "-3.95" "-0.71473487" "258778" "CCTTCCTCTGCTGTATCTATTGATCAAGGAAAAATCTCTTCCATTTTTTATACCATTGTG" "39594" "1" "0.036642" "2.5060856" "-3.95" "0.31476503" "" "CAAAGCTACATTGTTATACTACACATCACCTTTGTGGTTACTAATAAAAGCAGTAACTGC" "40184" "1" "0.036667" "2.5056521" "-3.95" "0.36228156" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "51084" "1" "0.036668" "2.5056267" "-3.95" "0.30098788" "" "TTGTTAAGTTCCAGTTTTATTACAGTGGAATGTCAGTGCAATCTTGAGATGTTACCAACT" "30681" "1" "0.03668" "-2.5054144" "-3.95" "-0.24492897" "217648" "TCTCCTCTTGTCATCATTGGTTTATATTCGAGCAACAGAGAAATAAATATAGACTGATGC" "56652" "1" "0.036684" "-2.5053529" "-3.95" "-0.24936118" "69788" "CTCAATGTCTGTCTCTGACCTAAACATGCATGTACCACACATACAAGATAAATAAAACTT" "12380" "1" "0.036714" "-2.5048282" "-3.95" "-0.53389354" "" "TTTGGCACCAGAGTCCTCCTCTGCTCCAGAATCCTATGGTTTAGATATAATCTGTTGCTG" "33658" "1" "0.03672" "2.504713" "-3.95" "0.37130756" "17929" "AAGTCATCAGATCTCTTATTCCTATAGATGAGGAGGCACCATTGAAGAACACATTAAGGG" "34023" "1" "0.036744" "2.5043043" "-3.95" "0.30714333" "22793" "ACCTTGCTCTGTGCTGCTAGGTTGTGGCCACAGCTAAGATTATAAAACCTCATTTTCCAG" "22739" "1" "0.036762" "-2.5039806" "-3.95" "-0.19884483" "" "ATTGTATGTTGAGTGTATTCATCCCATGACACTCTGCCCTATCTTTTCTCACCCTTTCTC" "3947" "1" "0.036799" "2.5033379" "-3.95" "0.29862027" "54371" "ATGTGTAACTATCAAATACAGAAAAGGTTTAGAGACAAAGAGAGGACGATTGTGTTAACC" "45499" "1" "0.036819" "-2.5029949" "-3.95" "-0.28107091" "18349" "TACTGTCTGCGGAACAAGGAGGTCCAAGTAGCTCTTCACAGAACCATGCACTGGTCCTGA" "19187" "1" "0.036821" "-2.5029447" "-3.95" "-0.24401478" "381933" "TGGTTCTCCCAACCCCCCAATATCGTGTCATCATCATTGATTTACTGCATTTGTGAGCTC" "19412" "1" "0.036854" "2.5023846" "-3.95" "0.41352709" "12229" "CAAAGATGTCTGTGAAGCAATGGAATACTTGGAGTCGAAGCAGTTCCTTCACAGAGACCT" "32435" "1" "0.036896" "-2.5016483" "-3.95" "-0.25439363" "" "CCTCCGATTTCTTAACCTGTTAATGAATGATGCTATCTTCCTTTTGGATGAAGCCATACA" "17455" "1" "0.036929" "-2.5010648" "-3.95" "-0.50311756" "53417" "CAGAAACCCACAAATGTCTCCAAAACCACCATAAAGACCTCTCCTTGTTAGGCACCAGAG" "26528" "1" "0.036938" "-2.5009083" "-3.95" "-0.23163859" "215856" "GCCATGAACCCTTTGATTTATGCTTTCTTTTATCCTTGGTTTCGAAAAGCCATCAAGCTC" "50343" "1" "0.036958" "2.5005696" "-3.95" "0.37023853" "15950" "ATTTCTGTAAAGCAGTGTGCCTTTGGCACTATCCTTTAACCATTTGAGATGTGCTTTAAG" "7610" "1" "0.036958" "2.5005656" "-3.95" "0.95560285" "" "GCCTAGCATATACAAAGTCCTAGGGTCTATCCAGTACCAAAGAAAACAAAAAAGAAAAAT" "32199" "1" "0.036959" "-2.5005423" "-3.95" "-0.27788607" "70081" "CCCAAAAATTCTATCGTCATCTTCATTCGAGAATTCATATAGGAGAGAAGCCTTACAAAT" "24394" "1" "0.037021" "2.4994741" "-3.95" "1.75154276" "" "GATCCCTGTCCATTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAATTTGGTAT" "24918" "1" "0.037028" "-2.4993476" "-3.95" "-0.23607116" "" "ACGCAAGGATAGTGGAGATTCATTGAAAGTTTTTGGCAAGGGAAAGGGACTGAGAGAAGA" "52375" "1" "0.037051" "2.4989564" "-3.95" "0.4197728" "" "ACTGTGAAAGCCAGCCTCCAGGATGGCTCTAGTTAGTAGTTCTATCAAGAAGTAAATGGT" "5973" "1" "0.037067" "2.4986692" "-3.95" "0.52477844" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "16955" "1" "0.03707" "-2.4986287" "-3.95" "-0.19585689" "16882" "CCTGAGATGTTAACTGGAATGGGTTCCAACTTTCATTTGGTTTAACAATAAAGTTGTTTG" "13640" "1" "0.037093" "-2.4982256" "-3.95" "-0.22330266" "14397" "GTTGAAAGATGTTGAAGATATCTTTACTTATAAATTGATTCTAGAAAACTGGGGACCGGG" "37176" "1" "0.0371" "-2.4980998" "-3.95" "-0.26778176" "" "AAGGCCAAGGAATCATAATACTCTTCTAAAGCCAGGTGCATGTTACCTCCGCCCTTTTTT" "16178" "1" "0.037163" "-2.4970051" "-3.96" "-0.27878344" "432582" "GGTGACTGTCATATGCCTTATTCTTAATAAAATGTTTGGAAAACATGGAGTCCATTCTCA" "30075" "1" "0.03719" "2.4965435" "-3.96" "0.42639665" "71684" "GGAAAAGATTCAATGTCTCAAGTATGATTTCTACTGACTCTTTATTCCTCTTGCACCATA" "677" "1" "0.037238" "2.4957249" "-3.96" "0.46979663" "60364" "CCATGTCAACTTACTACTTAGTATGCTTACAGGTAATCTGTGTTTGCATGTGTGTATAAA" "24727" "1" "0.037241" "-2.4956628" "-3.96" "-0.32076965" "" "ATCTTCTTTCCCTTACTGTAACAAAATACAAGAGAAGCTAGGCACTTTGTACTTTCTTTG" "15072" "1" "0.037275" "-2.4950765" "-3.96" "-0.22369896" "76123" "CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT" "43030" "1" "0.037327" "-2.4941943" "-3.96" "-0.3098389" "56349" "ATCAAGTGAAACCAAGCCATATTGTTTGAGCCAATTAAGAAAAGTGCAGTTTTTACAGTG" "11577" "1" "0.03733" "-2.4941374" "-3.96" "-0.20157818" "13798" "CTGCTTACGACCGTGTATATATTTAATTTCAGGTAAGGAAAACAAATATGTGTAGCGATC" "61096" "1" "0.037372" "-2.4934131" "-3.96" "-0.21585446" "" "TATGTTTATATGCATCGTTGGTTCAGGACCGTGGTTTCTGAAATGATGCAGTTGGGCGGT" "5038" "1" "0.03741" "-2.4927656" "-3.96" "-0.18734181" "17524" "TGAAACTCTTAAGAAATTGCAAGAAGCCTTTGACCAGGCTTGCAGTTCTCCACAGTGGGT" "21639" "1" "0.037412" "-2.4927171" "-3.96" "-0.25814133" "" "GGCCTGTGAAGGAATTGATGTGATTAAAGTGTTTTGTAACTTCATTTTTTGTTCCCTTAG" "36857" "1" "0.037498" "-2.4912525" "-3.96" "-0.24063658" "233424" "CCTTGCAAGGGTCAACAAATGTTTGTATTTTGTTTCCATGGAGCCATTTGGTTTTAATAA" "2195" "1" "0.037559" "-2.4902113" "-3.96" "-0.55514689" "229599" "TTTTTTACTTTAATGTATTTGTGGTGAGGAAATAGAAATCCTTTCTGATTAAAGACATTT" "7372" "1" "0.037575" "-2.4899349" "-3.96" "-0.19358007" "73739" "ACCCCAGGAAGGCCTAGAAATAATGAGCCTTGGATGCTGTCGGCAAGTGACAGCATGTAA" "21991" "1" "0.037593" "-2.4896183" "-3.96" "-0.44456838" "207565" "TCCTGGTAAAGACCATGATTCGAAAGCGCTCATTCGGGAACCCGTTCGAAGGTAGCCGCC" "42045" "1" "0.037609" "-2.4893457" "-3.96" "-0.33439915" "268319" "GCTGTATCACTTCATTTATTTTCTCCAAGCTCCTTGAGGAAGGATTCCGCTATGAGATAG" "32612" "1" "0.037643" "-2.4887697" "-3.96" "-0.20183114" "432442" "ATGCCTGGTAAAGTGTTTATGAACTCTCAGCCCATTAAATAGCTCTTTGGTGAGTAAACA" "48508" "1" "0.037643" "2.4887644" "-3.96" "0.83318474" "107993" "AGAGAATTCTGCTCCCATTTCTGTAGTCTGAGCTTGAACAACCGAGGCCTCTCTGAATAA" "53037" "1" "0.037667" "2.4883656" "-3.96" "0.49510854" "" "AAAGTAACTTAAGCTGTAGATGGAGCCATATCAGGTCCAGGTGCTAGAGAACTTTCCATT" "50787" "1" "0.037677" "-2.4881942" "-3.96" "-0.2892335" "12452" "CATTGATGACTTACTTTTTATTAGTAAGTCAACACCCAGTGAGGTGTTTTCCAAAGTAGA" "34821" "1" "0.037703" "2.4877532" "-3.96" "1.6586051" "16185" "GTCTATTCTGGGGTGGGTTTTTCTGTGAAGCAGCTTCTTTGGGGTAACCTAGCCCCCTTG" "55353" "1" "0.037704" "2.4877362" "-3.96" "0.35271348" "75296" "GACAGGTTCTGCATGTAATAAATGTCTCTTTGAACAGTGGATTAAAATGTTGGCCGGCAG" "31665" "1" "0.037752" "-2.4869194" "-3.96" "-0.20449561" "99480" "AAAGACGATTGTGGAAGAACTGCTGGCTGACTCTGAGTTCAGGAGATTTAATCGAAGGAA" "27050" "1" "0.037755" "-2.4868595" "-3.96" "-0.18942473" "" "GGTGTATAGGATTATTTAGTAAATAATCCCAATAAACGCTATGCTGATGCCTTTGCTGTC" "39371" "1" "0.037779" "-2.4864555" "-3.96" "-0.22873148" "100125931" "TGGGAGGTGGGGAAATCGGATCTTGGAAGACAAGAAAAACAAAATAAAACTTTTTGCGTC" "1659" "1" "0.037823" "-2.4857013" "-3.96" "-0.27460392" "225724" "TCGCAGCACCTTAAATCTTAGCTAACTATGATTTGTATATTGGGACGTACAATGCATCAG" "46935" "1" "0.037832" "2.4855617" "-3.96" "0.65250749" "15360" "CCACCTGTGCACTTTGGCATGAATGTGTTCTATCCCTCAATAAAATGCATTTCAAAATTG" "26306" "1" "0.037848" "2.4852863" "-3.96" "0.60471709" "" "TTTAAGAGAGATGAAAATAAAGCAGACTTAGAGAAGGAAAGACTGAAAAATTAAAGGCTG" "14454" "1" "0.037888" "-2.4846076" "-3.96" "-0.26112329" "67619" "TGCGCTGTCATGGCTGTTTCAAGACGACATCGGACATGAACCGAGTGTTCTGTGGACATT" "3347" "1" "0.037909" "2.4842478" "-3.96" "0.30447861" "236930" "TGGTAATGACTATGAGAGTCTTGTAGCTCGTGGGAAAGAACTGAAAGAGTGCGGGAAGAT" "9631" "1" "0.037914" "2.4841743" "-3.96" "0.60312135" "20868" "TGCCTTTTGGAGTGGGGTCTAGCCTAGTTTTCCAGCCTCATAATTATAGCGTAAGTGCAA" "29680" "1" "0.038" "-2.4827136" "-3.96" "-0.21750959" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "7748" "1" "0.038024" "-2.4822986" "-3.96" "-0.21610719" "73916" "CTTCAAGCATATTCAGTGGGTATTTTTGCACATGTGTTAATATCATGGTGATTATGATGG" "32662" "1" "0.038061" "2.4816884" "-3.96" "1.02429134" "60504" "TGCTGTGTAAACCTTGTTCCTTAATTTAATACCATTGGTTAAATAAAATTGGCTGCAACC" "46306" "1" "0.038074" "2.4814622" "-3.96" "0.75566333" "21877" "CCTCAGCTCTTAGTGAGCCACTTTTCTTGTGCAAAATGAACAATATTAAAGTTTACTACT" "32142" "1" "0.038075" "-2.4814519" "-3.96" "-0.21466527" "" "TAATGAGCCTGGATACCCAGAGGAGGAAACGAACACTGGGCGGCACCTTGTGATAATGGT" "33019" "1" "0.038098" "2.4810518" "-3.96" "0.20904897" "" "CCAGAGTCTTTAGCAGTTCTTAGTTTTGTCAGCCTCCACAACTTCATGAGACAATTCATC" "38030" "1" "0.038098" "-2.4810511" "-3.96" "-0.2321434" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "43769" "1" "0.038099" "-2.4810452" "-3.96" "-0.27389534" "" "ATGGAGCTTGCAGAGACTTCATGGGTACACTATATACATAACCGTTTTCTGTAAGAAACT" "58567" "1" "0.038146" "2.4802509" "-3.96" "0.94044322" "626578" "AATATGATTTATTTAAGGTGTACCCACCCCAGCTCCTCTAAGACATCCTCAAATTACCCT" "43258" "1" "0.038188" "2.4795364" "-3.96" "0.42261903" "" "TAGTTTCTCTTCCATGTTTCTCCAACACAGCTATACATTGGTACCGGCAAAAACCAAATC" "57744" "1" "0.038214" "-2.4791093" "-3.96" "-0.42903034" "67724" "TAGCCTGGTCTTAAATTATAACTATTTTGGTCAAAGCTCACAGAAAGTCCTGGCTGTCTC" "41535" "1" "0.03822" "2.4790025" "-3.96" "0.33772329" "" "TATGAACCTTTCTTCCCTCATACAGTCTATCCATATTTTAATCCTATGGAATGTTCAGAG" "15198" "1" "0.038223" "-2.4789478" "-3.96" "-0.3998598" "319480" "GTTTCATCTGAACAATGTCATCTGTTCCCCTATGCGGTACTACCTTTACTGTCAGAAATA" "20239" "1" "0.038246" "2.4785643" "-3.96" "0.73052676" "225825" "TTAGCACATGAAAAGAGATTGATGGTTTTAAGTAGTAGAACACAGTAGTGTAGGAATCTG" "12488" "1" "0.03826" "2.4783387" "-3.96" "0.35010061" "" "TCTGCATGTAATAAATGTCTCTTTGAACAGTGGATTAAAATGTTGGCCGGCAGTATCCTC" "47721" "1" "0.038278" "-2.4780318" "-3.96" "-0.34465093" "71691" "CTTGGTGCTAGAAGGGCTGTGTCGGTACCTCATGATGCACCTGCTTCAACATCCAGGCCT" "62260" "1" "0.038358" "2.4766849" "-3.96" "0.4075932" "71584" "GTTTTTGTTGTGAGCAATGAATGGTTCCTGTATCTTGCCTGTTAATCTGTTATTCAATGA" "53433" "1" "0.038423" "2.4756095" "-3.97" "1.24090302" "" "AGAGCAGCTCTTATCCCTCAGTGTACTGTAATCTATTGTTCTCAATGAATAAAACATAGT" "39312" "1" "0.038486" "-2.4745559" "-3.97" "-0.23997672" "17940" "AATCTATGAGTTTTATGAACTCTCTAGGGGGCTTAACAACCCCTCACTGGGCAGTGTCAT" "52065" "1" "0.038491" "-2.4744678" "-3.97" "-0.23805702" "" "TTGGGATGATAAACCATTGTTTCACACATCACCTTAGGAGAGTCGTGTGGGTAACCCTGT" "3548" "1" "0.038538" "2.4736807" "-3.97" "0.49215357" "117149" "CAGAGATGTCAACTCACCTCACAAAACTGGAAGACACGTTCATCCCCATACTGAATTTCA" "484" "1" "0.038547" "2.4735368" "-3.97" "0.56979506" "12095" "TCTCTGCCCTGCAAGTATGGATGTCACAGCAGCTCCAAAATAAAGTTCAGATGAGGAAGT" "39458" "1" "0.038565" "2.4732371" "-3.97" "0.27177015" "258248" "AGATATGTTCTTGTTGGTGCCACCCCTGATGAACCCCATTGTGTACTGTATAAAGACTCG" "27130" "1" "0.038566" "2.4732118" "-3.97" "0.29021226" "14598" "AAAGACATTGATCAGGTGGTGACTGCAGGCCTGAAGATTCGGCACCACCATACAGAAGTC" "40957" "1" "0.038571" "-2.4731439" "-3.97" "-0.21326181" "" "GTTCTTTGTCGTTCAGTTCAGACTAATTGTGGTACTTTGGTTTGTTATGAACTTTAGTAC" "1628" "1" "0.038615" "2.472404" "-3.97" "0.55420719" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "12113" "1" "0.038618" "2.4723532" "-3.97" "0.67166832" "22169" "CCCTCGAGAGAGACAGTCCTGCAGAAGGTTTTAGAGCTGATCCAGAGTTCTGGTCGTTAA" "7499" "1" "0.03866" "-2.4716504" "-3.97" "-0.28663186" "51786" "TGCTGTATGGTTATACATTTTTGCAATTATTCCTATATTTTTGTGACTCCGTAGGTGACC" "4510" "1" "0.038715" "2.4707493" "-3.97" "0.25859402" "" "" "53686" "1" "0.038719" "-2.4706768" "-3.97" "-0.30676321" "" "GCCTTCCTCTGCTGTGTCTGAAGAAAGCATACTCGCATACATAAATAAAATTATGTATAT" "27817" "1" "0.038721" "2.4706532" "-3.97" "0.39914939" "13614" "CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC" "13090" "1" "0.038765" "2.4699195" "-3.97" "2.07611045" "60440" "GATTATGTATCCACATTAGGTAGAGCAAGGGGATCAGATATGTATAAATAAACTGATAGC" "968" "1" "0.038819" "-2.4690206" "-3.97" "-0.24609632" "108030" "CCATTCATTGCTTTTTTACCTACTCAGACCTTTTCCATCCATGTCAGTGGAAACTCGCAG" "10646" "1" "0.038832" "2.4688151" "-3.97" "0.32645067" "71790" "GGAACGCAAATCTCAGGAAAGAAGTTTTATTTCCAAACCTCTAGGAAGGCATTAAAAATA" "1844" "1" "0.038834" "-2.4687777" "-3.97" "-0.22568419" "22003" "ACAGACTGCTTTCTATTGTACAGAAGCAATTCGCCCAGTGTAAAATAAACACTGTACGCT" "4592" "1" "0.038855" "2.4684316" "-3.97" "0.47847693" "" "ACATTCCTGGAGAAGAAGGAGGGGAAGCTGCTTAGAAAAACCTGCTCAACCTATTATGGA" "32392" "1" "0.038856" "-2.4684117" "-3.97" "-0.22104839" "269682" "TTTGAGTTTCTCATTTTTATAAAAAGTTATCTCATAAGGGAGTCAGTCTTCACGTTGGGG" "24036" "1" "0.038915" "-2.4674355" "-3.97" "-0.21615508" "100043474" "GGAGCTGAAAATAACTATGAAGAAAGCTTTCCTCAACAAATTATTTCCACAGAACTCCTA" "58982" "1" "0.03893" "2.4671847" "-3.97" "1.72766826" "631323" "AAGAGTTTGGTTCTCAGCGCCCATGCCAGACAACTCACAATTTCTTATAACTCCAGCTCT" "37948" "1" "0.038958" "2.4667279" "-3.97" "0.26915661" "70226" "AACTTAATGCATGCAGCAGCATGCCTGATATACTCATTAAGCTTTGTGCTAATTTGATAT" "30764" "1" "0.038961" "-2.4666809" "-3.97" "-0.4112866" "381511" "GGTTTGAATGCTGTCTATGGTTAGAGAAACGCCCACGGTGAATTAAAGCTTTATACCTGC" "51028" "1" "0.03897" "-2.4665349" "-3.97" "-0.30833822" "" "CCCACTTCTTGGTTTTCTCCTGGTAATCTTTCTTACATATGAAGACAAATGAATTGGTAT" "30845" "1" "0.038971" "2.4665139" "-3.97" "0.52037599" "16182" "GTCCACCATAATGGGACACGGTACAACATCACCAAGACTGTCAATATAACAGTTATTGAA" "3648" "1" "0.039006" "2.4659307" "-3.97" "0.67002631" "11745" "GGATGACATTAGCTCTGAGACGTCTGGAGACTTCCGGAAAGCTCTGCTGACTCTGGCAGA" "59743" "1" "0.039046" "2.4652799" "-3.97" "0.26531987" "104009" "TTCCCCTGCTCCTGTGGCTTGGGAGGGATGTGGAATAAAATTATTTTTGTTAAGTCACGC" "58907" "1" "0.039054" "-2.4651427" "-3.97" "-0.18761047" "" "" "17707" "1" "0.039075" "-2.4648053" "-3.97" "-0.19427396" "" "GGGCCTGGAATCACAGCCAGCTGTGTCATCTGTGGTTCCTCAAGAGAAAGGAAGACAGAG" "33838" "1" "0.039124" "2.4640065" "-3.97" "0.28352739" "215705" "TCCATCGACACTCCACGTTTTTCCAAGGATCACAAATGTAGCCTCGTGTTCTACATCCTG" "41415" "1" "0.039142" "2.4637016" "-3.97" "0.3620427" "80782" "CTAAAAATTTGCCAAACTTTCCATGAAAATAAAAGGAGTATGAATATTGAATTTACTTTA" "13197" "1" "0.039179" "2.4630929" "-3.97" "0.57658274" "" "ATGCCACAATGTGCTTACATCAGAACTTCTAAAAGTGTAATGCCCTGGTCACTTCCGGGT" "33202" "1" "0.039196" "2.462814" "-3.97" "0.39398059" "" "GTTCTTGGTTCAGGGAGAGACTCTGACTTAAGGGAGTCGGACTGAATGATAGAGCAGGAC" "39680" "1" "0.039271" "-2.4615869" "-3.97" "-0.4196198" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "48072" "1" "0.039296" "2.4611763" "-3.97" "0.76850457" "56045" "CCTTGTGAGTACCTGTGTCGTTTACGAGACTGCATTAAAAATGGAGATTTTAACAGCTTA" "1660" "1" "0.039331" "2.4606202" "-3.97" "0.82020689" "" "AGGTGAAATCCTAGTAGGTCTAGATGGTGTTTGAAAGTGAAAATGCAGGCTGAGTGCAGC" "38575" "1" "0.039348" "2.460335" "-3.97" "0.27720562" "" "GTTCTGTTAGATGCTACCAGATGCTAGCCTCCAAAACTAGTTTTCTCTTTTTAGATTATA" "24659" "1" "0.03937" "-2.4599695" "-3.97" "-0.22538393" "238257" "TATGGCGGTCAAATGCTGAGTTACAGTGATTCTTTCCATCCATTCTATTATTCTGTCTTG" "54720" "1" "0.039375" "-2.4598892" "-3.97" "-0.4628045" "13841" "TGGCCATCAAAAGAAGATCATGAGCAGCATCCAGACTATGCGGGCACAAATGTTGCATTT" "17434" "1" "0.039429" "-2.4590081" "-3.97" "-0.22023577" "69487" "CGAATGCAGTAGCAAAACTCACTACGTTGTCCTATCGAGAATTTTTGCAAAATTTGTTAA" "4898" "1" "0.039447" "-2.4587243" "-3.97" "-0.37665053" "22784" "GAATTTGAACCCGTAAGGGACACCTTGTTGTCCGTGCCGGGAGTCCGAGCAACCCATGAT" "35473" "1" "0.039456" "-2.4585712" "-3.97" "-0.29477212" "" "GGAGAGAAAGTCTCATTGTCATTACGTTTTGCTGCATGTCCTTATAGGAAGTTTTAAAAT" "62443" "1" "0.039477" "2.4582335" "-3.97" "0.31257638" "223646" "TGGACAGTTTGAGTGCTCGAGGTCCCCTGTGAAAAAAGTCATAAATAACACGGCTCTGTT" "7349" "1" "0.039487" "-2.4580684" "-3.97" "-0.27232387" "170767" "AATGGATCAGTTGGTTGATTCCTAAACTGAAATATATCTGATGTTAAACTCGTAGCTACG" "61762" "1" "0.039497" "2.4579103" "-3.97" "0.3226867" "380994" "CCATCATGGAGAATAATCTGAAGTACTCTTCTACTTTCCCATTTTCAGAAAAATGAAGCA" "58066" "1" "0.03955" "2.4570544" "-3.97" "0.3352227" "20655" "CCTGTGTGGTCTGAGTCTCAGACTCATCTGCTACCCTCAAACCATTAAACTGTAATCTGA" "10298" "1" "0.039568" "-2.4567524" "-3.97" "-0.23402887" "20383" "CCAGATGAGATTTAGGTATCAATCTATTCCAGTGTATATTTTTGTACTACCAGACTCTTG" "39220" "1" "0.039692" "-2.4547538" "-3.97" "-0.2251797" "19069" "CAGGGAGCACTGTTTAATTTATAAAGGAGCATTTTGGATAAGATTTGGTGTGGTTATTCT" "17364" "1" "0.039717" "-2.454349" "-3.97" "-0.23470386" "241525" "AAGAAGGGAAGTACATCATTGAGATGTCACACATGGTGAAAGACAACGGCTGGGATTGAG" "57560" "1" "0.039726" "-2.4542011" "-3.97" "-0.38787046" "100049164" "GTGTTTCTTTTATGTAAGAAGTCACCATCAGAAGAGACAGAAACCAAAAATGGCTTTTGT" "38391" "1" "0.039747" "2.4538523" "-3.98" "0.43713678" "" "ACAGGACACCAGACCTGATTTCTGTCTTTGACATCTACCAGTTTTCACATGATACCTGGG" "31597" "1" "0.039762" "2.4536178" "-3.98" "0.34464685" "" "TATTCTACTATCATAAATATGTGTATTACATATTCTTCATTTATTAATAAGAGAAAAGGT" "46086" "1" "0.039785" "-2.453248" "-3.98" "-0.19443833" "117229" "AACCACTCTGAAATCCACTACCTTGTTTCGAGGCAAGAAAAGGCTCTAAGGTTCTGTCCA" "58779" "1" "0.039817" "2.4527242" "-3.98" "0.76888613" "70544" "TTTCGAAGTAAGATGCAATCCATATTCCCACCAATTCCCAAGAACCATGAGTCAGCCGAG" "24289" "1" "0.039843" "-2.4523058" "-3.98" "-0.20517265" "432613" "GAAACACCAGGGACGAGTGAGTTTTCTCTCGAAACTGATTCAGACCATGCGAGACGAGGT" "13428" "1" "0.039853" "-2.4521512" "-3.98" "-0.33222966" "18526" "GTCACTCTTGGCATCTCCTTATTTTGAGTCTAAGATATAACTGATTGACTTTCACGAATA" "25453" "1" "0.039863" "-2.4519869" "-3.98" "-0.33126354" "11838" "TGGAGATCTCAAGAGAGTGTGGCTATCCCCTATTTTCACCAAGCCTTGAATATCCAGCCA" "43043" "1" "0.039881" "-2.4517023" "-3.98" "-0.23326932" "" "GTTGTGGATGCTTTTGGTGTTAAACATATCAGAAGAGAGGAAGTATTTAAACGTCAAATC" "23363" "1" "0.039918" "-2.4510983" "-3.98" "-0.31504048" "73598" "CTTTGCCAGCTGTATCTGTGTCAGAACGGGTGCTCGGGAGTGTTGGGAGATGGTTGGACA" "48358" "1" "0.039927" "-2.4509664" "-3.98" "-0.48421175" "27281" "CCCCAACACTATGAAATATTGTCTGGGCATATTTTCAGCAGTCAGGAATGGAGTCCACTT" "24921" "1" "0.03994" "-2.4507587" "-3.98" "-0.39014046" "216795" "CCTGAGTGACTGCAGAGAATGTATTTATTTAACAGCTTTGTGTAACAAAACCAGAAACAA" "36707" "1" "0.039949" "-2.4506109" "-3.98" "-0.197651" "" "ATGATGCCAGCCTCGGGGAAGGTAGGCCCCCGCCCGGGCTGTTTCCGAGGCGCCTTCTCC" "24274" "1" "0.039963" "2.4503876" "-3.98" "0.74392609" "15160" "CAATCCCAACATGTCTGAGATGTTCGGACTTTTAAATTCATGTAAATATCTCCTCTTCTG" "39170" "1" "0.040108" "-2.4480539" "-3.98" "-0.23753543" "244701" "ACGCATCTATTCCTGCACCTTCATCCAGACAGCCAGCACACAGTACACGGCAGCTGTGGT" "37917" "1" "0.040225" "2.4461837" "-3.98" "0.91084656" "20290" "CTCACAGACCTCAGTCATGTGATAAGCTATGTTATGGTTCTTTATCTGTTTAAAATATGG" "45589" "1" "0.040274" "-2.4454028" "-3.98" "-0.32937963" "67399" "TGAATATTGACGGTGAGAACGCGGGCAGCCTCACGCACATCGAAGCCCAGAACAAGATCC" "47831" "1" "0.040297" "-2.4450389" "-3.98" "-0.29053835" "13347" "GTTGGCCTGCAATGAGAAGTGGACTTATAATGATTCCGATGGAGGGACGGCTTGGGTTTC" "22781" "1" "0.0403" "-2.4449959" "-3.98" "-0.46165321" "54376" "TTCTACAGTTCCACAACTCCACACCCAAAGAGTTCAAAGAGTCATTGCATAACAATCCGG" "36044" "1" "0.040341" "2.4443352" "-3.98" "0.27394372" "" "" "28657" "1" "0.040362" "2.4440011" "-3.98" "0.33007933" "13548" "AACAGAGTCCTGTAGCTAGCTCGTGACTACATTGAAACTTGAGTTTGTTTCTTGTGTGTT" "35192" "1" "0.040367" "2.4439215" "-3.98" "0.40070343" "68936" "GGACCGCACTCTGGCCTAGACCTTTAACTTAAATGATTGACAGAGTGGATTTTTATATGT" "19469" "1" "0.04042" "-2.4430794" "-3.98" "-0.22378577" "331188" "GTAATCTTTGTGGTAAAGCCTTTGTAAGTCATAGTTATCTTCAAGTACACAAAAGGACTC" "21910" "1" "0.040421" "2.4430745" "-3.98" "0.32210371" "338350" "ACGTCACAGAATACTGATTCAGATGCTCTGTGGTAAAAGGGCCTTTCGGGACACAAAGAA" "9869" "1" "0.040465" "-2.4423676" "-3.98" "-0.22041325" "15565" "GTCCTCACATGGCTGGGATACTGTAATAGCACCATGAACCCTATCATCTATCCCCTCTTC" "20417" "1" "0.040495" "-2.4418927" "-3.98" "-0.28645939" "" "CCTTGCTATATCTTAAAACTTACTGTCATTTCCATGTTCTAGTGTTGGGTGTATAGGATT" "13172" "1" "0.040511" "-2.4416453" "-3.98" "-0.36116031" "" "AACCCAGGTCTGGATGTGGTGGCATTTTTTCAGAGAGTGGAACTGAAGATGGATGAAGCA" "25370" "1" "0.040571" "-2.440695" "-3.98" "-0.23353343" "72667" "GGATGTGACCGAAGCCCGGGGGTCAGTGTTGGAAAGGAAGAAAGTGGGGCAATTCCCTTA" "61373" "1" "0.040608" "-2.4401062" "-3.98" "-0.20477573" "414089" "AGAGCAATCTAACAGTAGCCATGACTGTACTTAAACAGCAGCTTCATAACCTAGACATTG" "15231" "1" "0.040674" "-2.4390611" "-3.98" "-0.3149963" "103210" "CCACATGTAAGGACGCTTCTTTGCCTGGATGTATATAACTGATTAATAAAAATGGAAAGA" "29643" "1" "0.040685" "-2.4388933" "-3.98" "-0.30996172" "" "" "35229" "1" "0.040689" "-2.4388243" "-3.98" "-0.20212171" "330463" "CCAGATTGTTCACTGTACTCTACATGGAAGATCTCACACAGGTCAAAGAGCTCTTAGGAA" "2059" "1" "0.040689" "-2.4388232" "-3.98" "-0.32062806" "94332" "CGCTTTTGGGGAAACAACTTTTCCTCTTCGAGCTGAACCACTCTGTCCATATTACACAGA" "49181" "1" "0.04071" "-2.4384948" "-3.98" "-0.23024897" "15182" "TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC" "58633" "1" "0.040792" "-2.4372014" "-3.98" "-0.2119097" "216119" "ATCCAACCCTCCCGGAGTGAACAGTGCTTTGTAAACAGCGTGTGTAAATACCCATACTTA" "23562" "1" "0.040807" "2.4369774" "-3.98" "0.4448081" "" "CCTTAACCTGTCCTATGTCTCACACGTCCAAAGGCGTGAGAGGCAGAATGCTAGAATAAT" "52039" "1" "0.040811" "2.4369064" "-3.98" "0.34933913" "56173" "TTTGAAATCGGCCAGGCCCTGTACATGGGCTTCATCTCCTCATCCCTGTCTCTCATCGGG" "2740" "1" "0.040821" "-2.436751" "-3.98" "-0.23592817" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "16143" "1" "0.040831" "2.4365907" "-3.98" "0.22362996" "" "TATAGAGCCGCTGAAAATTCAGCTACAGCGAGACCTTTGCCAAAGCTCAAAATCCTTCGA" "46714" "1" "0.040863" "2.4360885" "-3.98" "1.37848079" "20306" "TTCTGAGAACTGTTGATGAAATGTGTTGATCACGGTCCTAAGGGATAGGAGCTGTCTGTA" "28485" "1" "0.040869" "-2.4360061" "-3.98" "-0.26981056" "26400" "AAGGATGTCATGGCGAAGACCGAGTCCCCAAGGACTAGTGGAGTCCTGAGTCAGCACCAT" "56172" "1" "0.040889" "2.4356895" "-3.98" "0.53251882" "104110" "GCATCAAGGTCAAAGGCAAAGGGGAACTCTGTACCTACTTCCTGAACACAGACCTGACGC" "46045" "1" "0.040993" "-2.4340541" "-3.98" "-0.25786242" "19744" "TTATTTCATTGTGTTAAATGTATACTTGTAAATAAAATAGCTGCAAACCTTAAGCCTTTG" "47621" "1" "0.041016" "-2.4336965" "-3.98" "-0.33344296" "217371" "CAGCATTGTTTCAACAGATTAGCAAGGAGAGAGGTATTTCAGTAAAGGAGAAGTAAAAAC" "26698" "1" "0.041016" "-2.4336898" "-3.98" "-0.27295614" "19344" "GGGGGGTTGATTGATTTACCTATCCTTCAACCGTTTTAATTAAATGGAATCTACAATGAA" "21624" "1" "0.041022" "-2.4335973" "-3.98" "-0.27856287" "" "TGGAGTTCAGTAGGCTTTTTAGTTCCCTATAAGTCACACCCTTAGGAGTAGAACAAAATG" "54008" "1" "0.04114" "2.4317617" "-3.99" "0.63164068" "226041" "GCGCCTTAAGGAAAGATTTCCAGCAAGGTGTTTGTTTCCGTTTTCTCTCTGTGCTTCTGT" "893" "1" "0.041151" "-2.4315852" "-3.99" "-0.20222746" "" "AACGAAGGAACACCCAAGAACACACAAAAGCAGATGAAGGCCATCCTTCAAGAAGATCCA" "49085" "1" "0.041186" "-2.4310434" "-3.99" "-0.30921966" "68312" "ATCAGCTTATGGACAACCGCATGGTGCTGGCGAGGCTTTGCTACAACGCTGACTTTGTGA" "47592" "1" "0.04119" "2.4309859" "-3.99" "0.52213068" "13805" "TACAGAACTGCCCAATCCAGGGGCTCTGGGATATGGCTGCCCGGGATTACAGAAAGACAC" "49565" "1" "0.041214" "2.4306079" "-3.99" "0.34248986" "106766" "CAGGCTCCCAGGGATCAGTGGGCTATCTCTGGGTACAATAGTCTTCTTCCAGCTCTATCC" "14867" "1" "0.041255" "-2.4299676" "-3.99" "-0.21350321" "72465" "GGCTTTTGTTTTGAGTGGAATCTTTTCCCCCCAATTCTTAATGTAAAGATTTTGTGCTAT" "44263" "1" "0.041257" "2.4299386" "-3.99" "0.39925009" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "27180" "1" "0.041311" "-2.4290972" "-3.99" "-0.37412708" "433485" "AGATCAGTGATGCTGGCAAAAGGAATGGCTTAATTAACACCAGAAACTTCATGGCTGAGA" "49485" "1" "0.041313" "2.4290714" "-3.99" "0.30825078" "13614" "CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC" "57844" "1" "0.041347" "-2.4285438" "-3.99" "-0.36290848" "" "CAGGATACCCACCCTGCATTATCTTATATTTTAAGTCAATATGAAGATGGACATTCTACC" "16964" "1" "0.041364" "2.4282683" "-3.99" "1.93717315" "12481" "CCCCTAATTAAGAAGGCAGAGTTCGTCATTTCCAATAAAAAGCTGTGTGGATTTATCTTC" "48842" "1" "0.041419" "2.4274268" "-3.99" "0.26646065" "15356" "ATGTCCACCGCCGCAGGGCCTTTGTTCTACCTCTGAGGACAGAGAGCAGTTTCCCCTTAT" "61145" "1" "0.041425" "-2.4273364" "-3.99" "-0.23885756" "" "AACGAATTGCATAGACTTTGAGAATTGAGCCTGCCAGGAACAAGACAGTTGGCCTCTGAT" "38588" "1" "0.041437" "2.4271422" "-3.99" "0.2787365" "13436" "GTGCAAAGATGACAGATGCCCAGAGTTTACCTTTCTGGTTGATTAAAGTTGTATTTCTCT" "35861" "1" "0.041457" "2.4268306" "-3.99" "0.2409678" "" "GCCTCACAGCACAAGAGTGTTAATTCAGTCCTCAAACCCCAATAAAAATTCTGGACATAA" "11307" "1" "0.041473" "2.4265893" "-3.99" "0.66150296" "16453" "TGGCTAGAGCAGAGACATCTCCTGCACGCGCTGGTGGCCGACGTGGACCCAGCGCTAGAC" "46580" "1" "0.041485" "-2.4264024" "-3.99" "-0.25202324" "245020" "TACTGGAGGAATGTAAGGAGGGAAGATTATCAGGAAATACTGGACTCTCCCATTAAATGA" "52724" "1" "0.041506" "-2.426083" "-3.99" "-0.28973932" "" "TCAACTTGTTTTTGAGTCTCGGGGAGCTGACTAGATTCACCGGTACCTTATTCTGTGTCT" "18489" "1" "0.041522" "2.4258366" "-3.99" "0.5100287" "" "ATTTCTGCAACAGCCCTTTGAAATTATTTCTAATAAACTGTTTGGCCTAGTACCATGTGA" "8266" "1" "0.041546" "2.4254605" "-3.99" "0.74284785" "67849" "TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA" "23196" "1" "0.041549" "-2.4254157" "-3.99" "-0.22621457" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "45432" "1" "0.041564" "-2.4251873" "-3.99" "-0.18884472" "" "" "57456" "1" "0.041683" "2.423352" "-3.99" "0.6364854" "" "GAGGGATGGCTGATATTGGAATGCAAAGGGAATATGTAAATTAACTCAAAATGACCATTA" "703" "1" "0.041703" "-2.4230463" "-3.99" "-0.42041699" "19646" "TGGACAAGCTTGTTCATTGTTTTATACATTGACTAAGCAGTACATTTGGGCTCTATTCTC" "26570" "1" "0.041724" "2.422722" "-3.99" "0.69727964" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "37727" "1" "0.041807" "2.4214488" "-3.99" "0.43758686" "70028" "ACAGTCCTGAAGTGCTGTTCAGGTATTTTCTGTTCAGCGGCCAAACATGTCTCCCTTAAA" "1094" "1" "0.041807" "-2.4214443" "-3.99" "-0.2290946" "57376" "GTCTTAGAGACTAGAAACAAGATAGTTTGTAGTGTGTGCTCCCTAAAATCTAGAATAGAT" "47260" "1" "0.04182" "2.4212399" "-3.99" "0.41849111" "" "AATAGCCAGGAGTCCCTAAACCAACTCTCTTCTGCCTTATCAATGCTAAACTTTATTTGT" "40573" "1" "0.041827" "2.4211379" "-3.99" "0.24032519" "26934" "TCAAGTAAAGCTGTGTCTGCCTGTGTTTACTGCACGAGACACCCCTGTCTGCTCTTCAGC" "48883" "1" "0.041829" "2.4211047" "-3.99" "0.46357148" "" "GTGTCTAACTCACACTTTAAGGCTACGAGATACAAGGCATTATATATTAATAAAGGCTCA" "28630" "1" "0.04183" "-2.4210915" "-3.99" "-0.31856345" "70591" "TGAATCATTACGCTCTGTTTAAATGTTACATGTTCCTTAAGAACTGTGGCAGTGGAGATA" "14163" "1" "0.041852" "-2.4207496" "-3.99" "-0.23858125" "208151" "ATACACCAACTCTATCCTGTTTGACAGTGATGACAGCATCAAGTGGGTCTGCCAGGATAT" "5641" "1" "0.041859" "2.4206401" "-3.99" "0.21246259" "" "CACCTGAAATACTATTTGTTTCTTCTGAAGATGTGTTTTTCTTCCTAACAGCAGGTTTTC" "20328" "1" "0.041971" "-2.4189303" "-3.99" "-0.21782502" "19016" "GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG" "50207" "1" "0.041978" "-2.418818" "-3.99" "-0.25484018" "64103" "AAATTCTAAAATTCTGGAGATTTGCGATAATGTGACCATGTACTGGATCAATCCCACTCT" "20743" "1" "0.041981" "2.4187784" "-3.99" "0.3334947" "15975" "ATTGATGAGTTTTTCTCTGAGCCGCCTTCAAAAAACCTTGTACTTCTGACGGCTGAGGAG" "26816" "1" "0.041989" "2.4186593" "-3.99" "0.26158862" "" "GTTGGAAAACCAAGACACCACTGGTCTATGTCACTTGTGGAATAATAAGATAATTTGTAA" "38677" "1" "0.041995" "2.418571" "-3.99" "0.28914037" "11820" "CAGGATGATTGTACAGAATCATTGCTTATGCCATGATAGCTTTCTACACTGTATTACATA" "655" "1" "0.042" "-2.4184892" "-3.99" "-0.45397498" "" "" "49647" "1" "0.042003" "-2.4184405" "-3.99" "-0.21387907" "" "CACTTATCACACACAGTAATGTGGATAAAAGTATCAACCAATTTGGAAATCAGCGTCTAT" "55333" "1" "0.042081" "-2.4172503" "-3.99" "-0.30355631" "76832" "TTTGTCAAAGTAAGTGCCATTTTGAAACAACTTGTAAACTGTGGTTTGTTTTTTGGGTTT" "7318" "1" "0.042082" "-2.4172408" "-3.99" "-0.35618282" "" "GAGGAATGTCTTCATGTACCCCACTCGTATCCATCTGATGACTTCTGTAGGTTAAACTGT" "2565" "1" "0.042128" "2.4165408" "-3.99" "0.28766907" "26570" "AGTAATGTATCAGGAGCTTTATGTAAATGTACTTAGCTTTGCTTACATTCTTCTGCAAGC" "26605" "1" "0.042159" "-2.4160645" "-3.99" "-0.26751955" "24135" "ATCTTCAATTTGGAGCAAAGACTTGGGTCATGGATTGTAGAAGCCTCACACCAGTGTGTC" "19535" "1" "0.04216" "-2.416047" "-3.99" "-0.22235838" "67638" "AATTCCCAGTTATTCATCTGTAAGTCAGCTTCAAGTTCCGTACCATGTGTCTCATCACAG" "46985" "1" "0.042165" "2.4159736" "-3.99" "0.26657113" "381650" "CGAAGGACTCGATGTGGCATTTTCTTCTCCATATCAAGTTTAAACTTTGGAAAATAAACT" "33723" "1" "0.04218" "2.4157432" "-3.99" "0.35462727" "109700" "TCATAAAAGCACATTTTTCCAGCTTAAATCTTACCATACGGGGAGAACTTCAGAGTGAAA" "25530" "1" "0.042203" "-2.4153943" "-3.99" "-0.30728094" "233335" "TGGCAAAATCACAGTTATGAAGTGGCAATGGCGTGATTTTATGGTTGGGGGTCAGCACAA" "26854" "1" "0.042231" "2.4149624" "-3.99" "0.36213249" "" "AATTGGTGGGCTGAGGATTACAGGCATTTGGCTGTTATGAGAGGTCTTAGGGAAATTTGC" "22513" "1" "0.042244" "2.4147657" "-3.99" "0.29721996" "53859" "AACAATGTGGCCCATGCAACTGAAGGCAAAATGGCCCGTGTGTGCCGGAGGGGAAAACGT" "16905" "1" "0.042245" "-2.4147643" "-3.99" "-0.31503026" "14349" "AAGCAGATGCCCCTCAGATCCAGTCTTCAACATCCTTAGTTACTTCTGAACCTGTCACCA" "52108" "1" "0.042253" "2.4146407" "-3.99" "0.37324711" "" "TTAACTGTGGTCCCTTGGAATGTAATCAACAAAAATTCTAACCTCCAACAGTCTGATCTC" "56169" "1" "0.042334" "-2.4134011" "-3.99" "-0.54055198" "23892" "TCCTAAATTAATTCACTTGACCGCGGGTGTAAGTCTTTTGTCTTGTGAAGAACCTTCAGA" "40962" "1" "0.042412" "-2.4122277" "-3.99" "-0.21184102" "" "TCCCGGGAGCTCCAGCCTGCAGCAGCTTCGCCTCTTCTGGGTGCTGGTGCCGAAGCCCTG" "14124" "1" "0.042413" "-2.4122178" "-3.99" "-0.22684494" "217119" "TTTCTGGTCTGTGGCAGGATTGTGTGCCATAGGACCTTCTGCTTGTCCCTCCCTGGAGCT" "19498" "1" "0.042493" "-2.4110002" "-3.99" "-0.23179339" "668173" "TAAAACCTCCACACCGTTCTTTTGTCACATAAGCTACTACAGTTACCTGGAAAAAAGGGG" "38012" "1" "0.042543" "-2.4102413" "-4" "-0.29485299" "320595" "GAAGTCAATTCCCTTCAAGTATCAATGGAAAACTGAAATGACCTTCATGGATCTTTACAT" "52149" "1" "0.042557" "2.410032" "-4" "0.87517216" "" "AATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTTCTGCCTCCAAGTTACACATGT" "17076" "1" "0.042568" "2.4098646" "-4" "1.8970129" "80901" "AATGTATAAAACAGAGCTTAAGACTTTAACAAATACAAGAGGACTCTGGTGGCTTTGCTC" "13697" "1" "0.042598" "-2.4094144" "-4" "-0.28974213" "" "CTGTGAATTTACCTACTATTTGGTTATATAAACCCTCTGACATATCTAAAGACTCCCAGA" "10830" "1" "0.042639" "-2.4088068" "-4" "-0.19131592" "" "GCATTTATATGACTTAATGGATTGAGCTCCAAGTTTATAAATGTACCCTCTCTTCAAAGC" "59649" "1" "0.042661" "-2.4084684" "-4" "-0.34593572" "52589" "CCAGCGGACATTTATCAATGGAAGAGTTTAAGAAAATATATGGGAACTTTTTCCCTTACG" "57037" "1" "0.042692" "-2.4080049" "-4" "-0.31112364" "" "TTTTAGTGGTGGTGAGTCTTGGAAGAATAAAATGCCAGGGCCACCAGATTGGATTTAATG" "29299" "1" "0.042736" "-2.4073471" "-4" "-0.25244683" "328699" "GAGGACTTCTCTGCTTGTTGACTTTTTCCTTTCTTTGCAGTACTCAGGGTGTTACACATG" "18217" "1" "0.042745" "2.4072097" "-4" "0.67603939" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "60100" "1" "0.042776" "2.4067523" "-4" "0.22138134" "" "TTAATCTTTCCTAACTGTGAGAATATTTCTCCCCCACAGGATCTGAGGGAGCCACGTAGA" "46623" "1" "0.04287" "-2.4053445" "-4" "-0.19836916" "69823" "TCAGTGGACAATAAACGACTTCACACATAGGCAGTAGTTTTGTGGTATTTAATGTGTCAG" "24813" "1" "0.042909" "-2.4047571" "-4" "-0.18381032" "100043868" "ATGTTGATGGGTACATCCTTGCTTTCAAGGAAGCCACTTAGCTGCTCACCAGTATAGATG" "3529" "1" "0.042934" "2.4043815" "-4" "0.33900264" "" "GCCTCTGTTGGGCTGACTCCGAGGATATGTGAGGGTCTCTTCATCAGGGAGGATGACTGT" "3600" "1" "0.042945" "-2.4042133" "-4" "-0.36040257" "" "CGTACGTCACAGGAATCTTCAAAAGCATAAAAGAATTCATACTGTAGAGAAAGCTTATGA" "30705" "1" "0.042948" "2.4041784" "-4" "0.37140549" "" "GGGAGCTCTGCTCTGTTGAAAATCATAAAGTTGAAAATGAAAAGAGATAAAACCTTAAGC" "23563" "1" "0.042973" "2.403793" "-4" "0.30930301" "213989" "TGGGGACCTAGAGAGGTGGGGACATGAAGGCCTCAGAGTGAATCCCTCTCTCTTGGAGAT" "12136" "1" "0.043012" "-2.4032163" "-4" "-0.22284943" "269881" "ACGCCATCAGATGGGGCTTTGAGACAACGGGAGCCTCTGGAGCTCACCAACCACGGACAG" "24402" "1" "0.043021" "-2.4030834" "-4" "-0.36315542" "69068" "CTCCAGACACTGTAGTAAGCATTAGGAAATGAATATGGGGGATTTTAGAAGGATGCTGTG" "3732" "1" "0.043055" "-2.4025807" "-4" "-0.22608404" "66641" "TGCTGGGTTTTCTCATGGAAGCATTTTATTACTCACAGAAAGTTACCACATTCCTGATGC" "33954" "1" "0.043058" "-2.4025334" "-4" "-0.2048585" "19127" "ATAACCCTCTTGAAACACGAGAAAATTGGGGGCTCTCTTTTCCTCCTAAGGGTGAACCTA" "60085" "1" "0.043063" "-2.4024636" "-4" "-0.21810413" "117229" "TTGTTCCACGATTGTTAAAGGGATAAGTGCTGGGGCCATGCTCGCTTAGTTCTACTCAAA" "18628" "1" "0.043066" "2.4024091" "-4" "1.55340438" "317677" "ATCAACAGCATGGAACTCTGCATCTCTAACAAGATGCAGACAGGGAACACAGCCTTTTTT" "25127" "1" "0.043081" "2.4021854" "-4" "0.63588225" "328417" "TCAAATAGTAAAATGTACCAATAATGACGTGTAATACGTGTTAAATGTAGCTACAGCCCC" "9857" "1" "0.043109" "-2.4017739" "-4" "-0.26126148" "78785" "GTGTGTTGAGTTCTTCTTCCCTCATTTAAAAGCTCAATTAAACATGTCACAAGTGGCTAA" "13063" "1" "0.043146" "2.401227" "-4" "0.35807517" "319508" "AAGGCCTCTGCACATATGATATGGTATAGCTGTGTAACTAGGTCCTTAAGTGGACAGCAG" "20501" "1" "0.043149" "-2.4011748" "-4" "-0.260054" "66204" "ATGATGAAATACAAATGTGTATAATTCTAACCAATAAAAACACATTAGAACCTTATGCTT" "22432" "1" "0.04317" "2.4008625" "-4" "0.48157369" "170786" "GGACATGGTGAGCCTCAATGTTATAGACCTCCCAAATTTTTTGGAGGATTTATAATTTTT" "41986" "1" "0.043171" "-2.4008529" "-4" "-0.23393539" "" "CCAACCCATAATTGCATTTTGCTTGTCATGGTTCAATCTGATTGCATTGTTGGAAGGCCT" "39662" "1" "0.04318" "-2.4007217" "-4" "-0.19788823" "18260" "AAATGGCTTTTGATAATTGACTGGGCTGAACACTCCAATTAAGGATTTTACAGTTTCAAC" "761" "1" "0.043206" "2.4003269" "-4" "0.28613058" "" "GCGGTTGTCGCGTGTGGGGGGATGTGAGTGTCGCGTGTGGGTTCGCCCGTCCCGATGCCA" "6854" "1" "0.043326" "2.398556" "-4" "0.37693364" "16190" "ACCTGTTGGGAATTCCAACCCTCACCAGTCCCATCTCTTCATTCTATTAAAATTACTTAT" "49799" "1" "0.043331" "-2.3984846" "-4" "-0.62165555" "56392" "CACTGGCTTCAAACAATTCAGTTCAGTACTGTTACTTTCAGTCTCGTCACGCCGTGGTTA" "55967" "1" "0.043381" "2.397733" "-4" "0.62043214" "23871" "GTTGGGGTCTATATAAACCTGTTGAACTCTTACGTACATTCCAAAGACGTTTCAAGGAAC" "38805" "1" "0.043391" "2.3975975" "-4" "0.26321392" "" "TTTTTGTCTCTATTTCCAGCCGTAGAACACTACAGAGGCCATTAGAGGGTACCAGTGACA" "41433" "1" "0.043404" "-2.3974041" "-4" "-0.23019015" "211253" "AGAATGCTAGAAAATTGCAGGTGGGAACAAGAGCCCAGTCGGAGAGAATTCGGACATATA" "32587" "1" "0.043404" "2.397397" "-4" "0.85158094" "78781" "ATGTTGTGAGAAGGCCAGTTTTTGTTTCTTCGAAGGATGTGGAGCAGAAGAGAAGAGGTC" "43702" "1" "0.043424" "-2.3971088" "-4" "-0.3793457" "26381" "CTTGTAGTGACTCTCGTGTTTTAATCAAGCCAGATTGTTGTATTTATTCCACTATTTTGC" "25832" "1" "0.043435" "-2.3969382" "-4" "-0.44030457" "" "" "45116" "1" "0.043465" "2.396493" "-4" "0.53370569" "236312" "AATGTACCCAAAGAACCTTCTGAGGAAAAATGGTTACCAGCAAGGTTCCAAAAAAGTGAT" "22065" "1" "0.043483" "-2.3962371" "-4" "-0.20706908" "" "TCATCTGTGCTAAGAAGCATGAATCACATCGAAGGAAAACACTCCTGGGAGCTCAGACAA" "6173" "1" "0.043553" "2.3951969" "-4" "0.47658736" "" "TGAGATAATATATCTAAAAAGCAGGCTGAAAACGATACTGTTGATGACAGCTGTTTTGAG" "1178" "1" "0.04357" "-2.3949565" "-4" "-0.32755123" "80748" "GGCAAGGTGAGATATTGGTTTAGTTGAGATGCAGGAGTATCCTAAATAATATTCTGTGCT" "3999" "1" "0.043607" "2.3944081" "-4" "0.25148375" "" "TCGCGTGTCCTCCCCGCTCCTGTCCCGGGTACCTAGCTGTCGCGTTCCGGCGCGGAGGTT" "8683" "1" "0.043619" "-2.394229" "-4" "-0.26952504" "" "TGACTCTTGTCAGTAGAGAAGAGGAGGTAGAGGTAGTTGCTGGTGCTGATGAGGAACTGG" "12986" "1" "0.043623" "-2.3941655" "-4" "-0.3212789" "110891" "CTTGATGTCCCTTCTCTGTGGTTTCTGTAAAAAACTGCCATAAAACTTTGAAATTCTGCC" "52823" "1" "0.04365" "-2.3937693" "-4" "-0.44408413" "" "GTTGTTGTTGTTCTTTGTTTGGCAGCTGCATTTCTTAACCTCTTAGTATTAAAATGACAG" "36908" "1" "0.043677" "2.3933723" "-4" "1.65003499" "107526" "AGATCTCACAAGTCAAATAATCCAGGTTGAACACAAGTTAGCAGCTCAGCAGGTGACATC" "43828" "1" "0.043741" "-2.3924446" "-4" "-0.29426579" "66204" "TTACAAGTATGATGAAATACAAATGTGTATAATTCTAACCAATAAAAACACATTAGAACC" "51978" "1" "0.043784" "-2.391813" "-4" "-0.20243898" "240041" "GTTCTAGTGAAAACATCAAATGTGTGATTTCTCTGGGAATGATTCATACATCTCACAGAA" "56673" "1" "0.04381" "-2.3914256" "-4" "-0.24957684" "229487" "ACTTGCTGAGCTCCTCAACCTGCTGGACAGGAAAGCAATTTCTTCATCGGCAGCTAAGCA" "29504" "1" "0.04385" "2.3908395" "-4" "1.81970854" "20296" "TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA" "36999" "1" "0.043864" "2.3906342" "-4" "0.46350993" "381091" "CTTCCTAGTATGTTGCTAGTGCTGTCTGAATGTGCACACACATATATTTTTTGATGAAAA" "7391" "1" "0.043897" "-2.390155" "-4" "-0.24614351" "22412" "TGTCTTTCTAGCCAAAGCTTCCTCTCTCAACACCCATGAACGTCCATGCTTCCTGTCTGA" "27190" "1" "0.043921" "-2.3898069" "-4" "-0.20055645" "258353" "TGGGTCAGGGAACTCTCAGACTAGCTTCTACCTTACCGGCATCCCCTCTCTACAAAAATC" "26627" "1" "0.043927" "2.3897142" "-4" "0.30093326" "232943" "CTGGGCAGCTCTTGTAGATCGCTCCCTGCAATTAAAGGCGGTGCACTGGTACTGGGTGTT" "44335" "1" "0.044034" "-2.3881586" "-4.01" "-0.2820358" "" "GTGCTACTATATATGACTAGCCTGCTGTTTTGTTTGGATTATTATTTATAGCTGTTGGGT" "52562" "1" "0.044051" "-2.3879163" "-4.01" "-0.40510561" "229759" "GGGTCATTCTCAACTACCATCCTATCAAACTGGAGAATCTAGTTACTATAATCTTGAAAT" "10245" "1" "0.04406" "2.3877867" "-4.01" "0.20969783" "13079" "CCCATGATCCCTGAGCTGGTGCCTTCTGCCCAGTAATAAATGGTCTCTTCAGATTTCCTC" "1079" "1" "0.044094" "-2.3872874" "-4.01" "-0.25425803" "76373" "AATTAGTGCCATCTTCTTATTCATATGAAGTTAATGCTTTCTGGGGAATTAGCAAGAGGA" "10023" "1" "0.044096" "-2.38725" "-4.01" "-0.30983645" "58200" "GAAAAATAGACGTCTGGAAGTAGGAGGTCGCCTCAAGGTTTTCCTTTGTTACTGTGGAAA" "53435" "1" "0.044101" "-2.3871781" "-4.01" "-0.22341928" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "14278" "1" "0.044116" "2.3869679" "-4.01" "0.88064832" "240754" "TATGGGGATGTTGGGGATAAAAAGGCACATAGCACTTAGAGTGGAAGCATGACGTGATAG" "9967" "1" "0.044134" "2.3867026" "-4.01" "0.28346915" "11492" "CATCTATGCAAAATACTTGAATGGGCCATGGTGCCTTGTTTTTTGTTGTTGTTGTTATTT" "55930" "1" "0.044253" "2.3849838" "-4.01" "0.33260161" "13611" "CTGACATCTTTGGTTCTAATGTCTGGGCCCAGGAGTACCTGCGTGGCATGGACTGGATCC" "39973" "1" "0.044256" "-2.3849309" "-4.01" "-0.21222024" "75695" "CCAGACCACATTAATTTCAGTTAACAGGCTTTCTAAGCTGAACACTTCGCCACTATCATA" "1615" "1" "0.044267" "-2.3847715" "-4.01" "-0.1867751" "217265" "TCTGGGCAGCTAAGATGTATTGGAACAGTACAACATCTAAAGAGTAAGTTTGGTAAAGGC" "23483" "1" "0.044295" "-2.3843728" "-4.01" "-0.3386042" "" "AAAGTTGTGGTAAAGGCCCTTGGATTCCTGGCATTCCAGGTGGTCTTAGGAATGGAGGAA" "45922" "1" "0.044315" "-2.3840757" "-4.01" "-0.25809235" "" "TCTTCAATGCACGAGCTTTCTGAGTGGCTACTTACTATCTGAACTATAGCATCAACTCTC" "7620" "1" "0.044323" "-2.3839627" "-4.01" "-0.19762676" "" "TTTGTTGTTGTTTTTCACAGTGTCTCGGGTTACAGGTTGGCCTCAACTTTTCTAGCCGAG" "11345" "1" "0.044332" "-2.3838304" "-4.01" "-0.35923066" "213006" "TTCATTGAAAAGTACCTCATACTAGCCATATTAAAATCTAGCTGGGCAATCTAACTATGG" "21040" "1" "0.04438" "-2.3831333" "-4.01" "-0.25672318" "75695" "ATGACCAACCTCAACCACAAGGACGTGGGCTTCTCCGAGGAGGAGTTCCAGAAGCAGGAA" "54171" "1" "0.044384" "2.3830765" "-4.01" "0.45683314" "434234" "CAGATAGCTTTGGGATACCCTCTAAAGTATATTGTCATGTTCAAAATTCCAATAAATGCC" "25876" "1" "0.044418" "-2.3825922" "-4.01" "-0.42225497" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "36743" "1" "0.044437" "-2.3823099" "-4.01" "-0.215941" "20688" "CTTTGGTTAGGTTTGTGTGTGTGCTGCTGATTACATTAGAAGTTGATGTTAAAAAGTCAT" "10610" "1" "0.044447" "-2.3821758" "-4.01" "-0.23042553" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "46202" "1" "0.04446" "-2.381989" "-4.01" "-0.51984325" "" "TCTCCTCTGCTGGGATCCCGGGAAATACGCGGTAATTACCCCAAAAGGCCGCTCTCAAAG" "5917" "1" "0.044496" "-2.3814701" "-4.01" "-0.43253406" "11519" "ATCTGTCTGTATTGTGCTTCTCACAGGCTGAAAAATTAAACCCAGCTGTAGCTTAAGAAG" "26170" "1" "0.044551" "2.3806707" "-4.01" "0.34528929" "216161" "AGAGCTGCGACATCAATTTCAGGGAAGTGTTGGAAGACATGCTCCGCTCTTTGCGCGCGG" "59700" "1" "0.04459" "-2.3801154" "-4.01" "-0.23513887" "16911" "GAACATGATAGACCCACAGCCCTCATCAATGGCCATTTGAATTCACTTCAGAGCAATCCA" "34891" "1" "0.044606" "-2.3798784" "-4.01" "-0.33250075" "78506" "AACAGTCCAGAAGTATCCGACCTTCAAATCCTGCCTGAAAAAGGAACTTCACAGCAGATA" "32937" "1" "0.044621" "-2.3796681" "-4.01" "-0.19946883" "213452" "TGGGTCAAACAGTCCACATATTCCTTAAAAGAAAACGAGGACTTAGTTTTCTAAATGTTG" "20490" "1" "0.044634" "-2.3794864" "-4.01" "-0.56619646" "13656" "TCCTTTTTGTTGTTCATTTTTTGTAAAGCAGACGCTACTCTCAAGCATTTGACAAAACTG" "49960" "1" "0.044682" "-2.3787958" "-4.01" "-0.18841807" "258427" "CCAATATCAAGATTCTTGTTATCTTTGTTGGATTTAACCTGATATTCACTGTGCTGGTTG" "2185" "1" "0.044685" "2.3787474" "-4.01" "0.2230956" "" "GCTTTAGGGAGTCTCCTCACCATTCTGCACTTGCAAACCGGGCCACTAGAACCCAGTGAA" "15380" "1" "0.044702" "2.3785027" "-4.01" "0.70828898" "70544" "TGCCTGGTGTGGAGTTGGTGTGATCAGCTTTGCAGTGTGGAAAGCCTTAGGAGTTCACAG" "61018" "1" "0.044703" "-2.3784885" "-4.01" "-0.30163064" "258552" "TTCAAATCCACAGTCCAGTCATATCCTACGTGGGCTGCCTCACTCAGATGTCTCTTTTTA" "25939" "1" "0.044711" "-2.3783819" "-4.01" "-0.20240611" "" "GTCACACCTCCAAAGAAGGAAGAATTCAAATGTTTGAATTGACAACCCATTGAAATTACA" "26315" "1" "0.044739" "2.3779809" "-4.01" "0.35274901" "212167" "TGGACGCAGAATTTGTAGAGGAAGCTGCTCTGAAACACACCACCATGCTTTTGGGCTTAT" "54158" "1" "0.044754" "-2.3777542" "-4.01" "-0.19392279" "71805" "CTGGGGTGGGTTTCCAGTTTTGTTTCTGTTGTGTTGTGTTTTGTTTTTTGTATTATGTAT" "10384" "1" "0.044807" "-2.3770066" "-4.01" "-0.2342431" "100040999" "GAGCTGCATCAAGGAGTGACAATGTGACCGCCTCCAGTGTCTCCAGCACAGCTGTCATTA" "54404" "1" "0.044833" "2.3766233" "-4.01" "0.66887865" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "17278" "1" "0.044864" "-2.3761921" "-4.01" "-0.46588913" "16497" "GGGGTTTTTGTTGTTGTTTTGTTTTCTGTAAAGGTGGGGTCATTTTCTAACTCTTATTTG" "680" "1" "0.044899" "-2.3756844" "-4.01" "-0.33527549" "99633" "GCTTATCCTTTGCAGTGAGAAGAATAGATTTGTATCCTAATTATCTCTCATACAGAGACA" "627" "1" "0.044946" "2.3750111" "-4.01" "0.63440648" "64095" "TACATGAGCATAAGCCTGGTCACTGCCATTGCTGTGGACCGCTATGTGGCAGTGCGGCAT" "20963" "1" "0.044959" "-2.3748324" "-4.01" "-0.21603769" "" "CAGTTATACTGGCTACCAGTCACAGTTAGACACCTTCTGAGAAAAACTGACGGTAAAAAA" "45284" "1" "0.04496" "-2.3748158" "-4.01" "-0.2423815" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "27565" "1" "0.045055" "-2.3734626" "-4.01" "-0.42810247" "" "CCATTTCTCATCCGCAACCCAGGACCGTTGCACAAATCTCCTTAGGTGAATGAAATCAAA" "32346" "1" "0.045083" "-2.3730579" "-4.01" "-0.59181699" "103551" "GTTTTGGAGTTTCCCTTTGCCGGAAGGTTGGATGAAGGAAAGAGACCTCCAGCCTCAGCG" "5262" "1" "0.045087" "-2.373007" "-4.01" "-0.37834774" "76071" "CTGTACCAGAGCAATCTATTTATTGCCTACCGCTTGTTTTGCACTTAATAAAATAAGTTG" "49848" "1" "0.045111" "2.3726614" "-4.01" "0.28423809" "" "GTGGGGGGATGTGAGTGTCGCGTGTGGGTTCGCCCGTCCCGATGCCACGCTTTTCTGGCC" "36232" "1" "0.045119" "-2.3725444" "-4.01" "-0.23928102" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "37013" "1" "0.04515" "-2.3721084" "-4.01" "-0.2769575" "" "" "37026" "1" "0.045173" "-2.3717906" "-4.01" "-0.24514227" "" "GAGTTTTATTTTCAATGCTGGGACTGAACCCATGGCCCTGTCTATTGCTGAGCTAAATCC" "43363" "1" "0.045182" "2.3716547" "-4.01" "0.3014731" "" "" "57347" "1" "0.04522" "2.3711185" "-4.01" "0.23762402" "" "TTTCCTGTGATGAGTAAGGAGAGCACAGGAGCCATTTCCAAAGCAATGCCTTTCTTCAAG" "37290" "1" "0.045224" "-2.3710577" "-4.01" "-2.69600537" "30939" "CCGCCTGTTTGTTACGATGCAGATATTTAAACTTCTTACTTCTTTGTAGTTTCTGTATGT" "27820" "1" "0.045243" "-2.3707862" "-4.01" "-0.28774984" "" "TTTGTTCTGAGACGTGGCTTTTGGAGCATTTTGCTGAGCTGTCCCTTTGAGTGAATGTCA" "30039" "1" "0.045288" "2.3701599" "-4.01" "0.29371066" "" "GTCCCCTTTGCTTGTGAGAGAAGATAAGAAATTTTCGGAGTTGCAATAGCACTTTCACTC" "28020" "1" "0.045311" "-2.3698343" "-4.01" "-0.41558849" "" "GGTTCATCCTTTCACAGAAGCCACAGATGCTGTTTTTCAAAATAAAAATGAAATGGAAGA" "51774" "1" "0.045352" "2.3692481" "-4.01" "0.69700783" "74190" "CACATCCACACTGTAGTGCGAAGCTGAGGATTCTAAAAATAAATGTGAATTAAAATAGTG" "37458" "1" "0.045355" "-2.3692034" "-4.01" "-0.42351496" "106931" "AGATCTGTGTAGAACACACATGTTGGGATGAGAATGAATTAAAATGAAATTTTTCCTTTT" "10026" "1" "0.045379" "-2.368874" "-4.01" "-0.24739018" "" "CACTAGGGGTCAAAATGTATCCAGGGCTTAAGAAAAGGCACGACAGAAAAGTTATAATAA" "25179" "1" "0.045458" "2.3677558" "-4.01" "0.57481177" "" "GCACTGTGTTGCAGAGCATGGGTTCAAATTGCTTTTCCTTAAGGAAGATAAAACTTTTTT" "46224" "1" "0.045473" "-2.3675387" "-4.01" "-0.50280501" "19417" "GAGACGCCTGCTTTAACTGTCTTATGTATTAATTGGGCTTCCACAGAAAAGCTCATCTAT" "52922" "1" "0.04549" "2.3672988" "-4.02" "0.25831427" "53881" "GAAGAGACTCCACAAGTTAAAGTGATCCTAAACATTGGACTTTTTGCTGTGTGTTCACTT" "33301" "1" "0.045505" "2.3670877" "-4.02" "0.31053504" "" "TAGAAACAATCACCTCACTGCCTCCATACTCCTGTTGAGGTAGGAGGGTCTTGAATTTGA" "28933" "1" "0.045509" "2.3670345" "-4.02" "0.64396122" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "3927" "1" "0.045516" "-2.366938" "-4.02" "-0.43616969" "100043479" "CAAATGATGAACAATGAAGGTAAAAGGGCTTCCTAGTATACCAAGAGTTGTGGTCCTCAC" "11385" "1" "0.045536" "2.3666577" "-4.02" "1.38605096" "56696" "TTTCTCCTGATTCTGTCTGTTGTCCCCATCTCTTGGGGTGGAATTAAAAGGATGCATCAC" "20661" "1" "0.045553" "-2.3664194" "-4.02" "-0.38035552" "" "ACTCTGGATCCATATTTTATGATAATTTGGGGATTATGATTACATCATTCCTACCTCCTG" "123" "1" "0.045562" "2.3662879" "-4.02" "0.4121802" "11637" "AACTGACCAAATGCTGCCATGTTTGGCCCCTGAGTCAATAAAATATGTTGAAAATTTGTA" "7630" "1" "0.045583" "2.3659936" "-4.02" "0.20623283" "258289" "GACATGAAAAGGGCACTGAGAAGGCTGCTCAGCCAAAAAAGCTTGATTTGTAGTTGGTGA" "33278" "1" "0.045583" "2.3659882" "-4.02" "0.66983995" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "6297" "1" "0.045605" "-2.3656792" "-4.02" "-0.30957884" "" "GCCTGCTTTTTCTTAAAAACTGGCCTCAGAATTTCAACCCGGGTCATCATTTTAATTGGG" "62956" "1" "0.045616" "2.3655224" "-4.02" "0.51881926" "230837" "TCAAAAGTCTGCTTTCTAGGGCCAGAAATCCCACCATCGCTTAGTCCAATTACAAAGCCA" "28991" "1" "0.045617" "-2.3655074" "-4.02" "-0.26060274" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "43304" "1" "0.045624" "-2.3654123" "-4.02" "-0.20565443" "" "GAATACCCCGCTCCTGTAAGTAGCCCCTTACCTGTGCTCTTTAATGAAGCTCAATAAACT" "53453" "1" "0.045648" "-2.3650709" "-4.02" "-0.28683533" "13480" "CTGGGCCCACAGTGCATATTCCAATAAGAACTACTGTTGTTGTGTTCCCCTTTGCCAAAA" "30134" "1" "0.045675" "-2.3647024" "-4.02" "-0.2697669" "258298" "CCTGTAGTATACAGTTTAAGGAACAAGGAGGTAAAAAATGCATTTAAGAAGGTTGTTGGA" "50776" "1" "0.045731" "2.3639103" "-4.02" "0.96950531" "232414" "GCAATAGTCTGTAACGCTTTGCAGATTTCAGTTGACCTTGTCCATTGTGCCAAGGAAAAA" "15813" "1" "0.045736" "2.3638425" "-4.02" "1.2394274" "100702" "GAAATGTCAAGTTCAAAAGAATGAACTGTGTAAAGGAGAGAGAGAGATCTTGGTGCTGTT" "28804" "1" "0.045818" "2.3626915" "-4.02" "0.64270451" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "4014" "1" "0.04587" "-2.3619707" "-4.02" "-0.44494027" "" "AGGGTGTGCTACCACATCTGGCTGACTTGTCTTTTTAAATAAAGAAAGTTTGTACCTCTG" "26720" "1" "0.045938" "2.3610169" "-4.02" "0.64267056" "11501" "CCGTCATCTCCGGATTGAAACAGATTAGTTGTTGAAATTATGACTAAACACTATTCACTA" "44419" "1" "0.046005" "2.3600845" "-4.02" "0.35860998" "68842" "GTCCAGGAAGTATTCTAGAAGGGAGTAATGGTTTGCATTCAAAATGATGTAATTTTCCAA" "4855" "1" "0.046035" "2.3596674" "-4.02" "0.35549377" "353211" "AACCACTTGATAGAGGACTTTGCTGCTTTGTGGCATTCAGGACACTCACCAACAACAATG" "3698" "1" "0.046039" "-2.3596134" "-4.02" "-0.20304695" "78134" "GGGACACATTACAGCCAGAGAGCTACAGTATTTGTGCCCAGGTCAGGAGTAAATTGAAAA" "57246" "1" "0.046093" "-2.3588556" "-4.02" "-0.21432643" "" "ACTTACTTCCCTTGGCCTGCACTTACTGGAGTCCTTAGCCACACTTAAGCAATTCAAGTT" "32792" "1" "0.046104" "-2.358709" "-4.02" "-0.29942748" "20677" "TTTTCTGCAATGAAGACAGAAAGAAGGCTCTGGGGTGATGCGTTTGGCATTTGTGTTGAG" "4396" "1" "0.046129" "-2.3583622" "-4.02" "-0.26445653" "" "AGGCGTTGTGGTCAGTGACTTTGGAGGCCTCCGATGGTGTGGTGGGTGGCTGAGGAGACT" "9881" "1" "0.046196" "-2.3574249" "-4.02" "-0.30237538" "68044" "GCAGGTCTCAATTAACTTCCTGTTTCTATTAGAATAACCATGGTTTGTTGTACGTAAGTT" "7123" "1" "0.046212" "2.35721" "-4.02" "0.3472601" "" "GAGGGGGACTCCAAAAATTCTAATGTGAGCACCATTTATTATACCCTAGAAGAATATTTT" "31048" "1" "0.046217" "-2.3571408" "-4.02" "-0.29566913" "11858" "TGGCCACACTGAGGGAGCTATCCAAGCAGAGACTCATCCCTGTCACACATGAGCAGGGTA" "21997" "1" "0.046265" "-2.3564739" "-4.02" "-0.19888959" "77706" "GGAGATACATACTTTAAATTAGTAGCTGCACATTAGTAATTGCTTCATTGGGTGCACTGA" "7497" "1" "0.046304" "2.3559306" "-4.02" "0.36329895" "22259" "AACGTTGTATACCATCTGAAGACCTTGTTGACCCAACCAAATAAACTAGCCAGGAGAGCC" "10771" "1" "0.046311" "2.3558288" "-4.02" "0.27167473" "20351" "CCTCCTCCCTTTGTTTTGGGATTCAGAAAACTGCTTGTCACAGACAATTTATTTTTTATT" "28812" "1" "0.046348" "2.3553256" "-4.02" "0.33052021" "239985" "ATGACATCCGTGAAGGCACACATGTGTGAGTGAACATTAGAGGGTCACATATAACTGGCT" "31978" "1" "0.046369" "-2.3550276" "-4.02" "-0.18159077" "" "TTTGCACTGTTTCCATGAAGGTCTTCATTCAGGGCATGTGGCAATGACACTTTCAGCCTT" "23682" "1" "0.046388" "2.3547665" "-4.02" "0.39943924" "16425" "AAACTCGAGGGTGCTCATCTCTGTGAAGAAAGAAAAATCTGTGACTCTCACCCTGAATAA" "8573" "1" "0.046389" "2.3547602" "-4.02" "0.58869872" "" "CCCCAACCTGTTCCCTCAACTTTAGACAGAATTTGAGGTTACTATCTCAATAAATAAATA" "2043" "1" "0.046417" "-2.3543625" "-4.02" "-0.40321758" "208898" "GGCCAGTCTCTTTAAGAGCTTGATTTTAGCTTATATACATAAGCTTTGCAAAGGAATGTT" "1770" "1" "0.046484" "-2.3534436" "-4.02" "-0.32867147" "" "GAGCTTGTCACGGCACTGGGTGGCTAAGGGGATTTCCCCCTAAACCTCAAGGCAAAAGTG" "14233" "1" "0.046513" "-2.3530442" "-4.02" "-0.21106533" "13858" "GTGCATCAAACTACCTATGAGCATGGGATACAAAAGGTTTGAGATTCCTAGAAATGTGAC" "6846" "1" "0.046546" "-2.3525936" "-4.02" "-0.20673068" "53975" "CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG" "13973" "1" "0.046585" "-2.3520505" "-4.02" "-0.49653652" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "32064" "1" "0.046612" "-2.3516794" "-4.02" "-0.29359056" "446101" "CAGCTGCTGGATGATATCCTCATTCGCATGCGGGACCCTCGGAATGTTACTGAGGCTCCA" "25466" "1" "0.046677" "-2.3507827" "-4.02" "-0.2373156" "333433" "CCCACTGGAGGAATCCGGGGCTTGGCAGTGGGATCCTGCTGAACTGTACTTCGAATACAT" "29866" "1" "0.046711" "2.3503225" "-4.02" "0.24030276" "140887" "TGCCACTTTGTTATACATAAAAATATGTCCAACCTGGTGGTCTGGTGAATATTTGGGGGG" "11966" "1" "0.04672" "-2.3501959" "-4.02" "-0.3992184" "258296" "TGGTATGTCTCTTCCACCATCCCAAACATGTTGGTCAATATTCTCTCTGAGAATAAGACC" "9546" "1" "0.046721" "2.3501787" "-4.02" "0.22699621" "100163" "TCAAACCAGGGAGCTTTAGTTGTCTGCTTTTGTCTTGTTTCTGGTTTTGGTTTGTTTTTT" "18775" "1" "0.046765" "-2.3495785" "-4.02" "-0.25729811" "20610" "GTGTGAGGCTTTGGGGTTTGTTTTTGTTTTCATTTTTGTTCCCTCCCATCCCTAACATTT" "7454" "1" "0.046765" "-2.3495754" "-4.02" "-0.31257436" "217219" "TTCGTATCCCTGGACGGACGTTCCAATTCACAAGTGCGCCACTCCTACATCGACCTGCAG" "45234" "1" "0.046766" "2.3495599" "-4.02" "0.23487134" "671927" "TCGGGAAACCCAGTGGTTCAAGGAGTGAACGGCTTCAAGGCTGAGTTCAGCAAGAGCGAC" "14349" "1" "0.0468" "2.3491037" "-4.02" "0.52786893" "12763" "AATGAGCTCTGCATGGGAGATAAAGCCTAACAGAAGGAAAAGTGAGTGTCAGCACAGTAG" "34671" "1" "0.046805" "2.3490299" "-4.02" "0.76072307" "110749" "TATGCACTTGCGTCAGAGGAGGCAAGGCCAAAGCTCGAAGGCTGGTGATGGTGGCCAAAT" "9798" "1" "0.046829" "-2.3486986" "-4.02" "-0.23195066" "" "" "26638" "1" "0.046833" "2.3486462" "-4.02" "0.23332801" "13098" "TTACAGAATTTCAAACTGAAACCTCTGGTTCACCCAAAAGACATTGATATGATCCCATTT" "6171" "1" "0.046849" "2.3484229" "-4.02" "0.20456269" "" "ACTGCCTGTGAAGGGAGTGAAATTTGCCTTTAATAAGAAGACAGGTATATGTTGGAAAGA" "53242" "1" "0.046897" "2.3477774" "-4.02" "0.39278166" "73121" "TTTGTGGGGCAAACAGAACCTAAATGACTGATAGATTTCTGTTCATCTATTAGCTTATCT" "52059" "1" "0.046898" "-2.3477641" "-4.02" "-0.23174242" "" "GAATTACTAGTGCATAACTTTGGATGAGTATCATTGTCCTAAAAACTCACTGTATACCTG" "39388" "1" "0.0469" "-2.3477259" "-4.02" "-0.2411413" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "56021" "1" "0.046942" "2.3471619" "-4.02" "1.54780651" "16362" "CTGCTAAATGGTGTTTGGTCATGTGGTGGACCTGTGTAAATATGTATATTTGTCTTTTTA" "19577" "1" "0.046983" "2.3465945" "-4.02" "0.40373099" "100037283" "TCTGGGAAAACTAGCTTGAGTCCAGTCGCCATAAGTAGAACTGTTAAATTTGGTAGAAGT" "30131" "1" "0.047002" "2.346342" "-4.02" "0.28942321" "19700" "TGTAGACTGGCTTGGCCTGCTGGCCCAGATGTCTCAGACAATCCATAAAGTCAGTGAATT" "62656" "1" "0.04703" "2.3459619" "-4.03" "0.91296557" "13179" "AACACCTTCAGATGTGTCTATGTGCGTTCTGCCATTCAACTTGGAAACTACAAGTAACCC" "44138" "1" "0.047038" "-2.3458473" "-4.03" "-0.24865538" "" "GGTATCGGTGCTTGTATAACACACAATGAATTGTAACTAGCATGTTGTTAAGAAAACACA" "22523" "1" "0.047041" "-2.3458036" "-4.03" "-0.444714" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "45458" "1" "0.047076" "2.3453298" "-4.03" "0.35237155" "100037282" "CAGAGAGCAGCTCAACATCTGGTCAGTTATAATGCAAGGCAGGCACATGACCCATCCAGG" "28672" "1" "0.047156" "-2.3442355" "-4.03" "-0.36514077" "" "" "54759" "1" "0.047164" "2.3441362" "-4.03" "0.54335363" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "29217" "1" "0.047199" "2.343662" "-4.03" "0.61868233" "12959" "TGACTACAAGCACTTCAGAGAGTGGGGCTCCCATGCTCACACCTTCCAGGTGCAGAGTGT" "4736" "1" "0.047247" "-2.3430111" "-4.03" "-0.34791363" "" "TTCTGAAGTACTGGAGGCTGTCCTCTGTATATTGACATTGAATAAACGTGTGAATGCATT" "26376" "1" "0.047257" "-2.3428746" "-4.03" "-0.19189157" "99890" "GGTGCAAACTTAGACAAAAGATGGTCTGTTTCATAATAGACCAAGTATGTTAAATAGGTG" "33700" "1" "0.047332" "-2.3418481" "-4.03" "-0.2216979" "56149" "CACCGTTTTCTGCATATGTTGCTTCTGAACCACAAACTGTATAAAATTGATGGGTTTTTT" "54219" "1" "0.047356" "-2.3415327" "-4.03" "-0.42561563" "" "GTCATTGATAAGTGCCAATTGGCAGGAGGAGCATCCTTCCATGGCAGTTATTCTGAAAGA" "42728" "1" "0.047388" "-2.3410946" "-4.03" "-0.20771995" "" "GTTCTCTTCCCTGAGTTTCTCTGGTAGCATCTCTTTGATGTACTTGATTCTACTCGATTA" "25878" "1" "0.047452" "-2.3402325" "-4.03" "-0.24708375" "" "CTTTGGGGAGGTTTAATAGGAATGGCTTTGTTTAAAGGAGGCTGGCCATACATGACCTTA" "60913" "1" "0.047534" "-2.3391289" "-4.03" "-0.39014043" "" "CTAGTAGAACCAGCTTATTAAGTGTTACTTTGGTATGCAGTGAAATGGTCAATTAAGCAA" "45246" "1" "0.047579" "-2.3385115" "-4.03" "-0.18961131" "" "TGACTCAGCCAGCACTAGTTTGGCCTGAAGGGTTCAGGAAATCACCTGAGGGGTCAAGCC" "16768" "1" "0.047595" "-2.3383042" "-4.03" "-0.43092014" "68027" "GGCTTGTTGGATTTTAATGCAGCATCTTCAGAACTCGTCCTGATGGTGTCTTGTTGTGTC" "37996" "1" "0.047597" "-2.3382754" "-4.03" "-0.25207467" "" "" "28543" "1" "0.047685" "-2.3370964" "-4.03" "-0.20887583" "18760" "TGTGTGACCAACTGTGTTGTATTAACAAAAGTTCCCGGAAACACTAAACTTGTTATTGTG" "19686" "1" "0.047687" "-2.3370581" "-4.03" "-0.22086957" "233057" "GAAAAGGCCTTTGGTCAAAGAGCACATCTTACCAAACATCAGAGAATTCACACTGGTGAA" "5356" "1" "0.047708" "2.3367824" "-4.03" "0.51726675" "12399" "TGTCAAACAGAGGAATCTGTGTTTGTTACAATAATATAACAGATGCCTTGAAGGACCCGC" "3608" "1" "0.047742" "-2.3363176" "-4.03" "-0.41411822" "12151" "GCTTTGTCTTGCTTGTAGCCATTAAATCATTACTTTTACACACATTGCTGTTAACTTCTG" "46598" "1" "0.047781" "-2.3357994" "-4.03" "-0.34605419" "625638" "CCCAAAGATCTATGTCATCTACTGATCATTGTAAATAAAGTAAATCTGCTTTTTCAGGCC" "1405" "1" "0.047871" "-2.3345916" "-4.03" "-0.46174787" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "58758" "1" "0.047873" "2.3345649" "-4.03" "0.23313256" "219094" "GTAAATGGCTGCATCCCTTTTCAGCAACCTTCGAAACTCACGTTATCAAAATAGGCAAGT" "58847" "1" "0.047875" "-2.3345474" "-4.03" "-0.21797758" "108069" "ACAGTGGCAATATTAGGTAACCTTTTTCCTATGAAGTCTTTTGTAGGTTCTTGTTGTAAC" "18055" "1" "0.047883" "2.3344305" "-4.03" "0.31423029" "259300" "TTATGAGGATTAATCTGAGGCTTGGCAGCAACAGCCTTTCTCTACTGAGGTATCTTGGCA" "62861" "1" "0.047916" "2.3339917" "-4.03" "0.50867397" "258603" "CCTGACACAGCTATGCTTTTTTGCTACTTTTGGTATTGCAGAATGTCAGATGTTGGCTGT" "56333" "1" "0.047937" "-2.3337112" "-4.03" "-0.2400354" "" "CCCTACTGTTTTGCTTTGTAAAATGGCATGTCAGTAGATCTTTTTGAAAATTGGTTGTGA" "32751" "1" "0.04794" "2.3336687" "-4.03" "0.46247681" "27423" "TATTTGTGGGAAGAGATTGGACAAATTCCCTCATTGACTCTCTGACAAGTGTTAAAGGTA" "9531" "1" "0.047967" "-2.3333064" "-4.03" "-0.29564445" "17933" "CACATTTGGGGGTCTCTATATTTCTGAAGAGGTAAGCTGATGAAAATAAATAGAGTGTAA" "51998" "1" "0.048046" "-2.3322534" "-4.03" "-0.21783237" "" "TGTCCTGCGCAGACCCTTCTAGGTAGGCCTTCATCTGCAGTTGGTTGACCTTTATCTGTG" "3503" "1" "0.048071" "2.3319187" "-4.03" "1.25969611" "16818" "AATCTTATGTCTCTGTGTGTTCTGTCCTGGTGCCTAGCACACACCAGGAGCTCAATAAAA" "16427" "1" "0.048075" "-2.331865" "-4.03" "-0.23468599" "320560" "ATTGGTCAAGGCAAATATGAGCAAGGGTTCTTTCCAAAGTTACAGTCCGATGTCTTGGCA" "3765" "1" "0.048099" "2.331544" "-4.03" "2.5111327" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "55310" "1" "0.0481" "2.3315285" "-4.03" "0.22315698" "109900" "CTGGAGTCATCTCTACATTGCAGATTCATCGTGAGAACATGAAACAGGCGCTCAGCCCTG" "46456" "1" "0.048133" "-2.3310992" "-4.03" "-0.34795141" "57265" "TCACAGTCTACATGATCAAATACCTCATGACGCTCATCGTGGGCATCACGTCGGGCTTCT" "26803" "1" "0.048176" "-2.3305249" "-4.03" "-0.31114943" "" "TTACCCTTCTGTGTTAGCCTCTTAAAGTACTGCGACAACCTTAAAAGGGCACAGGAAAGG" "40083" "1" "0.048179" "-2.3304856" "-4.03" "-0.45126273" "21847" "CATATCTCAGAGGTTTCTGACATGCAAACTTGAACCCTTGAAAGAAGAGTTTTCTTAAAA" "43103" "1" "0.048213" "-2.3300319" "-4.03" "-0.26090617" "13175" "AATGGAACCCCTGGTAGTCAGCTCTCTACTCCACGCTCGGGCAAGTCACCAAGTCCATCA" "37298" "1" "0.048221" "2.3299268" "-4.03" "0.27230904" "225207" "CACAAGTCATGGAATGAACCAAGTGTGAATAACCAAGCACATGATATTATTTGTTGTGTT" "46781" "1" "0.048234" "-2.3297487" "-4.03" "-0.22277383" "" "CAAAACCCGAAAACCAGCGCTCATTGGACTACGACTTTAACCGGAAATTGAATGCACACG" "16629" "1" "0.048258" "-2.3294265" "-4.03" "-0.33625687" "78785" "TGGGTCTTGTGTTACGTATTGAAGTTTCTGTCCTGTTACGTGTAAAGACTTATCCACTAT" "57593" "1" "0.048265" "-2.3293368" "-4.03" "-0.50290329" "239731" "CAAAGACACGGATAACCATGATGGGTATTAGAGATGCCTTTTTCTGTGGTCAGTATGTTT" "37528" "1" "0.048278" "-2.3291607" "-4.03" "-0.18852288" "319581" "TTCCAAAAAATGCAAAGGAAAGAATCCACTTGCATCCTGGGTCCTTTAACCTTTTAACCG" "27092" "1" "0.04828" "-2.3291462" "-4.03" "-0.25396821" "" "TATGTTCTGTTTTTTCTTTTTTGTTAAACTTTTATCAATGAAGAATCTATTGCAGTTACT" "35430" "1" "0.048359" "2.3280983" "-4.03" "0.401734" "" "AATGTAAGCCACAGGGAGCCAGCTAAGGAACATAGAATCCTTGAGTTCACTCTGACTCAA" "27674" "1" "0.048363" "-2.3280364" "-4.03" "-0.35868642" "105000" "GAGTTTCTGAATGTTATTTTGTGAAACTTGTTTTAAAATAGTAATAAATCATGTTATTTT" "27673" "1" "0.048386" "-2.3277315" "-4.03" "-0.20004844" "" "TACAATCTGTAAAAGCAGGACTGTAGAAGCAGGGGACACACACCAAGAAGACATTATGGC" "44399" "1" "0.048395" "-2.327616" "-4.03" "-0.23432247" "116905" "ATTGCCAACCCTAATATACCTGCTTACCGGTATGACCCATATGGCAAAGTCCTATCCAGA" "38964" "1" "0.048465" "-2.3266946" "-4.03" "-0.42124256" "80334" "TGAGTTCATTGAAAGTTGCCAAAAAGATGAAAACATAATGCGCTCCATGCAGCTCTTTGA" "49575" "1" "0.048507" "-2.3261379" "-4.03" "-0.18288162" "667350" "ATCAGACAACATTGCCAAGATGAAGGGCACCTTTGTGGAGAGAGATCACAAAGGAGAGAA" "4810" "1" "0.048577" "2.3252048" "-4.03" "0.22973591" "" "GGGAAAACCTTTGTGGATACAGAGACTGTCAAGAGTCAGACTTCTGAACAGGAAAGCCAA" "2544" "1" "0.048613" "2.3247319" "-4.03" "0.24878802" "" "" "59991" "1" "0.048614" "-2.3247258" "-4.03" "-0.35464877" "56405" "CGTGCGTTGCCTGTGACGTTTTTTAAAACTAGCATTTTGAAATAGTGAACATGGAAATCT" "47492" "1" "0.048615" "-2.3247128" "-4.03" "-0.23158963" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "55820" "1" "0.048624" "2.3245846" "-4.04" "0.39557791" "71914" "CCACGTTTGTGGCACTGCTCCAAGAAGCCTTATGCACACATACAAATATACAAATGCACA" "56359" "1" "0.048631" "2.3244929" "-4.04" "0.18368183" "71405" "CTCATCACTAAATACAACAAGTCCAAATTCAAGCAGCTCCGAAGTCGCTTTGAGTCCTAG" "44032" "1" "0.048653" "-2.3242121" "-4.04" "-0.17668796" "" "TCTGGTGACAGATCCTTTCAGTGTAAGGAATGTGGAAAGGACATTGTTCATGGAACAGCC" "5955" "1" "0.04867" "2.3239813" "-4.04" "0.5129122" "" "ACTTGAGTGAAGCAAGCAGGTGAGAAATGTCAGTCGTACAGTGCTGGTGCACCCAGACCC" "55543" "1" "0.048671" "-2.3239681" "-4.04" "-0.35099602" "381801" "CTCCGAGAGAATACTTGTCGCCTCTACAGTCTTTGAGCAGGGAGCACGAGCAGTCATCTT" "40698" "1" "0.048679" "-2.3238711" "-4.04" "-0.24848851" "" "TCTCCACTACTGACTGCAGACCAGGTATTGTAAGCCGAGCTACCACATTTGTTTTCTACA" "20570" "1" "0.048683" "-2.3238143" "-4.04" "-0.44276055" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "22814" "1" "0.048698" "-2.3236167" "-4.04" "-0.23331783" "227731" "CATATTTATGTTCATGGTTGATTGTACCTTCCTGTCATCACCTGGTGGGGCATGGGAAGA" "22775" "1" "0.048721" "-2.323308" "-4.04" "-0.3568599" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "33099" "1" "0.048747" "-2.3229635" "-4.04" "-0.20736705" "" "" "26879" "1" "0.048766" "-2.3227208" "-4.04" "-0.2997106" "252876" "TTTTAAACCTTCCTAAAGTTGTTACATGTTTGAATACAAATAAATATATGTAACAGAAGT" "46013" "1" "0.048781" "2.3225256" "-4.04" "0.31373596" "" "CTGGAAGTCCCTCCACTTGTGAAGGGGCAAATATTTCCTAGAAGTAAATGCTTTGGACAT" "61731" "1" "0.048794" "2.3223572" "-4.04" "0.49873155" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "16784" "1" "0.048833" "2.3218411" "-4.04" "1.25869856" "12258" "TGGGTAAACATTGTCACCCAAGCTTCAGCTCCTCCGGTTATTTCCTTGCCACTGCCTGCC" "13779" "1" "0.048851" "2.3216015" "-4.04" "0.29827442" "245305" "GAGCTCTTCCATTCCTCTTCAAATATGTGAAAAATCTCATAGAGAAAAAGGATGCTACAA" "25910" "1" "0.048855" "-2.3215552" "-4.04" "-0.24845725" "" "GGGGTGCTATTTACCTAGAACCATTGTCTACTACAATTAACATTTACATTACAAAGTGTG" "42555" "1" "0.048875" "2.321287" "-4.04" "0.96847559" "15950" "AGTGAGAGGCATGAGTGCATTTGCTATGGAATTGGAGATGATACAGGAAAAATGGCAGTG" "48644" "1" "0.048876" "-2.3212731" "-4.04" "-0.21077691" "93757" "TGATCGCTCTTGAAGGAGATATTGTAAGAACAATTGGACACAAAAACCGGTTGGTCAAAG" "6284" "1" "0.048876" "2.321269" "-4.04" "1.77828726" "71898" "AGCCGACACCCATCCTCAGGCATGTCATGGTCCCCTAAATAAACCGTTTCTGTTGTTCCT" "30984" "1" "0.0489" "-2.3209658" "-4.04" "-0.22809368" "319636" "TAGATTAACTACCAAATAGGAAGCAGCCATGGAGGTTATTGCCTGCGTCCCAGAATCAAG" "60369" "1" "0.048917" "-2.3207396" "-4.04" "-0.28915557" "" "AGTCTCTTGGGCAAGCAGTGGGTGGTCGGAAACCTTGAACTACTTCCTGTCTGGGTCTCC" "26080" "1" "0.048917" "2.3207351" "-4.04" "0.28171982" "101744" "CCTCTTGTGAAGACACTTTGTTGCTGTGACCAGGCAGTACCTTGGCCTGGGGAGGAAGTC" "44053" "1" "0.048934" "2.3205209" "-4.04" "1.22575403" "17857" "ACTTTCCAAGGAAACTGGACGTTTCCACTTTAGCGCTTCCAATAAAATTCTTGCTAAGTG" "4824" "1" "0.048949" "-2.3203131" "-4.04" "-0.40985014" "14683" "CTGCACGTCTTTCTTCCTATGACTCTACAAGTAAAAATAACTATTAACGCTCCTGATAAA" "37043" "1" "0.048979" "-2.3199202" "-4.04" "-0.20760374" "" "TTTAGTATTTTCTGCCCCCCGTGTTATTTTCACGTGCAGAAATAAAGCGCACCGCTACTC" "27951" "1" "0.049" "2.319654" "-4.04" "0.41664127" "14347" "GGGTTGTGGAAGGACAGTGCAGATGATTCTGGGCTTTTGACACCACAGTTCCCCCAGGGA" "33602" "1" "0.049006" "-2.31957" "-4.04" "-0.19815419" "" "CAGATGTGACAGTTACATTGTTTCTTCTATCTAAAGTGCCCAAACCATTTTGGGATATAA" "53785" "1" "0.04901" "2.3195265" "-4.04" "0.39609521" "16909" "CTTCATTTTGAGGTGAGGCGCCCCACAGATTGTTTCTATACAAATGTAAATCTTAAAAAA" "13" "1" "0.049092" "2.3184487" "-4.04" "0.32289741" "NA" "TCTCAGGCGCGGTTTCTGATTGAATGCAGAGGTCACACGCATGCCTCCCTGTATTACCTG" "662" "1" "0.049136" "-2.3178683" "-4.04" "-0.26195645" "380752" "CAGCTGGTGCGTGACCTAGACTTCAACCCCAACAAGCAGTATTACCTCGCCAGCTGTGGA" "19606" "1" "0.049175" "2.317372" "-4.04" "2.48016442" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "36514" "1" "0.049185" "-2.3172328" "-4.04" "-0.22228885" "" "GAGGGCAGGCTTTCCAACTCAGTATTATTTACCTTATTTGTTTATTTCTTAAGAATGAGC" "7373" "1" "0.049193" "-2.3171333" "-4.04" "-0.21295357" "70047" "GTTCGATTTGTTGGACATGCAAAACAGAGAATTCAGGAAGATTATCTTCGAATTTTAAGG" "40161" "1" "0.049203" "2.3170043" "-4.04" "0.39208525" "104086" "TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA" "4306" "1" "0.049215" "2.3168503" "-4.04" "0.36515507" "257933" "CTTGAGGAACAAGGATGTAAAGAATGCTGGACAGAGGATATGGAAGAAGTTGTGCAAGAT" "31631" "1" "0.049256" "-2.3163051" "-4.04" "-0.1812826" "" "TATCTGAAGACTTCTTTGTACTGAGCATCAGCGGAGGTCGACTTCTGGTCAACACTTTGA" "953" "1" "0.049283" "-2.3159614" "-4.04" "-0.28124716" "19893" "AACAGAAGGCTCAGAAACTATTGATATTACTGATGAGAAGCTAGATGAAGTCCTTAAAGA" "23346" "1" "0.049289" "2.3158804" "-4.04" "0.51360524" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "23926" "1" "0.049316" "-2.3155274" "-4.04" "-0.26725504" "232966" "ATCTGCTGTAAGGGCTTCAGTCAGAGATCGCATCTCGTCTACCACCAGAGGGTCCACAGT" "36038" "1" "0.049495" "-2.3132044" "-4.04" "-0.25244468" "" "TTCTGGTTTTAAATAGAGGAAAAAAGCAAGGATCTTCCATGCCACCCAGTGGTTACTTTA" "53238" "1" "0.049497" "2.3131848" "-4.04" "0.24401158" "624086" "ATCGGAGCAGAGGGATAATTGCGGGTTTTAGGATCCAGACGTGGTACGGGTGAAAATGCT" "55178" "1" "0.049502" "-2.313115" "-4.04" "-0.21323619" "68355" "AAAGGAGTTTCTCCATTAGCACAGAATAAACTTCTTTCATCTATGGTTTGTGGGTCATGC" "49434" "1" "0.049513" "2.3129733" "-4.04" "0.19011643" "" "ACGATGGAGTGAACATCATAAATTGTCAAATCAACCAGGACCCTAAAGATCCTGGCAGGG" "3460" "1" "0.049525" "2.3128208" "-4.04" "0.38905335" "" "TAACATTGTGATTGGTGGGACTGAGGATTACAGGCATTGGTAGTTATGAGAGGTCTTAGG" "15025" "1" "0.049531" "-2.3127376" "-4.04" "-0.38528876" "13371" "AATGATAACTACTGACGAAAGAGCTGTCTGCTCAGTCTGTGGTTGGATGTAGTCACACGA" "51636" "1" "0.049532" "-2.3127291" "-4.04" "-0.2339976" "231570" "ACAAGACTCTCACGGGAATAGCAGTGTAATAAAAAGAGGGGATGGCAAAGGACTTAGTGC" "25903" "1" "0.049539" "-2.3126406" "-4.04" "-0.21082025" "20018" "GGCCAGCATAAAGGACTATAAAGCTAAAAAGGCAAGCAAAAAGGAGCCCACATTCTAGTC" "15438" "1" "0.049602" "-2.3118272" "-4.04" "-0.21209161" "213773" "GAGCAGGCCAAACGGGAAGAGCAGGTGATCAAGCAGCAAGAACTGGACAACCTGCTCCAT" "46601" "1" "0.049612" "-2.3116906" "-4.04" "-0.18440843" "" "CCACAGGCTTTCTTGATCTCTCCTAAGATGCTATGTGCACTTGCTTGCAGTAAACTCTGA" "19440" "1" "0.049668" "-2.3109652" "-4.04" "-0.24093014" "" "TTTTTATTTAGAAGACAAAGCCAGCTGGTGGTTGAGAGCACCTCCTAGATGCTGAGCTGT" "21883" "1" "0.049706" "2.3104817" "-4.04" "0.92481099" "17444" "GAATGATATTGTGTTTCTCTAAGGTGAAAACTCAGGTATAAAATGAGAAAAGGGTGAGAC" "30708" "1" "0.049709" "-2.3104456" "-4.04" "-0.28891989" "319613" "CTCTAGGGCATTTGGGGACACTGTCTGGACAGCGCAATGGACACGGTCTGCAAAGGAAAC" "60411" "1" "0.049759" "2.3098022" "-4.04" "1.05710383" "12772" "GAAGCAGGGACAGAATTCTTGCTTTGAAAATAATACTTGGGAACATATCTTAATTACAGG" "26931" "1" "0.049765" "2.3097201" "-4.04" "0.35587096" "" "TGTGCACTCGACTGACTTTGAACCATATGCAAATTCTTTCAATAATGAAAAACTACCAGA" "30040" "1" "0.049822" "-2.3089808" "-4.04" "-0.22080097" "68477" "CAGGTACAGGCTTCATGAGTTTTTCATACTGATTTACAATTGAGTAGATACCAAAAACAG" "56403" "1" "0.049831" "2.3088768" "-4.04" "2.10022584" "100702" "GGCTCTCTTAAATGGATTTTCTACAGTTCTTTTTCATTACCTTGTCCGTTATCTAAAGCA" "35466" "1" "0.049835" "-2.3088232" "-4.04" "-0.27039719" "" "" "18171" "1" "0.04984" "-2.3087547" "-4.04" "-0.20689419" "" "TTGATAGTGTAAGATAGCAAGCTGAATGCCCCAGGAGGAGTAAGCCAGGTAGTAGTGTTT" "4033" "1" "0.049857" "2.308538" "-4.04" "1.33089247" "74153" "ATTCCTACATCTTCAGCTCACAGCAGATACTTCAACAATAAAAACTTGTTGACGGAAGGC" "27293" "1" "0.049862" "2.3084694" "-4.04" "2.0057857" "15944" "GCATTGTTCCACTGAGGGACAGGGACAAGTAGTGATTAAAATTCATTGACCATGATTCTT" "31595" "1" "0.049864" "-2.3084452" "-4.04" "-0.22994033" "" "GGCTCATGAAGTTATGATTGTTGGAATCACACATTACTCTGCTGATAACTTCTTTTTACA" "47565" "1" "0.04988" "-2.3082391" "-4.04" "-0.1744825" "" "" "2022" "1" "0.049898" "2.3080051" "-4.04" "0.50451915" "630322" "ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT" "41910" "1" "0.049901" "-2.3079719" "-4.04" "-0.28227081" "218772" "GCTTTCTATGTTCATATACTGTTTACCTTTTTCCATGGAGTCTCCTGGCAAAGAATAAAT" "17874" "1" "0.049943" "-2.3074372" "-4.04" "-0.19079522" "69573" "TGTTTCAGACCTCTGTCCTAAAGGACTCTTTTGGACCTAAGTATCTTCTGTTGGTTTACC" "11347" "1" "0.04995" "-2.3073466" "-4.04" "-0.21974941" "" "AAGCGATGTGACATAAACACTTCATCCTGTATACGTGATGGGGCCGTGTAAACCCCACCA" "44042" "1" "0.049952" "-2.3073134" "-4.04" "-0.24275133" "270627" "GGCAGTGGCTTTGATTATGGCTTCAAAATGAAGAAGACTGAACATGAATCTACAATAAAA" "11597" "1" "0.050025" "-2.306377" "-4.04" "-0.30695291" "" "AGCAACATTCCTCAGGATCCTTGGCTACTAATTGGGCAACATATGAAAGAGCCTGTATAA" "60237" "1" "0.050071" "-2.3057844" "-4.04" "-0.2938728" "81896" "TGGGACCACGGCTCCCATGGTCTCCTTGCTGTCCCCAGACTGTTGGGAGAAGGAATTAAA" "12598" "1" "0.050085" "-2.3056137" "-4.04" "-0.18149399" "237782" "GCCTCATTCACATAGATATCTAGGTAGGTTATTCCTGTGTTCCAAGAAAATAGGAAAATA" "11666" "1" "0.050116" "2.305212" "-4.04" "2.53088094" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "15557" "1" "0.050166" "-2.30458" "-4.04" "-0.22398062" "407243" "AAACATACTTCTGTATCAACACAGGCTGGCTCAACTACCGCCTAGAGGTTATAGGCTTCT" "60848" "1" "0.050171" "-2.3045143" "-4.04" "-0.25529516" "" "ACTGTCTGTGTCACACAGTGTGTGTCAGTGTCTGCTCTGATCCTGGCCTTTTGTACTGAC" "52165" "1" "0.050196" "2.3041979" "-4.04" "0.27724719" "235627" "TGACCAAGGAGCGCAGTCATGTGCTGGTGGGCCTGGAAGATGGCAAATTGATCGTTGTGG" "44872" "1" "0.050202" "-2.304117" "-4.04" "-0.25880409" "381582" "AGCACTGTTTCTTGAACACCTGTTGTCCATCCGTCCGTCTGGAGGGGAGGGATGTGTCAG" "4591" "1" "0.050252" "-2.3034742" "-4.04" "-0.77853381" "77627" "TGCTCGAGTACTATGACAAATCACTGTCTTCGAAGATTTCCTACAATGACTTCCTGCGTG" "46142" "1" "0.050257" "2.3034103" "-4.04" "0.30259386" "13139" "ACCAGCAACGCAACAAGGAACACTGAAAAAATGCCTCATTCTAATAAAGTGACTTTCTCC" "28293" "1" "0.05035" "2.3022243" "-4.05" "0.23272618" "" "GCCTGACTTTTTATTTTTGAAGGGACTTATTTTATTGCTTTTTTGACACTGTCATCTGGG" "51522" "1" "0.050366" "2.3020271" "-4.05" "0.40621963" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "28674" "1" "0.050397" "-2.3016363" "-4.05" "-0.22754275" "" "GCACAGCAGCCAGATTTCTACCATCTGCAGGCTCTCTGCCTTTTAAGAACCAGGCCTAAG" "62197" "1" "0.050403" "2.3015588" "-4.05" "0.26759585" "235627" "CAGAAGACTTTGTTCTGCTGGGCACCGCTCAGTGCTCTCTACATATCCTCCACTTGAACA" "42571" "1" "0.05041" "-2.3014667" "-4.05" "-0.20355718" "66717" "ATGGTATCCTACAGAGTTTTGATTCATTCTGCTGATTCCTACCCATCAGCTATGTAACTG" "34984" "1" "0.050418" "2.3013663" "-4.05" "1.30392987" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "51755" "1" "0.05042" "-2.3013371" "-4.05" "-0.20282918" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "53184" "1" "0.050474" "2.3006492" "-4.05" "0.34289666" "" "TCTTTGCTCAATCCCCAGGTGGGGAAATCTTCGTTGAGCAATCACTGATGTCTCTGGAAA" "55976" "1" "0.050482" "-2.3005539" "-4.05" "-0.28158916" "" "TAGGCGGTGAAAAAGTTCTATAAAACTGTTCAGAGATTTGCCAGCATTGGGGGTGGTGGA" "45942" "1" "0.050482" "-2.3005441" "-4.05" "-0.18236869" "" "TGCCTTTTCTCAATGCTGGTGCCTCTGTCTGCAAAATGGTTTATTAAAAACTGCTTCACT" "11242" "1" "0.050484" "-2.3005294" "-4.05" "-0.36242464" "319554" "CTAATTTCTTGCTAACTCTGAACAGTTGATTTATCATTGGGGATATGACTATGTTGCAAG" "25504" "1" "0.050521" "-2.3000531" "-4.05" "-0.33784904" "" "TGACGGCTCCCTGGAGCAATATGGAAGTGTTTAAGCCGGTTTGCACCGGGCAGGGTAGCT" "56686" "1" "0.050527" "2.2999749" "-4.05" "0.20939653" "258270" "AATACTCTGTCATCATGAGCTGGAAAGTGTGCACCATTATGGCTGTTGCTTCTTGGGCAT" "51468" "1" "0.050544" "-2.2997573" "-4.05" "-0.37068415" "65246" "TCATGGAAAGGTGTATGTTGTGGTTATCTGTGCTGTTCCTGGACACAAGTGTTTCATCTA" "21529" "1" "0.050598" "2.299076" "-4.05" "0.49238154" "211550" "GTCAGGTGGGGGAAGTTAGCCACATTCGTATTTTGTTTTTGTTTTTGTTTTTGTTTTTGT" "29364" "1" "0.050622" "2.2987767" "-4.05" "0.67544392" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "11949" "1" "0.050641" "-2.2985305" "-4.05" "-0.44387847" "69256" "TTTCATAGCCTCAATTCAACATTTCAGGGTTCAGTAACTCTTAAAACATGCCTACTCCTG" "42426" "1" "0.050677" "2.2980801" "-4.05" "0.36226999" "66616" "GTGCAACCATGAGTACAAAGGCTTTCTCGGCTGCTTCCCGGACATCATTGGTGCCCACAA" "58948" "1" "0.050705" "2.2977202" "-4.05" "0.31081494" "26920" "GGTATGTCTAGTTACCATGGAAAAGAATGTACTAAAAGCCCCTAGGCTTAATTAATAAGT" "565" "1" "0.050739" "2.2973001" "-4.05" "0.30533149" "67088" "TAGTGCCTCATTAGTTAGCAGAGTGAGAACTGTTTACAGGGAAGATAGTGTGGCTCATTG" "50681" "1" "0.050766" "-2.296948" "-4.05" "-0.39924219" "19401" "CCTGTACATATCCTGCGTACCAATCCCCAGATATTAATTCTCGTTGGTTTTGTTTTTATT" "26047" "1" "0.050819" "-2.2962887" "-4.05" "-0.21815071" "66895" "CTTTTACACAGTCTGTTTTTAATCTATTTTAATTAAATAAAAATCTATTGTTCTACTTTG" "13334" "1" "0.050822" "-2.2962521" "-4.05" "-0.21105091" "218772" "AATTCTGAAGGACATGAACCCTTGACCCCAAGTTCAAGTGGGAATATAGCAGAGCACAGT" "21482" "1" "0.050822" "2.2962433" "-4.05" "0.8185802" "100037283" "CTACAAAGACCCAACATTGATGTTCACATTTTGGAAATATTTTGTGTCCCACAAAGTAAG" "4302" "1" "0.050829" "2.2961642" "-4.05" "0.28779307" "" "AACAATTCTTTCTGCTCTCTCTACATTGGCTCTGCAGGCCTAGAGTATTCTGCCATGTAC" "26035" "1" "0.050835" "2.2960857" "-4.05" "1.74694096" "20715" "TGTCTCTTGTTGACCAACTACGTAGGACTGGTGGACACCTCTGCATTACTCACACAAATT" "54573" "1" "0.05084" "-2.2960204" "-4.05" "-0.20502968" "241944" "ATTTGGGTACTGCACAGTGTAAAGTATTTAAAGGAGTGAGTGTATAAGACATCAGTGGAA" "9178" "1" "0.05085" "-2.2958925" "-4.05" "-0.20857886" "" "TTCCTTATTGCCAAGTGTTGCCCTTAGCCCTGAACTGTGTTATCTCAGCTCTTACAGCTT" "8265" "1" "0.050874" "2.2955876" "-4.05" "2.47232216" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "39074" "1" "0.050967" "2.2944182" "-4.05" "1.504447" "60440" "TGGGCTAGAGAGATGGCTCAGTAGATAAAGTAGAACTTGTAAGTTTGAAGACTTGAGTTC" "57452" "1" "0.050974" "2.2943298" "-4.05" "0.30968532" "13614" "CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC" "51854" "1" "0.050975" "2.2943245" "-4.05" "2.31525372" "" "ACAAGCTCTGTCAAGTGACCCAGTTGATAATCGGTGCCTGATTCATGATTACTTCCCTTC" "50562" "1" "0.050999" "2.2940199" "-4.05" "0.61933689" "19650" "ACACTGGAGGTTTAGCCTTCTGAAGAATCAGGTCGCTAGTGTTCACCTTTTCTTCTGTGT" "34320" "1" "0.051025" "2.293685" "-4.05" "1.90531519" "15944" "AGAGAATAGCCAACGAGTCCTTGAAGAATTCTCTCGGTGTCAGAGATGATGACAACATGG" "37201" "1" "0.051044" "-2.2934525" "-4.05" "-0.38968247" "" "TTAACTGGCTGAGCAGGAGGAATAGCAGCTATGCCATTTAGGGTGTCATTTTGAAGGCAA" "46057" "1" "0.051078" "-2.2930272" "-4.05" "-0.21828466" "" "ATTCGACCTAAGTGTGTCTTCAGTTGGGTTGCACCTCCTGGCTGATTATAATAAGGTCTG" "54416" "1" "0.051099" "2.2927578" "-4.05" "0.19074359" "244180" "CTCAGTCAACACATTAAGGTGTTAATAATGGCCTGGAAGGAATTGATTAAGAAACAAAAC" "6849" "1" "0.051118" "-2.2925182" "-4.05" "-0.31828238" "77521" "TGTGCAAGACCATCCTGGTATTGGCGCTTAGGAAGGTGTAAGCAGCAGAGTCTGGTGTCC" "6765" "1" "0.05114" "2.2922541" "-4.05" "0.51331301" "" "CACTCTCCTGGGGTATTAGAGCCTTTCCTTACACAGACCCTGTTTTTGTTTTGCTCAGTT" "28182" "1" "0.051144" "-2.2921929" "-4.05" "-0.25063174" "" "" "13646" "1" "0.05119" "2.2916247" "-4.05" "0.52721072" "20499" "CTGTCCACATTCACGACGTTCCAGTTAGGGTAGAGGCCACGTTTGCACCTGCACAGGTTC" "46173" "1" "0.051191" "2.2916047" "-4.05" "0.54618899" "100040631" "ATGCAGAAGAACGGTGCTGGGTTACACTCCGCAAGTTCCTGCTTCTGGGACAGCTCCACA" "34722" "1" "0.051235" "-2.2910554" "-4.05" "-0.27370326" "" "TATCTCCTAAAATTAACTGCCTGAGAAGTCCCTGGCAGGCCACATCTAAACTCAAGGTCA" "4150" "1" "0.051293" "2.2903353" "-4.05" "1.18815502" "" "ATACCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTA" "21414" "1" "0.051295" "2.29031" "-4.05" "0.24125219" "20975" "ATTCAAAGCCCATCATTGACCGTTTTGTGGAGTCCTTCAAAGCCATGTGGTCTCTGAATG" "20756" "1" "0.051331" "-2.2898523" "-4.05" "-0.2986948" "" "GGTTTGGCTTCATACATGGAACCTGCACTATTCATGGAATTCATATTTTATGGAAAACTT" "43141" "1" "0.051353" "-2.2895854" "-4.05" "-0.21948775" "399674" "GCTTCTGCAAAGTGTTCTTTCTTGGAGCCAAATGTGGTCTTAGAATCTAGCCAGCTATGA" "44553" "1" "0.051359" "-2.2895126" "-4.05" "-0.31788595" "78102" "CGTTTGTATTCATTTTGTGTGAGTGCATGTGTGTATTTGGGTGCAAATAAAAGCCAAGGG" "51592" "1" "0.051369" "2.2893784" "-4.05" "0.22000978" "" "TTTCAAGCTACTGATTCCACCTAAGAGAGGAAGACTGCTACTTGGCAATAAAGTTCTTAA" "16062" "1" "0.051402" "-2.2889736" "-4.05" "-0.45870377" "13841" "TGTCATCATAATTGCTGTAGTGGCTGTAGCAGGGACCATCATCTTGGTGTTCATGGTGTT" "46446" "1" "0.051402" "-2.2889671" "-4.05" "-0.33422694" "12295" "TTGGAAGATGCCTGCGAGCACCTGGCTGAGTACTTGGAAGCCTACTGGAAGGCCACACAT" "10958" "1" "0.051424" "-2.2886968" "-4.05" "-0.22224761" "" "ATGTATTCAATTTCTTGGCACTTTCTGCCCGAAAAGCTGAGTAGCCTTCCCAGCACAGTT" "42991" "1" "0.051428" "-2.2886492" "-4.05" "-0.23690384" "" "TTGACTGGGTGACTCACAGTTATGGAGAAAAGACTAGAGCTGCAGTGCAAAGACTATGCA" "37112" "1" "0.051441" "-2.2884901" "-4.05" "-0.19721572" "242384" "CAAAACTGCTCAACTCTGTTAACTTCTGTTACTATAAATAAAGGCATGTGCCTAGTTTTG" "2998" "1" "0.051455" "-2.2883096" "-4.05" "-0.3474567" "233335" "AGTTCCTCCTGAGATCAGAACTTTTCCCTATAGGTTCAAACTAGGAAGCATGCACTAACT" "58063" "1" "0.051467" "-2.2881618" "-4.05" "-0.27676977" "" "TGAACATACAAACAAGATTAGTGTCCTGACTCCTGCTACGTTGGTGGGTTTCAGAGTTGG" "41969" "1" "0.051468" "2.2881511" "-4.05" "1.50053548" "16182" "TGTCACAACAGCTGTGTGTGAAAACCTAGCATCAGAAGAGAGTTGGGAGAGTTTGAGACT" "11265" "1" "0.051505" "2.2876908" "-4.05" "0.46344169" "72536" "GACAGTTTATTACTTGCTGATGTTATATCCTTTGCCTCAAATAAAAATCCGCCAAGAACA" "61689" "1" "0.051508" "-2.2876549" "-4.05" "-0.33474507" "70806" "CAAACTACGAGAATGTGATTGCCATTCAGATTGGAATAATGGAGCAAACGATTAGTGTTA" "53198" "1" "0.051533" "2.2873346" "-4.05" "1.87722522" "16912" "CAGCTGCTGGTGTGGACCATCGAGTCATCCTGGGAGATGAGCTGCCAAAATTCTACGATG" "43505" "1" "0.051535" "-2.2873097" "-4.05" "-0.22997322" "" "ATTAGTGCTTGTGAGGAAACGCCAAGAAAACGCGAGCCTTGTGATCTCAGTTCCTTCAAA" "45463" "1" "0.051546" "2.2871786" "-4.05" "0.77141239" "68655" "GAAAGTATACCCTCTTTGAGATTTATCCTAAAGACCTATCCATCACTGGGCTAAGTGCCT" "54295" "1" "0.051596" "-2.286552" "-4.05" "-0.19996381" "384619" "CCACTATACCTCCTCCGTCAGCATGGGACCCACATCCCTAAGTTGTGTTATGCGACCATG" "8939" "1" "0.051623" "2.2862151" "-4.05" "0.49422957" "12982" "TCATAAAATCCAACGTGCCTTCATGATCAAAGTTCGATAGTCAGTAGTACTAGAAGAATC" "17166" "1" "0.051735" "2.2848354" "-4.05" "0.9858248" "" "CTGGAACAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACT" "46951" "1" "0.051737" "2.2848108" "-4.05" "1.86595793" "" "GAATGCCTCTCAAGATATATTCAGAAGTTCTGTTTGGCTAATGGGTACTTAGTTACTAAA" "32327" "1" "0.05177" "2.2844023" "-4.05" "0.34127474" "630322" "ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT" "38203" "1" "0.051808" "-2.2839235" "-4.05" "-0.35532816" "214791" "CCCGTGGCATGCGTTATATTTTGACCTGTTTTTGCATCATTTCATGCGTTTAGACTCTTA" "7115" "1" "0.051843" "2.2834968" "-4.05" "0.51687646" "100503847" "CATGGCCAGCAGCCTGTCAACAGACTATTTGTAATGTTGCTACCTTTAAATATCGATGTC" "51623" "1" "0.05186" "-2.2832792" "-4.05" "-0.5691181" "269784" "TGTACGCTGTCAGCCATCAGTACAATAATGATTTCTCTCACAGCCAGGTCTAGTTTATGA" "5673" "1" "0.051861" "-2.2832774" "-4.05" "-0.22319555" "69792" "TAAAATCTGAGGAGAAGGAGAGCACAAAGAACATTCAGCAGACTGTGAGCACTAAAGGTC" "59514" "1" "0.051866" "-2.2832129" "-4.05" "-0.19540993" "" "ATGGCTGCCACCATCCTCTGCTAACACCAGCCTCCACTAGCTTTGATCTTTTAATGCAGA" "18732" "1" "0.05189" "-2.2829196" "-4.05" "-0.23888897" "224617" "TTTTTTCTGACTTTTCTACCAAAAGGTGTGTATTGTTTTCTTTATATTTTTATTCTTATC" "35630" "1" "0.051912" "-2.2826442" "-4.05" "-0.27638951" "" "GGAGAGTTCCTTTACCCTTCTGTGTTAGCCTCTTAAAGTACTGCGACAACCTTAAAAGGG" "43717" "1" "0.051926" "2.2824696" "-4.05" "0.65347259" "26382" "CCACCTGATGTCTATACCGAGACAATTCATCCTGACTCTGTATCCAGCAGACACAGGCCC" "29600" "1" "0.051937" "-2.2823328" "-4.05" "-0.41200946" "" "TCATTCAACCACAGTAACCCAAATTTCATATTCTCTGCACCTGCTCTAAGAAGAAAGAAA" "16584" "1" "0.051942" "-2.2822763" "-4.05" "-0.30775096" "19088" "CTTGTGTGTTAGCCTTGGCCTATTGGTAAAATGGTGTGAAAATCATATGCAATTTTGAAA" "51305" "1" "0.051949" "2.2821816" "-4.05" "0.26995696" "" "CCACAGCCATGCTCTATCTACTGATGAGATTTTAAGTTCAGTTTATAGTTTATTACCTTC" "48830" "1" "0.051959" "-2.2820635" "-4.06" "-0.28268663" "27274" "ACCTGCCAGTCATTTTTAAGACCAGACACTTAACTGTAGCAGACATTGACAATGGCCATT" "28571" "1" "0.051977" "2.2818408" "-4.06" "0.34209871" "75547" "AAAGAAGCTGATTGTAAGAGAAGTGGCCCATGAGGAGAAAGGCCTGTTCCTCATCAGTAT" "33800" "1" "0.051991" "-2.2816669" "-4.06" "-0.40374974" "381820" "CTCATGTGGATGAATATATATTGTTACAGGCTTGGCATGGAATTGTCTCTGTTATTTGTT" "4836" "1" "0.051992" "2.281654" "-4.06" "0.63389011" "104816" "CTGCTTCCCAGCCTTTCCGCACGACAATCTGAAGGTCTTTGTTGAGAAGAATGTCAATAA" "16958" "1" "0.052011" "-2.2814183" "-4.06" "-0.24101113" "74528" "CTAGTAGCATTAAAATTATAAGTTACACAATCACATTTAGTTTTCATTAGTCTTAAAAAA" "24191" "1" "0.052011" "2.2814181" "-4.06" "1.04000167" "78826" "CACCAAAAGGAGGAATTAAAAGAAAATTTCTTGGTTTTGGGGGAATGAGATAGTTCTGTA" "62678" "1" "0.052092" "2.2804236" "-4.06" "0.8582155" "" "" "9789" "1" "0.052125" "-2.280017" "-4.06" "-0.29708691" "226539" "ACTTTAGAACCAAATGTCTGTGTAGAAGCAATCATTACCGAGTAAGAAAGAGAAGCTACA" "32167" "1" "0.052127" "-2.2799983" "-4.06" "-0.20735292" "16911" "ATTGTATCTCTGTAAAATACAATGTATGTATGCATGTGAGTGTTCTTGTCCTGATGTTGC" "52457" "1" "0.052145" "-2.279768" "-4.06" "-0.17651912" "" "" "5466" "1" "0.052253" "2.2784462" "-4.06" "0.28011732" "" "AGAATCAACAGCCTCTTGATCAAATAGACATGGTCAAGGAGAGATTCTCAGCTGTGTGCC" "38258" "1" "0.052267" "2.2782772" "-4.06" "0.30914978" "28080" "AATTGGGGAGAAGTACCTTGTTATGTCTGCAAAGAGCAAGATTCAGAAGCTCAGCAAGGC" "35224" "1" "0.052287" "-2.2780285" "-4.06" "-0.22844576" "" "TGTAAGAACTGTCACCCTGAAATCACTGCTGAGAACTCCAAAGTTCTGTGAAGATGCCCT" "60345" "1" "0.052288" "2.2780104" "-4.06" "0.40776166" "14268" "GGTGATTATTTTTATAAGCACATGCCAACGCTTTACTACTGTGGAAAGACAAGTGTTTTA" "18022" "1" "0.052313" "-2.2777038" "-4.06" "-0.25953802" "67311" "GCGTGAACATGACATTGTTATAGTTTGGTGAAAAACTATTAAAAATCAAACCGTGGTGCT" "51914" "1" "0.052365" "-2.2770704" "-4.06" "-0.29025191" "68870" "CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT" "45824" "1" "0.052368" "-2.277033" "-4.06" "-0.2147716" "" "CGTGGCTGGAGGATTTGGTGAATGCCTTAATAAACTTGGTACTTAAGTAACTGTAATTAG" "33074" "1" "0.052378" "-2.2769133" "-4.06" "-0.23257374" "240665" "CTGGACAATCATTAAATGTGTACTGTGAAGAGATTAATGATGTGTGTAAAGGACTTAACC" "17328" "1" "0.052401" "-2.2766263" "-4.06" "-0.21261965" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "22427" "1" "0.052402" "-2.2766137" "-4.06" "-0.19734373" "13664" "CCACAGCTCAATGAAAACACGGTTCCTGTTTTCTAAATGGAGGCGCCCAGAAACACAATA" "2035" "1" "0.052423" "2.2763588" "-4.06" "0.32202729" "" "AAGTGAGACAGACGTGCTTCAAAGTTCTAATGAGCGTCACACCGGAAGCATTAAAAGGAG" "39212" "1" "0.05243" "-2.2762775" "-4.06" "-0.3568331" "" "TTGAATATGTGTTAACCATCCATATTAAGAAACTGGTGACAGAAACATACGTAAACTGGC" "24362" "1" "0.052486" "2.2755871" "-4.06" "0.32717708" "" "TTGCTGCTCATTCAAGACCAAGAAGAACTGGTAAGTGGTGTCACTGAAAATGGCAGCTGT" "16948" "1" "0.05251" "2.2752944" "-4.06" "0.40256358" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "39446" "1" "0.052516" "-2.2752197" "-4.06" "-0.18945744" "15289" "TTGAGATTATCGTTCTCTTAAAGTGCCAGTGTTTTAAATAGCGTTCTTGTAATTTCACGC" "19013" "1" "0.052519" "-2.275193" "-4.06" "-0.25530979" "" "CAACTACTGGTACTCTCTTGGCTGCTGTTGGCCACCGGGTCCAGAGCGTAAACACAAAAC" "16602" "1" "0.05253" "-2.2750495" "-4.06" "-0.24619164" "" "TCATGCCCAATCGATTCACTATTCATCTTGATTCCATCATGAAGGTAAACTAAATTGCCA" "53995" "1" "0.052541" "-2.2749214" "-4.06" "-0.25743512" "" "CCCTCTTACCCACCAGGGACCTGCCAACCCTAGCTAGAGTGACAGGAGGCAGCTGTGACA" "36742" "1" "0.052565" "-2.2746268" "-4.06" "-0.23099912" "56525" "GCCCTGAATTCATTGAGGAAAGAGCTTTTTATTGTAATCACTACTGCAAATGTTTTTGCA" "45727" "1" "0.05262" "2.273953" "-4.06" "0.50953565" "209837" "CCTAGATGAAGCTGTTAGGGTTACCCTGGCGCTAAAAGGGAAGAATAAAGATGCTGAATG" "10448" "1" "0.052653" "2.2735527" "-4.06" "0.1907841" "16517" "TTATAACATGCTTTGACACGCCTGATGGCTTACTTAATAAAGATCTTAGACTGGTGCAAA" "53804" "1" "0.052722" "-2.2727131" "-4.06" "-0.24357186" "73451" "TAATTTCAGTTCAGTGGGTGTTGTTTAATGAAGTGAGGCAGTGCTTTTTCTACTTTACTG" "7084" "1" "0.052724" "-2.2726874" "-4.06" "-0.25882407" "240261" "CCCAGATGTTTTTATCATGGCTTAGTGATGTAATTTGGGAAAATCAGTCTTTTTTAAGCC" "61100" "1" "0.052756" "-2.2723081" "-4.06" "-0.18541011" "" "GTCAGCTGCCAGGGATATGGGTGTTATTTTAATTTTTAGGGGGAAAGTAGTTTTATTTTA" "29632" "1" "0.052758" "-2.2722831" "-4.06" "-0.17265294" "67337" "ACACTAGCGTTTGAGCCGTTGCACACGTCCAGAATATCACACACTCATTTTTGTCACAGA" "61800" "1" "0.052785" "2.271944" "-4.06" "2.4404963" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "58702" "1" "0.052791" "-2.2718712" "-4.06" "-0.2226109" "22763" "AAACTTATTGTACAGTGTCAGGTATTATATGGGTGGAAAGAAAGAGATTTGACTAGGGGG" "48008" "1" "0.052815" "2.2715881" "-4.06" "0.56878409" "100040563" "GGTGGAAACAGCTCTACTTTCTGAAATGATTCAGATACACTAACTTTCCATACTTTATTC" "31311" "1" "0.052825" "-2.2714679" "-4.06" "-0.18897963" "68032" "TGTGGTGAGGCCAGTGTGCAGCATGTTACAGCAGAAAAGAAACTACAGCACAACTTATGA" "21771" "1" "0.052828" "-2.2714287" "-4.06" "-0.20690472" "" "AAGAAATGATAACCCTTTTCCACAGAGGAAAAAGTGAATGGAATGCGGTTTGTACATTTT" "21186" "1" "0.052876" "-2.2708405" "-4.06" "-0.35186446" "" "ACACACTTTATGTTGGGATTTCCTCTGGAGAGCAAACTTGCCCTCTTACATCAGCAGTAG" "44156" "1" "0.052884" "-2.2707518" "-4.06" "-0.21568731" "226841" "GGTTCATTTTTCAAGGCAGAGTTAGTCACAGAAACATCTAAAAATGTTTGTCTTTGTCAC" "41200" "1" "0.052918" "2.2703314" "-4.06" "0.49131643" "14191" "TTGGAAACCAGGAGAACAGGATATATGGAGTCTCACCTCTCCTGTCAGGAAGTGTTTATT" "57287" "1" "0.052956" "-2.2698792" "-4.06" "-0.18466328" "" "GGAGTTGTATAAACTTTCCTGGAGACTGAATTGATCTATTTCAAAGAGAAGCTGTGAAAT" "51455" "1" "0.052994" "-2.26942" "-4.06" "-0.19118056" "53975" "CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG" "45175" "1" "0.053025" "2.2690436" "-4.06" "0.27157847" "16992" "AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC" "30711" "1" "0.05306" "2.268617" "-4.06" "0.47883842" "50723" "TAGATGGGGCATAGTGACTTCTAGAAACCTAACAAGGGAATAAATGTAAGATGTGCTTTC" "55222" "1" "0.053067" "-2.2685344" "-4.06" "-0.20293128" "" "GCTTTGCTGTTTGTTATGGTGTTTCCCTTTTTCCTGTATCTTTTAATGGTCGCAATAAAA" "52412" "1" "0.053139" "2.2676621" "-4.06" "1.85808949" "16994" "ATCTGTATTCATTCCTGGAGGATCGACTGACGGTGCGAATGTGTGAATCGTGATGTCCGG" "21035" "1" "0.053215" "-2.2667485" "-4.06" "-0.2044995" "237859" "AATAAAGATAGTAATATGCTACTGCATTTAATTCAACATTTACTTAACTATAAAGGTGAT" "54353" "1" "0.053217" "2.2667179" "-4.06" "1.50859859" "15978" "CTTCCCTATACAGCTGAAAACTGTGACTACACCCGAATGACAAATAACTCGCTCATTTAT" "3688" "1" "0.053253" "-2.2662921" "-4.06" "-0.36558857" "70546" "GTCTTGACAAGGAACTTACATCAGAAATGTACTTTCATGTCTTCTCATTTGAAATCAGAG" "59778" "1" "0.053275" "-2.2660281" "-4.06" "-0.3048419" "" "CTTCAACACGCTGATAAGGAAAAAGAGCAAACTGGGAGACCTGGAGGGAGCCAAGGTAAG" "10657" "1" "0.053284" "-2.2659124" "-4.06" "-0.26779925" "217716" "GTTTATTTCTTTGCATCCATGCACACAGGAGCTTGACATATAATACCTATCTTTTGTAAG" "48041" "1" "0.053293" "2.2658056" "-4.06" "0.24988625" "67946" "ATTTTCTACAACTTCAGTGATCACTGAATGTCTGATAAGCTCAAGGAAGTGCCGCACTCA" "19011" "1" "0.053314" "-2.2655506" "-4.06" "-0.306155" "" "AGGAACTAGCACAAAGGGTTTGGAAAAATACACCCTAGAAGCATAACCCTGCATAGGCTG" "51501" "1" "0.053343" "-2.2652064" "-4.06" "-0.1985195" "" "CTTCTCGATGACACATTTTGTCAAAAAGCTTGAATGTTCAATGGAAACAGTTCAGTTCTG" "50541" "1" "0.053367" "-2.2649157" "-4.06" "-0.19801947" "" "GGACACCAGTCTCACCATTTAGGGGTCCACTATGTTTTTCAATTAAAATGCAATTATATT" "6747" "1" "0.053379" "2.264772" "-4.06" "2.47878862" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "2338" "1" "0.053398" "2.2645505" "-4.06" "0.20301993" "666914" "GATTCTAAATTCCAGCATGGCTATATTGTTATGGCACACTTCAAGGAACACCAGCTCCTG" "36564" "1" "0.053452" "-2.2639015" "-4.06" "-0.75902184" "13590" "CTTTCATGCAAATCTGAAGTGCTCATTATACTGGGAGAGCTGGGGATTCTAACTCCCTAA" "30352" "1" "0.053459" "-2.263816" "-4.06" "-0.17758862" "" "GGTGTGTGAACCAGACTGAACCATAGCTCAGTTTCCTTTCCAAGTTGCTACTTCTTAATG" "39863" "1" "0.053469" "-2.2636962" "-4.06" "-0.27932821" "242748" "TAACTGTTGGCACCACCGGGTCCCAGAGGCACCAACTCCCGTGAATAGAAGCTTGACCTT" "31396" "1" "0.053492" "-2.2634166" "-4.06" "-0.39144715" "13121" "AGGTTCCTTTTAGTATTATCTTTGGTTATTTAGGTAAGTCACTCTTGTTATCAATGCCCC" "23522" "1" "0.053496" "2.2633674" "-4.06" "1.58709483" "74748" "GGGGTCTGAGTTCCTTGTGTTCAAGATGTTATTATAAGAAAAGGCAAAGAACAGGAAATG" "15605" "1" "0.053507" "-2.263236" "-4.06" "-0.28038566" "67422" "TTCCTGAAGGCCTTGGAACTTAAACGGGCCAACTGGCTGGCACTTTGGGGCACTGCATCT" "19170" "1" "0.05352" "-2.2630862" "-4.06" "-0.28746117" "229227" "TTGCTCAGACCAAGACCACAGCCATTGTGGAAGTGAAAGGAACTGTTGATGTTGTTCTCA" "10730" "1" "0.053541" "2.2628282" "-4.06" "0.34495336" "53313" "ATTTTATATGTAAATCAAGATTCACATCACTGTCCTGACCCCCAGTAACAAAAGCCCCCT" "2063" "1" "0.053578" "2.2623929" "-4.06" "0.49478602" "217578" "GCAGATAGATATCTGGGTTTGAGGCAAGCATCGTCTACAGTCAATTCTGGACATTGAGGG" "56509" "1" "0.053618" "-2.2619095" "-4.06" "-0.24391774" "232533" "TTTTTAAGCAATATAATCCAGCAGTTGTCCAGAACCATCAGGCTTCTGAGCCCATCCAGC" "48207" "1" "0.053642" "-2.2616279" "-4.06" "-0.46966088" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "34212" "1" "0.053661" "2.2613932" "-4.06" "0.60066992" "14247" "TTTTCAGGTAATCGTGACTTTTTAAACGATATTGTTAAGGTGACAACTCTTAGTCCACTG" "26603" "1" "0.053672" "2.2612645" "-4.06" "0.45596744" "" "GAAGATCCAGAGCACGCAACCCCAGGACTCAGCGGTGTATCTTTGTGCAAGCAGCTTAGA" "32876" "1" "0.053722" "-2.2606672" "-4.07" "-0.21914911" "93683" "TTGTACATGTGGGGTATATGCCATGTGTCAAATATGCAATAATGTGTTTACTGGATGCCC" "42565" "1" "0.053753" "-2.2602951" "-4.07" "-0.24582776" "66634" "GCAGGCATTCAGCTAATGCAAAAACAGATTAGTATGTGTTCAGGTGAACTTTTACTTAAA" "29495" "1" "0.053813" "2.2595818" "-4.07" "1.58359919" "83408" "CAATGCGTGCTTTAAAACTCGGCGTTTCAGCCTAATAAACAGAGACCTTGATAGGAAAGA" "5286" "1" "0.053834" "2.2593294" "-4.07" "0.87056207" "667597" "TCCCATTCTGACATCTTTTCGTTATACTAGTCGATCTACTGTATCTATGGAAGAAACCCC" "35915" "1" "0.053838" "-2.2592805" "-4.07" "-0.23157774" "110084" "ATGAGACGTTTGCCTTATTTAATGCCATTCTCCAGCTGCAGCCCAAATCCTCTTCTATGG" "2840" "1" "0.05384" "2.2592612" "-4.07" "0.22203202" "56552" "AACAATCACATTCAGCATGCTGGTTTTCTGCAGTGTGTGGATTTCTTTTGTACCAGCTTA" "7917" "1" "0.053875" "-2.2588441" "-4.07" "-0.20680819" "67781" "CCCCAAAATATGCATCAGTGTGACCATGTCCTGAACCCTTTGAAACCATAATAAAATAAA" "54440" "1" "0.053905" "-2.258492" "-4.07" "-0.24023883" "" "CAGCTCTGGCACATCAGCCATGTGGACTTTGTGAGAAATGGCAATATGCCAGGTTGCTAA" "8238" "1" "0.053965" "2.2577713" "-4.07" "0.78965022" "" "CTGTTGAAATACCAGTCTTATAAAGACCAGCTCTTAATTCTAAGAAATGGTGCTTTCTCA" "18487" "1" "0.053982" "-2.2575719" "-4.07" "-0.22261791" "" "AATACATGAATTCTGGCTTGGTCCCTGTCTTTGACTAGACAAGAAAAGAAAGGGGAAAAA" "13828" "1" "0.053984" "-2.257548" "-4.07" "-0.24310699" "15182" "TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC" "60902" "1" "0.054019" "-2.2571266" "-4.07" "-0.39951522" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "13665" "1" "0.054036" "-2.2569326" "-4.07" "-0.20506329" "" "ATTGTTGACTAAACTGTAGCTATGTATGTCTCCAAAAGAACTGAGTATTTGCAAACAGCC" "55485" "1" "0.054167" "2.2553834" "-4.07" "1.40597962" "20737" "CGTGGGGTCGGGAAAATTAAATGATCTGTAAATACATCTGTAAGAAGCTACATCCTGCGT" "34970" "1" "0.05426" "2.2542789" "-4.07" "0.20470189" "380918" "TTCTCAACACTTCACTGGCTCAGCTCTTCTCTGACAACGGCAGCCTCGCCATTGGAATCG" "17245" "1" "0.054263" "-2.2542435" "-4.07" "-0.20946445" "" "TGAATATACTACAACAGTAGAGTTGTGAATCTCATGGCTCACATGACCTCCAAGGAGTAA" "18861" "1" "0.05427" "-2.2541618" "-4.07" "-0.21048524" "22762" "GAACTTTATAACTCACAAGAAGTTTTATTGCTCATCACATGCAGCAGAACATGTCAAATG" "42763" "1" "0.054347" "2.2532455" "-4.07" "1.03057402" "19260" "ATGTGACAAACTTCCAGCAAACTTGTATTTTCATATTCCTTATATTTCACTGGGAACTGC" "61857" "1" "0.054442" "2.2521266" "-4.07" "0.24670251" "245525" "GGATATGCATCATACTGAAGGAAATTTGTTAGAGCTAAATTCATTACTATCTAGGAAGGC" "1599" "1" "0.054487" "2.2516019" "-4.07" "0.28452361" "" "AAAGGGAGTATCCTTGATACCTCAAGATGAGCTCTAGGAGGCTCTGGATGAACATATGAG" "26790" "1" "0.054488" "2.2515904" "-4.07" "1.17481982" "19265" "CATGCATGTTATGGTGAAACACAAGCTGCCCTGGACCTTCGTCACCCCACCCTTACATCA" "2754" "1" "0.054491" "-2.2515545" "-4.07" "-0.23956857" "" "TTGTTGGGCTACTTACCAACCAGGAATCATTTATATCCTCTGACCCACAAGTCCACATTC" "34070" "1" "0.054493" "-2.2515258" "-4.07" "-0.31823007" "" "" "407" "1" "0.054506" "2.2513739" "-4.07" "2.42892338" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "29324" "1" "0.05452" "-2.2512173" "-4.07" "-0.36344296" "" "CTCAATATAGGTCTCTGTTTCTGTGGACTACATATTGACAAAGTGGATATAACGATTGTA" "55638" "1" "0.054525" "2.2511489" "-4.07" "1.34853002" "13041" "AGTAAAGAAGGCACGGACCTCTTGTCCTCCCTGAAGGCAGCAGCCACTCTTCTGCTTCTC" "24106" "1" "0.054574" "-2.2505826" "-4.07" "-0.27339087" "100042588" "GGAATAATACAGCAATATGTGATTGATTGCTACGGCTGCTCTCACCAAGTTGCCCTGCAT" "12164" "1" "0.05458" "2.2505032" "-4.07" "0.19425692" "442825" "TAGCAAGTTAAAGACTTACAAGAGGATAACGAGGAAGCGTCAGTGCGTGGTCGATGGACC" "60407" "1" "0.054594" "-2.2503444" "-4.07" "-0.227193" "68176" "AACAGGGGCCGCAGTCGGCAGCCCCTGGTGCTAGGGGATAACTGTTTTGCTGATTTAGTT" "6836" "1" "0.054606" "-2.250197" "-4.07" "-0.24370022" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "20306" "1" "0.05461" "-2.2501539" "-4.07" "-0.18286403" "51812" "AGATCACCCCACAGTGAGGCGGTAGCAGAAACCAGGGTATTCTCCAGCCTCAGTTTCCCT" "43207" "1" "0.054753" "-2.2484772" "-4.07" "-0.1950328" "" "ACAGAAACTGTAACTATTACCCTCAACACCACCTCTGACTGAGTGAGCTTTAAGCTTCTT" "14062" "1" "0.054771" "-2.2482725" "-4.07" "-0.19249944" "74270" "AGAAGCCAGCCTTGTGCAAAAGTTACCAGAAGTTGATCTCTGAGGTGTGGCACAAGAAGC" "1926" "1" "0.05478" "-2.2481585" "-4.07" "-0.20726118" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "16025" "1" "0.054786" "-2.2480895" "-4.07" "-0.31604055" "" "GGATCTGTGATCCCAGGTAGAGGTAGCAGCATTCATTGGAAACTTTCATATCTAGAAATA" "60160" "1" "0.054808" "2.2478392" "-4.07" "0.33462649" "70375" "AGCTTACAGCATTAAGATGGTAACTTAAGTGTGCTCTTGCTCTCTCTTGAGCATCTATAA" "6874" "1" "0.054813" "-2.2477754" "-4.07" "-0.19771549" "380711" "TCTATGAGGAGGAGGAAGAGGACAGCCTGAGCCCCAACACATTCGGCTACAAGCTCGAGT" "14375" "1" "0.054821" "-2.2476864" "-4.07" "-0.22748638" "" "ACTAGCCAGACTTGGATTTTCTGGAAAGATTTAAGCTGAGGAACTGGTACAAAAATTATA" "8429" "1" "0.054824" "2.2476431" "-4.07" "0.19151924" "" "AGAGCTAAGACATACTTTCCCTGGAAAATGCTGGGACTTTATTAGGCTGGAAATAATAAC" "32253" "1" "0.054826" "2.2476186" "-4.07" "1.30326007" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "54537" "1" "0.054906" "2.2466939" "-4.07" "0.45086489" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "36673" "1" "0.054988" "2.2457357" "-4.07" "0.2980986" "12368" "ACCAAAAAGCTGCATTTCTGTCCCAAACCTAGCAAGTAGGGCCATCTGTCTTGCTACATA" "48129" "1" "0.05499" "2.2457117" "-4.07" "0.22013161" "" "" "5381" "1" "0.055011" "-2.2454654" "-4.07" "-0.34638919" "" "GATGGACATTCTACCCCTGAGACCAATTTCGATCAAATACTTTTGTCAATAAAAAGATAC" "3072" "1" "0.055013" "2.245442" "-4.07" "0.31488216" "" "AATGTTTCCTAAACTGAAACCTGATGACCTGCAGGCTATTAACACTTGAGAAGGCCTAAT" "7962" "1" "0.055039" "2.2451311" "-4.07" "0.17277422" "80857" "CAAAGACCTACTGATGTACACTTGATGAATCTAGAGCCATTGTTTAAAAATCACAGTTCC" "43458" "1" "0.05506" "-2.244893" "-4.07" "-0.27251415" "75805" "GTTTCAACTGGCCTAGTATATAAGTTTTGTGTCTTGCACTAGAAGCTCAAATGTCAAGTC" "6437" "1" "0.055113" "2.2442724" "-4.07" "0.32878658" "" "TAGGCACTCCGGCAAAGCCACTAGCATCCCGGTTATTATCCCGCGCTTCTCCTGCGCCAG" "62077" "1" "0.055123" "2.2441591" "-4.07" "0.67222447" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "36457" "1" "0.055167" "-2.2436435" "-4.07" "-0.17305234" "" "TCATCTTTGTGACATTACATACTTTCACAGCGCCTTGGGCTTATTTTCATTTCGACTGTG" "24742" "1" "0.055175" "-2.243559" "-4.07" "-0.59715932" "" "" "6240" "1" "0.055212" "-2.2431284" "-4.07" "-0.24352143" "75712" "TCTATTCTCAGCACATCAGCATCCTGACACAATGCACTCAGTGTTGAAATAAAATGCATC" "308" "1" "0.055221" "-2.243016" "-4.07" "-0.34517806" "18045" "TTGTGTATGTGCTGTGGTAGTTCTAGCTCTATCAAAAATGGCTTATTGTATAGTCTGTCC" "36875" "1" "0.055224" "-2.24299" "-4.07" "-0.20794118" "" "GGTCTCTGTGGGGAAACTGAAACATGGCATTCTTAACTAAAATTACACTCCATTTTAATT" "9317" "1" "0.055237" "-2.2428293" "-4.07" "-0.52083595" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "61831" "1" "0.055253" "-2.2426492" "-4.07" "-0.17386597" "269470" "AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG" "60417" "1" "0.055322" "2.2418441" "-4.07" "0.22577461" "" "AGAAATGGAGAGAAAGGGAAGACATTTAAAATTGGAAAGGCCAATAGTTTCTTCTGTGTC" "48511" "1" "0.055375" "-2.2412283" "-4.07" "-0.1852465" "" "GGCTTGTCCCTTTATGAATCAGATACAAGAGGATAAACTTTGCATATTAGTACATACCAT" "11418" "1" "0.055385" "-2.2411191" "-4.07" "-0.30009107" "" "AGCAAAAGCATGGGTTAACTCCTACAACTCATCCAAGAGCAGCTGGTCGAGAAACCAAAT" "3898" "1" "0.055394" "-2.2410084" "-4.07" "-0.27259957" "407803" "TATCCTTGGGTTTCTCAAAATGGGTTTCCCTGAAATAAAGGTTCCCCCATCTTTTCACAA" "32682" "1" "0.055399" "-2.2409568" "-4.07" "-0.18474858" "" "TTGACTAATCATCCTCAGAATAAACATTGTCATTTGCTTATTGTCATCTTTTAAAAGCAA" "47926" "1" "0.055437" "-2.240511" "-4.07" "-0.30217865" "68870" "CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT" "15990" "1" "0.05544" "2.240484" "-4.07" "0.19346055" "" "ACATAAGTGAACTATCATCCTGAATTTACCCTTGCAACTTTCCATTTTGACCTACATTTG" "23917" "1" "0.055456" "-2.2402994" "-4.07" "-0.17826061" "19046" "TTTTTTGTTTGTTTAGAGACAGAGTCAAGTCCAGGTTGGCTTCCAGCTCTAGTCTCCTGC" "58977" "1" "0.055506" "-2.2397219" "-4.08" "-0.32345572" "73100" "AGTTTAGTTTGCCCAAGTTCCAGGGTAATTAATCAACTGTAAAATAAATGCAACAGGTAC" "30325" "1" "0.055635" "-2.2382333" "-4.08" "-0.27551074" "" "" "45982" "1" "0.055644" "2.2381255" "-4.08" "1.51233077" "671535" "CTTGGTTGGACCGCGCCCTAGAGGGGTTCTCTGTCTTTGAATAAACCTGTACTTGAAACC" "24265" "1" "0.055735" "-2.2370785" "-4.08" "-0.2069193" "18390" "GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT" "44619" "1" "0.055744" "-2.2369692" "-4.08" "-0.40165495" "109593" "TTGTGTAAATGTTGTCCAGATTTCTCCCTAGGAGATGAGGGCTTTGTGTCCGTGGTTAAT" "28623" "1" "0.05578" "-2.2365584" "-4.08" "-0.60268487" "64452" "TCAATGTCATCCTCCTCTTGGCTGTAGCAGCGTTTTTCTATGGCTATTTTGCCTGAACTC" "38128" "1" "0.055791" "-2.2364302" "-4.08" "-0.26663665" "" "AAACGAGCGGACTTCACTGGAGCCACCTCTCAGGCTCAGCACCATATTGCCACTGAGTAG" "26461" "1" "0.055797" "-2.2363591" "-4.08" "-0.21242977" "" "GGAGTAATTATCTACTTGTTGTTTATAGGTCTGGCTTTTTCACCCAAGAAACAATCTGAT" "21800" "1" "0.055798" "-2.2363563" "-4.08" "-0.2749841" "21405" "TTACCTGTGGTATTAACAAGTCAACATGTTACAGACAAATGTGGGGAGAGGAGGAGGTGG" "5857" "1" "0.055805" "2.2362782" "-4.08" "0.18868156" "" "ATAGAATGTTCACATCATGAGCTCCTACATCCTCTGGATGCAAAAGCCGAGACTCTCGAA" "43775" "1" "0.055806" "-2.2362575" "-4.08" "-0.18376456" "19016" "GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG" "6610" "1" "0.055832" "2.2359573" "-4.08" "0.27421443" "100505017" "ATAAAGAGTGAACAATGAAGCCATCATTCCGTAGGGTTGTACGGCTAAGCACTGCACAGA" "47126" "1" "0.055843" "2.2358413" "-4.08" "1.49247527" "12263" "TCTCTAGTGTGGATGACCCGTGCTCCTTTTGCTTTCACACGGAATTTCCCAGTTATGTAA" "29851" "1" "0.055851" "2.2357458" "-4.08" "1.08072854" "668139" "TTGATCTTTGTTCTAGTGTTGTAGCAAGTGATTCTTTCTTCATTTTACATGACCGCCGGA" "31919" "1" "0.055878" "2.2354387" "-4.08" "0.25309789" "217258" "TATTGTGGCCTTTCAGAATTCTGGAGAGATGGGTTTGTGGCTCTTCAAGCTGCCATTAAC" "56431" "1" "0.055891" "2.2352792" "-4.08" "0.22618177" "" "" "28499" "1" "0.055918" "2.2349759" "-4.08" "1.21251224" "223672" "AGCCCACGCCCATCCTCAGGCATGTCATTGTCCCCTAAATAAACCGTTTCTGTTGTTCCT" "21137" "1" "0.055952" "2.2345865" "-4.08" "2.43520632" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "42733" "1" "0.055966" "-2.234423" "-4.08" "-0.37167231" "433022" "CCATATGATGTGTTTCCTTGTGTTTGACTTGAGCCAGTTAAAAAGGTTTAAACCTAGTAA" "48595" "1" "0.055968" "2.2344059" "-4.08" "0.5175546" "" "CTCATTGGATAAATAGGCCACTTGTACATGTATCTACTCTTTGCTTCCCTTGCTTGTAAC" "35180" "1" "0.055975" "-2.2343187" "-4.08" "-0.18395724" "" "ACGAGTATGGCAAAGCTTTTATTCATTGCTTAAACTTTTTGCAGCACCGCAAAAACTTAT" "30369" "1" "0.055983" "-2.2342347" "-4.08" "-0.18279522" "67434" "CCTGAGCATTCTATACACTAAGAGGTCAGTTTACCTAGAAGTCACCCTTAAAGAACCCCA" "29199" "1" "0.056002" "-2.2340105" "-4.08" "-0.29226273" "319909" "GGGGTGGGTAGTAAGTGAATGTGCAGAGTCAAATCTAAGACATCGTTTTCAATGGCTTTA" "30954" "1" "0.056068" "-2.2332571" "-4.08" "-0.19699011" "72117" "GACGAACAGAATTGCATTACGTAAAAGGCTTAGATGGACTTGTAACACATTAAGTGTATT" "39069" "1" "0.05608" "2.2331147" "-4.08" "0.96098174" "209200" "CATCCAGTGTGCACATGCAAATTCCACGTGGTGGAGGGCTCAATGACATTTGGATTTTTT" "50137" "1" "0.056101" "-2.2328851" "-4.08" "-0.19433211" "" "GTAATGGCTCACAGCTACAGTGAAGGCAGGCACGGCCTTGCTCATCAGACTGCGTCAGTT" "27467" "1" "0.056144" "2.2323831" "-4.08" "0.21583565" "98396" "TCACCTGAAATCAGAACTGTCGAATTGGACAGATTCATAGAGATTGTCTAGTTGGGGTTG" "25835" "1" "0.056168" "2.2321168" "-4.08" "0.40859972" "" "GGGAAAGGCATATTTTTTGCATGTACAAACAAACCTATACACGTGAATATTTACATTGGG" "37427" "1" "0.056178" "-2.2319993" "-4.08" "-0.18674636" "70769" "GTTGTCAATTGCCTTCCTGTTCTGTGGGTCTTCATACTGAGAGATTTGTATATTTTATAT" "6835" "1" "0.056196" "2.2317918" "-4.08" "0.29674621" "56229" "CACCCAGATTATATGTGTGCGCGCGCATGTGGTTTTGATTAATCAGGAAGAAGTGGTTTA" "17187" "1" "0.05621" "-2.2316391" "-4.08" "-0.24391427" "" "TTGAAATGTCAGCGCCCACGTGCCGTTCTGAGCTCTGAGGTGCATAGCCACCCAAATCTG" "24483" "1" "0.056224" "-2.2314774" "-4.08" "-0.17063384" "68051" "AGTTCACTCCTCCAGATGCTCCAAATATCATACACAAACGAGCAGGGCCGAGGCGGGAGC" "12319" "1" "0.056224" "-2.2314766" "-4.08" "-0.22181455" "381694" "TGTTTATGTCCTCAAGCCCTCTAAACAAGTCACCTGCAAAATGTGTTCTCCTCCTTTCTA" "22815" "1" "0.056256" "-2.2311115" "-4.08" "-0.18379316" "" "TCTCACAGAGGAATGGTGCCTTTTCCACATTCAGCTTCAAAAACTTGGTTTCAAGATGTT" "28508" "1" "0.056278" "-2.2308533" "-4.08" "-0.40276805" "" "" "47374" "1" "0.056283" "-2.2307974" "-4.08" "-0.22752636" "" "ATTTCTTGCGTTGGAAGGCCAAATTTGATACAGAACTCCTGGAAATTAAAAAGAAAGGAA" "61879" "1" "0.056329" "2.2302812" "-4.08" "0.27394074" "17172" "CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA" "35838" "1" "0.056356" "2.2299672" "-4.08" "1.03667638" "80285" "GCCTGTTATTTTCTAAAATGATAGCACAAACTAGGACAACAGGATGATTTCAGGTTTTCT" "27410" "1" "0.056409" "2.2293669" "-4.08" "2.46933557" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "38172" "1" "0.056458" "2.2288112" "-4.08" "0.26142654" "12525" "CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT" "19923" "1" "0.056474" "-2.2286277" "-4.08" "-0.17146163" "" "AACTGAAGATAGTCGTACTCTACCAGTGAGTGCAAACTTTCCCGATTTTTGCCCGTGGAA" "30594" "1" "0.056482" "-2.2285351" "-4.08" "-0.39428405" "13857" "GAACGGGATTGGTGAAGCCATACTTAAAGTCAGAGCTGACCTTGGCCCTCTGAGCAGGAA" "51524" "1" "0.056516" "2.2281551" "-4.08" "0.24208652" "" "CCTGGGATGAACTTGCTCATTAGAGCTGTGTCAAAAACCTTCACTCTGAAGAACTCAGCT" "62513" "1" "0.056539" "2.2278869" "-4.08" "1.007552" "" "GATGAAACACTACCAGGACCAGAAGGATAAAGCACCGAGAAATTGTCTAGCGAAGATTCA" "23587" "1" "0.056558" "-2.2276763" "-4.08" "-0.45647026" "228550" "CCCGATCCATAATTGTACTTCACAGGTATATAGACTTCCTGGTCTAACTCCTGCACTACA" "60892" "1" "0.056561" "2.2276383" "-4.08" "0.23976684" "" "TTCTGCAAGGTCACTGGGAGCAAGGTTGCTCTGAGCGTCGGTGCGTTCTGCAGCCTGACC" "24645" "1" "0.056586" "-2.2273609" "-4.08" "-0.18317965" "245522" "ATGAAAAAGAATTAGCTCCAGGACTCTATCCCTGCCAGGGGAGAAGAGGGAGCTATTTAT" "6988" "1" "0.056587" "-2.2273521" "-4.08" "-0.44102257" "" "TTTACACCAACAGTGACAGCACTATCAACTCCCGAGTGTTCATCATTGCTGTGAGCATGA" "1291" "1" "0.056634" "-2.2268164" "-4.08" "-0.21974807" "" "TCTGCACCTTCTCTGGTGAACAAACAGAGCTCAGCCCTTCCTGTTGCAGGTTGCCACTGC" "227" "1" "0.056664" "2.2264741" "-4.08" "0.45596175" "" "GGTGCTCGATTTCTAGTTATCATAAGGAAAGCAATAGCAGTTTTAAAGTCTTTTTCCTTC" "31171" "1" "0.056669" "-2.2264132" "-4.08" "-0.21362232" "" "" "26974" "1" "0.056722" "2.2258236" "-4.08" "0.6204258" "16790" "CACGAGATCCAGAACCAAAGAATCAACAGGGCACAAGATCTATATATATTTTTAAGAGAA" "17246" "1" "0.05673" "2.2257245" "-4.08" "2.50680905" "16145" "ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA" "53493" "1" "0.056745" "-2.2255536" "-4.08" "-0.18223172" "59289" "GCACTGCTATGCGGATTTTGGCGGACATGCGACCATTTGGAAGCTGTACCTGCGCTTCCA" "55867" "1" "0.056761" "2.2253778" "-4.08" "0.19864449" "" "CCCCCAAAAAGGTACAATATAAAATTCCCTTTTTAAAGGGCACATGTGTATCTCTATATG" "33631" "1" "0.056776" "2.2252026" "-4.08" "0.23636436" "235674" "TCTGCGTGGGACACTCAGCAGTGGAGGAGTGTGTCACAGCACTTTAATTTAGAAAATGTA" "26291" "1" "0.056784" "-2.2251149" "-4.08" "-0.24416438" "" "AAAGGAATCCAGCCTTCTGTCGGGACATTTCCGACCTCAGCCAGCTCATCCTCTGGCATG" "13518" "1" "0.056787" "-2.2250828" "-4.08" "-0.19399435" "380753" "GTCTATAAACCTGTGATACTAACAGCCACCTCATATGGTCATTGTGATAATTTCATGAAA" "648" "1" "0.056801" "-2.2249309" "-4.08" "-0.4548132" "278795" "TATCCGTAGAATCATCCCTACTCTGACTCTGGATGTCAGGGCATCTATAACTTTCACTTG" "30724" "1" "0.056847" "-2.2244092" "-4.08" "-0.18750646" "272589" "GACAGAGTTCTCTGAGAGGCTTTTTTACGCTTTGAAACTCGTATCTTCTGTTATTACTCA" "18953" "1" "0.056869" "-2.2241615" "-4.08" "-0.21289096" "" "ATAATTGGAATTGGTGAATAATCTTCTCTGTTGAACTCTGGCCAGCTCCTCCCACTCAGC" "56834" "1" "0.056904" "2.2237648" "-4.08" "0.21752002" "109082" "TTTGTGGTAGTGCTGAATTTATAGCCTGCTCGTTTGCAGTGTCCAGATGGCAACAGAGTT" "27771" "1" "0.056917" "-2.223622" "-4.08" "-0.45537577" "14200" "TGTGTTATGAACTTGAATGTATTTTCACGGGAGAGCTGGGATTTGCAGCTTTGTGACTTC" "44139" "1" "0.05695" "-2.2232443" "-4.08" "-0.19607389" "" "GTCAGCGAGACACTCAGAATCACCAGAAATCATCATTACTGTCCTCTCCCCGAAACCAGC" "20494" "1" "0.056973" "-2.2229883" "-4.08" "-0.23179292" "" "TTGGATATGATAAGTAAAGAATTGGAACAACTTGAGCGCACAGCAGAGGAACAACGCTTA" "60627" "1" "0.056995" "-2.2227373" "-4.08" "-0.23941318" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "29703" "1" "0.057022" "-2.2224377" "-4.08" "-0.19438149" "" "AAGTTTACCTTCCTGGCCTGCCTATCTTTGGGCTGGACATGGGACTTTATCTACAGTTTA" "814" "1" "0.057039" "2.2222466" "-4.08" "1.00616088" "" "TCACTCCATCCCTGTCACTTCTGTGTCTGATCACAAATAAAATCAACTTGAATGGCTGCA" "28654" "1" "0.057047" "-2.2221501" "-4.08" "-0.20731257" "28126" "ACCCAACGGAGTGGCAAGCCTTCATCGATTCTCTGCAGAGTAAGAAGATGGAGGTAGACT" "43153" "1" "0.057053" "-2.2220887" "-4.08" "-0.2595827" "70802" "GAACAACAGGACTGAATAAGATTGGAGCTTTAAACTGCACTAAGAAGTAAATGTAAAGGC" "24673" "1" "0.057066" "2.2219384" "-4.08" "1.00505131" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "4414" "1" "0.057072" "-2.2218673" "-4.08" "-0.22931913" "" "GCATCTCCCTTCTACTGGTCAATTTCTAGCTTCTACATGCAGTCTTACTTGAATGAACAG" "12069" "1" "0.057078" "-2.2218093" "-4.08" "-0.21692425" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "51889" "1" "0.057099" "-2.221571" "-4.08" "-0.23501645" "100503774" "GGCTGCAGCTGGATAGTTGTGTGGTACTTGTTAGTTTTGTCTTATTTTATAATTGTATAC" "11927" "1" "0.057122" "2.2213097" "-4.08" "0.31340734" "75292" "CCTTGGCTACAGGATTATCAGACTTGGCTTGACCTCAGAGAATTTGAAACTCGCATTGGA" "7671" "1" "0.057158" "-2.2209111" "-4.08" "-0.29781478" "233335" "AGACGCGCTGCGGAACCAGGCGCTGGAGTTGGAGCAGCTGCGCGCGAGGCTGGAGGATGA" "7486" "1" "0.057167" "-2.2208088" "-4.08" "-0.20080271" "109910" "AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC" "40638" "1" "0.057175" "-2.2207196" "-4.08" "-0.20430724" "" "ACGGTGCTCAGGTACACTCTGAAGACAACCAGCACCACGAGATATTATTTATTCAGCTAG" "18068" "1" "0.057176" "2.2207042" "-4.08" "0.21263524" "" "TCCAGCTGAAGTTATCAGGGACAGAACCCCATTTATATTAAAATGGAAATTGTGGACAGC" "36893" "1" "0.057184" "2.2206147" "-4.08" "0.20333028" "70024" "GCTCTCCTCACCTTTAGTGTGGGTTTATTTAAAATAAAGTTTGATGCTCCTAATAAAAGC" "7407" "1" "0.057213" "-2.2202886" "-4.08" "-0.1871383" "408062" "TATCTCACTAGTCTCTGTAGTCACAGAAAATTCTGTGCTGGAGAGAAACCCTGTGGCAGT" "55652" "1" "0.057222" "-2.2201844" "-4.08" "-0.1811217" "26371" "AGCAGACACGCTAACTGGCTTCTCTTAAGCTAGACGTAAAGTGATTATAACACTGTACCA" "37117" "1" "0.057233" "2.220062" "-4.08" "1.02895633" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "29118" "1" "0.057238" "2.2200131" "-4.08" "0.57855274" "" "ATCAAGAAAGCATCTTTCCAAAGCATGAGCTTGGCCCATTAGTCACTCCTCTGGTCTTGT" "29937" "1" "0.057274" "-2.219608" "-4.08" "-0.22756621" "13006" "GTGACTAACTTAGTGTAAATGTGGCCTTTGGTCTTTGCAATGGTTAGAAACATTAAATAC" "3720" "1" "0.057276" "2.219586" "-4.08" "0.27459576" "" "CTAAGAGTTTTGCTAATGCAATCCTGGTTTTGAACCTAACTTTGGCACATATGGAAAAGT" "5373" "1" "0.057286" "2.2194705" "-4.08" "0.24768416" "74279" "TCCCAGATCCTACCCAACTAGGTATGCAGATGCTTTGAAAGATGAGATAGACAGGACCTA" "44979" "1" "0.057306" "2.2192487" "-4.08" "1.31764061" "" "AAATGAAGGAAAGCCACTCAACCCAGACTCAGTCAGGAGAAACTCTCTGGAACCATACTT" "9428" "1" "0.057314" "-2.2191606" "-4.08" "-0.23781115" "" "GTTTATCAAAGATGCAGTACTGAGAAGCTTTTGCGAGTCTTGAAGGACTTTACTTTTGGG" "45386" "1" "0.057321" "2.2190812" "-4.08" "1.02519401" "16643" "TCTCATACATTTGTACCCAAGTAATTTATACTTGATGGCTTCTTCACACGTGTGCATAAA" "45646" "1" "0.057327" "-2.2190158" "-4.08" "-0.52915163" "109264" "TCTCCAGAGATGGTTTGGGCTGGATGAAGAAATACAATATAAACCGGTTCCAAAATGGCC" "30056" "1" "0.057341" "2.2188529" "-4.08" "0.90928512" "" "CCGTTAGCCCCACCCACACTGTAGGCTTAATAGCACAATTGGATCTGGAGTTGCCTGCCT" "39978" "1" "0.057346" "2.2187969" "-4.08" "0.72280098" "" "GAGTAACTGCATAAGCCATAGTAGTCGAAAATACAAATCTGATTCCTCAATTGCAGTTAT" "46579" "1" "0.057381" "-2.2184036" "-4.09" "-0.22898299" "" "GAGCTGTCCAAAGAGATGATGAAAGCTGGAATCATAAAGATGTTAGAGGATACATTTGAA" "9877" "1" "0.057406" "-2.2181311" "-4.09" "-0.29610062" "76522" "GTTATACATTGTGAGGGGCGACAATGTAGCAGTCATTGGGGAAATAGATGAAGAGACGGA" "31471" "1" "0.057471" "2.2174065" "-4.09" "0.21477344" "18707" "GGGGCACACAAGGCAGCTTTATGGACGGACAGGACTGATCTCTTCCAGAGCTGAAATCGC" "5057" "1" "0.057481" "-2.2172918" "-4.09" "-0.24657947" "666244" "GAAAGAACATAAAATGATACTCTCCTTTCAAGAGCAACATCAATATTGCCTGACAGTCAT" "33072" "1" "0.057484" "-2.2172538" "-4.09" "-0.1958759" "213819" "CAGTGGATGCTTATTTTTGTATTGGCAAAGAATCAAGCCATGTGTGGTTTTTGTTTTGTT" "16579" "1" "0.057494" "-2.2171453" "-4.09" "-0.41612643" "320784" "GGTTCTGTGCTGTTCTAGCTAGTGCATAGTGTCTCTAAATAAACATGCTAAATGATCAGG" "28671" "1" "0.057501" "-2.2170719" "-4.09" "-0.16768483" "64424" "CAGAACTCTGATCGACAGTCAAAGCGGAGGAAAATGAACTAGATGTTTTCCACAGCCACT" "56550" "1" "0.057504" "2.217036" "-4.09" "0.77155904" "16160" "GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT" "26957" "1" "0.057505" "2.2170256" "-4.09" "0.19765505" "" "ACAAGCACGTCCACCCAGTAAATAAAGGCGAAGCCAATGAAAGCAGCTGTATTTCAAGGA" "52697" "1" "0.057553" "2.2164912" "-4.09" "0.90074959" "" "CTTGGAGGGTGTCTCTCATTCTTCTCTTCTTCTGCTTTTTCTCATCTACCTGAGAATAAT" "56760" "1" "0.057553" "-2.2164864" "-4.09" "-0.18547423" "" "ACCAGCCTTCTTGAAGATCTCCTCAATCTGAGAAAGGGAGAGGACACCAGGAATTGGACT" "745" "1" "0.057562" "2.2163905" "-4.09" "0.41119517" "" "AGCTCAGGCTCAGAGACTGGCAAGTCCAATTATGCAAGAGATCAATCAGCAGTGTTCTTA" "20900" "1" "0.057626" "2.2156802" "-4.09" "0.21351616" "" "ATTGTGTACACAGCTATCAACACGTACAAAAGCAGTGACTGGTATGTTCCTTTCATCTTT" "48015" "1" "0.057692" "-2.2149352" "-4.09" "-0.16652354" "60315" "AAATAGTGGAACTCGCAAAAGGTGGATGCCCTTGGAAGGAGCATCTATACCACCTAGAAT" "59350" "1" "0.057727" "2.2145562" "-4.09" "0.28158292" "" "CCCAGGTACATACCCAGGCAAACACACATACCTAAACATAAATAAAAGTGAAAATAAACT" "11062" "1" "0.057744" "-2.2143647" "-4.09" "-0.26899379" "14866" "TCTCACCTATGATGTCTTGGATCAGAACCGTATATTTGAGCCCAAGTGTCTGGATGAGTT" "60719" "1" "0.057765" "-2.2141255" "-4.09" "-0.17900361" "" "TGCTTCTGAAGGCAAATATAGGGCTCTGAAGATGGACTTTTCCTCGTTCTACTTACGCCA" "61078" "1" "0.057774" "-2.2140323" "-4.09" "-0.18324764" "" "ATACAGAGTTGGATGGGTACTAGACCCAATCACAGTCCAAAGGCTGTTCTCTAGGAATAG" "26134" "1" "0.05779" "-2.213855" "-4.09" "-0.24387828" "" "ATTTTTTCATTTGGTACGCGGAGCCAAGTCGTACAGTATGTGCTGTGATGCAGGCTACTA" "25166" "1" "0.057825" "2.2134642" "-4.09" "0.31856154" "67111" "GTGTCCTGTGATTCTGTGTTCACACTCCTGCTTGTCCACTGAAGAAGGGACAGGACAAGA" "799" "1" "0.057829" "-2.2134157" "-4.09" "-0.3769438" "" "ATCTTGACTTTCATCCACTAAATAAATAGTCCTCTGAAGCATTGCTTGCTGATTATCCAG" "58947" "1" "0.057861" "2.2130593" "-4.09" "0.27050556" "213573" "ACATAGCAAGTTCCAAGACATCCGGAGCTACATAGAGAGATTCTACCTCAAAACAAAAAA" "25322" "1" "0.057934" "2.2122515" "-4.09" "0.43985563" "" "GCTGTCTATGCATGTGTCTGTGTATCTACACATACACACCCATAATAAAACTACATATAT" "50570" "1" "0.057983" "2.2117115" "-4.09" "0.35785987" "78600" "CATGGAGGGGCTAGGAACAGATATCACGGTCATCTGTCCCTGGGAAGCGTTCAGCCATCT" "30560" "1" "0.057986" "2.2116786" "-4.09" "0.2659791" "18755" "CTTCTCACTTCTCACCCAATCACATATTGTCGATGTGCATCACAGCTCCTGCGTCTAGGA" "62849" "1" "0.058024" "2.2112617" "-4.09" "1.48721268" "12766" "GCCAGGCGTTGTCAGCACTGAATGTGCCCATCTCAGTATCTCAATATTTGCCCAATTTTA" "35416" "1" "0.05806" "-2.2108572" "-4.09" "-0.20520986" "232337" "CTATCAGTGCAAAGAGTGTGGGAAAAGCTTCAGTCAGCGAGGCAGCCTGGCTGTCCACGA" "38482" "1" "0.058087" "2.2105682" "-4.09" "0.28773769" "" "TGCATAGATCAAGGCAGATCTCTATGATCAACTTCAGGTCCCTGTTTGCAGTGCCTGTTT" "24788" "1" "0.058101" "-2.2104119" "-4.09" "-0.20910573" "67187" "AAGATATTTGCATATGCCTTTGACAAAAACCGAGGAAGGGGCTCTGGCAGGCTTCTACAT" "21350" "1" "0.058134" "-2.2100388" "-4.09" "-0.17059009" "192653" "TTGGGCCCTAGGAGCCATGGGGACTCCAAATGATCAGGCAGTGTTGCAGGCCATCTTCAA" "57186" "1" "0.058172" "-2.2096221" "-4.09" "-0.16775509" "" "GGGAGCCAGCTTGGTCCTGCGTCTTTCACATTTGGCATCATGAATGGCCGCTATTACTGA" "21424" "1" "0.058173" "2.2096084" "-4.09" "0.34775441" "22259" "TCCTGGGAGCTGGGTGAAGGAGAGAGCCTTGCGTAGCATTAAGGGAGAGTCAACAGGTTG" "10151" "1" "0.058189" "-2.2094377" "-4.09" "-0.67436083" "" "GTTAGAGGGAGGATTATTATTCGAGAGAGGATTGTTATTATTGGGAGATATAAACAGGGA" "25947" "1" "0.058227" "2.2090238" "-4.09" "0.1900364" "" "" "50271" "1" "0.058252" "-2.2087448" "-4.09" "-0.17306867" "" "TTACAGTCATATGAGGGAGTGTTCGAAAAGTTGTAATTTGAAAACTGTTTTTGGTTGTCC" "31486" "1" "0.058261" "-2.208648" "-4.09" "-0.20513045" "" "GTGGCGTTTAGAGGCTTCCCTGGTATACACTGCCACAATAAATATGTCACATTGGAAGGT" "61647" "1" "0.058279" "2.2084465" "-4.09" "0.33190688" "215387" "GAATCATTTCTCCATAGCCTCTTTCTGTCCTTAAAGAATTCCCAGATCTATGTACATAAA" "14022" "1" "0.058287" "2.208361" "-4.09" "0.31687179" "" "GATAATGTCGACATTTCCACTCCCAATGACGGTGATGTATAATGCTCAAGTATTCCCTTG" "24117" "1" "0.058302" "-2.2081872" "-4.09" "-0.24938153" "" "CCACAGCAGACATGCACAGACGAGAAGAAAACAAGTCATGCCTTAGCTTTGTTATGACAA" "48614" "1" "0.058314" "-2.2080609" "-4.09" "-0.21853845" "20439" "GGGTTTAGTTTTTGTTGTTTTTGTTTTTATCTTTACATACGCGCACACACATACACACAC" "25510" "1" "0.058347" "2.2077015" "-4.09" "1.47149846" "547349" "CTTTTGTGTTGAAGAGCAAGAGAAAAATAGGTGGAAAAGGAGGGGTCTATGCTCTGGCTG" "3997" "1" "0.058352" "2.2076452" "-4.09" "0.19672149" "" "" "38011" "1" "0.058381" "-2.2073282" "-4.09" "-0.20668482" "78895" "CACATACCAACGACATTGGAAATGGTAGTGATTCTCTTTGAAAAATAAAGACATTCTCGA" "27000" "1" "0.058419" "-2.206908" "-4.09" "-0.18049555" "74347" "CCTTGAGACCTCTACGTCTTGTTTGTAAACCTCTATGTCTTTTGCTGTAAACTTCAACCT" "44876" "1" "0.058429" "2.2067936" "-4.09" "0.90036979" "56532" "TGAAGTGTGCCATTCAGCGTGGCAATAAAAAGCACGTTTTAAGCAACCTGGACTGGCTAA" "14148" "1" "0.058465" "2.2064024" "-4.09" "0.27314803" "72112" "GTCAGCTGTAGTTTTGTCTAATGCTTTTCCTTAGCAGCCAAGATAAACCTTTAGGAACCC" "808" "1" "0.058538" "-2.2055954" "-4.09" "-0.17575494" "66046" "CAGGGTAGTAATGAAACCTGGAGGTCTGGGAAGTTGTGAATTCCTAAAGTGACACTGTTG" "41794" "1" "0.058552" "-2.2054468" "-4.09" "-0.16888833" "" "ATAATGTGATGAGTGCCTTTGATGGGATAAGTCCAGCCTCCTCATTTAAAAAGAGGCTCT" "5720" "1" "0.058617" "-2.2047355" "-4.09" "-0.2906876" "" "CATGTCATGAAATTATCCACTTCCTCAAGACAAAAATCCCTGTTTGCATCATCTCTCTAT" "59616" "1" "0.058624" "-2.2046625" "-4.09" "-0.22257695" "414072" "CTCAAGACTTAATTCTTTATGTAAAAATAAACAGACCCGGCTGTGTCATTCATATGCAGA" "19670" "1" "0.058625" "-2.2046478" "-4.09" "-0.20111758" "257958" "GTGGTAACATTAGAAGTAGCTAAGGAGATGACTCTTTCTGTATTCTATACCATTGTTCCT" "20815" "1" "0.05863" "-2.204592" "-4.09" "-0.28837798" "246791" "CAGGAACCCTCATATACATGCAGAACTTGCAATCATATGATAGAAAAGCAATAAATCTGA" "36007" "1" "0.058657" "2.2043012" "-4.09" "1.30481899" "24047" "ACCTCCAGACCAGCTCTGGGTGGATCGCATCATCCGAAGACTGAAGACGTCTTCTGCCAA" "58853" "1" "0.058659" "-2.2042724" "-4.09" "-0.27204994" "330941" "CTTAGCTTTAATTGAGAGACAGTGCATTATTCGGGTTGCTTTACCCATTTGAGGAAGGAT" "36848" "1" "0.05868" "-2.2040502" "-4.09" "-0.20482451" "232337" "GACTCACCTGGAGTGAGGCAGAAGGTCTATGATTGCCAGGAATGTGGGAAGTCTTTCCGG" "43187" "1" "0.05868" "-2.2040406" "-4.09" "-0.20055272" "74600" "TCAAGGAAAGGACTGGAAGAATTTTTTGATGACCCAAAGAATTGGGGGGAAGAAAAAGTC" "28383" "1" "0.058697" "2.2038641" "-4.09" "0.53999058" "" "GAATGTATGTTAAAGCACTTCAAGACACAGAAAGTGGCCATTTCTAATGCGATAAGAAGT" "21558" "1" "0.058735" "-2.203441" "-4.09" "-0.24102083" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "37304" "1" "0.058757" "2.2032015" "-4.09" "1.5151236" "231655" "AAGGTAGGAGGGGATCAAGTTCCTTTCAAATGGAGAATAAAAAAGCCATTGTTTCTTCCC" "47526" "1" "0.058778" "-2.2029735" "-4.09" "-0.33300511" "223601" "TTATTCCTTCAGTGTCTCAAGCAAGGATCTTGCATAGTACCTAAATATGGAGAGCTGCCA" "8150" "1" "0.058815" "2.2025698" "-4.09" "1.30549177" "74558" "CTCTTTGGATCATTGACATAGCTAGTCTTCAACATCCTCATACAAATTGAAGTTGCATTA" "29071" "1" "0.058823" "2.2024878" "-4.09" "0.70147175" "77056" "AAGGACTGGGCCTTGGTAAGCATGGATTACATGAGGGGGGACCAATAAACACTGATTATC" "18911" "1" "0.058837" "-2.2023359" "-4.09" "-0.24651013" "108067" "TCCGCTGCTATGTCCACATCATGAAAGAAGGACTTTGCTCTCGAGTAAGCACACTGGGAC" "33587" "1" "0.058842" "-2.2022806" "-4.09" "-0.227437" "56183" "TGTGCATCCGTTGCTGCAGCTCGTCCCTCAACTGCATGAGAGAAGAATGAAGAGATTCAA" "30779" "1" "0.058911" "-2.2015239" "-4.09" "-0.21344209" "15387" "GTCATGAATCTGGAGCATCAATCAAAATTGATGAACCTTTAGAAGGATCTGAAGATCGGA" "15988" "1" "0.058941" "2.2011981" "-4.09" "0.32155256" "381334" "TGGGGGATGGGATGCCCCTCTTTATAAGCTCAGATTCTTAAGTAAACTTTGGGCCTTGAT" "15615" "1" "0.058949" "2.2011093" "-4.09" "0.27188547" "29820" "ATGGAATATATTTTGAATCGCAGGATTTTCTACTCTAAAGAGTGCTGCTGTCTGTGTTAG" "1101" "1" "0.058991" "2.2006591" "-4.09" "1.98457005" "" "AGTAAGAGTCTCCTGCATAGTAATGGCAACACTTACTTGTATTGGTTCCTGCAGAGGCCA" "4816" "1" "0.059041" "2.2001107" "-4.09" "0.22600878" "" "" "15360" "1" "0.059044" "-2.200079" "-4.09" "-0.26320423" "66713" "TGGATATTAACTTTCACAGTTCTGAGCACTATTAGTATCTATCTGACAAGTATTGGGAAG" "52688" "1" "0.059058" "2.1999219" "-4.09" "0.6316403" "18293" "ATTAATTTATAAAAAAGAAATTGGTCTGGCAAGATGGCTTAGCACTGACTGCTCTTCCAA" "52260" "1" "0.05906" "2.1999033" "-4.09" "0.22608636" "" "CTGGATCCTTGGCCTATATTCAACGTACATTGCTGCTTCAAGTCTTTTGATTTCACGACT" "32404" "1" "0.059078" "2.1997043" "-4.09" "0.76506577" "" "CCCAGAATTCATCATTTTCACCAATGGGTTTCTTTCACAGCTTTTCTCACTTTTGGCCCT" "712" "1" "0.059098" "-2.1994942" "-4.09" "-0.19343901" "" "AAGGAGCAGGACTTAATCAGGCTGAAGAATTCCTTCACAGAATATAGAACATTAATTGTT" "59503" "1" "0.059115" "-2.1993084" "-4.09" "-0.17314255" "16396" "GACTAAGTTGCTTTTAAGACCTTTTTCTCTGTAAGCATCGTAAATGCTAATCAACCTGTT" "21215" "1" "0.05917" "2.1987067" "-4.09" "0.30111862" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "39117" "1" "0.059188" "-2.1985166" "-4.09" "-0.61055571" "13067" "GTATTTAAAACAGGCCACATCCTCATGAAGTGAAGTAGTATTTCAGCTTCAAAATATTCG" "19213" "1" "0.059243" "2.1979191" "-4.09" "1.04493419" "" "TTCCATGCTACAGTGGCTACTGAAGCTGAGTTCTTCAGAGTGAAGGTTTTTGACACAGCT" "1777" "1" "0.059265" "-2.1976747" "-4.1" "-0.18085492" "76758" "GTCTACAGGCTGGTTCCAGGATAACAAGGGCTATGTTGTCTCAAAAATAAATAAATAAAA" "38348" "1" "0.059282" "-2.1974985" "-4.1" "-0.28882975" "" "TATTGGGCCTCTGGGCTAGATGGTGGGTACTGGGGTGGTACCAAATTTCCTGTGCTCCCA" "33607" "1" "0.059319" "-2.1970907" "-4.1" "-0.334578" "" "GAAGCAGCAGCTTTAACTTTTATGTAACTGTAGAATACACGGCCCACTTCGGTCTTTTTG" "2087" "1" "0.059328" "2.1969938" "-4.1" "0.31698165" "14060" "CAATTTTAGGAAGACTCCACTAAGTTCAGTGTTCTGAGCCTTTACTTTTGCATAAAATTG" "27638" "1" "0.059338" "-2.1968921" "-4.1" "-0.22972917" "328162" "TCCTACTGTCATATGTCATACCCGAGGGCACCCAAAGGATAATAAATATTTTCCCCACTG" "30231" "1" "0.059359" "2.1966643" "-4.1" "0.66987417" "78416" "TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC" "21572" "1" "0.059366" "-2.1965883" "-4.1" "-0.53424586" "269994" "AGGAGAGGGCTTAAAGTACTGTCCTGTGTTAGGCAGGGCACGAGGGGCAAAGGATGACTC" "35206" "1" "0.059371" "-2.1965295" "-4.1" "-0.20037577" "232164" "TATCCAGTGTTGTGAGGAAGCACAATTGTACCCGAGACTACAGACTTAGCCCCAATTACA" "43107" "1" "0.059379" "-2.1964516" "-4.1" "-0.24295674" "78405" "CCCTGGCTCATCAAAACGGACGAGGAAAGAACGCATGAAAAGGGGATGCATGATGCATGC" "55792" "1" "0.059389" "2.1963415" "-4.1" "0.44503264" "" "TTATGGAGGGGTATGTATGTATACTTAGTGATAAATTTCTTTAGTCACAATAAGGACCCC" "9528" "1" "0.059431" "-2.1958858" "-4.1" "-0.20872657" "" "" "59306" "1" "0.059476" "-2.1954037" "-4.1" "-0.32635527" "19346" "CAGTGCTTACGCTTACGCTTCTTTCCTAGTGTGATAAAGTGCATTGGAAATAAATTATAT" "7618" "1" "0.059509" "-2.1950469" "-4.1" "-0.26468041" "57815" "GAGTTGAAGAGCCAATGTTTTGACTCATTTGAGTATAATAAACATTTCTCTGGGCAGTTC" "30814" "1" "0.059513" "-2.195002" "-4.1" "-0.23597631" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "6894" "1" "0.059539" "-2.1947148" "-4.1" "-0.18812435" "67235" "TGGTGAAAGATTTAGACAGAGTACACACCTTGTCCGACACCAAAGAATCCATCAAAATTC" "29150" "1" "0.059569" "-2.1944008" "-4.1" "-0.5048503" "" "TCAAAACCATCGTGCTTAGAGCTTCTCCATCATCGTCTTCAACAATGATGACCAAAGGCT" "30505" "1" "0.059577" "-2.1943099" "-4.1" "-0.18918532" "223435" "TCACTGTGCATCGCCCACTCCCGAAGTAGCATGGAGATGGAGGGCATCTTCAACCACAAA" "24912" "1" "0.05958" "-2.1942735" "-4.1" "-0.21293511" "" "AGAGTCATGTACTGTGACCAGGTGAGGACATGCATCTTCTGTTCTCCTGCACCCAGGGCC" "4755" "1" "0.059597" "-2.1940914" "-4.1" "-0.36585489" "" "AAACACTGTTGTTGATGGCTGCCATGCGAGGCCAGGTCTTGGTCTGTTCCCCTGAGCTGA" "28431" "1" "0.059619" "2.1938634" "-4.1" "0.75734025" "" "TGAGGACAAGCTTCCAGTTTTGCAACCATCCACGGTTTATGATGCTCGTCTTCATAGATG" "3733" "1" "0.059628" "-2.1937597" "-4.1" "-0.21779737" "" "TATGAAGAAACACAAGGAGAGACATAAGATGGGCGAGGAGGTTATACCACTGAGAGTGCT" "28607" "1" "0.059666" "-2.1933493" "-4.1" "-0.23141225" "692132" "CAGCACTGTGAATGAACTTATGCCTATTGAAATGCATTCTTAAAGATGGTGAAGAGTATA" "8120" "1" "0.059694" "2.1930503" "-4.1" "0.60566253" "622554" "AAACCAGTAAGAACGAGGCTAGAGAGATGGTAGTTGAGTGCACACTGATAGTGCAGAGGG" "8572" "1" "0.059698" "2.193003" "-4.1" "0.2106237" "433632" "TAAAAAGTCTGATTGCTTGCAATAAACTTGTCTCAACCTTAGGTTTTCGGAGACCCCTTC" "40136" "1" "0.059709" "-2.1928864" "-4.1" "-0.33132658" "66573" "TATTTTTTATACTTTGTAGAACTATTAGGACTATCTCCAAAAACAAAAAAGGAACCTATT" "1431" "1" "0.059803" "2.1918778" "-4.1" "0.74788631" "214763" "TATTTTTTAAGAGCACAAAAAGAAAATGAAATTATAATCTGACCCCATAATATGATAAGT" "44221" "1" "0.059819" "-2.1917045" "-4.1" "-0.22828757" "22042" "ATCTCTATATAGAGACAGCAATTGGATTAGCAAAGTTGAGAAACTTTCCTTTGACAATGC" "50692" "1" "0.05985" "-2.1913744" "-4.1" "-0.29117024" "" "CAAAAACAGATGCTAAAGCCCCCTACACAGAGCCTCAGTGCTTCGATCTGATAGACAACA" "10511" "1" "0.059866" "-2.1912024" "-4.1" "-0.47658227" "" "GAACCATTAACCAGATGGGAGCCATATTTTGGTGATTTTAAAAGTGTGTCATCAAGAAAA" "61005" "1" "0.05989" "2.1909458" "-4.1" "0.20876032" "11883" "TGTCTGGAGTTAGGTGATAAACTGATCATTCCGGGTAGAGTTAAAGGACCTGGGGACCCT" "36008" "1" "0.059918" "-2.1906475" "-4.1" "-0.21253515" "56403" "TCTTTGATTTGGATTAGATGTGTGAAGTACTGTCTTTCGCCAAAAACCTCAAATTTCCTG" "17109" "1" "0.059928" "2.1905375" "-4.1" "0.22624381" "" "TACCAGCCCATCTAAATGATTCTGACTAGCTATCAGTAGGCAGAACAGAGCACAATCCAC" "62964" "1" "0.05994" "-2.1904109" "-4.1" "-0.18224355" "67008" "GGACGGAATTGTTAAGGGTCTTCAGTATTAACACTAGTAAATGGAATGACATTGGTAAAT" "31985" "1" "0.05995" "2.1903031" "-4.1" "0.32100847" "100042092" "CCCAATGACGGTGATGTATAATGCTCAAGTATTCTCCTGCTTTTTTACCACTAACTGGGA" "1463" "1" "0.059968" "-2.1901149" "-4.1" "-0.26995238" "232539" "CTGGCAAAGCAAAGGAAAATGTGATTTGTTGTATCACTTCAGGGTGCGACATTTCTCTGT" "47264" "1" "0.05998" "2.1899842" "-4.1" "1.06309719" "12703" "GAGGGTCTCTGGCTTCATTTTTCTGCTGTGCAGAATATCCTATTTTATATTTTTACAGCC" "23136" "1" "0.059987" "2.1899057" "-4.1" "0.25353867" "65107" "GTATTGTTATTGCCACTGGCTGAGCCAGAAGTCTGGGTGGTGGAGGCAGAGGATGAACCA" "41626" "1" "0.060017" "2.1895883" "-4.1" "0.4064593" "66616" "AATGGAACACAAGAGAACTCCGAAGTGCTTCATTTACCTGGGGCAATGCGATTCAATTCC" "19794" "1" "0.060065" "-2.1890739" "-4.1" "-0.37241018" "50787" "AATTTCCTGGACATGCAGCTTTATGAGTATGCGAAGGATCTCTTCCAGCAACGCTACCAT" "25924" "1" "0.060116" "2.1885275" "-4.1" "0.78959864" "69217" "GCTATGGTCAAAGATTGATTTTCCCAACACTGTCCAAAATTGGATGAAAACTTTGAACTA" "51666" "1" "0.060152" "-2.1881504" "-4.1" "-0.19639345" "" "CCAAAGGAGTAGGAAGAAGTATTCTGACCTCTAATTTACTTTCAAGTAGTTCAACAGAAT" "49099" "1" "0.060177" "2.1878807" "-4.1" "0.74378026" "67596" "CACAGTACCACATAAACTCTACACAGGTAAGGAGACAGCTGTGGGTTCTACAGGACATTA" "22424" "1" "0.060177" "-2.1878799" "-4.1" "-0.21167737" "67187" "AGTTTTCACCTCCAGCAGAGACAACAGGGAGGCTCCCTAGGACCTTTCTCATTATTTATA" "17256" "1" "0.060197" "-2.1876642" "-4.1" "-0.23603302" "100042894" "ACATGGTCGACACTTTCACTTATACATAGACATGATTGAAGTGGCCACAGGAAGTAGAAA" "16411" "1" "0.060201" "-2.1876284" "-4.1" "-0.22042166" "11744" "AGACCTAAAATCAGAACTGTCGGGAAACTTTGAGAAGACTATCCTGGCCCTGATGAAGAC" "7451" "1" "0.06021" "-2.1875244" "-4.1" "-0.25101181" "78785" "TTGAGTTCTTCTTCCCTCATTTAAAAGCTCAATTAAACATGTCACAAGTGGCTAAAAGCA" "35104" "1" "0.06022" "2.1874201" "-4.1" "0.28011191" "" "GTGGTAGTCCACGGAGGCACATCCCACGTGGTAGAAACCTGTGAGTCTCGAAGCAATGGA" "12835" "1" "0.060234" "2.18727" "-4.1" "1.52849612" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "49549" "1" "0.060238" "-2.1872331" "-4.1" "-0.44220159" "" "ATTTTGCTATATTTCCCTATTATCTGCACTCTCTTGTTGTTTTTTGTTTTTGTTTGTTTG" "60644" "1" "0.060256" "2.1870362" "-4.1" "2.0895987" "54396" "GTGTCTTAGGTCATAGACATAGATTTTCTCTTTGCTGGTTGTATGTACATACCTATCTAT" "43460" "1" "0.060259" "2.1870074" "-4.1" "0.81293215" "18301" "AACATGAAAGAATCCTGAAAGGAAGAGGCCACTGGAGGGAGTCAGGCTTAAGGCTAATGG" "25182" "1" "0.06026" "-2.1869892" "-4.1" "-0.19398538" "15289" "GTTCTTGTTGGTGCACAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGCTTTTTCT" "19019" "1" "0.060263" "-2.1869573" "-4.1" "-0.18545403" "" "ATAGATAACACAGAGCCCGATTAAAATAAATTGGCATTGGAGTGCTTCACCCTTTAAAAA" "24580" "1" "0.060273" "-2.1868557" "-4.1" "-0.22589149" "" "TCAGATCGCCCGTTGACTTTTGTCATATTCTCTGCTGTCCAATGACAGTGCTTGGTTGAT" "57798" "1" "0.060327" "-2.1862834" "-4.1" "-0.16724946" "" "AACCTGGAGGTCATTTCTGAGCAAGAATTCCGGGAATCCTAAAGGTCTTCAATCTCTGCT" "7708" "1" "0.060412" "-2.1853777" "-4.1" "-0.19846991" "28036" "GTAATGAATGCACAGACTGAAATTAGAAAGAAGCACAGTTGGAACCTCGAGGTCCTTTCT" "49400" "1" "0.060465" "2.1848128" "-4.1" "0.65726251" "19186" "AGAAACCAAGGGAATGATCTATTGAGCCCCCTCTCTCATTCTGTGATGGGTATAGCAGAA" "53192" "1" "0.060492" "2.1845244" "-4.1" "0.18501734" "" "AGCTTCGTGGGTGAAGGATATGAAAGAATGAATTCACTCTTCTTTGGGCGGTTAAGATGA" "22945" "1" "0.060493" "-2.1845213" "-4.1" "-0.1869952" "22194" "GGAAACCTGTAGTGAAATACCTTAAGCTGTTAACTGTACATGTGGAATAGAAATTGTTCA" "59562" "1" "0.060552" "-2.1838946" "-4.1" "-0.30280541" "" "AGGTTTAGAAGCTGAAGGTCAGAACGTCAGGTGACTTGGCCAGATTCACTTAACAAAAAA" "22349" "1" "0.060561" "-2.183798" "-4.1" "-0.2240372" "99890" "AACCTTACGCACGCACAACTCTGACTTTCTAATTGTAAACAAAAATTCACTCCTGTTATA" "34198" "1" "0.060592" "2.1834708" "-4.1" "0.37793291" "15042" "AAACCTTTAATCCCAGGAGACAAAGACAAACAGATCTCTAAATTCAAGGCCAGCCTAGGA" "60879" "1" "0.060592" "-2.1834654" "-4.1" "-0.21269752" "" "AATGTTAAGAAAAGCTTCCTTAAAGCTTACTGTGTTCCTTTGTTGAAAGACTTTGCAGTC" "62672" "1" "0.06062" "-2.1831669" "-4.1" "-0.27015577" "" "TGCCGGTTGGGAGAGAGATCCTGGTTTTGATACTAGAAAGCATAGTAAAATTGATAATTT" "16798" "1" "0.060643" "2.1829249" "-4.1" "0.97455824" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "23828" "1" "0.060684" "2.182495" "-4.1" "0.60718668" "" "TTCCAATTTTACAGGTCAGAACTCAAGGTCCGGATTGAGGAAACAGCTGAGCTGATCTAC" "15942" "1" "0.060702" "-2.1823029" "-4.1" "-0.26691786" "71059" "CACACATAAATATGTAAAGACGAAATCCTGCAAAAAATAAAAAGAACTTGTGGCCTGGGA" "46489" "1" "0.060732" "2.1819873" "-4.1" "0.2740296" "" "GGACTGTTCAACTAGCTTTAATCAGTAGTAAGGGCAAGCAGACAGGAAAAATAAACCGTG" "27257" "1" "0.06074" "-2.1818972" "-4.1" "-0.20811644" "71354" "GAAGTGGCAGCCTTCTAAAATCAAGAGATATTGATTGGATAATATCAAACCATGGTCCCT" "29581" "1" "0.060745" "-2.1818459" "-4.1" "-0.29333425" "70208" "CTGTATGAAATGAAACCATCAGAAAGTTAGAAATGAAATAAAGCCGTGCTCAGACGTCTG" "5388" "1" "0.060756" "2.1817373" "-4.1" "1.68902426" "12500" "GCAGCTGTATCAGCCTCTTCGAGATCGTGAAGATACCCAGTACAGCCGTCTTGGAGGGAA" "52368" "1" "0.060774" "2.1815376" "-4.1" "0.92022075" "666926" "ACACCAAGGGAAAAATGTTCCAGGAAATGTATACAAGAACCACCTGGGAGAAAGGCTCTA" "33171" "1" "0.060783" "-2.1814443" "-4.1" "-0.25255568" "" "GCCATGTTTTCGGTAATGAATAATGAAACCTTTCTAAAATTGATTTGTGGTCGATGTGGA" "25082" "1" "0.060795" "-2.1813258" "-4.1" "-0.22985165" "53420" "CTTCCCACACAGCTTGACTCCTATGCTGCTCTTGGGGCCAAATAAAATACTCAATAGCTT" "56462" "1" "0.060853" "2.1807075" "-4.1" "0.22796742" "" "" "42786" "1" "0.060856" "-2.1806794" "-4.1" "-0.28625108" "171247" "GATTGTGCCTTTTCCCTAATTTTAAGTCTCTCCTCAAAGGACAACACCTTAATGGTAAAT" "50427" "1" "0.060859" "2.1806487" "-4.1" "0.95621486" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "42299" "1" "0.060862" "-2.1806096" "-4.1" "-0.33313133" "" "CATGGACTTTAACTCCTGTTGGGGATTCACTGTACACTTACTTTTGGTTTGTAAGAGATT" "17791" "1" "0.060882" "2.180403" "-4.1" "0.32520741" "21846" "GTGAACATGTCGCTGTTTGAGAACTTCACCTATGCGGGCATCGATGCCACAGCTGAGGAG" "16011" "1" "0.06091" "2.1801087" "-4.1" "0.29879065" "" "AACAGCATTTTCTGGAACCTGAAGCAAATTTTAGATGATTCCATAGACATTCAGCAACAG" "6117" "1" "0.060911" "2.1800955" "-4.1" "0.22343966" "" "CCTCCAAACCCACTACCATATGTATTTTTAAGTCAATGCTAAGATCCCCAAAGTAAAAAA" "23677" "1" "0.060958" "2.1796028" "-4.1" "0.17253779" "384534" "ATGGTGAACACTTTCAATTACATTTAGACATGTTTGAGTTGGCTACAGGAAGTAGAAAGA" "44000" "1" "0.060982" "2.179346" "-4.1" "0.6372582" "16639" "CAGAATTGTGTTCTTTCTGATTTCTTAAACTCCCATAAAACTGAATAAAGAGTCCCCCCT" "27822" "1" "0.061005" "-2.1791103" "-4.1" "-0.20078865" "" "TATAATGACAGATAGTTCAAGATCGTCGCCACTAGGGAGGCAATGGCTCACATTGTCAAG" "52083" "1" "0.061015" "2.1790007" "-4.1" "0.44232373" "26401" "TAAGACTTCCAGGGCTTAAGGGCTAACTCCTATTAGCACCTTACTATGTAAGCAAATGCT" "47037" "1" "0.061018" "2.1789685" "-4.1" "0.28651907" "70967" "CGTCGCACTGTTTACAGCACACCCTGGAATAAATTGGGAGGAAGCCGTGGTGTCTTGCAA" "33466" "1" "0.061024" "2.1789114" "-4.1" "0.88979893" "70785" "ACCTCGAGTTGCTGATCTGAAGAAGTGTTTCGAAAACTAAGATAAGGAGTGTGAGGGGTT" "7786" "1" "0.061027" "2.1788776" "-4.1" "0.22624225" "" "GAGCAACATTCTTTGCCTCTCTTGTACCTTGAATTTCTCCTTCTTCTTTAGTATTCCTCT" "8443" "1" "0.061079" "2.1783258" "-4.1" "0.22378252" "" "CTCATACATAAGCTTCATGCTTCTAACTGTAGAGTGTGGGTTCAGTAGCACATTCTTGCT" "34332" "1" "0.061089" "2.178224" "-4.1" "0.303098" "23872" "CATGGTGACCTCAGATCAGCAAGTGACATTGATAAAGAGCCGTTATACCATGAGACCACA" "58903" "1" "0.061106" "-2.178042" "-4.1" "-0.24617179" "230657" "GAAGCCATAGTCACATTAATAATAGGTTTAGGGATAGCATTACACAATGAACTTTTCCTC" "44570" "1" "0.061113" "-2.1779678" "-4.1" "-0.24497072" "107065" "GGAATTGGGTTGGTGGGACTATAGTACAGTGTACAGAAAAGTTTTGTTATTAAAATTGTG" "55515" "1" "0.061122" "-2.1778813" "-4.1" "-0.33061389" "21885" "CGGCTTCATATTTACAGTTGGATTGGGCCAAATGTTTGGAATTTGTAGAAATAGAAGTTA" "45688" "1" "0.061144" "-2.1776488" "-4.1" "-0.65263049" "30939" "TCATGGGAATCTGGTAAGGGAGTCCGTTCAAACTCGGGCTGTAAGCAACTTGTCACATGA" "25945" "1" "0.061155" "-2.1775327" "-4.1" "-0.24897236" "11554" "CTCCTTCTTCTGCGAGCTCTGGACTTCGGTAGATGTGCTGTGTGTGACGGCCAGCATTGA" "43539" "1" "0.061155" "-2.1775259" "-4.1" "-0.25555645" "12616" "TTGATGATAGTGATGAAGAGGAGGAAGAAAGTTCCTCTGAGGGTTTAGAGGCTGAAGACT" "49868" "1" "0.061167" "2.1774053" "-4.1" "0.62869139" "13830" "AGCAGGGTTTTCTAGAGGTGTATGGAGCACTTCCACCTGGACTCAAGTTGCATTTACATT" "25344" "1" "0.061207" "2.1769828" "-4.1" "0.43094207" "13346" "CCCGGGATGGAGAGGTTGTCAGCGAGGCTACACAGCAACAACATGAAGTGCTGTAAGCCA" "49065" "1" "0.061302" "-2.1759914" "-4.11" "-0.28092374" "" "GCAGAAGGTGGGACTGCTGTAGCTGTGCAGACGGAACTTGTGCTTGTTGCGAGGGTCCTA" "24711" "1" "0.061304" "2.1759711" "-4.11" "0.34540789" "" "GCACTATGACTCTTTATCTGTTCACACTACTACTACATGCAAATGACTTACAAACTGTAT" "56904" "1" "0.061307" "2.1759358" "-4.11" "0.38828304" "101497" "GTGTCCACAGATGGCCCTCCTGAGGTCATGGTTATTTTGTTAATTAATTTTATGAAACGC" "24108" "1" "0.061363" "-2.1753526" "-4.11" "-0.43967812" "68263" "GAATGCCCCCACAGAAGGTAACTTATATGTCTAAGAAGTATATTATCTACATTTGCTGTT" "12693" "1" "0.061365" "2.175332" "-4.11" "0.37554938" "" "CAGTTTATTGCTAAGGACAGTACAGTACAGAAATCAACAAAACCAAGTATACTCCAACAT" "7863" "1" "0.061382" "-2.1751491" "-4.11" "-0.16223509" "71601" "AGCTCCAGTGGCACCCCTCACACCAGCATACAGGCATATAAAAATAAAGATAAACTATTT" "42549" "1" "0.061384" "2.1751278" "-4.11" "0.35088353" "" "CAAACCTGAAGCCATTCAGAGTAAATTTCAGAATCCAAAATATCAGAATTGTCTGGCAAA" "23146" "1" "0.06141" "2.1748638" "-4.11" "2.16389686" "14962" "TCTCATTGTTCACAAGAGAAGCCGCTTCATTCAAGTTGGTGTGATTAGCTGGGGAGTAGT" "4508" "1" "0.061475" "-2.1741756" "-4.11" "-0.18179148" "210853" "CTTATGCTGGTTTTAAGTTTCAGGATAGCAATTGTCTTTCAGTCCCTTGTGCTCTCATTT" "16320" "1" "0.061498" "-2.1739367" "-4.11" "-0.21250611" "" "ACTTGTTTACTTTATAACCAGTACACCCTTCTCTCAGCAAAGGGAGTAGGGTTTCTGTAG" "41961" "1" "0.061535" "2.173553" "-4.11" "0.69141707" "" "CCTGAAGATGAAGCAATATACATCTGTGGTGTGGGTGATACAATTAAGGAACAATTTGTG" "24054" "1" "0.061537" "-2.1735315" "-4.11" "-0.27531695" "" "CAAGAAGGCTATTACTGCCTACAGAGCTAAAGAAAAACCTGATGCAGTGAAAAAGGGGGG" "55043" "1" "0.061579" "2.1730949" "-4.11" "0.17950437" "243864" "GAGGACAGTCAGGATGTTGCTAGCTCTGCTACAGCTTCAGCTGGATCTGCACTCCCTGTT" "8331" "1" "0.061586" "-2.1730232" "-4.11" "-0.21837418" "" "AAGTGAGGCCACGTGTGGGGTACCGCAACCAATTCATCATTGCCTTCTCCAGCTGCTGGA" "15767" "1" "0.061656" "-2.1722934" "-4.11" "-0.19821177" "230612" "CTGGGTCTCCAATTCCAACTCTCTTTCTACTATACTGCCCTGTAATCCTACCTCAAAAAA" "4493" "1" "0.061658" "2.1722668" "-4.11" "1.61648643" "225594" "GTTGGCCGGAGTAGGACAACGACAATTATCTATCTTGTTTATGATTGTAAAGAAATGTTA" "5368" "1" "0.061674" "-2.1721021" "-4.11" "-0.28583404" "" "ATGTAGATGGTTTTGCGATGTGGTTGATGGCCGCCCAGGACTGACTCTGGGCTGTAGAGC" "11139" "1" "0.06168" "-2.1720396" "-4.11" "-0.37327768" "" "TCTGTCTGTGGAGTGCTGAGCTGGAGCCATAACAATGGGAGTTAAGCACGCAGCCCCATC" "27937" "1" "0.061721" "2.1716136" "-4.11" "1.24158122" "" "TAAAACCTCTGTGTACAATTCACAGCCAAAGTCTGAAAAGGAGCTTCCATTCTATTTCCT" "38003" "1" "0.06173" "-2.1715206" "-4.11" "-0.24389109" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "38944" "1" "0.061747" "-2.1713408" "-4.11" "-0.17103534" "" "GGATTAGGAGAGTTGGCACCAGTGTTCTAAAGAGAATGCATTTGTGTTCAATAAAATAGG" "35609" "1" "0.06177" "-2.1711111" "-4.11" "-0.22820595" "" "AGAGTTTAAACAAAGCCCTATATATGTCTTTGTCATTGTATGGCTGGTCAAAGTCCTACC" "4409" "1" "0.061772" "2.1710871" "-4.11" "1.36053209" "50909" "AACAGAAGATAAGTTAGCTTTCGATCTCAGGTTCGTCAGACTGCCTGTAGCTGACAGTGA" "32365" "1" "0.061774" "-2.1710605" "-4.11" "-0.3210509" "19014" "GTGGCTTTGGGGGGTATACATTTGTTTTCAGAGTCTATACCCTATCGTATAAAAATCAGC" "11513" "1" "0.061795" "-2.170847" "-4.11" "-0.21509669" "" "GTGTTTTGTTTCAAGCCACAATATCTGCCTCTTTGCTGTCCTGAACACTAAAAACTTTGG" "34658" "1" "0.061835" "-2.1704329" "-4.11" "-0.24378226" "56275" "TATGGGGCTCAAGCATCTATTGGCCTGTCAGGCTCATATGGAGCTCAGTCTGCTGCTGCG" "21814" "1" "0.061861" "-2.1701647" "-4.11" "-0.24994835" "11737" "ACTGTTCTATTTGGTTCTGTAAAATATTAGAGCAACTGGTTTTGCAGAAATGACAGGAGG" "23775" "1" "0.061877" "2.1699995" "-4.11" "0.23398682" "57875" "ATGGTGCTGTTGTAGGTGCTGTGGATGCACAGGTGCTAACTGTGGTTCCCAGGCACAGCT" "13930" "1" "0.061878" "-2.169983" "-4.11" "-0.20411079" "26465" "AAACCTGCACACCACAAACTATAACCGATAGTAAAAGTCAGATATATGGGGGGTATTGAA" "31420" "1" "0.06189" "2.1698559" "-4.11" "0.61058963" "100505163" "TTTCAAAGTATGAAGTCAACAGAATACGGTCCTCATTCAGGTTCCTCACAGACCCAGGGA" "62042" "1" "0.061894" "2.1698225" "-4.11" "0.23964064" "382066" "AGTACATCATCACAACCACCACCAATGGCAACGGGGGCAGCGAAGTGCACATCACCAAGC" "21827" "1" "0.061911" "-2.1696476" "-4.11" "-0.30195663" "75502" "TGATTATGATCCTCCTCATTGCTGCAATGGTCTGTTTCCAAAGAGTGGCCACTCATCCAA" "37255" "1" "0.061959" "2.1691431" "-4.11" "0.30095167" "50788" "CTAAGCAAGTTGCGCAGGCACGCCCCAGTTGCTAGTCTCTTTAGGGGCTCCGTTGACTAA" "28316" "1" "0.061966" "-2.1690706" "-4.11" "-0.17598654" "20021" "TATTGATCAACAGTAGTTGTCTTTTTAAAAGTTTTTATTTTTGGCAATAAAGAGCACAAC" "7948" "1" "0.061969" "2.1690384" "-4.11" "0.38421962" "216454" "ACATGGGGGACATGGGACCACAGGAATCTGCTATGCTTAAATGATCATTACCATTGTTGG" "21674" "1" "0.061997" "2.1687529" "-4.11" "0.65894904" "13421" "CGCCATTCTCAGATCTCTCCACATGTAAACATGCCCCCAATAAATAAATGTAATAAAATT" "21472" "1" "0.062004" "-2.1686815" "-4.11" "-0.21060245" "629378" "ATTGGGAGGTTAGAGAGAGGAAGGAAGATGGTTTCAATCTCGTGCCTCTCCCCACGGGGG" "61764" "1" "0.06208" "2.1678968" "-4.11" "0.3336259" "" "" "44557" "1" "0.062102" "-2.1676683" "-4.11" "-0.22855311" "" "ATTAAGGGATATGCACTTTTTGAGAAGGGTTCTAACATGATGGAAAGCTAGTTTAAGTAC" "33207" "1" "0.062105" "-2.1676348" "-4.11" "-0.20994134" "20687" "GAGAAATGTATGTTTTTTATTATGCTGTATTTTCTTTTTATTTTTTAATTATTGTTTATA" "61863" "1" "0.062108" "-2.1676021" "-4.11" "-0.23917828" "433771" "AGCCCAGAACAATATGTATTTTGAACTCATTTAGATGGATGACTTTTGTATTCTGAGTGG" "17512" "1" "0.062113" "-2.1675539" "-4.11" "-0.21603895" "" "AGTATCCCCTAGAGTCACTGCCATGGCCGTTGTCACTGCCTTTTGTGCAGACTGTGGGTT" "5822" "1" "0.062128" "2.1673986" "-4.11" "0.18580615" "259011" "TTCCACTGTAAAAGAGAGTGCCATGGCTATGATGTACACAGTGGTGACTCCTATGCTGAA" "19139" "1" "0.062154" "2.1671294" "-4.11" "0.61014274" "12822" "GGGATACAATCCTGTATAGTTCCCATTTTTATGTAATCCTCAAGAAATAAAAGGAAGCCA" "50172" "1" "0.062167" "-2.1669968" "-4.11" "-0.24171212" "13347" "AATATCTGACTCAGTGGTGTAAAGCTGTTACCACTGTGAAACTCCGTTCCATTTTCTAAT" "35031" "1" "0.062168" "-2.166983" "-4.11" "-0.28043023" "16716" "AGAGGCCAGGGCCCTCTAGAAGAAAAAGGTGCTATGTAAATCCAAGGTATTGTGAAACGT" "17708" "1" "0.062189" "2.1667682" "-4.11" "0.9883921" "19331" "GAACTGGCTTGCCCTTTGTCACTCTGACTACAAGGGTGGAAGAAATGCCTACTATGAATT" "29040" "1" "0.062191" "-2.1667422" "-4.11" "-0.23660501" "240261" "TCTGCCTTCTCAAAGCAAAGCAGAAGATAGTCCAAAGCAGAGAGAGGAACAGAGGAAGAA" "31992" "1" "0.062221" "-2.1664367" "-4.11" "-0.32406838" "71393" "TCAGAGAACTTCCTGCAAGCTCACGTTTTGGGACATGGAAGAGACTGTTGTTGGGTTTTA" "3683" "1" "0.062251" "2.1661213" "-4.11" "1.76181018" "16913" "ACCTCAGTCCTGAAGAGGCCTACGACCTTGGCCGCAGAGCTATTGCTTATGCTACCCACA" "45126" "1" "0.062314" "-2.1654724" "-4.11" "-0.19130731" "" "GTATAGGAAGATGTATGTTCATATACCCAAAGACAATGTAGAATACATAACATTGGGCTC" "13312" "1" "0.062354" "2.1650647" "-4.11" "1.65077281" "246177" "AAGGCCAGGACTTGTCTACCCTTACATGGAACATTGCAAAATAAAGATGTTATATTTGTT" "48393" "1" "0.062366" "2.1649358" "-4.11" "0.4337433" "" "AACTCACAAGGGACAATGGGGACAGTCACCAAACCTGCCTAGATAAAGATTATAAGGCCT" "32340" "1" "0.062397" "2.1646195" "-4.11" "0.36721538" "12525" "CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT" "32726" "1" "0.062397" "2.1646169" "-4.11" "0.3075691" "" "TTTATAGGGAAGAGGAAAGACTCACCAAGGAACACCAAACAAAAGCTTGGCTGACGGTCT" "36883" "1" "0.062399" "-2.1645961" "-4.11" "-0.18678226" "" "AGAAGCTGAGTTTAAGTATGTCCCTAAAAATATAATTACTTAACCCTCAGTGCATGTGAC" "52092" "1" "0.062421" "-2.1643776" "-4.11" "-0.2236036" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "53173" "1" "0.062469" "2.1638861" "-4.11" "0.33893204" "229302" "CCCTGACCACATGTGTTGCTAATTCCTGTCTGGTTCCTCTCTGGCAGAGCTTGGGAGGCA" "57086" "1" "0.06248" "-2.1637636" "-4.11" "-0.23126795" "" "CATTGGTATTGTCTCTGTGTTTAAGAGAATAAAGAAAGAGTGGGTTAATTGGGTAAAGGT" "743" "1" "0.062489" "2.1636784" "-4.11" "0.44361195" "" "ATTCCACTAAGAACTCGGTTCCTCTACCAAATTTCCGCAGACCTGAAAGCTGAGCTTTTC" "3741" "1" "0.062513" "-2.1634337" "-4.11" "-0.35321251" "15182" "TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC" "46001" "1" "0.062514" "2.1634146" "-4.11" "0.22717336" "75338" "GCTTCCAGGAAAACTCTAACTCTTCCTTTAGGGGCAGACTTTCATGACCTATGAATCATT" "15289" "1" "0.062534" "-2.1632088" "-4.11" "-0.24115749" "242819" "GGTACACTTTTTCAGATCTGTCCGATAGAAGCACTAGTTTGTGACATATCCCTGCTGCGA" "28629" "1" "0.062558" "2.1629675" "-4.11" "0.27822468" "" "ATAACCGAGAAGCTGCAGCAAAAGCATCCGCAGAGGATCACTAAGGCAGGTCCGTGCGAC" "28248" "1" "0.062581" "2.1627302" "-4.11" "0.21494579" "14186" "GAGAGACGAGAAGCCTGTGGGAACGACAGAAGAACATGGCATTTTTATAAATTATTTTTT" "41595" "1" "0.062592" "2.1626181" "-4.11" "0.28333148" "244237" "CCAACACTATAGAACTATTCACTTGATAAAACTATTCTCCACCAGTCCAAGTACTGTGAA" "36204" "1" "0.06263" "-2.1622231" "-4.11" "-0.26252384" "258649" "CATCTCCTTCATTCCATGTATAATGCAAACATTCTTGTATCTGGCCTTTGCTTCCATAGA" "432" "1" "0.062644" "-2.1620853" "-4.11" "-0.40486737" "73728" "TATGCAGCACTGCTTCGAGTCAAGATGAAGGCAGCCAGCGAGGAGCTGGACACCATAGAG" "35887" "1" "0.062651" "-2.1620098" "-4.11" "-0.27806077" "" "CACTGAACATCAGAGGATTAGACAATTAAGAACAGAAGGTATCATCAAATTCCAGTATCT" "25487" "1" "0.062681" "2.1617025" "-4.11" "1.26538838" "74558" "GGCTCAAGCTCACTCCTGCTATCTCTGTCAGCATATGGAAAATAATGGTTCAAAAAATAG" "1975" "1" "0.062716" "2.1613418" "-4.11" "0.43807553" "67664" "CTACAGTATTACCTGCTTGTCTTTGTTATGTTGCATTCAAAAACCGTGTTCATTCTGGCT" "59621" "1" "0.062727" "-2.1612346" "-4.11" "-0.20095848" "" "GATCAGTGAAACAGTTCCTCCTTTGCCCATTTGTCGGTCTAATAATTAAAATAAGTCTAT" "30245" "1" "0.062806" "-2.1604225" "-4.11" "-0.21351265" "" "ACGACAGTAGAAGGACCTCCTCCTCCTAAAGATACTGGCATTGCCCGAGTGCCAATTGTT" "39929" "1" "0.062838" "2.1600978" "-4.11" "0.3145908" "278679" "TGTGCTGAGAGGGGAGTCCCCAATATGTTGGATCAATAAAAATCCTCATGCAGTTTGCAG" "31417" "1" "0.062856" "-2.1599109" "-4.11" "-0.24002339" "78929" "GCAGTAGATCTTTGTTTATGGGACCAGACTGAGTACTGAACCTAGTGGCGGTGTGATAAA" "43429" "1" "0.062875" "-2.1597243" "-4.11" "-0.17986493" "71836" "ACCCAAACTGAAGATGACGAACAATCATATCTACAACAACAATGGCTATGGAGTGAGCAT" "40755" "1" "0.062881" "-2.1596629" "-4.11" "-0.24070927" "70369" "TCAGTATTTCTGCTGCTTTTGATGTTGCAAACGAATATCATTATAGCACATTACCTTTTC" "48259" "1" "0.06293" "-2.1591578" "-4.11" "-0.37173446" "19049" "AATGCACTTACTATCTGTCCTTAGGGGGCCACACAGTGGGGGGAGCCTGGTTCTCCTTGT" "7411" "1" "0.062951" "-2.1589402" "-4.11" "-0.17035644" "" "" "12018" "1" "0.062954" "2.1589187" "-4.11" "0.27319558" "" "AATATTGGACCAGCGAGGGAAGCTCACTGAATGAGCACAGGAACAACTTCAAAGAAAAAA" "1858" "1" "0.062961" "2.158841" "-4.11" "0.24939722" "15431" "AAAGAAAAGAAACTGAACAGGGACCGTCTGCAATATTTCACTGGAAACCCCTTATTTTGA" "16757" "1" "0.062972" "2.1587263" "-4.11" "0.86808726" "" "AGCGTCTCCAGTGGTTGTTTCAAACAAGGCAAATGAGTTCAGTTGAACTTTATATGTTCT" "8822" "1" "0.062974" "-2.1587072" "-4.11" "-0.32993556" "68087" "GTTACGACTGTGTAGCCAAAAGTGTCTTGGGCTTGAACCTTTCCAGAGCATCTGCCGCAT" "62206" "1" "0.063029" "2.1581544" "-4.11" "0.29720411" "27382" "ACATCATAGAGTGTGGATAGCTGTAAATGTGGAAACTTCTCATTCATCACATGGCAACAG" "23374" "1" "0.063031" "-2.1581293" "-4.11" "-0.3942826" "" "GTTGCTTGTGTCTCATGAAGGAAGAGGAAGTTTAACCTTGAGATTAAAATCAATCAGATA" "33259" "1" "0.063043" "-2.1580064" "-4.11" "-0.2025455" "70047" "ACTACTAAGTTACATAAAGAAGACCTAAAGATGAGCCCTGTATGAAACAGGGGAAGTCTT" "17549" "1" "0.063053" "-2.1579094" "-4.11" "-0.27719379" "" "ATGTAGTTTAGATGTTTTTCACAATAACACTCTTCTCCTGGTGTATAACTGTATTAGTTT" "34895" "1" "0.063092" "-2.1575031" "-4.11" "-0.23660467" "" "GGGTTACGAGCTCAGTCTCAGCATGCTGATACTATTTGAATAAACGTCATGCAATATTGC" "26753" "1" "0.063096" "2.1574669" "-4.11" "0.46526889" "" "" "23401" "1" "0.063123" "-2.1571949" "-4.11" "-0.17412116" "17127" "TATAAACGCCCTTCTAATAAACTTTTCACCGTAAAGCTCCTGAGACAGGAGCACAGTCTG" "17203" "1" "0.063179" "-2.1566271" "-4.11" "-0.17479571" "28036" "AATGCACAGACTGAAATTAGAAAGAAGCACAGTTGGAACCTCGAGGTCCTTTCTGGGGAT" "49768" "1" "0.063184" "-2.1565722" "-4.11" "-0.24363651" "117592" "TGCAGACTGTGTTGAATTCATCTCAAAATGTTACTTGTCAAAGTTGTCTTTGTATTGTCC" "55530" "1" "0.063197" "-2.1564412" "-4.11" "-0.24996146" "101739" "TCACAGGAGGAACATGCTAAAAGGCCAACATGAGAAAGAAGCTGGAGATCGGAAACGCAA" "13922" "1" "0.063222" "-2.1561907" "-4.11" "-0.16149983" "" "TTTAAATATGGAAAAGCCAGGGCCTTATGGTCCCATGCTGTCCTAACTAGCATCAGGACA" "31725" "1" "0.063229" "2.1561191" "-4.11" "0.35143553" "" "CAGACCCAGGTCCTCATGTTTCTTCTGCTCTGGGTATCTGGTGCCTGTGCAGACATTGTG" "43944" "1" "0.063231" "-2.1560965" "-4.11" "-0.25169539" "239554" "CTTTGGATCAAATTTGTGTTTATTTTTCGAATGTGATTATATGCTACTGAAATAAAAAAT" "22758" "1" "0.063234" "-2.1560671" "-4.11" "-0.22447554" "258027" "CCCAAGAGCAGTTATTCTGAGAGTGATGGAAAATTTGTGGCCCTTTTTTATACTATTGTC" "38344" "1" "0.063286" "-2.1555357" "-4.12" "-0.18656051" "" "" "15743" "1" "0.063306" "-2.1553295" "-4.12" "-0.4081232" "" "CATTGTCTTGGTTCATTCTTCACTCAGTAGATTATTGCTTTGGATCCTAAATGCCAATAT" "35665" "1" "0.06333" "2.1550936" "-4.12" "0.24766899" "12580" "CAGTGTCTGACTTGGAGACTTTGTTTTAAAAATTATTTGTCCTGATGCATCTTTTGCCTA" "2886" "1" "0.063339" "-2.1550021" "-4.12" "-0.38059485" "13112" "AAGGCACCTCCCACGTATGATACTGTGATGGAGATGGAATACCTGGATATGGTGCTTAAT" "50704" "1" "0.063346" "2.1549308" "-4.12" "0.33707434" "67374" "CCATGAAGACCTGTCTGTCTGCTGTTTTCTGTGACTTGAACTCTAACAATGTGTCAAAAT" "39871" "1" "0.063348" "-2.1549033" "-4.12" "-0.21670575" "114228" "TTCAATAGGAAGACCCTGAACAATGACATCATGTTGATCAAGCTCTCATCCCCTGTGACC" "54540" "1" "0.0634" "-2.1543847" "-4.12" "-0.32950528" "23856" "GTAAGAAGGCTGGCTAACGTATCTGACTGTGCAAATATGTTTGATAGTTCCTTTTATATT" "1569" "1" "0.06341" "-2.1542791" "-4.12" "-0.37210265" "" "GGCCTGATTGGTGAGAAGCCGAGAGCAGACGACATGAAATGGGCCCAGAAGTTCAAGTAG" "8279" "1" "0.06341" "2.154279" "-4.12" "0.32755475" "73748" "CTAAGACCGATGCTAGAAATAAGTTGGATTTCATGAAATAAAAAGCTCTGTCAGCACTGT" "35468" "1" "0.06341" "-2.1542785" "-4.12" "-0.22735503" "" "GGCAGGAGGATTATTTTCCTTCATTCATTCCTCCTTACAAAAGGTTTTTCATTTTGAGTT" "29301" "1" "0.063421" "-2.1541628" "-4.12" "-0.16079053" "68080" "CAAAGTAGAAATTAATGCACAAAGACTTGTGTATAATATAAACCAACCTAGCCACACACG" "26866" "1" "0.063422" "-2.1541545" "-4.12" "-0.24735207" "12315" "TGTGTTCAGTTCAAGCTGTGAAGAAAAATATATATCAATGTTTTCCAATAAAATACAGTG" "46875" "1" "0.063423" "2.1541498" "-4.12" "0.23779195" "" "TTTCCAGAATCCTCAATGGAGTGGTATGACAGATAATTACCTTTGAATTGGAAGCCATGG" "8712" "1" "0.063423" "-2.1541478" "-4.12" "-0.18629961" "" "" "42042" "1" "0.063426" "2.1541216" "-4.12" "0.96821465" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "1120" "1" "0.063442" "2.1539555" "-4.12" "0.30942338" "" "AGTTTCCTAGATGTGTATGGGGTTTGTTGGGTGGATATGGCAAGTTCTACCTGCTGTGTT" "38218" "1" "0.063501" "-2.1533601" "-4.12" "-0.17085649" "26448" "TATGACCCTGACGAACGAATTGCGGCTCACCAAGCCCTTCAGCACCCCTATTTCCAGGTG" "33006" "1" "0.063509" "-2.1532757" "-4.12" "-0.25260264" "20462" "AACCATTCTTAAGTTATCAGTAAAAAAGTAAAAAGTTAAATAAATGTCTTTCAGGAGTCC" "42689" "1" "0.063519" "-2.1531721" "-4.12" "-0.16029709" "66618" "CTTGGATGCTTGCTAGGTGTTCTTAAAAACTGAAAGTGAATTGCATACATTTCCCCAATA" "55195" "1" "0.063529" "-2.1530704" "-4.12" "-0.1876017" "" "CCCACCGGGTGGTCTCTGCCAGGCAGAATTGGCCATCAAAGGATAGGGTCTTTGCCTCGC" "723" "1" "0.063534" "2.1530218" "-4.12" "0.18805626" "227327" "GAGGTCCAGGAATAGCCAGAACTTCCCTGACTGGAGGTCATCCGAGAACCTGGATCTCTC" "38883" "1" "0.063545" "-2.1529139" "-4.12" "-0.32959977" "" "CTCCTCACTGTAGGGGCGGCCAGTGTGGCAGAATCCAAGCTTGTCTGTTTGGCTTTTGTG" "34751" "1" "0.063549" "-2.152876" "-4.12" "-0.23077536" "666676" "TCTTTGGGTCACCTGCATTCCATAGCATTGTGCTTGTACTTGTGCTCACACGATTACGTA" "44099" "1" "0.063564" "-2.1527182" "-4.12" "-0.25161356" "73533" "TGTTTCAAAGCCCCAACCAGATCTGTAAACGGGGAACTTTGGTACAAAGCAATATGGTAA" "3937" "1" "0.063629" "-2.1520629" "-4.12" "-0.18649595" "" "TTCCCACAAAACTCTGAAGTTGCGACTCTGAAGAAACGGCATCCTTTTTCTTTCGTGGCA" "61124" "1" "0.063647" "2.1518852" "-4.12" "0.17253127" "" "ATACAGAAAGTACAACAGGAGCTAGCTTGTCTTCTGGGTCTCCACAAGCACAGCTATTTG" "36081" "1" "0.063676" "-2.1515865" "-4.12" "-0.18598876" "258917" "CTCAGGAACAGGGAGGTGCAATCAGCTTTCCACAGAACCATGCGCTGGTCTTCAGTTTGA" "46232" "1" "0.063684" "2.1515102" "-4.12" "0.9368749" "" "CAATGTGTATATGGCATATAGTGAAAAAACACATGTAAAATCCAGCTCTTGATCCTAGGA" "32145" "1" "0.063693" "2.1514205" "-4.12" "0.41892647" "76469" "TATGATGAGAAAGCACAGAGCTTCGAGGAAGTGAAGAAGAAGAAGATGGAGTTCCTGCAT" "1510" "1" "0.063697" "-2.1513791" "-4.12" "-0.34401358" "19058" "GAGGGCATGGTTTATGTTGAATGTTTAAATTTTCTTCTGCATGATACATGTCATGTTGTG" "14942" "1" "0.063751" "-2.1508342" "-4.12" "-0.16683042" "69893" "TCAAGTTTGTTTTCAGAATGTCTTGAAAATAGTATTTGGTGTGATTGAACACCATAGGCC" "5078" "1" "0.063766" "-2.1506804" "-4.12" "-0.26121506" "329697" "GCTTTAAATAGCACATTCTAGGCTTAAAGGACATAGGGAGACCTTGTCTTAAATAAACAA" "41292" "1" "0.063785" "-2.1504927" "-4.12" "-0.19029885" "" "AACAGGGTCAGCATGTACTGCTGCACTTTGCAGATGGCAGAGGCCAGGGAGCTGATGACT" "25219" "1" "0.063786" "-2.150483" "-4.12" "-0.20381214" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "61475" "1" "0.063798" "-2.150358" "-4.12" "-0.24222226" "268319" "TGACCTTGTTGTAGGGTTTTGGACAAGCATAGCCCAGGGCCTTGGCCTCATCCCACACAG" "52706" "1" "0.063824" "2.1500946" "-4.12" "0.33692186" "434197" "AACTCATAAGTATCTCTGTGATTTAGTAACATTATTGCTCAATAAAGACCTTCCACATGT" "24978" "1" "0.063898" "-2.1493579" "-4.12" "-0.3552544" "269784" "GGCACAGTTTGTCCTGTCTTTTCCTTGTGTTGCCACCACATGACTAATAAATGTCTAACC" "1070" "1" "0.06393" "-2.1490289" "-4.12" "-0.33381952" "269999" "TTGATAGATGGTATGAGTCCATCAGGTGCTGACAAGATCTGATAAACTTCTGAATGTGGT" "29100" "1" "0.063955" "2.1487834" "-4.12" "0.73631336" "21784" "TTCAACCCCTCAGACTTTTAGTCCTCGAATTCGGCCTGAGAATTAAAAGAGATGAATGTT" "21233" "1" "0.063968" "-2.1486531" "-4.12" "-0.37208372" "18627" "ACCTTTCACAGTGATCAGGTAGTAGCCATGTTTTAAAGGAAATTCAATGTTACAGACAGC" "60391" "1" "0.06404" "-2.1479281" "-4.12" "-0.41590355" "" "GTCAAGAAATACAGATACAAAAGCCTGTGATGTAACAAATGCCAGGAAAGGATACTTAGA" "8504" "1" "0.064065" "-2.1476825" "-4.12" "-0.17398474" "108098" "GAAAATCACGAAGCTGCTACATGTCTGGAGGATGTTGTTTATCGAGGAGACATGCTTCTG" "48381" "1" "0.064066" "2.1476703" "-4.12" "0.63487921" "" "TTTTGCAACCATCCACGGTTTATGATGCTCGTCTTCATAGATGCCCTGTCTTGTGAAGAC" "36792" "1" "0.064081" "-2.1475132" "-4.12" "-0.29263395" "77521" "AAATGTTTTAGTATAGTGAGAAGCAAAAGAGAAACAACTCCAATTGTCCTTGAGCGACGA" "32385" "1" "0.064088" "2.1474427" "-4.12" "0.33694258" "66147" "GGAGTAAGCAGCTTTTTGAAAATGTTAATACATTACTCTGCTAATATGCTGACCTGCACT" "25424" "1" "0.064099" "2.1473346" "-4.12" "0.3145854" "" "GGTCATTCATATGGACAGAACAAAATGGTCCTTTCCTGTAATGGGTTTTGGTAAATTTTA" "48821" "1" "0.064116" "2.1471621" "-4.12" "0.6356261" "66775" "GCATTCACCATCTATCAGTCACTGCCTTATTTTGAGTCATTTGGTACAAACTCCACCGTG" "42374" "1" "0.064133" "2.1469994" "-4.12" "0.21913931" "" "CTGTGTTGGCAATCTTTGACAATCCCAGTATCTTTGCCAATAAAATGTGTTTTGTTCTAA" "17499" "1" "0.064137" "2.14696" "-4.12" "0.20950204" "80837" "CAATCATGTTGAGCATATGAAAGCCAATTGAGAAGACCAAGTGAGATTGTTTTGTTTTGT" "29123" "1" "0.064146" "-2.1468624" "-4.12" "-0.52067442" "432589" "TACATACATGGGGCCTAGAAAAATCTAAGTAAGAAAATAAGTCTGTTGTTTGTGTACAGA" "59227" "1" "0.06415" "-2.1468243" "-4.12" "-0.17391953" "73415" "TATGGTGAAGAAATGAGGTTCTGTGATGCGACCAGCAAGAACATACATCCCAAATCCTAA" "14672" "1" "0.064158" "-2.1467492" "-4.12" "-0.21367268" "245638" "TGTGTTACCATACCACATACTATTTTCAGTGAAGCTAAGCACTTCTCAAATTGTGTCTTT" "50844" "1" "0.064165" "2.1466731" "-4.12" "0.34133313" "234839" "GCCTGGCTCTCCCTTCCCACAAGTACTGTAGGGTTTTCTAAGTAAAACATTTTTATTTAT" "19182" "1" "0.064179" "-2.1465351" "-4.12" "-0.25780121" "" "" "52208" "1" "0.064227" "-2.146055" "-4.12" "-0.21771159" "18861" "CTGTCAATGAAGCTGTACTGATAGAAAATCTGGAAATATTCAGAAAGAATGGCTTTGACT" "22561" "1" "0.064234" "-2.1459886" "-4.12" "-0.18268963" "" "TATACTTGAACTCAGACACTGCATGTGGATGTCAGCACTGGCATTTTGTGGTGTGCAGAA" "36803" "1" "0.064258" "-2.1457441" "-4.12" "-0.30810376" "100042480" "CGAAGGATTATTGCACAGTTCTCAAAAGACTACGAACCCACTGACAACCCCAGTACCTAA" "48865" "1" "0.06426" "-2.1457292" "-4.12" "-0.27609215" "" "GCTTTCGGAAGTCCTCAGCATGGTTGTTAAAAGCGATAATCTCTGTGGGGCAAACAAAAG" "22711" "1" "0.064324" "-2.1450833" "-4.12" "-0.35061675" "319455" "TCTTGAAATAATCTCTGTGGTATCCTGGTAGCACCAATACCAGGCACTCTCCCGAAGAAT" "58196" "1" "0.064417" "-2.1441558" "-4.12" "-0.18556996" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "48792" "1" "0.064426" "2.1440668" "-4.12" "0.2641449" "100042568" "ACAATCCTTCTGGGACAAAGCAGAGTGGGAGACTGACATCCACAACAGTCATTAAAGAAC" "20285" "1" "0.064432" "-2.1440067" "-4.12" "-0.28278449" "" "CTTCCCTTAAACACCATAAAGGATAAACTGTACCATGCATCTATCTATATGATTTTTCCC" "247" "1" "0.064438" "2.1439461" "-4.12" "0.97824646" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "32302" "1" "0.064441" "-2.1439189" "-4.12" "-0.2337947" "" "CTTTGTGTTCCTAACAGTCGATATTGGTTCCTGCTGTTACAACTGTTACAATGTTAAATA" "43375" "1" "0.06446" "2.1437243" "-4.12" "1.62956126" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "12142" "1" "0.064465" "-2.1436761" "-4.12" "-0.27070083" "13796" "AATGACTAGGGGAACAATCAAGAGCCCACAAGGGCAGGGCATTGCTTGCTGCTGGCCAAG" "18264" "1" "0.064478" "2.1435522" "-4.12" "0.23119167" "225471" "TAAGCAAAGCCTGAAACTTTTATGAGGTGAAACATAATTGTAATCATTGCAGAAGGCATG" "59081" "1" "0.064493" "2.1434001" "-4.12" "0.30489617" "14283" "CTAGAGCTGGCCTATCATAATTTGCACAAAATTAGAGGAAAATATGTTCCCTCTGCCAGA" "9949" "1" "0.064509" "-2.1432451" "-4.12" "-0.18668435" "66682" "TATGTGCCTAAAATAAATGTAGAGTGGTTATTCGCCCTTTAGACATCGGCTACTCAAAGT" "28783" "1" "0.064536" "-2.1429685" "-4.12" "-0.26378522" "" "AATACTCCCGCAGCCCACCGAATCCCGTTGGCTTGGGGACTTCAAGAGGACAAGAAGGAA" "23799" "1" "0.06454" "-2.1429357" "-4.12" "-0.25611004" "56468" "GTGTCTGAGAACGTCATCCAAACCTACTTTCAAAGCATAATGTGCAATTAAGTTGTTATG" "19649" "1" "0.064543" "-2.142897" "-4.12" "-0.19475635" "18226" "TGTCTATTTTATTTCTCTGCACTCTATTGTAGCCTTTGTGGTCCCTGATCAAAATGTTTG" "7203" "1" "0.064569" "2.1426426" "-4.12" "0.81122408" "75345" "TGAGCCAGGTGCTGTGTTACACTTTCATGGATTGTTGCAATACACTCACTCTTGCTTGAT" "62875" "1" "0.064572" "2.1426091" "-4.12" "0.23270574" "100046290" "AAGACAATACTGATACCCTGTTTGTTTAGCCTGCCTTTAAGAGAACAATGTTGGGCCGCC" "4984" "1" "0.064582" "2.1425097" "-4.12" "0.77482097" "" "" "61238" "1" "0.064587" "-2.1424622" "-4.12" "-0.20449305" "226823" "AGGATGAAAATGAGCATAAAGTGGAGTTCCGAAAGAAAGGGTTTGAAGCAGGAGGATTTC" "24709" "1" "0.064605" "2.1422879" "-4.12" "1.0632609" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "29532" "1" "0.064643" "2.1419038" "-4.12" "0.62333536" "18037" "GGTCATGCACGAAGAAGGAGAAGAAATAAATCAACATACTTTCCGATGCTTAGCGCTTAT" "21907" "1" "0.064646" "-2.1418777" "-4.12" "-0.27164923" "70357" "TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA" "39785" "1" "0.064665" "2.1416863" "-4.12" "0.31744311" "20975" "GAATTTTAAATGGTTGTTCAATCTGTGTGTGTGTGCCATTTGCTTGTTCGTTTTGTGTTT" "24995" "1" "0.064693" "2.141414" "-4.12" "0.23251345" "214111" "AAAGCAAGAAGGCTAGTCCTTTGAATAGTTTATCAGTGGGTCTTAAGAGAGTTTACAAAG" "10129" "1" "0.064726" "2.1410787" "-4.12" "1.36532003" "15978" "CTTCCCTATACAGCTGAAAACTGTGACTACACCCGAATGACAAATAACTCGCTCATTTAT" "40550" "1" "0.064732" "2.1410186" "-4.12" "1.4422192" "16186" "CATCAATCCTTTGATGGAACCTCAAAGTCCTATAGTCCTAAGTGACGCTAACCTCCCCTA" "31923" "1" "0.064763" "-2.1407164" "-4.12" "-0.23734694" "246179" "CTGTTCTTCTATTCCAATATTACTTCAAGTTTCCAAAATGGAAGGTTAACATGAACCTGG" "39497" "1" "0.064779" "-2.1405555" "-4.12" "-0.31012981" "17954" "CAGGCAAAATCATATTTATTATTGATAACAGCTAGTGCAAGGCTTCTGATTGTATGTGAC" "39889" "1" "0.064781" "2.1405328" "-4.12" "0.4955195" "209200" "GCTGTGGCACCATTGTGATTAATTATGAAATAAAAGATGGCATCCAAACAGTAAGTGTGC" "24230" "1" "0.064869" "-2.1396634" "-4.12" "-0.18561036" "22293" "AAAGGAAATTTGTCCATGTGCCTTCAGATGTAAAAGATAAAGCTATGGGTTTCCACTCTC" "3661" "1" "0.064871" "2.1396482" "-4.12" "1.02715079" "14998" "GGAAGTGAGCCCGAAGCTTGAAGGTCAAATCCCAGTGTCCAGAGGTTTGCCTGTGGCAGA" "27589" "1" "0.064893" "-2.1394321" "-4.12" "-0.40885914" "" "CCAGGGATTATAGCATGGAAGAGTTCCTCTTCTCAGAGGATATTAAACTTTTTGAGGATT" "25174" "1" "0.064949" "2.1388704" "-4.12" "1.09658684" "57444" "CCGCAATGTGTAAAACCAAGAACACTCCCCCATTACAGCAACTCTCTTGCTTTGAGGCAA" "59259" "1" "0.064989" "2.1384747" "-4.12" "0.3326154" "" "ACTACTGCAGTATAGATTCTCAACAAAGGAAACATTTTCAGAAATGAACTCTCAAGTCCG" "28339" "1" "0.065022" "-2.1381472" "-4.12" "-0.2347823" "" "TGTCTTTTCTTGGAAATGCACCATCTCTAATGAGCTTCCTGAATACCCCAAGTAGGCCTG" "4565" "1" "0.065071" "-2.1376634" "-4.12" "-0.5599898" "" "CGTTCTGTGCTCTGTTTACTCAACAGCCACTTTATAATCAAAGCTGTTAAACAAAATTTC" "40528" "1" "0.065073" "-2.1376438" "-4.12" "-0.24787735" "" "CTTGCAGACCCAACCTCCAATACCACAGAAGTCTTTGGTCCCAGTCAAAGCTCTTTGGAG" "19654" "1" "0.065101" "-2.1373678" "-4.12" "-0.31885233" "" "ACAGGGTCCCTGGACATCATCCATGTGGCATACTCTTATGAATAAAGTTCTATAGGACAC" "31806" "1" "0.065173" "2.1366578" "-4.12" "1.76559122" "434341" "TAAACTCACAACACTCCATATCAAATGATCAATAAACGCAGATGTAACTGGTGTCTGATG" "62603" "1" "0.065184" "2.1365503" "-4.12" "0.37926776" "93670" "TCCTTTTACCTCTGCATGTGTCATGGCATATGTTACACAAAATAAAAAGACAGTTTGGAA" "21266" "1" "0.065186" "2.1365363" "-4.12" "0.83961447" "14103" "GCAATGATGTCTGTGTGTTTGTATGTATGAGAGCAAACAGATTCTAAGGAGTCATATAAA" "26263" "1" "0.065218" "-2.1362164" "-4.12" "-0.2867062" "74934" "CCAGGAAGCCAGAGTTGAGAAGCATTTACAACCAGTTCTTCAAACAGCCTAAAGAAAAAA" "50292" "1" "0.065223" "-2.1361654" "-4.12" "-0.17690779" "12583" "CTATGCTCAGTTCTACTGCAAAGGGTGTGTCCTAAGGAAGCAAACAATACCCTGAGCTAT" "35050" "1" "0.065282" "-2.1355837" "-4.12" "-0.23100324" "" "GCAGCCCGGGAACCCCATATTCCGATATATACAGCTTTATTACAAAATAAAATCTGTAAA" "36884" "1" "0.065285" "-2.1355593" "-4.12" "-0.35097382" "93878" "GTACTAAGCATAGTTCATGTTTTTTCCTCCACCTATGAATGATTTTGGTGATTAGTACTC" "20578" "1" "0.065311" "-2.1352999" "-4.12" "-0.28962054" "241656" "ATTGGCAGAAGCTGCACCACAAATAAAGTAAGTGTTTGCCTTTTTCCCACCGTGCTGTTG" "29628" "1" "0.065312" "-2.1352925" "-4.12" "-0.31462659" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "27691" "1" "0.065345" "-2.1349706" "-4.13" "-0.22507658" "13406" "GCAGTGTAAATTCTATCCCTGAGTCCTTTCTATGTGTTGCACATAGAAAAAATTCTGCAC" "56777" "1" "0.065358" "2.1348347" "-4.13" "0.22163629" "17868" "CTAAGGATAATGTTAATACTGGGAGCATAAAGTGTGTGGGCTTCAGAAGTGGTGACTGGG" "35210" "1" "0.06538" "-2.134626" "-4.13" "-0.31818757" "17311" "TCTTCAGTCACAACCTGCAGCCTGTCGTTAATTATGGTCTCTGCAAGTAGATTTCAGCCT" "39398" "1" "0.065384" "2.1345817" "-4.13" "0.20851867" "17172" "CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA" "32767" "1" "0.0654" "-2.1344285" "-4.13" "-0.2851817" "" "AGAGATATTGAAGAGTTATCCACAGGAAAACGGCTATAGAACATGAGAAATGACGTCATG" "13273" "1" "0.06541" "-2.134324" "-4.13" "-0.23918017" "" "TGTTGGAATTATCAGGCCCTTCCTTAGGCTGGATCAACTCCTACTTTAGCTCCCCAATTT" "21402" "1" "0.06544" "2.1340322" "-4.13" "0.22370357" "" "GTCAGAAGACCATCAGTCATGGTGATAGAGCTGAACAAGTCACCAGAAATGGTAAGTTTT" "52191" "1" "0.065483" "2.133609" "-4.13" "0.22860203" "" "ACTCTGATGAGCTTTAACAGCTTATTCTACAAATGTTCCCACATTCCTTGCTTTCATAGT" "27163" "1" "0.065489" "-2.1335561" "-4.13" "-0.1891293" "75901" "CAAACGCTGCAATGCAATACAGATCACTTTGAAGTGGGGAAAAATGCAAAGTTGTGTTTC" "5423" "1" "0.065515" "-2.1332943" "-4.13" "-0.27747852" "" "GTCTGCTGCCACAATTCCCTGCCATGATGGGAACCATAGTCCAAATAAATCCTTTCTTCT" "40398" "1" "0.065524" "2.1332062" "-4.13" "0.38513177" "77106" "GAGCCCGTATGCAGTCATGAGGAGAAGTTACCCATTTTTAATAAAAAGAATTATGTACTT" "31902" "1" "0.06553" "2.133148" "-4.13" "2.14684112" "641221" "TTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAAACA" "29650" "1" "0.065535" "-2.1330994" "-4.13" "-0.16609859" "" "ACACCAGGTACCCTGTTTCTAGTCAGTTGAAACGAGGGGGGAACTTGACTTTTAAAACTG" "61479" "1" "0.065555" "2.1329049" "-4.13" "0.29375207" "56176" "CTGTGTATAAACATCCTAAAACCAGTCATTTACAGTTGTGGGCTGAATAATTTTGAGCAT" "34737" "1" "0.065583" "-2.1326309" "-4.13" "-0.22477158" "" "TTGCCCTTCTATCAACTCCGTTGTCAAGGCAACATTATGGGCTGAAGAGATATAGCTCAG" "26712" "1" "0.065606" "-2.1324052" "-4.13" "-0.28611974" "" "TTCTCTGCTGCTTCCTGCCACATTGACTGTATCATGCATGTATCGTGCTGTATTGTGCAA" "44372" "1" "0.065632" "-2.1321548" "-4.13" "-0.21757225" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "49003" "1" "0.065672" "2.1317619" "-4.13" "1.55991752" "240328" "GTTTTACAAAACTTGAACTAGACCTCGCCAAAGCAATCACAAATATGAAAAAGAATTACT" "15051" "1" "0.065711" "-2.1313733" "-4.13" "-0.2289004" "223473" "TGTTGGCCTGCTATTCAATACCACCTTTTAAAGGATTGCACATGTTCGTTCTGTGTCAGC" "5334" "1" "0.065728" "2.1312085" "-4.13" "0.21407817" "71797" "TGGTCACACTCATTCCGACTGGGTAGGGTACAGGTTGCTTTAGGTGACCATAACCTTGTC" "14820" "1" "0.065732" "2.1311758" "-4.13" "0.32062382" "" "TGTCTTAGGCGCTGCAGACGTCTGTTTGACGGTCTCTGTGGGATTGTAGAATGTTCTCAC" "14515" "1" "0.065739" "2.1311048" "-4.13" "0.23778081" "" "CTTAAGGCTCCCGACAAATGAAGATAATCTTTCATAGACATAACATAGTATTTTATCCCC" "46744" "1" "0.065742" "-2.131078" "-4.13" "-0.18675398" "15434" "TAGTTGATGTTAAAGGATTGAGATCACAAATGGTCCTTCATGGGTAGAGTCAGGCAGCCC" "16929" "1" "0.065745" "-2.1310498" "-4.13" "-0.32464519" "81703" "CTATGGTCTGTTATGGACATCCACCCACCAGTTAAGGCCATTGTAATTCCTAAGTACTGT" "47484" "1" "0.065746" "2.131032" "-4.13" "0.94880157" "16391" "GTCATGGACCCTAAACCTTTAGAAATGTGAGCTCCAAATTAAATTTTGCCTTTTCTAAGT" "27245" "1" "0.065748" "2.1310108" "-4.13" "0.26894388" "632737" "AAACATCTCCTTCCACACAAAGTCAGGATGTTGTGGAAGGAGAACAGACAGTTGCTAGAG" "20045" "1" "0.065753" "-2.1309654" "-4.13" "-0.22621674" "434156" "CTACATAGTACGTACATATATCAGCATCTGAGGTTTGATATGTTCAGTTATCATGGAAGT" "42129" "1" "0.065841" "-2.1301031" "-4.13" "-0.37480988" "216011" "CCTATGCTGTATAATGAGAGCCTATCTCAGTGCAACAAAAGCAGACAAAGTAAAAGAAGA" "31908" "1" "0.065859" "-2.1299355" "-4.13" "-0.67562257" "71753" "AGCCTCTTGGGGGAACTGCACAGAGAAAGAAGGTGCCTCTATCAAGGCTCTATCAGAGCC" "23885" "1" "0.065859" "-2.1299301" "-4.13" "-0.22112473" "66385" "CACTGCTTTTACATAAGAACATAAATGCAAAGGTCTGAAATCAAAGATCAGCAAATCAAA" "56475" "1" "0.065861" "-2.1299153" "-4.13" "-0.28250803" "" "GCTGCCCTGAAGCCAGAAGATGTGGGACACTGTCAGCAGAAGGAGTTGTGACAACCACAC" "18110" "1" "0.065865" "2.129875" "-4.13" "3.15193362" "16061" "TCGGGTAAACCCACCAATGTCAGCGTGTCTGTGATCATGTCAGAGGGAGATGGCATCTGC" "33735" "1" "0.065884" "-2.1296898" "-4.13" "-0.29032576" "" "AAATCGATTGTCAAGTACAAGACGGCCATGTACATGGCAGGCATTGATGGGGAAAAGGAA" "42059" "1" "0.06589" "-2.1296246" "-4.13" "-0.24977312" "14042" "TGTGACAAAATTGCCTCCAATCAAAGTGACCCAGAAGAAACAGTATAAGGAGACAATGAT" "62487" "1" "0.065908" "2.1294579" "-4.13" "0.86060228" "" "GCCACCAAACTGAGAAGTTGACTTGCCTTTAATCACCTGTAACTTTGTTAGAATAATAAA" "46146" "1" "0.065935" "-2.129193" "-4.13" "-0.3366031" "" "TGACACATTTGAACCTTACTTCATGACGTATTAGCTTGATTTTATGTAGCTGAATGGCCT" "18745" "1" "0.065935" "2.1291913" "-4.13" "0.22162794" "" "TGGAAAAGTCCAGACCTTCAAGACTGTCACTACATGCACAAAGATGTTAGTTTCATTCTT" "3864" "1" "0.065949" "-2.1290526" "-4.13" "-0.29805961" "64450" "CTTCCCTACCAGTGAAATTGCTAGCATTGAACTGTATTATGTGTTTTTTGTTGATTCAGT" "4915" "1" "0.065956" "-2.1289871" "-4.13" "-0.26703636" "" "ACGAGTATCAGAGGATGACGGGCCGAGACATTGAGAAGAGCATCTGCCGGGAGATGTCTG" "58480" "1" "0.065958" "2.1289651" "-4.13" "0.24684088" "276742" "GGGAGATTTACTGTAAATTACACACTTGTTTTGATGTATCTTTCTGTAGTTCTTCTATTT" "53583" "1" "0.066018" "-2.1283848" "-4.13" "-0.34800493" "207565" "TGCGAGCATTCCTCAGCTGTGGTGGTAGAGGTCTGTCTGGAGGCTGAACACACTTCATGT" "58060" "1" "0.066036" "-2.1282091" "-4.13" "-0.25372191" "" "TTTCCTAGGCCAAGTCCCTAGCTGATGAGTGGCTGGCCATGTAGAACCCAGAGAGTCTGG" "10005" "1" "0.066094" "-2.1276424" "-4.13" "-0.20243065" "56335" "AGCTATTAAATACCACAACAGCCAAGGAACAGTCCATTGTTGAAAAGTTTCGCTCTCGAG" "30649" "1" "0.066109" "-2.1274992" "-4.13" "-0.21339511" "" "TTGAGGCTAGGCTCCAAGTTTATCTGCGGCCTTCCTCTTGCATTCACCCACCACCAGCAT" "50515" "1" "0.066117" "-2.1274184" "-4.13" "-0.27029784" "98741" "ACTGCCAGCACAAACTACAAAGTGTATTGTTTAAGGGGGGAAAAAATCTAAATTTTGTTC" "32124" "1" "0.066125" "-2.127343" "-4.13" "-0.21551458" "" "TCCTGAGAGTCGGGTCTCAGCCAGTCTCTAGTGTGAAAATGTGCCATTGTGCTATTTTTT" "40418" "1" "0.066194" "2.126671" "-4.13" "0.31313147" "75766" "TGATATTGATGGAGTCTTACCTCTCTGAAACCTTAAGCCCAAATAAATCCTTCCTTCTAT" "23620" "1" "0.066238" "2.1262397" "-4.13" "1.34149502" "" "AGGCAGAGTCACCATTACTTGCAAGGCAAGTGACCACATTAATAATTGGTTAGCCTGGTA" "47417" "1" "0.066259" "2.1260409" "-4.13" "0.98973635" "56045" "TGAACTGAAGGCCGAAGATTTCATAGTTGATGTTATCAATGTGGATTATGGGATGGAAGA" "57454" "1" "0.06627" "2.1259292" "-4.13" "0.20921221" "112419" "CCTTGCAAATATGTCACCCAACTTCCTTATTGTCTTCTACATAAAAAGTCTAATGCTTGA" "14453" "1" "0.066297" "-2.1256666" "-4.13" "-0.1745342" "57443" "CCGCCACACTATTTCTTCACATACCGAATCAGGATTGAAATGTCAAGGGATGCTCTTCCT" "14807" "1" "0.066308" "2.1255661" "-4.13" "1.51772085" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "14094" "1" "0.066311" "2.1255393" "-4.13" "0.29689127" "449000" "CCCGGATAATGCAGTGAATGTGATAAAGGCTTTGTTATTGTAGTCTGAAAAGGAATTTTA" "38594" "1" "0.066363" "2.1250306" "-4.13" "1.09593622" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "52410" "1" "0.066364" "2.1250181" "-4.13" "0.27362544" "16443" "GTTGGGCTCTTCCCATCCAATTATGTAAAGCTGACCACAGACATGGACCCCAGCCAGCAA" "59956" "1" "0.066368" "2.1249849" "-4.13" "0.42372305" "14841" "TAGACTTTCAGAGCCTCTTTAAGTACACTTTTAGGCCTCTGGTACTAATCTCTGCCACTA" "15905" "1" "0.066383" "-2.1248354" "-4.13" "-0.18226529" "" "GAGGTGGTGGGTATTACGGATAAAAAGAATTAAGGTATGACTAGCTTTACTCTAGATTAT" "4570" "1" "0.066389" "-2.1247834" "-4.13" "-0.27941645" "74486" "AAGACACACTGATGGGCGGAGGTGCAGTGCTTCCCGTAATAGGCCTGGTTTTGTAGGAAT" "6253" "1" "0.066392" "-2.12475" "-4.13" "-0.34908619" "16539" "GGGGGAATCCCAAAGTGCTTTAGAGACTGTCTTTTTAACATTTCTTGTAGATATATGTAT" "58045" "1" "0.066399" "2.1246831" "-4.13" "2.16502794" "240327" "CCATGTCATGTTCATGCCTGATATCACACATGGATATGCACACACAAAAAAGAAATTTTT" "12446" "1" "0.066404" "2.1246375" "-4.13" "0.20657425" "11490" "GAAGGACATGGACACTGTCTATCTCTGCTCTGTTGTAATAAATGTGAGATCTTGGAATGT" "42358" "1" "0.066408" "2.1246004" "-4.13" "0.33331289" "" "GCCCATGCAGTGTTTGTTATGACGGTTTGGAGGGTTTGAAATAAAAAGCGTTGACTTTGA" "18864" "1" "0.066417" "-2.1245107" "-4.13" "-0.18378298" "" "AGAAGAAAAGAAAAGCTCTCACCGATACATCTTCGACCCTCCCAAGTACCTCAATTTCAA" "5541" "1" "0.066435" "2.1243372" "-4.13" "0.28588494" "" "TTCTGTGTTTGTATTTCTCTGTTTTGTGAAAGAATCCAGTAACCTCTTTGTACCTTGCGG" "6804" "1" "0.066457" "2.1241179" "-4.13" "0.65162294" "12491" "AAGAATGAAAAATGAACAATTCACATGTGAGCCACTGCTTATATATTAAGTCTCTCCCTC" "30383" "1" "0.066486" "2.1238438" "-4.13" "0.24385908" "" "AGTGTTAATACCAAAGATGGAAGGAGAAAGACCACCGACCCAATCATTATGGTCAAATTA" "35552" "1" "0.0665" "-2.1237098" "-4.13" "-0.22193241" "" "AATCACTAAGTGAAGGATTGAAACTTGGGATGAAGTTCACCAAGGAAGCGGGGGGAATAC" "1444" "1" "0.066507" "2.1236361" "-4.13" "0.51058966" "" "AGACACACCAGCCCCTCGGGTTTGGATCCTAGAGTAAGTAGAGAAAGCAAGCTGAAAAAA" "47643" "1" "0.066512" "-2.123591" "-4.13" "-0.24129042" "" "CTTGACATACAGAAGAGAGTTAGGATACAAGGTTTGCTATGTGATGCCAACATTTTAAAA" "62238" "1" "0.066581" "2.1229255" "-4.13" "0.96805476" "" "GTCTTCGCAGCCATCTGGTTTGTGTTTGTTTGTTTGTTTACAGCTTTCTTAATAAAATTG" "11365" "1" "0.066595" "2.1227838" "-4.13" "0.29803634" "100465" "ACAGGGGAGGGGGGAGGAGGGAAATCTATTTTTGTGAAAAGAAAGATTTTGCTATTTTTT" "9167" "1" "0.06666" "-2.1221598" "-4.13" "-0.30322482" "192156" "TTTCTGAAGGGCTAGCTGACCCACTCGATGGACCTTCCAGCACTCCAGACAGCTGCTCAT" "43093" "1" "0.066723" "2.1215563" "-4.13" "0.21464484" "" "AAATTATCTAGAAGTCAGAACGTTCTGTACCAAACTGCCTGGAGGTTCTGGATCCTCGCA" "31022" "1" "0.06675" "-2.121297" "-4.13" "-0.17555172" "218629" "CTTGAAAATCCAAAGATGTCCCTTGAAAATGACAAGATTCTACAGATCATTACAGAATTG" "26416" "1" "0.066757" "2.1212225" "-4.13" "0.33367837" "12408" "GATAAAAAAGTTGAACCATGGTGAACCCAACTCTCACCTCCCACCCCCTTGTATCCAGAC" "19589" "1" "0.066795" "-2.1208558" "-4.13" "-0.24431638" "73420" "TCCCCATTCATGTACAGAGCCCTCCCTCTGAGGTGTATATTTAATTAAAGAGTAAGTTCT" "27038" "1" "0.066798" "-2.1208293" "-4.13" "-0.19811094" "380780" "GACCCCCCTGCATGGCAGGACCCCTGTGCTTCAGTTCTAATAAATCTGAATTTGGCTGTG" "28950" "1" "0.066872" "2.1201227" "-4.13" "0.7107871" "15976" "GTCCTTAGAGACTTACTTCCAAAGACAAACTACTGTGTATCTCTTTATTTTGATGATGAC" "27070" "1" "0.066875" "-2.120093" "-4.13" "-0.26152125" "14265" "AGCAAATGAAAAAGAGCCTTGCTGTTGGTGGTTAGCTAAAGTGAGGATGATAAAGGGTGA" "28855" "1" "0.066918" "-2.1196759" "-4.13" "-0.17150514" "76123" "CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT" "51732" "1" "0.06695" "2.1193676" "-4.13" "1.18935765" "21355" "TCAGGATAAAGATTGGGACCGTTTTGGACTTTGTGTGTTTTTGTGGCCTTGATGGGTGAG" "25112" "1" "0.067012" "-2.1187734" "-4.13" "-0.19649153" "19335" "CTTTGCACCACTGTATTTTCTACCTAACTTAAAAAGGTCTAAAATCAGCCACAGGTAATA" "14829" "1" "0.067034" "-2.1185663" "-4.13" "-0.20712402" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "6592" "1" "0.067037" "2.1185393" "-4.13" "0.20333109" "68401" "CTGGTGGGGAGGGGGAGCTGCTCAGGAAGACCCCAATAAAGCCCTTGGAACTTGTGAATT" "58805" "1" "0.067085" "2.1180754" "-4.13" "0.21645063" "66864" "TCGTTTTGGTCGTCTTGACCATTACAGTGCTGGGGCTTTTCAAACTCTGCTTCCACAAAA" "18974" "1" "0.067092" "2.1180124" "-4.13" "0.78385246" "" "CGAGTTTTGTGAAAAAGTACCAGCTCTTAGAAAACGTGCTGAAATTCTTAAAAAAGAGAG" "15392" "1" "0.067101" "-2.117923" "-4.13" "-0.25409578" "231014" "AGGAGGCAAAGCTTATGAGTAAGGTTTTCACCATGTGTTTTTCCTGGTGTTTCAGTGCTT" "30321" "1" "0.067112" "2.1178198" "-4.13" "0.48884034" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "34218" "1" "0.067123" "-2.1177108" "-4.13" "-0.23219667" "98238" "AACCTAGAAACTTGACTTCATGGAAGCAGGTTTAGAGTTGATTCTGGACCTGTAACAGAA" "34614" "1" "0.067124" "-2.1177005" "-4.13" "-0.21742379" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "25735" "1" "0.067141" "-2.117534" "-4.13" "-0.19270087" "" "ACGTGGTGAGAATGTCTCCTGGTCATTTTAAATGAAGGGAGACTGAAATTGTGGCAATAA" "6007" "1" "0.067154" "2.1174105" "-4.13" "0.18831185" "" "AATTCTGCAACTACCAGCCAGCATGATCCTTTTTTCCTTCAGTTGTTTATGTGAATACTG" "2124" "1" "0.06716" "2.1173563" "-4.13" "0.32708475" "140499" "AAGCAAAAACCAAAATGTGATCTGGAGGAGACTGGTGGTTCTCAACTCCCTCTTGAGGTT" "58382" "1" "0.067171" "2.1172543" "-4.13" "0.51886632" "19294" "GGGCATCTGGGTTGGGAATTTTATTTTGTAAGCATTTCCTACATAATATGAGTTTCTACT" "20860" "1" "0.067194" "-2.11703" "-4.13" "-0.19552835" "73668" "GTTCTGTGATAAAGCTTAACTCGTTTCTACAGAGGATATTTTTGTTAAAGTCTGGGTGAT" "10823" "1" "0.067204" "-2.1169335" "-4.13" "-0.17208989" "" "ATTACTATGATGTACACAGTGGTGACTCCCATGCACCCCTTCATCTATACCCTCAGAAAT" "34967" "1" "0.06723" "-2.1166829" "-4.13" "-0.18714161" "24136" "CTGTATTTTCGACTGAAAATTCCACTTTCTTCATCTTGTTTTTTAGCTAACCTCAAGAGG" "44241" "1" "0.067264" "-2.1163659" "-4.13" "-0.21062314" "211712" "AGGAACCAATTCAATGACCGTAAGCAGTATGGCTCCAATGAAGGCCATTTCAACAATGGC" "609" "1" "0.06729" "-2.1161097" "-4.13" "-0.20286216" "" "TTGTCCTTGCCATTCGTCCTGTTACACATTAAAACTATTTACCCTCTTCCACCTGTAAAA" "53044" "1" "0.067312" "-2.1159028" "-4.13" "-0.37777971" "238266" "AACAGAAATGAATCAGATGCTGAGTGCTAAGGAAGGGTGTAACCAATCCGCAATCCTCTG" "32533" "1" "0.067316" "2.1158666" "-4.13" "0.39526416" "233221" "GATTAAGGATGATTTTCATGTATTTGATCTTGGATTTTATCTGGCATCAGTTGTCCTGAC" "41132" "1" "0.067319" "-2.1158349" "-4.13" "-0.27777962" "50933" "AATTTTTAATATTTTCATTAACTTGACTAATTAAACTTTATGTGAATAAACTTTGACTCT" "34711" "1" "0.067327" "-2.1157592" "-4.13" "-0.25718681" "18505" "AAATATTAGTCTCGATCCTTTGATACCGTGGTATTAAATATGACATTGTCAGCCTGTAGC" "48318" "1" "0.067343" "-2.115604" "-4.13" "-0.31534748" "269717" "GACACTGTAAATAACTCCTTTCCTGGGTGTGTGGTTTTTTGTTTGTTTGTTTGTTGATTT" "34093" "1" "0.067439" "-2.1146938" "-4.13" "-0.43808705" "" "ATAATTGTAACAACAGCAGCAACAGAGCAGGTTCAGAGGAAAGTACGTGGCTCTCTCTCT" "62500" "1" "0.067439" "2.1146924" "-4.13" "0.31198875" "22658" "AGATTGTCAGTCTTTCCATTGAGTTCTACGAAGGCGTCAGGGACCGAGAGGAGAAGAAGA" "39113" "1" "0.067457" "-2.114516" "-4.13" "-0.20022489" "69572" "CTGAGCTGGATGTTGGTTAGGGCTGTCTATAAAGCCAATAAAGCTATGTATGGCCTGGAT" "24147" "1" "0.067462" "-2.1144694" "-4.13" "-0.19115922" "" "" "44541" "1" "0.067491" "2.1141961" "-4.14" "0.22924685" "" "CTCCTGGAAAACCAGTATGTCACCTGCCGGGTCTGGATGAATGCTGACTGTCAGACAGGG" "30588" "1" "0.067491" "2.1141911" "-4.14" "1.33753007" "12010" "TTGAACCTGCTTAATTACAAATCCAGTTTCTAATATGCTATACAATTTATGCACGCAGAA" "24105" "1" "0.067505" "2.114058" "-4.14" "0.27903508" "14390" "AAGGGAGGAGAATTTTTGCATACATTTTTACTCTTTAAATAAAGACACTTATACTATCAT" "39685" "1" "0.067539" "-2.113742" "-4.14" "-0.44429413" "67392" "TCCTTTAGAACAACCAGAGAGAATCCGTCAACGGACACACTTTGTTATTAGCAACTACCG" "40742" "1" "0.06754" "2.1137308" "-4.14" "0.32622309" "14230" "CTCAAAGGCTAAACTGATCCAGTCCTTTCTCCTTTTGGTCAATAAAAGGCTAAACTGAAG" "17992" "1" "0.067543" "-2.1136973" "-4.14" "-0.17572731" "70316" "TGTAAATGGCTACTTTAAATCCCAGGGTAGCTGAAGAATTGGCGCAAAAATGCATGTGGA" "58012" "1" "0.067548" "-2.1136555" "-4.14" "-0.31470183" "235584" "TTTGTGACCCTACATACATATATATATATAGACACACACACACATACACATATATATCCC" "2897" "1" "0.067548" "-2.113651" "-4.14" "-0.39401983" "" "AGGTATGGATGCTCAGCAGCCAACTCACTGACTTGGGGAAGACAAGATGAAGTCAAGGAC" "39730" "1" "0.067572" "2.1134286" "-4.14" "0.35501077" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "53010" "1" "0.067576" "2.1133818" "-4.14" "0.18339123" "13605" "CTCGAGGTAAATTTGTACTCATTGAAGTTTAACACTGCTGTATTTTGTGATCTCCCTAAT" "3394" "1" "0.067617" "-2.1129976" "-4.14" "-0.21257698" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "15995" "1" "0.067629" "-2.1128794" "-4.14" "-0.17231434" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "30494" "1" "0.067643" "-2.1127453" "-4.14" "-0.18795062" "" "CTCGGGCAGATGAAAGACCATTGTTGAATCACTAAAGTAATATACGTTTTACAGTCAATA" "37216" "1" "0.067651" "-2.1126732" "-4.14" "-0.20748452" "233271" "GTCACATGATGGTCAAGTATTGAAAACTAAAAAGTGCTGAAAGTGGCCTATTTTTCTTCA" "8248" "1" "0.067667" "-2.1125247" "-4.14" "-0.19580378" "28081" "AATTGGAACAGTAAGGCAAACAGGGCTATGAGAAGAGAAGCTGTCAAGCACACATGGACA" "53463" "1" "0.067676" "-2.1124329" "-4.14" "-0.16457252" "68634" "CTGTACTTGGCTTGCCTTGATGAAGGTAAAATAAAGAAATCGAACACTGAACCACGACAA" "56927" "1" "0.067681" "-2.1123913" "-4.14" "-0.23942971" "" "ACCCACAGTTCAGAGTGTTTGTGGATGGACACAAACTTTTTGATTTTTATCATTGTATTC" "49265" "1" "0.067683" "2.1123645" "-4.14" "0.2795885" "" "CAATGTGCTAAGGCCTTTGTGTTATGGTCCACTGAGATTCAACACTACTCAAGCACCAAG" "55621" "1" "0.067697" "-2.1122393" "-4.14" "-0.20579875" "17919" "CTAAAGATAGCTATAATCTAGACCATGTTCAAATACAAGATTTTCTTTCCCCCATAGCTG" "19207" "1" "0.067715" "-2.1120658" "-4.14" "-0.20509706" "" "TCTGCATAGAACATTCAAACAGAACTTTTTGGGGGGCTAAAACAGAGATGCGGGTACCAC" "25341" "1" "0.067718" "-2.1120337" "-4.14" "-0.23993095" "114871" "ACATTATACATCAACGGGTCCCTGTGGATCCAAAATGTCACACAGGAGGACACAGGATAT" "50036" "1" "0.067719" "-2.1120314" "-4.14" "-0.19355756" "16351" "TGTGACAGAGAAGGCACAAAAGCACAAGGAACATTTGAAAATGTAGGTTCTGACCATTTG" "23003" "1" "0.06777" "2.1115441" "-4.14" "0.30099287" "17450" "AACGAAAAGCTAAAAACGTGTTTCAACCAGATCCAGAATATCTACATGGCTCAGTATGAG" "2722" "1" "0.067774" "2.1115057" "-4.14" "1.64397239" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "18012" "1" "0.0678" "-2.111254" "-4.14" "-0.18697027" "229504" "TAGCCACGTTACATAGCACTGACTAACAGTGTTTACTTAATTTAGGTTCCACTTAGTTTA" "9845" "1" "0.067811" "-2.1111572" "-4.14" "-0.42507006" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "53154" "1" "0.067823" "-2.1110397" "-4.14" "-0.26073114" "328424" "ACCCCTCAGCAGATGATCCTTCTGTATAGACACATATTATCATAAAACCAGGTTTCCCTC" "47611" "1" "0.067824" "2.1110274" "-4.14" "0.15771756" "" "CGACACCTTCTTGGCAAGTCCTGAAACAAGAATTAAATAGTATAGTTGCTCCTTCTTTAT" "43029" "1" "0.067834" "-2.1109391" "-4.14" "-0.42139294" "56724" "GACAAGTTGCATATTTTACTTAAATTTGCTGTTGACACTAAAGTCCAACATGTGACTGAG" "6456" "1" "0.067849" "-2.1107891" "-4.14" "-0.19756306" "74132" "GTGTTGCTGGAGCTTCATAGTCAAACGCTTTTCTTGAGTTACTTGTGATCAGGTAACCAA" "13934" "1" "0.06787" "2.1105935" "-4.14" "0.7020421" "269346" "GTGTAGGAGTGGATGTGAGGGGAGATATTTTTTAAGTTATATTGGAAACATGTGTGAATT" "3149" "1" "0.067883" "2.1104687" "-4.14" "0.32826469" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "19519" "1" "0.067901" "-2.1103024" "-4.14" "-0.27990567" "100040475" "AGAGCTGGGTACTAAGTCTTTCAGGTTTCTGTTTTAATAGCAATTTCATAGCGGCAATGA" "43743" "1" "0.067908" "-2.1102349" "-4.14" "-0.18642916" "" "GATACATTCTGACATGTGAGAAACTTGCAGCATCTCTAAGCAAATAGATGGTATATATAC" "43031" "1" "0.067919" "-2.110129" "-4.14" "-0.2872596" "67509" "GTTTCATTGGAATTGGGCCACACATACTTTTTCTGTGAGTCATTCTGATGAATAAAAAGA" "54917" "1" "0.067932" "2.1100121" "-4.14" "0.21842549" "" "CCACCCTAATATCTCCAAATTACAAACACAGTTATAAAATAGAAATTGTTCTCCCTGCTC" "41873" "1" "0.067937" "2.1099635" "-4.14" "0.21268305" "" "ACTTCTCGTAGAAAACATAATCAGGGGATTATGGAACTGAACCTCGGTTGCTTGGCTTGG" "48002" "1" "0.067944" "-2.1098915" "-4.14" "-0.17047255" "74159" "AAGAGGTTGGTATGATAAAGTGATGGCTTTTTTCTTATATAAATAGAATGCAAATCAAAG" "40533" "1" "0.067948" "-2.1098567" "-4.14" "-0.19276069" "74571" "AAGGATGGAGCAGCCCCTGACTCTGAGCCTAGATCACAGAAAATCCCCATCTCTGCATGA" "23372" "1" "0.067964" "-2.1097054" "-4.14" "-0.29700226" "14667" "GCATTAATGACAGGTGATGTGACATTTGAGCTATTTCTGTCTTGCTTTAGAAGTTTTTCA" "35072" "1" "0.067971" "-2.1096366" "-4.14" "-0.25150623" "71702" "CTACGAACCATCTGGAAATAAAAAAGGAAAAAATGTTGGGTTTGCTACCAACAATTCAGA" "35036" "1" "0.068008" "-2.109292" "-4.14" "-0.22747089" "80515" "AACACTAGTGACGCATTAAAGTGCCAAAGTGACATTCTTTTGAGAAAAATTTTTCTGAGC" "61055" "1" "0.068012" "2.1092464" "-4.14" "0.21226775" "" "AACATCATTTTTAGCACTGTGTCCACGTTATTTGCTGCAGACTCAGAAGGAGGCTGGAAG" "2621" "1" "0.068029" "-2.1090857" "-4.14" "-0.24113478" "" "TGTTCCGTTTGTTTCTGCAACAGAGATGTTGTGTCCATGCCCTCTGCACTTAACACTATG" "4262" "1" "0.068033" "-2.109048" "-4.14" "-0.19735219" "100046119" "TTTTTCTCAGTGATGGGGAATGGAGCACCATATTTGGATGCTGTGTTTAAGGGTGTGGCT" "29579" "1" "0.068041" "2.108981" "-4.14" "0.19560604" "" "TTCTCTAAATGCCTTCCAAAAATATCCCAGCTCATTTGTTCACTGTTAAGTATGTGCGAT" "53683" "1" "0.068081" "-2.1085967" "-4.14" "-0.22282431" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "54341" "1" "0.068123" "-2.1082062" "-4.14" "-0.32358456" "" "TACATAACTCCAAACATTTTTAAAATGAAAATGCACTCTCGAGTCCTCACTCAGTGCACT" "9004" "1" "0.068182" "2.1076483" "-4.14" "0.38430066" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "24587" "1" "0.068191" "-2.1075561" "-4.14" "-0.21626486" "24086" "TATAATTAAACTTATCCATACTGTTTTGGCCTTTTCCAACATTGGATATAGGGCACAAGG" "14206" "1" "0.068206" "-2.1074153" "-4.14" "-0.23779564" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "26634" "1" "0.068208" "2.1074006" "-4.14" "0.3180562" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "30162" "1" "0.06821" "-2.107377" "-4.14" "-0.25888663" "" "CGCCGTCCGACATGGTGGGGGAGATGGGCAGCCAGCTGGCCACCAGCCTGCGGGGACACT" "8092" "1" "0.068215" "-2.1073375" "-4.14" "-0.23651845" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "40570" "1" "0.06828" "2.1067186" "-4.14" "0.43566308" "12550" "ACATTCTAACGGGAAAAAGGAGACAAGACCTTTGAGAGTTTTCATTCAAAATGCAAATCT" "28756" "1" "0.068327" "-2.106275" "-4.14" "-0.2839975" "108841" "CCAATTCCTGTGTAATTTTAACTGTAGACTCTTAAGCTTGTTGTTTGATTACAGTAACAT" "21564" "1" "0.068365" "-2.1059214" "-4.14" "-0.19304451" "58909" "GTGGGTGGAGGATTCCTTCAGTTTTGCTTTTACAAACAATCCCCTAGAAGCATGAGCTAT" "53992" "1" "0.068386" "-2.1057221" "-4.14" "-0.29651624" "236576" "CTAATTCTACTGCTTTCCACATATTAGTGCCTTGATATGTGTTCTATGTCATTAGCTGAA" "5676" "1" "0.06841" "2.1055008" "-4.14" "0.6703787" "67849" "TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA" "39415" "1" "0.068424" "2.1053685" "-4.14" "0.25348984" "243653" "TAAAGTGAAATGTCTGAGGCGAAATCATGACGTTGAGGTTGGTATGTTGACTAACTGGGG" "12204" "1" "0.068425" "2.1053564" "-4.14" "0.28766613" "" "CAGAGAAAATTAAATTACTGTATAAACAAGCAGTTAAGACAATTACGGACGGGGTGTTCT" "35241" "1" "0.068461" "-2.1050182" "-4.14" "-0.31945813" "14105" "GAAAGTGTTTACCGGATACGACTTTTTAGTGATCTACTTGTACATTTTATAGGGGACATA" "47073" "1" "0.068507" "-2.10459" "-4.14" "-0.25349641" "" "ACCCCAGATCAAGGCAAAACCAGGCAGGACCTTTGACCTCTTTGCTACCTCTTCAGCCTG" "16893" "1" "0.068541" "2.1042645" "-4.14" "1.34973024" "50908" "AAAGAGTCTGCATGGAGGCAGGGTTGATCACTGAGCCGTGTTGGTTATTCAGTTACTATT" "44318" "1" "0.068573" "-2.1039671" "-4.14" "-0.21813453" "" "TTGAGCCCAAGACTGAAGAAAAGCCTGGGCAACATAAGATCCCTGTCAAAGAAAACCACT" "9746" "1" "0.068591" "2.1037948" "-4.14" "0.19373647" "" "GTGGCTGCTGTAAAGACCGAGCAAAGAAGGAATGGACAGATGCCTTTAGGAGAATACTTA" "245" "1" "0.068595" "2.1037615" "-4.14" "0.32407609" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "57827" "1" "0.068603" "2.1036894" "-4.14" "0.61517394" "" "ATATGATGTGCTCCGAGCTCACCCAGTAACTGACATCATGGTAGTGTGTCTTGTAACACT" "24805" "1" "0.068648" "-2.1032676" "-4.14" "-0.19910553" "56428" "ACACTTAATGAAGGCAAAATCACTTTAGAAGGAAAATTTTCAACTCAAGCATTGAGCTCC" "51571" "1" "0.068658" "-2.1031683" "-4.14" "-0.32434012" "229644" "CAGGTCAGACTTTGGCTCACAGTAGAGACAAATAGTATGTTGAATGAATAAAAATTCAAG" "17001" "1" "0.068691" "2.1028624" "-4.14" "0.52666784" "208263" "CCATTAAGAAGCCCAAGACTTGACTCAACATACCAAACAAATGGAAATACTAAAACGAAT" "25070" "1" "0.068699" "-2.1027881" "-4.14" "-0.23937435" "214230" "AGCAGCCAGGGGGGAATCTTCTGAGAGAGAGTGGGGTTGGCAGTAAACGTGGTTCCATTG" "2673" "1" "0.068709" "2.1026932" "-4.14" "0.2471768" "" "TATATAAATGAGTGGCTGCCCGTGCAGAGGTGTGATTGGGGTCTGGACAAGCCCTCGGTG" "56570" "1" "0.068719" "2.1026033" "-4.14" "0.2870543" "106628" "GATCTTTCTTCCCGCCGCTTGGCTTGAGCCAAGTTTTGTTTTATATTAAAAAAGTATATA" "36897" "1" "0.068783" "-2.1019992" "-4.14" "-0.1562779" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "62913" "1" "0.068848" "-2.1013888" "-4.14" "-0.26069134" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "27656" "1" "0.068873" "-2.101155" "-4.14" "-0.21162885" "" "ATGCATTTGTCTCTATGGGCCTACCATGTACCCAGGACTCTTAGGTAATTAATAGAGTAT" "58590" "1" "0.06888" "-2.1010981" "-4.14" "-0.1905418" "171256" "AACATTCATTGGCCACTGCTATATGCTACCATCCAGACATATCATCAAATGGCTTTTCCT" "27096" "1" "0.068881" "2.1010833" "-4.14" "0.42634875" "20732" "GGAGAAGGCCCAAGAGTCTGGAAGGAGCAGAGCAGCCTTGAGCCAGGAGTACTGTATATA" "6992" "1" "0.068908" "-2.1008323" "-4.14" "-0.22191484" "105372" "TCCAACTAACTGTAGGTTTTCTGAAAGCACAAGGGGGTACAGTAAGACTGTTCTGATGTG" "48593" "1" "0.068928" "2.100646" "-4.14" "0.2829279" "22668" "CTCCTGTTTAGGGTACTAGGAAAATCACCCCTTGTGTCTTTGTGAGAGCCACGTCTTTGG" "37514" "1" "0.068949" "-2.1004519" "-4.14" "-0.27634005" "" "TGAATGTTGGAGCAGTGTTAGGAAACTGCTTTGTGTTCCTAACAGTCGATATTGGTTCCT" "28257" "1" "0.068979" "-2.1001704" "-4.14" "-0.40293823" "24012" "CTCATACCCCCGCTTTATAAGATCTAGTGCCTACCAGGAACTTCTACAGGCAAAGAGAAA" "30790" "1" "0.068979" "-2.1001688" "-4.14" "-0.32044012" "" "AGCTGCTTCCCCATTGGTGTGTCATTTTGGCCATTGCCAGAAATATTGTCACCATTTTTT" "18355" "1" "0.069026" "-2.0997328" "-4.14" "-0.28768882" "" "CACACTTTAAATGTACTCTTGTCTTCAAGCGTTCCTAGTTCAGTAGGGAATGAAATCCAG" "34063" "1" "0.069044" "-2.0995597" "-4.14" "-0.23536837" "56032" "GATGAAGAACCTTATCCGGAGACTACAGAAATATCCAGTCCGAGTGTCTCGGGAGGAGCG" "9348" "1" "0.069081" "-2.0992162" "-4.14" "-0.19941433" "18552" "ACCACTCTTCAGAGGGTGGCTACAAATCCTGCAAGAGATGTGATAACAGCTGTTTGACAT" "22544" "1" "0.069094" "2.0991002" "-4.14" "1.71439287" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "8235" "1" "0.069133" "-2.0987385" "-4.14" "-0.29009899" "" "CACAGCCAGAACAAAGGACTAGCCTTTGGGATTTTCCCCCATATATTTAGAATTAAAAAA" "25392" "1" "0.06916" "2.0984839" "-4.14" "1.75859489" "55932" "CACATTGGCATATGTATCCCAGTTGTACACTACAGATAAATTGTTAAAAAGAGCTCTTGT" "49036" "1" "0.069172" "2.0983708" "-4.14" "0.30215828" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "57618" "1" "0.069181" "2.0982894" "-4.14" "1.35794229" "246728" "CTGGGGACTCTGCAGTTGGCTGTTCATTTATATGCTTCATAATAAATGGTTTCTTTGTGT" "25386" "1" "0.069234" "-2.0977974" "-4.14" "-0.40364154" "" "CTTGCAGTGGAATTATTAATCTGTTCTACAAGTGGAAGGGTGCTCAGAATATTAACAATT" "12999" "1" "0.06926" "-2.0975515" "-4.14" "-0.27540706" "14860" "GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA" "30188" "1" "0.069293" "-2.0972466" "-4.14" "-0.23089114" "54562" "CAAACAAACCCCAGAAAAAAGCAGATAGAAAGATTGGAAGTTGACCCCAGCAAGCATTCC" "939" "1" "0.069319" "2.0970095" "-4.14" "0.43509721" "" "GTACACACTTGGTTGTAGACTATGGCAACCTCCGAAACTATTTGAAATATATTTCTGCTC" "36055" "1" "0.069325" "2.096954" "-4.14" "0.33098652" "" "TCACTACCTTCCCAAGGTCAAAGTCATCCTGGGGCCTGTAATCTGAGATTAATGTAGCTA" "5685" "1" "0.069331" "2.0968966" "-4.14" "0.17931317" "258946" "AATCGGGATATGAAAGGAGCTTTGAGAAATATGCTTGCAAGAGCAACTTCTTCCATGTAA" "31767" "1" "0.06936" "2.096624" "-4.14" "1.30437547" "15051" "GTTTTCATTTTGCTCATCATTTGTCTCTGTGTGGTTTGCATATGCATGAAGAAGAATGCA" "14473" "1" "0.069368" "2.0965518" "-4.14" "0.34730812" "630322" "ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT" "23214" "1" "0.069384" "-2.0964064" "-4.14" "-0.16385701" "18769" "ATGGAAGTCGAGTCCTCTTACTCGGACTTCATCTCCTGCGACCGGACAGGCCATCGGAAT" "62520" "1" "0.0694" "2.0962512" "-4.14" "0.3966827" "75943" "GAATTGAACCTAGGACTTTATGCATTTGAGGCAAACACTTTAATATTGAACTGTATCCCC" "10123" "1" "0.069516" "2.0951797" "-4.14" "0.31233268" "16443" "TGGAAGACTTATTCCAGAGAAACAGATACTCAGTGACCAGTTAAAACAAGTCCAGCAGAA" "34092" "1" "0.069518" "-2.0951598" "-4.14" "-0.23887975" "338349" "TATTCATCGGGGAGTGGGATAAGTTGGAGTATGAATCTATTCATTGCACATATTTTATAC" "30873" "1" "0.069525" "2.0950946" "-4.14" "0.21409596" "17125" "CTCTCTTCAGCCCAAAGCTGCAGATTCAAAATTTATTGACTTTTTTCTTTCTGCAAATAC" "8969" "1" "0.069544" "-2.0949236" "-4.14" "-0.26121243" "20744" "GGTAGCTGAGTGATATGTGCTTACTCCAGGGCACTTGAATTTGGGCTGTAGTTATTTTTT" "51409" "1" "0.069559" "2.0947858" "-4.14" "1.55205466" "12502" "ACCCTACAGGTAGACTGCAAGCAGAGAGGAAGAACTGTCAAAGAAATTTTGGTCTTTTTT" "55906" "1" "0.06956" "-2.0947751" "-4.14" "-0.16722805" "98828" "TCGATTTCCTTAAGCTGAAAAGAAATGAGCAAGAGGACGACTGAGTGCTGCTTGGAGAAC" "2769" "1" "0.06958" "-2.0945888" "-4.14" "-0.20200101" "140742" "GACCCTGACTTTGAAGGTTATACAGCTCCTTAAAGAATAAAGCTGGAAAATATTTTAGTG" "38736" "1" "0.06961" "2.0943075" "-4.14" "0.76746579" "" "CAGAAATTTCTTGGTAAGAGTTAAATGTTTGCTGTCTCTTAACCTAGAATTATGTGGGTG" "545" "1" "0.069649" "-2.093949" "-4.14" "-0.22787888" "" "TTTTTTTCTCTCCCTCTTGTCTACATGCCTGTTGTTTGAACTATAACATGCTATATATAG" "39448" "1" "0.069661" "-2.0938447" "-4.14" "-0.41514367" "69577" "TTAGATGCCTTCACCGCATCGAGCAGGATTATTCAAATGCAATAAAGCAATGTAACAAGT" "52429" "1" "0.069682" "-2.0936468" "-4.14" "-0.27242667" "68312" "AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT" "33066" "1" "0.069689" "2.0935847" "-4.14" "0.70109705" "78416" "TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC" "45714" "1" "0.069694" "-2.0935316" "-4.15" "-0.17667684" "14457" "GTCAGAGAGCACAAAACAGGCAACATCCGCCCAGTGGACATGGAGATCTAGAAGTGACTG" "54919" "1" "0.069707" "2.0934155" "-4.15" "0.51703616" "54381" "TCTTTACAACATCCATCGTCACAAAAGAGTGTTATACATTTAATCCACAGGGCATAGTTT" "15831" "1" "0.069719" "-2.0933069" "-4.15" "-0.2058381" "230577" "GGGTCACTTCAGCACTGAGATCATGTTCTGTTGATTGAATAAAGTCAAGCCTTTGGGGTG" "16782" "1" "0.069739" "2.0931214" "-4.15" "0.23921887" "" "AATATATCAACAACACGGGTCTTATTGGCTGAGCTGATGAAGTGGTCTTGTCATTCCATG" "15753" "1" "0.069796" "-2.0925957" "-4.15" "-0.20094038" "76829" "GATTACATATGAGTACATCTGTCTTTGGGACGTCCAGAATCCCAGAGTTAAACTCATCTC" "28619" "1" "0.069803" "-2.0925314" "-4.15" "-0.21959208" "" "GGCACTTGGTAATGACATAGCCTCAGCCGTACCCTGTAGACCTGTTCTCAATCAGGCCCA" "32907" "1" "0.069809" "-2.0924751" "-4.15" "-0.22578796" "" "ATGATTTTAGGGCTTGTGAGAGTTGAGATAGCTGAACAGAGAAGGTCAGAACTTGGGGAA" "26534" "1" "0.06983" "-2.0922817" "-4.15" "-0.20725051" "" "CTACCACTTCGTGCAAAGTAGATCAAGAAAATGCCTATGTTGATAAATCAAGGGTTCATT" "33441" "1" "0.069833" "2.0922513" "-4.15" "0.77882457" "21817" "CTGGGAAGAATCAAACTGATGCATTTAACGTGTTCTGCTTTACACAGAGGATCGCACCGT" "11463" "1" "0.06984" "2.0921862" "-4.15" "0.42628701" "12825" "ATAAGCCAAACTCTCTGAAACCCCAGCAAAACAAAAACCACATCCATGTGTTCATCTTGT" "49482" "1" "0.069874" "-2.0918757" "-4.15" "-0.45938208" "26557" "TGTGTCCAGCCAGTCACTGATTCTTTTTATCCTAATCCTTTTGGTCTGAATTTCATTTGC" "14195" "1" "0.069916" "-2.0914907" "-4.15" "-0.18062205" "" "ACAGGAGACAGCCACAAGCTGGACAAACAAAATTTGCAAACAAGGTCAAAGTTCAGTACA" "43239" "1" "0.069935" "-2.0913174" "-4.15" "-0.18164226" "" "CGTCCAAAGTGTTTTGAGCTCTAATGCAAAAGACTATATGCTATTGTGCATTAGAAAGAA" "27138" "1" "0.069944" "2.0912347" "-4.15" "1.09094854" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "4454" "1" "0.069951" "-2.0911651" "-4.15" "-0.24207397" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "24881" "1" "0.070012" "-2.0906036" "-4.15" "-0.19666461" "" "" "2390" "1" "0.070051" "2.0902496" "-4.15" "0.46912793" "12013" "TCCTAGATGGTGATTCTAGACTGACGGTTAAATAAAGTTCCTAACATGGCTTTCAGTCGA" "34552" "1" "0.070088" "-2.0899075" "-4.15" "-0.19087183" "26885" "TGTGCTTGGCGTATTCAGATCAACAGTCTGATTCACTTACCTGTTATTGGTCAGAATGTT" "26951" "1" "0.07009" "-2.0898934" "-4.15" "-0.1971777" "74455" "TAGCTTCTTCAGTAAGTTTTCAGGACATGGACAGTAACACTAACCTCATCATAACTGAGG" "20107" "1" "0.07009" "-2.08989" "-4.15" "-0.29485729" "" "AATGTCTTGTGCTTCGTAAACTGCCCATTTGTTTCCTCCATTTCAGACTGCCTACTCTTC" "21320" "1" "0.07009" "-2.0898891" "-4.15" "-0.2181534" "76366" "AACAGCAAAGAGTCGGATGTTGTGTGTCAGTGACTTTAATAGGAAAAGTGCAGGCCAGGA" "9793" "1" "0.070135" "2.089481" "-4.15" "0.67337489" "319229" "CCTGGAGCAGGAAACAGGCCTGGGATTTGGTCTTTCTAGTTCTTCTAAGAAGAGCACTTC" "37273" "1" "0.070141" "2.0894245" "-4.15" "0.36981075" "" "TCTTTCTTAGGCCTATGATCTAGCTACCTATGAATTTTTGGTTTGGTTAATTGTAACAGG" "54325" "1" "0.070156" "-2.0892819" "-4.15" "-0.3166847" "14611" "AAACCACCCAGTCAAACACTGCAATGGCCACCACCTGACGACAGAGCAGAACTGGACCAG" "36864" "1" "0.070176" "-2.0891024" "-4.15" "-0.47602532" "18991" "GGAGCTTCCCCCTTCACCATTTCTTCATCTGTTTGTTAAGGTTTCAGCTTAAATTTTGTT" "11471" "1" "0.070177" "-2.0890914" "-4.15" "-0.26571626" "" "AGATACAACTTCCTGGTTCCACCTCCTGTAAAATCGTGGCTGTTGAATGGCTTAGAGTTC" "14892" "1" "0.070192" "-2.0889501" "-4.15" "-0.24081458" "67391" "CCAGTGGATGTGTAAAACTAATTAGGATTCACCTATTTGCATTTCCTCACTACGTTTTGA" "27698" "1" "0.070202" "-2.0888588" "-4.15" "-0.20491468" "432868" "TAATGCTTTCTCTGTGCCAGACATAATGCCAAGGGCTTGGCATGCTAGTCCTTAAGCAAA" "20147" "1" "0.070203" "-2.0888538" "-4.15" "-0.64595548" "12671" "GGATTTGACTCTTGGTTCTTGCAAAGTACTGTTTTGTGCAGTTCAAGTTTCATACAAATA" "16753" "1" "0.070206" "-2.0888278" "-4.15" "-0.17534127" "14339" "AAAGTGGTCGACAGTGTTAAAGTGTGTACTGCCCGTCTTTTTGACCAGCCCAAGATAGAA" "29130" "1" "0.070264" "-2.0882973" "-4.15" "-0.16383699" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "45917" "1" "0.070339" "-2.0876107" "-4.15" "-0.35505115" "330173" "GATTATAACTCAAGCACTTCCCTGAAGTTTGGTTATCTATGCTCAAGAATTAGTCGGCAT" "49854" "1" "0.070343" "-2.0875719" "-4.15" "-0.22346385" "94044" "GAAGCAACATCATGGGGGGAAGCACCCTGGAGGTGACAATAAAACGAGATTTTATGATAA" "45927" "1" "0.07038" "-2.0872287" "-4.15" "-0.18460534" "637873" "GATTCAACTTATTATCTGTGGAATCTGGATTCTAACATCTCCACCCTTCATTGATCAAGA" "54626" "1" "0.070412" "-2.086944" "-4.15" "-0.35148419" "" "TCCAAAGCACGTAAACAGGATACCCACCCTGCATTATCTTATATTTTAAGTCAATATGAA" "55843" "1" "0.070414" "-2.0869244" "-4.15" "-0.3144802" "381813" "AGGAAATCTACGGGACCATATCCATGAAGCCAAATGCCAAAAATGTGCGAGACCTCGATT" "1090" "1" "0.070434" "2.0867378" "-4.15" "0.74120336" "16155" "GTAATTTGAGCCCTTTGTGCTCACTAAAACAAGGATCACATTTAACTTGTGACAAACAAA" "11105" "1" "0.070487" "2.0862571" "-4.15" "0.48145563" "" "TGTTAGTTCCTGATTTCTGCTTAAGGTCGGTACTTTCCAGTAAAAACCGCCTAGATACGC" "43723" "1" "0.070526" "-2.0858969" "-4.15" "-0.29466629" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "12137" "1" "0.070539" "-2.0857815" "-4.15" "-0.30383407" "239250" "GCGTTTCTACAGGTAAGTGTTCTGAGCTTCCTCAGGAGAGGGACAGTGTAGCTTTATTTT" "10421" "1" "0.070547" "-2.0857102" "-4.15" "-0.34071516" "269994" "ACCCAGCTGGAAAGCCAGGAAGAACATGGGCATTGACCACTGGATGCTAGACACCCCACA" "19363" "1" "0.070548" "2.0856978" "-4.15" "0.94864053" "12516" "GGAGGTACCTGCCTTGGAGCCGCCTGGCCAGGAAAAATTAAATAAACACACAAATACATT" "2241" "1" "0.07057" "-2.0854951" "-4.15" "-0.31409542" "69577" "TACAAAGGAAGCTGTTTTCTCAAAGCTCCGCTGTCCACTGGTAATAGAGGAAACTGGCTT" "30099" "1" "0.070605" "-2.0851805" "-4.15" "-0.18634124" "" "CTATGCATTGCAAGTATCTACATCAAGATATAAACATCCAGTTGACTGAGCAAGAATTGT" "29898" "1" "0.070648" "-2.0847878" "-4.15" "-0.2196132" "" "TTGTAGAACCACCTTCCAGTTGATGTTTCCTTCCGGTCAACACCGCTAATGCAAATTCTC" "55660" "1" "0.070652" "-2.0847524" "-4.15" "-0.78138281" "75677" "TTTACTGTGCATAAACTAGGCTGCGACTGTGCACACACAGGGCACCTGTAAATAAAACGT" "21068" "1" "0.070668" "-2.0846025" "-4.15" "-0.17325119" "56692" "TGTCTCTCCGCTTTGCTGTAACCGTGCTTCCACCATTGTGTTCTTTGTACAATTGAAATG" "55565" "1" "0.070719" "2.0841395" "-4.15" "0.22989407" "" "GGGAAGAGGAAAATACAAGGACTTGGTTGGTGTCTTAGTTTGGATTCAATTAAAAAATGA" "24370" "1" "0.070726" "-2.0840726" "-4.15" "-0.20661811" "71331" "GAGCAGAAATTTCACCAAATTTGTTCCTGTGGTACTAAGTCTCATAGGGCGTGTGAGGAA" "44402" "1" "0.07075" "-2.0838615" "-4.15" "-0.38418756" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "13694" "1" "0.070754" "2.0838218" "-4.15" "0.8575279" "12097" "CAGTGTGAGCTTAACCCTGCTTGTGACGAGCTATCAGACCAGTATGGCTTGAAGACCGCC" "37640" "1" "0.070775" "2.0836298" "-4.15" "0.3571059" "100048658" "GTGTTGAAACATACGTCACTATGGAGAGACTTGGCTGATTCTTAAAATAATAGTGTGTTA" "47395" "1" "0.070777" "-2.0836159" "-4.15" "-0.2083376" "83703" "CTGAGTGATGAACACGAACCTGAACAAAGGAAGAAAATAAAGAGGAGGAACCAAGCCATC" "26147" "1" "0.070795" "-2.0834519" "-4.15" "-0.41472149" "21924" "TGCAGGAGATGATCGACGAAGTAGACGAGGATGGCAGTGGCACAGTGGACTTCGATGAGT" "50123" "1" "0.070799" "2.0834111" "-4.15" "0.49398805" "14412" "GGTCCACACATTGTGACGTGCCCGAATCAATAACATCCCATTGAGGCAGCTTGGGAAGCC" "50077" "1" "0.070805" "2.0833623" "-4.15" "0.2449182" "257635" "TTCCTTCCAGGTAGCCCTCCTGGGTTGCTCTCAGTGGCTCCCTGCTGTCCAGTGAATAAA" "10471" "1" "0.070829" "-2.0831366" "-4.15" "-0.21110542" "620592" "TTCTTATACTCCTCCATACCGTAGTGTCCTTCTCCAGCAGCCAGAGTGGTGGGGGACTGG" "45708" "1" "0.070845" "-2.0829911" "-4.15" "-0.20386298" "" "GACTTTACTTTTGGGCCTTGCTATATCTTAAAACTTACTGTCATTTCCATGTTCTAGTGT" "16404" "1" "0.070861" "2.0828496" "-4.15" "1.71060366" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "39503" "1" "0.070863" "-2.0828297" "-4.15" "-0.1578454" "67921" "GAAGCTTCCCAGAATGCATAGTCATTCACTGTAGATCTTACTGAAATGCGTATTTTATTT" "41541" "1" "0.070879" "2.0826852" "-4.15" "0.84043268" "11576" "GTGAGCCTTTTGGCTTAACTGTAACTGCTAGTACTTTAACCACATGGTGAAGATGTCCAT" "27202" "1" "0.070883" "-2.0826473" "-4.15" "-0.23931076" "50794" "TTTTAGCTTTGAAAGATACAGCTTCCAGAACGGACAGATGGAAACTTTGGACAGAAAAAA" "58095" "1" "0.070893" "2.0825623" "-4.15" "0.75641103" "" "ACTCGGAAAATCTGCTCATTGCCCTTGGCTTTCTGTGTTTCCCGCTCCCAATACTCCGGC" "48506" "1" "0.07094" "-2.0821321" "-4.15" "-0.31056202" "" "CCCTTGTCTTCCAGAAGCTCAACCTTGACCACTTTTAGTACCTCTGAGAAATGACTTGGT" "29006" "1" "0.071008" "-2.0815119" "-4.15" "-0.27714815" "" "TACAGTGCTGTGCTCTGTTTGCAAAACCATTAATGACTTCAGGCTTGAAGGAAGCTGGCT" "66" "1" "0.071014" "-2.081458" "-4.15" "-0.210904" "67568" "GTTTGCTTGAAAAGATCAGCCCGGAGAGTTACTAAGAAATATTAAGTGAAGTCTTCCTTC" "520" "1" "0.071056" "-2.0810797" "-4.15" "-0.26689541" "238384" "CAGCCGTTATTTGAGCAGCTCCACAGACTCTTGGCTACCAGCTGCAGGGATGCATCATAT" "11748" "1" "0.071073" "2.080923" "-4.15" "0.55480552" "100040462" "AGCATCAACTGTCCTGTCAAGCACAAAAAATGAAGAAGAAAATAATTACCCAAAAGATGG" "23234" "1" "0.071095" "-2.0807256" "-4.15" "-0.28495373" "18720" "TATGAAATATGACCTGAAGGGTTCAACTTACAAGCGGCGGGCTTCTCAGAAAGAACGAGA" "13538" "1" "0.071127" "-2.0804366" "-4.15" "-0.29371031" "384061" "CCAAGGCTCCTTAAGGGAGGTCCTTACCTCCAATCCAGTTAGAGCAATAACCACTTTTTA" "7421" "1" "0.07113" "2.0804098" "-4.15" "1.54594238" "" "TGCAAGGCTTCTGGCTACACCTTCACTACCTATCCTATAGAGTGGATGAAGCAGAATCAT" "12958" "1" "0.071155" "2.0801826" "-4.15" "0.56527788" "637515" "ATGAATGGGTCTCAGTGAAAAGGATGGGCTTAGGCCTTCTGTAAGTGGATGTTAGAGGAT" "53405" "1" "0.071156" "-2.0801788" "-4.15" "-0.24312087" "" "AGATTTTCGGGTACTCGACAAACATCTTCATCTCTGCATTTATGACCGCCGATTCTCCCA" "42676" "1" "0.071162" "2.0801242" "-4.15" "1.09771539" "12046" "AGAACCTAAAGTCATACTTGGATGACTTTCACGTGGAATCCATAGATACCACCAGAATAA" "59538" "1" "0.071175" "2.0800002" "-4.15" "0.28077593" "192232" "CAGGATTCACTGCTGACCGTTTACTTGAGATACCCATGGTGCTTTGTAACCGTATGGTGC" "61282" "1" "0.071233" "-2.0794777" "-4.15" "-0.28251208" "77794" "CTTCCTTGGACACCCACTCTGCAGGGGATGCTGAACTGTGAAGATGTGACACAGGGCACA" "31616" "1" "0.071233" "-2.0794747" "-4.15" "-0.17580926" "" "CCTTCTCTAGGAGAAAGCACTCATCAAGTTCAAAGAAAATGGAAAAGTTTTGAACCAAAA" "12294" "1" "0.071275" "2.0790981" "-4.15" "0.24055839" "56738" "GTTCACTGTGGTCTGCCCACACCTGTCTACTCTGGCATGTGTCAGGAAAAGGAGCGTCAA" "26287" "1" "0.071292" "-2.0789472" "-4.15" "-0.23301545" "16392" "CCCCCAAAGATGTGTATAGTTATTGGTTAAAATGACTGTTTTCGCTCTTTCTGGAAATAA" "2073" "1" "0.071317" "2.0787178" "-4.15" "0.79284838" "" "TCAGCAGAGTGGAGGCTGAAGATTTGGGAGTTTATTACTGCTTGCAAGGTACATATTATC" "17293" "1" "0.071349" "2.0784305" "-4.15" "0.21109066" "18416" "ACACCGCTCGTGTCTTATCTAGCATGACAGATGCAGTGTTAGCTCGAGTGTATAAACAAT" "11444" "1" "0.071355" "-2.0783761" "-4.15" "-0.41996727" "66975" "TTATCAGCATCTTCTTATGACTGAACCACTGTTTCAGTCAGTAGGAATGTACAACTTATT" "45952" "1" "0.071357" "2.0783576" "-4.15" "0.23002968" "11555" "ATTTCAGGATTGCCTTTCAAGAGCTTCTGTGCCTTCGCAGGTCTTCTTCGAAAACCTATG" "25566" "1" "0.071381" "-2.0781424" "-4.15" "-0.22663546" "16841" "GCCAGGGAGTTTGACATTTTCGATTTTTAGGTTCTGGTGACTGAGATAAATGAATGACCT" "16585" "1" "0.071383" "2.078122" "-4.15" "0.41028422" "22379" "AAGGATTGTGGAGGAAGACCTGTGGCTTTCAAAAGTGGAAAAAGAAGGGCTAACACTTAA" "59544" "1" "0.071385" "2.0781037" "-4.15" "1.02980979" "" "TTGGGTGCAATGGATTTTTGGAGATATACAGAGCTTCCTGTGTCTCTGATGTGAACGTTA" "33030" "1" "0.071399" "2.0779789" "-4.15" "0.17695728" "" "" "62213" "1" "0.071462" "-2.077416" "-4.15" "-0.20268638" "66598" "GTCATTCCAGAATTGTATAAATGCTTCATATGTGGCGTTTTTGTGATGAAATAACCTCAG" "19393" "1" "0.071472" "2.0773234" "-4.15" "2.47145282" "" "GCTAGCAGCTACCTGACCCTGACAGCAAGAGCATGGGAAAGGCATAGCAGTTACAGCTGC" "22734" "1" "0.071551" "-2.0766102" "-4.15" "-0.24850289" "235106" "TTTTTCAACGTCTCTGAACATGACTATGGGAACTACACATGTGTGGCCTCCAACAAGCTG" "56211" "1" "0.071557" "-2.0765579" "-4.15" "-0.18484154" "15289" "GAGCTTTTGTCCACATGCCCTGCCATTGTGGTAGGGTAACATTTTCATCCATAGTTGAAG" "43035" "1" "0.071559" "2.0765384" "-4.15" "0.37349483" "" "" "20712" "1" "0.071576" "2.0763844" "-4.15" "0.95063834" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "4176" "1" "0.071662" "2.0756113" "-4.15" "1.31692088" "50909" "TCTGACCAATTGTTGATAAGCACTATGATTCTCATATAAAAATCAAAGATGCAGAACGCG" "18780" "1" "0.071696" "2.0753065" "-4.15" "0.36688572" "328795" "GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC" "31896" "1" "0.071745" "-2.074871" "-4.15" "-0.26095183" "233437" "AGTGCTATCTTATTTTATTAAGACCACAGACAAATTCTTTTTACAAGTTCAGGCGACCAC" "33964" "1" "0.071755" "2.0747774" "-4.15" "0.71004311" "72310" "AAGGAATGCAGAATTCTGTCTCTGTCCCTCCCACCTTGCCTTATCCTTCATTGGTTTCTT" "41388" "1" "0.071759" "2.0747395" "-4.15" "0.3285678" "" "" "8045" "1" "0.071765" "2.0746873" "-4.15" "0.98739932" "243374" "GTCTTGGACTGCCTAAACCTTTGTATTTGTATTCTTTATAGCCACTCTGATTAAATCTCT" "49080" "1" "0.071772" "-2.0746236" "-4.15" "-0.19328697" "18260" "CCCAATTTGGTCTGTTTTAGCTGAAAATGTTTTATATACCTTTCAGACATGGCAGTACAT" "49012" "1" "0.071779" "-2.0745633" "-4.15" "-0.43477365" "13199" "TGAGCGCTTTCTGCCTCCCATTCTTTTGTCCCTAGGATTTTGTGAATAAGCGAGTAGAGA" "36209" "1" "0.071803" "-2.0743451" "-4.15" "-0.17354309" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "3261" "1" "0.071847" "-2.0739541" "-4.15" "-0.18872896" "434632" "TGACGCAGGTGCTAATGAGTTAGGAGAGGTCATCAAAGATGACATTTGGCCAAATCCCAT" "47099" "1" "0.071865" "2.0737962" "-4.15" "0.3945832" "268816" "ACTGGAAGACTACTTGATGCTGCAGAAAATACAACCAAGGACTGGTGTCCACATTGGGAA" "33100" "1" "0.071899" "-2.0734848" "-4.15" "-0.28017315" "" "CAGTTTACACAGGTGAAAATGATTAGCAGTCAAAGAGATGACCATCCTTTTTCTGAGATA" "56865" "1" "0.071931" "2.0732047" "-4.15" "0.22092315" "" "TTGCTCTGTCCTCCTGACACAGCATGGAGGTGTTATCTCTTTCTTGCTCTTAAACCTTTC" "47774" "1" "0.071947" "2.073055" "-4.15" "0.94228501" "" "CTTCCATGATTGAATCTTCCTGCTTCTGGAAATAAAATGGGTAGTCCCTTGCATACAAAG" "5310" "1" "0.071968" "2.0728692" "-4.15" "0.18925701" "" "" "62654" "1" "0.071975" "2.0728104" "-4.16" "1.81592133" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "54550" "1" "0.07206" "2.0720504" "-4.16" "0.21470165" "" "ACACGGGGAGTGAAAAAATTCCCAAGGATTATAACCTTGTCATTACTGCTCAACTTTAAA" "418" "1" "0.072069" "2.0719701" "-4.16" "0.65955582" "" "AGTTATATAGAGATCTACAATGAGACCGTTTGAGACCTGCTAGCTACTGGGACCCACAAG" "5472" "1" "0.072079" "2.0718779" "-4.16" "0.23819917" "" "AATCCATCAGCCTTATCATTTCAGCTTTACAACCAGACGATTCGGGAAAGTATTTCTGTG" "46995" "1" "0.07211" "-2.0715971" "-4.16" "-0.18086842" "" "GCAGCCTGTGTGCAGCAGGTCTGTTCTTACTATATTAAAAAACAAAAACAGAATGTTTAT" "50204" "1" "0.072118" "-2.0715316" "-4.16" "-0.2519166" "21410" "CACTCTGTGCACAGCAACAAGGACCCCATTTTCCACACCATCAGTCTCTGGGGAAGTCCA" "43199" "1" "0.072132" "2.071401" "-4.16" "0.36395067" "546185" "CTTTCAGAAAGACAACAGGTTATAAAATCCTCACCTTTGAATATAAGGAGGAGTGAATTC" "23038" "1" "0.072162" "2.0711395" "-4.16" "1.68484127" "15016" "TGCAGAGAATGGAACCTTCCAGAAGTGGGCATCTGTGGTGGTGCCTCTTGGGAAGGAGCA" "35689" "1" "0.072186" "2.0709235" "-4.16" "1.49201071" "16068" "AAACTCAAGCTTCACTTCTACCCTAGATTATCATAGTAATTAAGTCCTTAGAGTTCTTCC" "40492" "1" "0.0722" "2.0707981" "-4.16" "1.77749855" "76933" "CCAAAAGGCACCTTCAGAACCCTCACTGATGTCAAAGAATGATGAAAACAACAAAGTATA" "32595" "1" "0.072235" "-2.0704865" "-4.16" "-0.31266215" "" "ATTGAAGCCGGAACAGGATGCAGAGAATGACCGGAACTGGATGTTAACCAGTTAGGATAA" "28793" "1" "0.072257" "2.0702866" "-4.16" "0.28040112" "" "TATCACTGTCATCAATAGTACCACCACCAATGTTTTAGCCTGTATGAAGCTCCTACACAG" "56146" "1" "0.072264" "2.0702239" "-4.16" "0.53332245" "403183" "ATTTTCTGTACAAACATATGGTACTATTGGTGGGATAGGGTGCATTAAATGACCTTAGAA" "36031" "1" "0.072298" "2.0699234" "-4.16" "0.35607561" "20416" "CGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCATTAAAGTTCGT" "59744" "1" "0.072298" "2.06992" "-4.16" "1.74698597" "630499" "ACTAAGTGACAGACAATGTCTTCACACATCTCCTGTGACATCCAGAGCCCTCAGTTTTCT" "44941" "1" "0.072365" "-2.0693318" "-4.16" "-0.23418474" "" "" "42430" "1" "0.072366" "-2.0693197" "-4.16" "-0.30658236" "" "" "20069" "1" "0.072406" "-2.0689662" "-4.16" "-0.23059175" "243833" "CCACAGTGAGTTTACCAGGAATAAAGTCTCTGCACTGGCATAGTGTGGAAATAACATATG" "60426" "1" "0.072422" "-2.0688189" "-4.16" "-0.39708478" "" "AGCTCATAGCTCCTGCTAGAAGTCTTTTGGGCAGCAGCATGTGGTGTATTTGAAGATCTA" "16527" "1" "0.072425" "-2.0687947" "-4.16" "-0.27582237" "71091" "GTTGCCTTGAGTCCTATCTCCTAGGTTGTTTTCAAATCATATTTAAGTATGATTTTAGGC" "6050" "1" "0.072446" "2.0686054" "-4.16" "0.40960241" "" "CATCCTACTGACTTTAGAGATGATATGACAGAAACCCAAGGCGTGTTATTGAGGAAAAAA" "13633" "1" "0.072447" "-2.068595" "-4.16" "-0.19124839" "244202" "ACAGGGGGACTGAACCTATAACTTCATATGAGCTAGGCAAGTAAGTTATGTCCCTATTCA" "11961" "1" "0.072461" "-2.0684763" "-4.16" "-0.27314456" "" "TATCGGCCGATATTCTTTTGTGGCCCGCGGGCGCCCCACATTATATACACCAGACAAAAA" "6490" "1" "0.072498" "2.068146" "-4.16" "0.2159844" "" "ATAGACACGTAGGAGAGAAGCTGAGGATTGATTTGTGTAAAAGAGACATTCCCCCTGCTA" "46130" "1" "0.072501" "2.0681171" "-4.16" "0.31183796" "71706" "CGTCTGCACAATGGGCTTGCTGGCCTCTCAGGGATTTTGAAGACATAATGAGGAATTTTT" "25234" "1" "0.072532" "-2.0678398" "-4.16" "-0.39914469" "" "TAGTTAATCTGAGGCAGCATGAATGGATTTGAAATTGACCAATAAACTCAGTCACCAAGC" "27429" "1" "0.072545" "-2.0677279" "-4.16" "-0.18944432" "" "TTCTTTCATTGTACAAGAACTATTTGTGGATATGTACTGACAGATAGGCAAGCAAGCACA" "15526" "1" "0.072547" "-2.0677065" "-4.16" "-0.19646888" "244867" "GAGCTACTCCCCTAGTCCAAAAGTTTCCTAAAGTCTATGTGATCTCTTGAATCCCTGTTT" "57079" "1" "0.072549" "2.0676902" "-4.16" "0.82672461" "320484" "ACTGGGAGCTGGTATCTCAAAGTTGGATTCTAAGGGTGGTCTCCCAAGCAACGGAAGCCA" "23547" "1" "0.072561" "-2.067587" "-4.16" "-0.24434229" "74978" "CCATTCTCCAGTATGGCCCTTGGAAATCTTTAAAGCAGGTATTTATAATTTAGCAATACT" "14759" "1" "0.072566" "-2.0675384" "-4.16" "-0.2954841" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "32252" "1" "0.072584" "-2.0673775" "-4.16" "-0.37966434" "12918" "GTGGCTAGGACGAAATGTGTAAGCTCTTTGAATCAACTTTTTCTTGTAAATGTTTCAGTA" "44522" "1" "0.072605" "-2.0671923" "-4.16" "-0.27307921" "" "GCCGAGTCAGCAAATGCACTGAAATGAAAACGTGAAGACGACGATGATGATGAAGATGAA" "59498" "1" "0.072609" "2.0671574" "-4.16" "0.20808585" "" "ACAGAGGTCTTCTTTGGGATACTGCATCGGCAGTCTCTGACAGTGACGGCCAGTCTCAGC" "45424" "1" "0.072619" "-2.0670686" "-4.16" "-0.42328313" "" "AAAGCAAACGTGAGGTCATACTGTACTCCTTTACAGCCTGCTTTCTGTGTAACAGCATAG" "34409" "1" "0.072645" "-2.0668442" "-4.16" "-0.16846132" "74192" "GATGCTACCGAGAGACCTTTTGCTGAGTGTTTATTTTTCTTACTCTTTTGATTTGTATGT" "5369" "1" "0.072673" "2.066593" "-4.16" "0.22123786" "" "TACCTAGAGTCTGTACACGGGGTATAAGGAAGCAAATCTCTCAGGACTATTAAAATAAAA" "29792" "1" "0.072676" "-2.0665637" "-4.16" "-0.26283064" "" "TGGCCATTCTACCAACTACCTGTAGCTGATGTGACAATGGTTCAAGGCAAGGCAGCCAAG" "61888" "1" "0.072683" "-2.0665006" "-4.16" "-0.37612063" "66648" "CGCTTTATGTTTTGAGAAAACATTTTCAAAGACAGTCTTGTGTTCTTTACAACCTAGACC" "28986" "1" "0.072688" "-2.0664635" "-4.16" "-0.1988281" "67049" "GCCTTGTGTTCAAATCCATTAAAGTCTGGTCTACAAGTATATTTGTTCTTTTTCAAGGCA" "8098" "1" "0.0727" "2.0663559" "-4.16" "0.26865115" "" "CAAATGATGCCTTCTTGCCACAGCAAATCCCAGTTAGAGAACAATAAGGTGACACTAATC" "2109" "1" "0.072704" "-2.0663181" "-4.16" "-0.19718603" "19298" "CCCTGACTGTCCTTACGTCCTCTCTGTTTAGAGTCTTATTTATTCTGCCCTTTTAACCAG" "5422" "1" "0.072719" "2.0661855" "-4.16" "0.18577251" "30937" "GTGGTAGATCTTAGAGGGTCAGTAGTTTCAAAAACAGAGGTATTCTAAGAAGTCTTAGAA" "51499" "1" "0.072728" "2.0661079" "-4.16" "0.83423569" "54153" "TCAACTGTTCTGGGGAGGGCTGTGACCCAGCATAGTCTTCTCCATGTCTGCGAGGGACAA" "7445" "1" "0.072732" "2.0660729" "-4.16" "0.79695843" "78781" "CCCCCAGTTTTTAAAAACAAGGTGTTCCTTGATTTATAATCCTTCTTGTTTATGCTGTGT" "47223" "1" "0.07275" "2.0659136" "-4.16" "1.84289574" "66857" "GATGACAGAAAGCTGCGAATAGGACACCAAAGGCACTCTTAGCTGTATTTTCCCATCTGT" "31356" "1" "0.072762" "2.0658073" "-4.16" "0.77540635" "319236" "TATTTTTGAAGAGCATTGATAGTCTAAATCATGTTAGAGAGGAGGGAAGGGAAGGGAAGG" "51485" "1" "0.072797" "-2.0654936" "-4.16" "-0.28542334" "" "" "56529" "1" "0.072837" "2.0651423" "-4.16" "1.35720313" "12010" "TTGAACCTGCTTAATTACAAATCCAGTTTCTAATATGCTATACAATTTATGCACGCAGAA" "36434" "1" "0.072879" "2.0647676" "-4.16" "0.56187011" "64095" "GAAGACGGGAGGTAGAAAATGAAGGACAATCTTTACACAAAAGCTGCAAAATTAGCACAC" "1535" "1" "0.072913" "-2.0644729" "-4.16" "-0.29436306" "432842" "GATTGTGCCTACCAGAGTTCTTTGCACAGGCGTGATTAATAAATTACTTTTTGATGGCAG" "22223" "1" "0.072924" "2.0643694" "-4.16" "0.21078061" "" "TGTGGTGTTTTATCTAGTTAGCAAAATGCTCTTAGCAATTTGCCATTCATTGTGTATCAG" "6770" "1" "0.072934" "2.0642842" "-4.16" "0.27408539" "27424" "TTAGTCTGCAGTGCAAAGAGAGAGAAAATCTGGAAGATTTTGGGAATATAGTGCAAAGAG" "34049" "1" "0.072955" "-2.064099" "-4.16" "-0.1603935" "" "CTTGCAGTTTATGTATTGGAATTTCACAAAAGACATAGGACTTATGTGGAAAAAGGGGAA" "5072" "1" "0.072969" "2.0639738" "-4.16" "0.31478334" "75452" "GGGAAAGGATGGGGATGCCGAACCAAAGTGTCTTTCATCTTGTGCAGCGAGGCACCACCT" "3353" "1" "0.072978" "-2.0638925" "-4.16" "-0.218787" "70771" "AACTAACTTTTCCTCCTAGGAATATATATCCACTTTAGTCCCCATTAGGGATGATGTGGG" "54246" "1" "0.072984" "-2.0638441" "-4.16" "-0.20581052" "210009" "TTGTGTATAGTAACGGTCTCATTTTATAGTCCACCTTTAAAACACATCTCTACCTGGTGA" "56268" "1" "0.073017" "-2.0635504" "-4.16" "-0.2570538" "" "AACCTAGAACGGAGCCAGCTATTAACTACTCCACTTAGAGACTTATTTCCCGCCTACTGT" "3567" "1" "0.073018" "-2.0635448" "-4.16" "-0.3185071" "242702" "GGGAGGAGTTATCAAATTCTAGCTGTTTGCTGCCAAATCTTAGATGATTTTGGAAATTAT" "15374" "1" "0.073074" "-2.0630508" "-4.16" "-0.18261994" "70556" "ACCTTAATGAATCCTATTTGGATGGTTAAAACGAGGATGCAGCTAGAACGCAAGGTGAGG" "39954" "1" "0.073078" "-2.0630163" "-4.16" "-0.2235902" "" "AAGATCTTTTGATGGAATGCCATTTCCAGCTCCTATGTTTGCAAAGGTGTCAGTGTGTGC" "57995" "1" "0.073101" "-2.0628081" "-4.16" "-0.25058964" "69131" "TAATAGCAGATTTGCTTAACCCAGTTTCTTTAGTTTTTTCATCTGTCTATAGGGAACAGG" "22951" "1" "0.073125" "-2.0625954" "-4.16" "-0.17077574" "224045" "AACATTAGCCTAAAGGAAGTGATGCAGGTCCTGACCCTTGTAGTCCTGGAGTTCCCCCTG" "32980" "1" "0.073178" "-2.0621341" "-4.16" "-0.26005044" "" "" "29170" "1" "0.07322" "-2.0617609" "-4.16" "-0.23556978" "107701" "TATCTTGTTATAGTATGGAGGCATTAGCAACAGAAATAAAATGTCTGGTGATGTGCTAGC" "50790" "1" "0.073223" "2.0617347" "-4.16" "0.63222777" "233328" "AAATTATAAAAAAGAAAACGTTAAGATGTGCCGCGGGGTGCGCATGCTGGTGAGACTGGT" "55454" "1" "0.073258" "-2.0614315" "-4.16" "-0.19868303" "23806" "AGAGGACAACACAGTATTTTTCAAAATTGTATATAGCGCATATGCATGGATAAAGCAAGC" "440" "1" "0.073328" "2.0608121" "-4.16" "0.22608883" "" "TATTTGAAACTACTAGGCAGCAAGTGATCACCTTCAAGCCCCATTTCAGCTGCTGTAAGC" "57649" "1" "0.073335" "-2.0607513" "-4.16" "-0.20853092" "" "CAGGCAATCCCTTCTGAAATACAATTGGCAGTCAGCCCAATTTTAAAAGTATATAGTATA" "36806" "1" "0.073365" "-2.0604858" "-4.16" "-0.27163629" "18221" "AAAGGATGCAGAGGATCAGGAGGCCCAGCTCAAGAACGGCAGCCTTGACTCACCAGGAAA" "59086" "1" "0.073393" "2.060244" "-4.16" "0.31185588" "270198" "TTATCCTGGTTTTCACTTGTGCATTGCACTGTGTCCAGCATTCTTTGCAATAAATACTTT" "18706" "1" "0.0734" "2.0601838" "-4.16" "0.19349949" "14173" "AGCGACCCACACGTCAAACTACAACTCCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAG" "35808" "1" "0.073402" "-2.0601663" "-4.16" "-0.20840741" "" "AAGATATACTATAATTTGAGAACTTTTATCTTATTATTTCTAATTTCTTTACTCTTCTGA" "32264" "1" "0.073435" "-2.0598716" "-4.16" "-0.23530904" "208982" "TACCTCAGTGTACCAGTTGACTTTCATGACCACCTTGATATTATCTAATTGCACTTGACA" "54559" "1" "0.073454" "2.0597083" "-4.16" "0.18479152" "" "GCCTTGGCTGAGATTGTTTTCCGCTATCCAAACCCTGTTACCCAGTATGCTTTGTGGTAG" "57718" "1" "0.07349" "2.0593893" "-4.16" "0.23324946" "56277" "TCTGGTCTCAAGAACACTTGTCTGAGGCTGACTCCATGCTGTTTGTACTTCCAGTTTTGT" "56341" "1" "0.0735" "-2.0593078" "-4.16" "-0.1651011" "" "AACTTTAATATCAGTGACATTAACACGTCCTTTGGGTTCCTGGACAAGGGATGAGGGCTG" "35680" "1" "0.073525" "2.0590828" "-4.16" "0.26099762" "100036518" "TAGGCAGTAGCATGAACAGTTCTGAAGTTGGAATGTTTACTGGATATTGTTATATGCTAC" "34806" "1" "0.073533" "-2.0590136" "-4.16" "-0.31911923" "109050" "AAATCTGTAGCTTTTTGCTAGGCAATGTACCTATCTCAGAACGATTAATCAATGGGGTCA" "45997" "1" "0.073596" "-2.0584599" "-4.16" "-0.21977378" "" "CCCTAACCTAAGCTTAGGTTAATGGAAAAGGAGCCAGAGCTTAATGAAAATGATGTTACT" "62774" "1" "0.073598" "2.0584421" "-4.16" "0.48426036" "242700" "TATACGTCTTACGTGTTTGTATTACCTGTCTTGCATGTTTGTATTTTTGTCGAAATCGTG" "33139" "1" "0.073642" "2.0580583" "-4.16" "1.70030528" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "29140" "1" "0.073662" "-2.0578899" "-4.16" "-0.19966959" "" "GGAAATTCTAGTTACAAACTTTTCATTGTTTTTCTTTTACATTTCTCTACATTCTTTTGA" "46268" "1" "0.073663" "-2.0578743" "-4.16" "-0.27306028" "" "ATCATCTCTTGATGAATCCAGAGGATGTGGTCACCTCTATCCCCTCTTAGATGACACAGA" "47696" "1" "0.073678" "2.0577456" "-4.16" "0.17840148" "" "TACCGTGTGTGGCAGATTGTAGATGAAGGCCAAAAGCTAGGCCAGGGTAACCAGGAGGGA" "23276" "1" "0.073705" "-2.0575116" "-4.16" "-0.23333743" "" "CCTGTTCATTCATGACAGAATGTGTCTTTGTCTACTGTGTTCTTTGTTTACTATATACCC" "25617" "1" "0.073725" "2.0573347" "-4.16" "0.4393259" "" "TCGAAATAATCCAACATCATAGGTGTAATTTGTTGGTGCTGCTTAGGCCTGAGCCTAGGG" "44799" "1" "0.073774" "-2.0569039" "-4.16" "-0.3559236" "" "AGTAGGCTTTCTCGTTGAGACTCCAAGTGGACTCTTAAACCCACCCCTATCTTCTTCTTT" "57062" "1" "0.073788" "-2.0567835" "-4.16" "-0.27178544" "93885" "TATTCCTTGCATTTTTTGCTAACTATCTTTCCCTCAAGCACACAATATAGCTGCAAAATG" "47504" "1" "0.073796" "2.0567138" "-4.16" "1.20324816" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "16253" "1" "0.073796" "2.0567128" "-4.16" "0.18711191" "64934" "AAGTATGTATGGCTCACACTTCCACATTGTATGTACAAAAGTATGTATGGTTCACACTTC" "589" "1" "0.073798" "-2.0566963" "-4.16" "-0.20301271" "" "GGTGTGTTGGGAGAAATTTACTCAGGTACTCACTGTGATACCAAGAGGGGTGTGTCATCT" "9820" "1" "0.073822" "-2.0564835" "-4.16" "-0.18491314" "59020" "ATGCAAAATACACACTGTGGTCTTAGTAATAAAGGGAGGCTTCCAGGAAATATACTTCAG" "52247" "1" "0.073836" "-2.0563698" "-4.16" "-0.31785927" "72097" "CAGACCTGCCCGTCAACCAGGAAGAGAAACCTGGGTCGAGGATCCTAAAGACAGAAACTG" "48273" "1" "0.07386" "2.0561566" "-4.16" "0.98154655" "213233" "GCCTCCGAATACAAAGTAAAGTACTCCACATCCTGGCTACTTAAAGGACCCCGTGTGAGG" "17156" "1" "0.073881" "2.0559774" "-4.16" "2.03048305" "76074" "GAGAAGTTGCTTCATTTATTTTTTCTCCCATTTCAATGATTGAAAAGGGTATAAGGTCCC" "4006" "1" "0.073889" "2.0559076" "-4.16" "0.30867419" "" "CCTAGCTATACCATCTTCCTACAAGTGACATAATTTTCTCCATTTTTATGGCTGAAAAGT" "61896" "1" "0.073896" "-2.0558429" "-4.16" "-0.18394193" "258185" "GACATGAAGGGAGCCCTAGTTAGAGTTGTCTGCAATAAGAAAATCAGTTTGAAATGGTAG" "54658" "1" "0.073906" "-2.0557567" "-4.16" "-0.22189615" "103765" "ATGTATGGCACTTCAGACGAAATTGCTTTGTTCAGTGGAATCTCACCAAGTGTGACAACA" "22050" "1" "0.073917" "-2.0556565" "-4.16" "-0.17613935" "170770" "TGGGAGCGGGGAGGGACGGCCCAGCCTGTAAGATACTGTACATGCACTGCTGTAGATATA" "20535" "1" "0.07393" "-2.0555499" "-4.16" "-0.19909013" "" "GGCACAGGACCAAATGGTATCCGAAGCATTTCTTTGTTAAATATAATTAATTTTCTTGGC" "10232" "1" "0.073951" "2.05536" "-4.16" "0.27316315" "" "" "938" "1" "0.073965" "2.0552451" "-4.16" "0.78872642" "16774" "AACTTTAAAACATGTTAAATTGCTACAGTTCATTGGGATTAAATAAATACAATGCACTCT" "356" "1" "0.073977" "-2.0551328" "-4.16" "-0.21330688" "22030" "GGATTATTGCTCTAGGATTTCTCCATAGACATTGCCCATTTCTGTCCGTTTTTTCTACTT" "59342" "1" "0.073997" "-2.0549658" "-4.16" "-0.34729807" "56177" "TGCTGAAGATCGGGGTCGTGCTAAGCACCATGGCCATGATCACCAACTGGATGTCCCAGA" "26692" "1" "0.074028" "-2.0546911" "-4.16" "-0.20525547" "" "AAGTTCAGCTCCAGGTAGCCTGTTAGGTTTGATCCCCGAGTGCTCCTCCACAGGCTTCAC" "9058" "1" "0.074032" "2.0546613" "-4.16" "0.39477352" "75731" "CGTTATGGAAGCCCTCAAGTGAAGAACTCGTTCATAGCAGAGTACACTCTGCTCCCAAGC" "62582" "1" "0.074055" "2.0544603" "-4.16" "0.35809885" "" "CAAGCTTATTAAGACTATTTCCAGTATGCTTTTGAGTAGATGTTGCAGCTATCTCGATTT" "44228" "1" "0.074083" "2.0542155" "-4.16" "0.34312289" "16429" "ATCCCTTGGAGTGTGGAGACTTTGCTGCATTTGATGGGAATGGATATGGAACTCACATTG" "49907" "1" "0.074106" "2.0540112" "-4.16" "0.44323202" "" "TGAGACTCACAGCCAAGGTCAGGGCTATGCTATCAAATAAAACAGAGTGACTGCTGTTGT" "19315" "1" "0.074115" "2.0539359" "-4.16" "1.12784843" "12258" "GTAAAGAGCAGCCAAGACATGCTGTCAGTCATGGAGAAACTGGAATTCTTTGACTTCACT" "19330" "1" "0.074156" "-2.0535817" "-4.16" "-0.28438909" "620928" "GGGCTTCTTCTTTGCATCTTTGCCCCAAAATGTTATAATATTTTATTAAGACCAGGGAAA" "46966" "1" "0.074156" "2.0535813" "-4.16" "1.93091909" "547349" "TGATAATCATAGAAGTTCTGATTGTCCTTGGAGCTGTGATCAACATTGGAGCTATGGTGG" "52220" "1" "0.074166" "-2.0534929" "-4.16" "-0.25929678" "217698" "CGCTGGTCCTGTTCCCCTGAGAATTAGGATATATATGCATTGTTTTCTTCTTTTAATAAA" "13146" "1" "0.07417" "-2.0534571" "-4.16" "-0.20781015" "" "AACTTAGACAAAAAAACCACTTTATACTCTTCTATAATCTCCTATATTGCCTTTTAATAC" "32702" "1" "0.074202" "-2.0531789" "-4.16" "-0.36493187" "20324" "AGTGAGGTGAATAATGGGTGTTGATGGTGTAACCTCTTCAGCTGTGTTCCTGTACTGCAA" "8000" "1" "0.074216" "-2.0530557" "-4.16" "-0.26778258" "" "ACTAATGCGGGCAATTCTGAAAGAGAGAAGTCTGAAGTTAGAAACAACTCGAGTTTCAGT" "42488" "1" "0.07423" "-2.0529353" "-4.16" "-0.14923365" "71834" "CCAATGTTTCTTCCAGAAAGTTATTTTATTTATGCAAGTCAGGTGACTCTTAGACCACAG" "10447" "1" "0.074252" "2.0527424" "-4.16" "0.33922879" "226654" "GGCTAGGCAAATCCTTGTAGTGCTTCACACATGAAAAACTCAAATAAAAAGTACACTTAA" "18847" "1" "0.074303" "-2.0523071" "-4.16" "-0.236111" "100039946" "AATTACAAAAGCCCATGGAGACTCCAGAACCCCCAAGTCCATAATAAACTTGAGGTCCTG" "17377" "1" "0.074312" "-2.0522293" "-4.16" "-0.16425383" "" "CAGAGCATGCCTTGTAAAGACTTAAGTAATGCAAACAATTGTCGGGTTTTCTTTTTGTTT" "15441" "1" "0.074318" "-2.0521763" "-4.17" "-0.24322004" "11306" "TGCAGGAATGTTCTTTTAAATGTACTAGGGGATGAATAATTTGAGCTCTGAAAATAGAGG" "18744" "1" "0.074334" "2.0520379" "-4.17" "0.43524278" "" "CTGCATGGACATTTTCTCCTCCTTAAGATGGAGGCTCAAGACGCTCCTAGCTCTGACTTT" "60905" "1" "0.07434" "2.0519806" "-4.17" "0.18422685" "" "AAGACATATTTGAATTGGTTACAACAGAGGCCTGGCCAGGCTCCAAAGCGCCTATTCTAT" "11446" "1" "0.074367" "-2.0517526" "-4.17" "-0.45677852" "67418" "CTCACACAGATGAACCTAAAACATGGTCTAGAAGAATGAGCAGGGACAGGCTGGAAGCAA" "1488" "1" "0.074367" "-2.0517502" "-4.17" "-0.19454499" "211712" "GGGATAAATCTCTAATTATTGCTGTTTAACTGTTTGTTATCATAGTTGGTCAATGCCTGG" "36337" "1" "0.074391" "-2.0515445" "-4.17" "-0.32725762" "14658" "TTTCATTGGTTGGTATGGAGAGCATTAAGCATAAGCCTTAAAAAGAGTTGCACACATTTC" "55592" "1" "0.074418" "-2.0513066" "-4.17" "-0.295461" "67122" "TTTTTTGAATCTTGGTTATGAACCCAATTTTAAAGGGCGTTGTATCCAGCGTTGTGAAGG" "49443" "1" "0.074445" "-2.051076" "-4.17" "-0.20529822" "22770" "CCTAACATGTTAAAAATTACCTTTTCGTGTAAGAATCGGGGCTTTTTAACGGTAAGTATG" "8342" "1" "0.07445" "-2.0510268" "-4.17" "-0.32603405" "" "AAACCCTGCTGCTGTGAGTCCAGTTGTTGCGGGCCTGTGTGCTGCCAGTGTAAGATCTGA" "35935" "1" "0.074475" "2.0508115" "-4.17" "0.18586941" "" "AAGCACGGAAAGGCGGACTCCCCACCCGGGAGCCTCGGAGGCAGCGAGCGGTAGAGAAGG" "10515" "1" "0.074482" "2.050754" "-4.17" "1.80978498" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "51528" "1" "0.074483" "-2.0507458" "-4.17" "-0.20988412" "11554" "GTTGGAAGGCCATTTTGCACAGTGTTAGGCATTGTAAAATTCATAGAAGTTGTTAACTTG" "10356" "1" "0.074542" "-2.0502298" "-4.17" "-0.20670523" "" "" "42285" "1" "0.074556" "-2.0501095" "-4.17" "-0.20548332" "68094" "AGCTTTGTGTTTGTGTTTAAGTCACCTGCTTACTCGTCAGCGTCTGTGTACTTGTGGGAA" "6604" "1" "0.074558" "2.0500981" "-4.17" "0.19386077" "" "GACGCACTCATCTTAGTATAAGCAGTTTTCTCTGAAGCCCTTATTTTTTTGGTTTGCGGT" "62328" "1" "0.074559" "2.0500904" "-4.17" "1.39872533" "" "TACCTTCTGGAGAGGAGCAGAGATACACATGCCATGTGGACCATGAGAGGCTGCCTGAGG" "43509" "1" "0.074565" "2.0500335" "-4.17" "1.77269981" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "37148" "1" "0.074567" "-2.050014" "-4.17" "-0.32096363" "67569" "GGAGATTAAATGGCTGTCTTATGTGGGAGAAAAGTAATATCTAAAGAAACTAGGTTTTGG" "49269" "1" "0.074575" "-2.0499473" "-4.17" "-0.2011237" "13085" "GACCACGTGCATGGAAGAAATAGAAAACACTACTCACCTTGATAAAATTGTAACAGTAAT" "16177" "1" "0.074608" "-2.0496654" "-4.17" "-0.34007078" "105853" "AGACGAAGGTGTTTAAGAATCTCTCTACGTATCTTAGCTGTAAAAATGAAAAAGTGTTGG" "38299" "1" "0.074653" "-2.0492722" "-4.17" "-0.24308985" "360216" "TGTTAAGCTCTTGAACTAAACCAACAGCCATAATTATTGTCCCAAGAAAGTGTAATGCCG" "54376" "1" "0.074675" "-2.0490834" "-4.17" "-0.16091632" "319163" "TGGTGCACCAGTGTATCTGGCGGCAGTGCTAGAATACTTGACAGCTGAGGTCCTGGAGCT" "33987" "1" "0.074688" "2.0489686" "-4.17" "0.6777214" "" "TATAGGTCAGCACATGACAGAGGCTTCATGGGAGCAAGAGATGTGATTGGTATTGAGTCA" "28167" "1" "0.074715" "-2.0487422" "-4.17" "-0.19285238" "" "AAGCCAATTATTATTGGGTCAGGTGTGATGGACTTACCAGTTAAGTCCAGGACTCAGGAC" "8818" "1" "0.07474" "2.0485246" "-4.17" "1.02998439" "21356" "ATTAGGACGAAAGGTCTTCATAGCATCTTAAGATTCTAGAGACCTCAGGGACAGCCCACA" "4211" "1" "0.074773" "2.0482423" "-4.17" "0.23922183" "" "AGGAATCCTATAGTACCTTCTATACCAGGAAGAGAGGTGTCACTAGGTACCTCCTGGAAA" "51743" "1" "0.074844" "-2.0476307" "-4.17" "-0.34222155" "68888" "TCTGAACCTCTACGTCAGCCAGACTGGACAGACCTCATCTAGCCTCTGCCTGTGAGAAGT" "17302" "1" "0.07485" "-2.0475789" "-4.17" "-0.20848634" "226525" "ACCAACCCCACCAAGCTTTCCATCACGGAGAATGGTGAATTCAAAAATAGCAGCTGCTGA" "33269" "1" "0.074877" "-2.0473447" "-4.17" "-0.21628178" "" "" "31691" "1" "0.074911" "-2.0470503" "-4.17" "-0.16297172" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "32186" "1" "0.074928" "-2.0469066" "-4.17" "-0.25545699" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "49607" "1" "0.074947" "2.0467441" "-4.17" "0.46113513" "20135" "CTAGCTTCCTCATGAACTGACATAACCCTGATCAGTTTCCTTGATTATTGTATAAATGTT" "30801" "1" "0.074985" "-2.046412" "-4.17" "-0.29201267" "" "TATTTCCAGGGATGACCATTTCTAGTCATGTAACACTTCTCTGAGGAGGAACTCCCACAC" "4674" "1" "0.075002" "2.0462687" "-4.17" "0.43365398" "26401" "CTTCCAGGGCTTAAGGGCTAACTCCTATTAGCACCTTACTATGTAAGCAAATGCTACAAA" "13818" "1" "0.075006" "-2.0462385" "-4.17" "-0.29862585" "13669" "TAACTACATGTAGGCAGTTTATAGCTTCTGATCAGTGTAGTAGACATTACAAACACTGGT" "7098" "1" "0.075009" "2.0462085" "-4.17" "1.74993989" "" "ACTCAGGAAATGCAACATGTGGAGACCAGGCCTGCAGGGGATGGAAGCTTCCAGAAGTGG" "50638" "1" "0.075015" "-2.0461608" "-4.17" "-0.32392476" "" "CAGGTTGACTATCCCAGGGCTGACGTTCATTTCAAAGATTCCCAGATTCCACGGGCCATA" "24831" "1" "0.075033" "2.0459991" "-4.17" "1.67973264" "14963" "AAGTTCTACCTAGAGGGCGAATGCGTGGAGTGGCTTCGCAGATACCTGGAGCTCGGGAAT" "49855" "1" "0.07505" "-2.0458568" "-4.17" "-0.17221901" "227731" "GAGGATTTCTTTATTTTGCCCTTTGGAACGACAAGGCAGTGAGGTGCTTCACCAGGAATT" "22481" "1" "0.075053" "2.0458267" "-4.17" "0.50947268" "" "AACTGGCTCTGAGAAATGTCCTTTGCTTCCCGGAGGCCATTGTATTGTCTCGGGGACAGA" "47586" "1" "0.075094" "2.0454807" "-4.17" "0.57788996" "" "ACCTAGCATAACCATGTTTTTACAGGAGTAAAACATTGTAGCTTATGTGGATACCTTGAT" "59965" "1" "0.075111" "-2.0453358" "-4.17" "-0.2375812" "74189" "CCAACATTTTGATTCCTGTTAATTTTGTTCTTTAATTAAATGACTACTTATTACAGGAAA" "14679" "1" "0.075115" "-2.0452978" "-4.17" "-0.18604622" "" "AGATATTTTTCCCATGGGGTCAAAGGTACCAAAGTATATGATTGCGAGTGGAAACAGAGG" "33459" "1" "0.075117" "2.0452807" "-4.17" "1.67347714" "15013" "ATCCACTGACTCTTACATGGTGATCATTGCTGTTCTGGTTGTCCTTGGAGCTGTGATCAT" "22729" "1" "0.075126" "-2.045203" "-4.17" "-0.2482867" "217364" "GTACAGAGTATGCTTTTAAAAGTGCTGGTTCCTTCAAATATTTTATGCAGAGAAGGAGAG" "20449" "1" "0.075168" "2.0448399" "-4.17" "0.23442286" "" "GGGAAACACCCTCTCTGCATTTTTCTCTTTTGACTCTAGGTCTTTTCCAACCCCTGATTA" "6262" "1" "0.075182" "2.0447238" "-4.17" "0.5117205" "328561" "CCTGAGATAACAATTCCTTCACTTTCTGGTATTCCTCTTGAAATATAAACCTTGTTTGGT" "56108" "1" "0.075191" "-2.0446478" "-4.17" "-0.26678679" "" "CATAGTTGGTTTGGGAAAATGACATATAATTTTAAGTTAACCTGCATGCTGTAAATGTGT" "35547" "1" "0.075203" "-2.0445435" "-4.17" "-0.21841629" "13714" "AAATAACTCATCAAGATCTAAGAAGCCCAAAGGGTTAGAACTGACACCCGCCCTTGTGGT" "27639" "1" "0.075203" "-2.04454" "-4.17" "-0.23664069" "77652" "AATTTGGCAGGCTATATTTGTAGACACTTTATAAAATTGCGGTGATTTATTGTGCACGTG" "19061" "1" "0.07521" "2.0444803" "-4.17" "1.72157701" "15007" "AAGACACATGTGACCCATCACCCAGGATCTGAAGGTGATGTCACCCTGAGGTGTTGGGCC" "20342" "1" "0.075212" "-2.0444632" "-4.17" "-0.18563176" "66446" "CACGTTGGTTGCCTCACTTTTCATTGACACTGGTTTGTATATATTTCTCTTAATTGTCAA" "20941" "1" "0.075222" "2.0443794" "-4.17" "0.16637548" "" "GCAATTGCTATTTAATGTTTCACCATCTGACAAACAAGACAAAGACATTTTGGCTGAGTA" "32994" "1" "0.075243" "2.0442046" "-4.17" "0.29875917" "" "ACTACGCCCATACACAAGATTCCTATAGGTTAACTATACTAACAGTTGTGTGTCTTGTAA" "31400" "1" "0.075256" "2.0440874" "-4.17" "0.25409814" "14466" "GGATTTCCTGGCTCCAGCCAAAGCTACTTTAGGAGAGACACACCGCTTGTTCCCCAACAC" "53019" "1" "0.075256" "2.0440864" "-4.17" "1.0139768" "14580" "GGTTATATTAACAGAGCTAGCCTATGCTAAAGGTTAGGTTGTACTAATAGAGCTAGCCTA" "20196" "1" "0.075304" "2.0436819" "-4.17" "0.40662479" "193003" "AGGTCTCCAGATATCTCAACCATTCACAGTACTTCTATAGGCAGTTAGAATCCACCACCT" "15098" "1" "0.075326" "2.0434913" "-4.17" "0.61781873" "63913" "TAATCACCTTTTAAGGAAACTCAGATGGGGCAAGAGATTTCATTGGCACAAATTAGCCTT" "2652" "1" "0.075366" "2.0431451" "-4.17" "0.24087198" "" "AGCATGTTGTGTTCATAGGTTAACAGTTCTCTTTCATGGTTAATTACCTGTCAATTTGCA" "16449" "1" "0.075398" "2.0428769" "-4.17" "0.43581627" "434484" "CTTGTCTCTTACTCTCCTGAGAACAATCCACAATAAACCATAAGCTTCCAGGACTTCAAA" "26858" "1" "0.075434" "-2.0425688" "-4.17" "-0.22722497" "71241" "ATTTTCTTGACTGAGGGTGGCTATTCTTGTAGCCCGTTTAAATACTAAGTCCCCCAATAA" "56954" "1" "0.075453" "-2.0424032" "-4.17" "-0.252292" "19088" "CGGCTATGAATGCCAGCTCTGTTCTGTTCAGTATTGTTGGTTATATTTAAATTTTCCTTA" "50168" "1" "0.075471" "2.0422482" "-4.17" "1.4473416" "17067" "TATTATAGTATCACCATCCACACATAAGTATCTGGGGTCCTGCAGGGTTCCCATGTATGC" "32475" "1" "0.075496" "2.0420376" "-4.17" "0.35007074" "16439" "GCCATTTAGCTCCCAGAACAATCCGTAACTGTGTTTGCACGCTTGAGAAGATTCAAGCTT" "34555" "1" "0.075566" "2.0414435" "-4.17" "0.30353624" "328440" "TGACCTCATTTTAGCATCTTCTGCGTCCAAGGCAGGATGTCCAGCAGCTGTGCTCTGGTG" "41166" "1" "0.075578" "-2.0413376" "-4.17" "-0.19522734" "20382" "GAGCGACTTCAGATTTCATTATTGGATTGGATATTTGAGGTAAAATTTCATTTTTGTTTA" "51495" "1" "0.075584" "2.0412819" "-4.17" "0.27594427" "" "TGGCGCTTTCTATAGCCTCCTTTACAATGCTGCTCACTTCATCAACAACAAATGCAGTCT" "62741" "1" "0.075585" "2.0412735" "-4.17" "0.31754461" "106489" "GGACCTGTGAAGCAACTGAAGAAAATGTTTGAAACAACAAGATTGCTTGCAACAATTATT" "45179" "1" "0.075587" "-2.041258" "-4.17" "-0.18103997" "" "GTACACCACAAACTATAACAGATAGTAAAAGTCAGATATATGGGGGGTATTGAAAGCAGA" "37509" "1" "0.075609" "2.0410686" "-4.17" "1.07320556" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "61033" "1" "0.075639" "-2.0408197" "-4.17" "-0.31585454" "" "ACATGAAGAGGCTGTCCATCAGAAAGTTGCTGTCATTCGAGAAGAACCCATTATTGGTGG" "9940" "1" "0.075644" "-2.0407757" "-4.17" "-0.28930984" "22068" "AGAGTCCTAATATCAACTTTTTGGGTGATTAAATTGCATTGCTGAGGCTAACAATTGCTG" "38351" "1" "0.075655" "2.0406811" "-4.17" "0.26892218" "" "GAGATGGTTAAATGAAAAAATGTCCTTGATAATAAATGGTATGGCCCGGATCCTATTTTG" "50895" "1" "0.075656" "2.0406742" "-4.17" "0.17382752" "" "ATCTCTTGCTCACAGCTCATTTGGTTCCCTGGTAAGGACATAGCATATCCTGTTTCTGCT" "7059" "1" "0.075689" "2.040391" "-4.17" "1.5364083" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "40931" "1" "0.075699" "2.0403041" "-4.17" "1.53892092" "" "GCCACCCTGTATGCTGTGCTTGTCAGTACACTGGTGGTGATGGCTATGGTAAGGAACAGG" "39843" "1" "0.075745" "-2.0399136" "-4.17" "-0.21387687" "69161" "GCACAAGAGTAGTAATGATAGCCTTTGGGGTTTGCTGAAAAAGGTGCTATTTTAAACAGC" "36920" "1" "0.075749" "-2.0398797" "-4.17" "-0.17310245" "" "GAGTCCATTATTTGGACCTCTTTTGAGATGAAATAAAGTTGAGATGAATTGGCATTTCGA" "34329" "1" "0.075751" "-2.0398635" "-4.17" "-0.27100433" "66405" "TATCCATTATCTAAATGACGGGCTGTGGCACATGAAGACATATAAGTGAGCCTTAGACAC" "32626" "1" "0.075766" "-2.0397384" "-4.17" "-0.18269543" "" "TAGCTAGCACACTTGCAGTCAGAGATGCCAAGGCTGGAATGCTGAGCTCCCCGGAGTCAA" "30041" "1" "0.075771" "-2.0396931" "-4.17" "-0.31830113" "57269" "CCTTTAGGAATGAGGACATGAAGAGTGCCTTGAAGAAGTTAATCAGGAGAAAAGAGGGGA" "27892" "1" "0.075819" "-2.0392862" "-4.17" "-0.28338584" "" "ACTTGGGAAACCCATCATATTGAAGGACATTGTCAAAGTTCGAGAAGAAATGAAAGGTAA" "39024" "1" "0.075864" "-2.0389028" "-4.17" "-0.16308715" "" "" "31503" "1" "0.07587" "-2.0388506" "-4.17" "-0.1738529" "" "CAGGCTCAAACTCAGCATGTATTTTCATTTCTACAAGATCCTTTTCAAGTTGTAGAGAAA" "29880" "1" "0.075875" "-2.0388069" "-4.17" "-0.20613443" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "31939" "1" "0.075881" "-2.0387616" "-4.17" "-0.24280441" "" "TGATCTCCAAATAGCATTCAATGTGGCTTCCTCCTATCAAATGGCTGCCTCTGCTCATGT" "9809" "1" "0.075893" "2.0386515" "-4.17" "0.17938169" "69379" "GAAGCACCCCTTCATACAGCTCTGTTGTCCTAGGTCTTTTCATTAAACATCAGACTTGGC" "5582" "1" "0.075897" "2.0386176" "-4.17" "1.68865436" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "38440" "1" "0.075916" "2.0384611" "-4.17" "0.44644383" "12479" "TAATGACCATCTTAGGACACAGTCTCTATGGAAATTTTGCATTAATGACTGAAAGGTGTT" "34611" "1" "0.075916" "-2.0384605" "-4.17" "-0.18800747" "" "ACATCACAGATATCGGCTCATCTCTGCTTCCTAGGTACGGGGATTAAAGACGTTAGTCAA" "59247" "1" "0.075934" "2.0383046" "-4.17" "0.42607249" "223920" "ACACGTTTGGTTCTTTCTGCTTCTCCCAATGCAACAATAAAAATCTTAGTCTCGGACTGG" "26280" "1" "0.075947" "-2.038199" "-4.17" "-0.26984936" "" "ACCAGACAACTTCTCCGAAGGAGATCTGCTCCCTGTTCTTCAGCGACACTAAGCTCAGGC" "17438" "1" "0.075948" "2.0381916" "-4.17" "0.18728975" "404316" "TCATTGGGAAACACAGACAGTTATATACTAGCTGCAATGGCATATGACCGAGCTGTGGCT" "42951" "1" "0.075952" "-2.0381524" "-4.17" "-0.17620314" "20482" "TGCCAATGCATATAGTTTTATGATTAAAATTGCTGTGGTTGGTTGCATTACATGACACAC" "48296" "1" "0.075997" "-2.0377733" "-4.17" "-0.33776168" "14950" "GCCTATCTCGTGATTGTTTCACGTAAGCTTTGAAAGAGATAACTATGAAGATACGTACGG" "18469" "1" "0.076013" "2.0376352" "-4.17" "0.60830815" "12741" "TCCTACTGAGATCCTGGGGGCACTAGATGCTGCCTTAATGTCCAGTGGCACCTGCTAACC" "35826" "1" "0.076021" "2.0375726" "-4.17" "0.23343516" "" "GTTTGCTAAAGATTTTAATCAATGTACTAGGATCCTGCCCCACCCCTTCTTCATGTCCCA" "18755" "1" "0.076024" "-2.0375442" "-4.17" "-0.31939886" "74747" "TGCCACCTGGGTCTTCCATCTAGAACCTGTTTACATGAAGTTACTCGCGGTTCATGAATA" "17687" "1" "0.076045" "-2.0373615" "-4.17" "-0.15739742" "269470" "AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG" "828" "1" "0.076073" "-2.0371274" "-4.17" "-0.73152127" "20346" "GATGGGAACTAGAAAACTGGAGAGAAAAATGTAACGATATTGCTGCTGTAAATTATTCCT" "822" "1" "0.076088" "2.0370023" "-4.17" "0.6784996" "73149" "GCCAATGGTTATACATATGATAATACTGGCACATGTGTAAACTTACTTGGTCATTGTCAT" "54562" "1" "0.076106" "2.0368472" "-4.17" "0.3691575" "751864" "CCAAACTTCTTCTGGTTATTGTCTCTGTCATGTACAGGCACAAGAAGCAGAAGGCCTGAA" "26524" "1" "0.076125" "2.0366883" "-4.17" "0.71424861" "" "GGGCTCCTCTGTTCCACCCAGGGTGTGGAAGTGCCTTCATCCATTCTTGTATTACTATTT" "46014" "1" "0.07614" "-2.0365609" "-4.17" "-0.20091963" "109910" "AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC" "24493" "1" "0.076148" "-2.0364937" "-4.17" "-0.19887902" "21915" "CGTCGTATTTGACCATCGTATTTAACCACATCCGGCTTGTTTTGTTTTATTAAAAGGTTT" "51295" "1" "0.076155" "-2.0364352" "-4.17" "-0.20421103" "227800" "CAAGGTAGAGACAGTGTCAGAACAAAGATTGTATTTAGGCTCATATAAAGTACAGTGCAG" "5827" "1" "0.076184" "-2.0361845" "-4.17" "-0.1744387" "228714" "TTTAAAGAGTCTGTTCTGTCTGGATAGAGTGCTTGTGGGCAGATGTCCTTCTGAAGGTCT" "1879" "1" "0.076192" "-2.0361233" "-4.17" "-0.22881732" "" "TAGGAATCACACAAATCCTTTGCAATGCAGATAGCTAAGGAAATGTCAAGTGAGGGCCCC" "5300" "1" "0.076195" "-2.0360951" "-4.17" "-0.31885401" "" "ATGTGATGAAATGGTGCTTTGGACAAGACTTTTCCTCCAAGTTGGTCCTATCCAGGGGTT" "51111" "1" "0.076198" "-2.0360729" "-4.17" "-0.24638877" "" "TTAAGCATGAAGCCGCTGTCTCCCCGTTCCGGCACGATGCGCGGAAGCATCCTGAGCTGT" "62698" "1" "0.076231" "2.0357913" "-4.17" "0.43378545" "" "TCATGGCAGTACTTGTTCATGTGATGTTTATAGGACGTGGGAGGCGCAGTTAACAGCTTT" "7635" "1" "0.076272" "2.0354423" "-4.17" "1.27708687" "" "GGACACTTGAAAGCAGTACCTCAGGCTTACTTTCACCTTCTCTGGGTTCTTAAGAAAAAA" "45516" "1" "0.076292" "2.0352717" "-4.17" "0.35812037" "79554" "CAAACTTTGGGGCATATCTCTTCCATTAAGCACTGTGATATATGTAGTATTTCCAACAAA" "62015" "1" "0.076322" "-2.035025" "-4.17" "-0.46925753" "269016" "AGAGTTCTCAGGAAAGAATATAAACAGGTCTGGTTGAAGCAATGTTTACACTGACAGAAG" "8959" "1" "0.076322" "-2.0350233" "-4.17" "-0.278115" "108143" "GAAGACGATGATGATGACGATGATGACGATGATGATGATGACTATGATAATATGTAGTCT" "52392" "1" "0.076325" "-2.0349926" "-4.17" "-0.29770541" "68870" "CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT" "13044" "1" "0.076344" "-2.0348344" "-4.17" "-0.16581638" "" "" "33629" "1" "0.076347" "2.0348075" "-4.17" "0.56664332" "" "ACGAGTCTCTGATACAATTGTTCTTGCTTCATCACGCCATCTACAAAGTCCAACAGCAGG" "49223" "1" "0.076348" "-2.0348052" "-4.17" "-0.21703284" "54160" "TGTGGATGTTATCTTGGCTTCTGTGGGATAAGTTCTTGCTGGGAAGGGTGATGTTGCTAT" "55667" "1" "0.076361" "2.0346957" "-4.17" "0.23484337" "12235" "AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA" "40087" "1" "0.076375" "-2.034575" "-4.17" "-0.25034927" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "27264" "1" "0.076399" "2.0343692" "-4.17" "0.59837805" "71398" "ATTCCTATGAATCCCAAGGCACTATTGTATTAATTTGATCAGAGGATGTGATGGAGGGAA" "24618" "1" "0.076406" "-2.0343075" "-4.17" "-0.16793376" "232973" "CAAGGTATCTCTTGGAGTGTTCTCTTATGCCTTCTTATACTCCTCAGAGATTGACCACCC" "46384" "1" "0.076479" "-2.033698" "-4.17" "-0.16364406" "" "GTCCCATGCAACCTAAGAGTCCATAAATTGTTTGGATCCATCAATCGTGATATTTAGTAA" "44463" "1" "0.076491" "-2.0335941" "-4.17" "-0.18603851" "" "TCCTGTCACTACAGGCAGATTATACCAGAAGCTCAAAGGGCAGGTGCTGGCCCTCCATGT" "3018" "1" "0.076501" "-2.0335088" "-4.17" "-0.18243057" "66983" "GACACATGTTTATATGACCTCGATGTATATATATTTTCAAGCCTTAAACTCCAAGGGTTG" "33338" "1" "0.076589" "-2.0327705" "-4.17" "-0.33513225" "230162" "GCCCCAAAAGAAAATTACTGATTTATTTTGTGCTGCCTCATCTGTGAAATCTGTTTGTAA" "16459" "1" "0.076609" "2.0325966" "-4.17" "1.49579584" "" "TATACCTTCAGTATACCTATGGTGGGAAAAACACAGGTGGAAAAGGAGGGGACTATGCTC" "17517" "1" "0.076619" "-2.0325203" "-4.17" "-0.20130515" "113860" "TAGGAGTCCTAGCTAATATGTGTCTTCTTGTTTTCTATATTTTCATGGTCCTAGGGCACA" "47983" "1" "0.076626" "2.0324612" "-4.17" "0.3121619" "243369" "TGTGCTCAGGGTGAAGTGATCATGCAGGAGCCAGGGAGCTGTTGCCCCATTTGTCAGCAA" "42893" "1" "0.076654" "-2.032222" "-4.17" "-0.31280822" "18537" "TCTCATGGGGGTGATATACGTGCCTTTAACAGATAAAGAAAAGCAGTGGTCCAGGTGGAA" "26104" "1" "0.076668" "-2.0321052" "-4.17" "-0.17655519" "" "GACCAGGGGGCTTTTGGATTTCAGGTTTATTTTGGATTCTAGATTATTGACATATGAATA" "15799" "1" "0.076704" "-2.0318004" "-4.17" "-0.22394089" "216760" "CCCTGTCACACAAAAGGGAATGAGTGTTGTTTGATAGTACTTGTATCTCAACAATTATTT" "17340" "1" "0.076708" "-2.0317676" "-4.17" "-0.208186" "72135" "TACTAACAATGCTTCATTTTATTGTTTTTTGTTGGTTGTCTTGAAATGAGATTAATGGGG" "29429" "1" "0.076729" "-2.0315925" "-4.17" "-0.23278172" "" "GTTATGGTCAACATTATGGTCAACAGTCTGGCTATGGTGGACAGCAACAAAGCTATGGAC" "13282" "1" "0.076756" "-2.0313616" "-4.18" "-0.22711902" "26894" "TTAAAGTTACGACAGCAGCTGCTGCTGCAGCCACCTCCCAGGATCCTGAGCAACACCTGA" "62398" "1" "0.076784" "2.0311329" "-4.18" "0.29197015" "11600" "CATGTGTGTAGCAATTTGATACGCATAGCTTTTTGCATTTAATTAATGCAGGGCAGAAAA" "37007" "1" "0.076784" "-2.03113" "-4.18" "-0.18931837" "435616" "TCTGCAGAGGAGTTGGACGCCCAGCTGGATACTTATTGGGAAATGATGGACACCAGTTAA" "36346" "1" "0.076801" "-2.0309885" "-4.18" "-0.4746775" "67304" "TTAAGAACACTGACTGCTCTTCATACAATGCATCCTGAATCCTTGTGTTGGGCTCGGCTA" "50972" "1" "0.07681" "2.0309068" "-4.18" "0.48799853" "" "CACTTGCTTATCTACGGATGATTAGATATCTAAATAACATGTTTAAGGTGAATAGCCACC" "19533" "1" "0.07681" "-2.0309065" "-4.18" "-0.19894089" "" "" "55272" "1" "0.076814" "2.0308811" "-4.18" "1.14264758" "" "CTTATCTTTTCTCACAAGCAAAGGGGACATTTGTGAGTGGAGAGTACTTAGTAATTAAGG" "4489" "1" "0.076821" "-2.0308202" "-4.18" "-0.30836665" "242894" "GTGGAGGAACCCTGGCCTTCCCAGCCTATTTTTGTAAATAAAATGTTATAAACTTGAAAT" "10520" "1" "0.07683" "2.0307447" "-4.18" "0.30827351" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "54639" "1" "0.076844" "-2.0306293" "-4.18" "-0.24720487" "228859" "TATGTATCGTTATGTCTTGGGGTTTGGAGCAGTAACAGAGAACCCCATTTTCTCTCTTCT" "1424" "1" "0.076856" "2.0305209" "-4.18" "0.66529242" "" "TCAGAGGATGACGATGGCAGTCCTCATGATCACTGTAGCACCTCAATTGAGAGACTGAGA" "40609" "1" "0.076956" "2.0296899" "-4.18" "0.21790941" "28240" "CAGTTCAACCATCAGACACAATTTTGAGAACTCAAGAGAAATGAATTGTACTGACTCATA" "39127" "1" "0.076963" "2.029623" "-4.18" "0.37020125" "16801" "CTACCCCAAGTGCCTTTGCTATGTTTTTATATCCTGGACTGGAGGTTTATTTTTAATATA" "28731" "1" "0.076966" "2.0295988" "-4.18" "0.48129449" "100038601" "GACAGCGCAAACGGAAATATACCCAGCCTCCTAAAAGGGTGATTAAACATTTAAAATATC" "54030" "1" "0.076986" "2.0294353" "-4.18" "0.36638016" "12556" "AGACATTATCACAGGCATGTCCCCAAAGCCTGAGCACCTACTTTATGGGATGACCATGGG" "55028" "1" "0.076999" "2.029328" "-4.18" "1.01799161" "20821" "GTGTCTTTGTTACATAAAAGTTACCTTGAGAAAGATCTCCAAGTATTGGTTCCAATTCTG" "7278" "1" "0.077049" "2.0289054" "-4.18" "0.26666456" "" "GGACGAATGTGCTTGCCTGTTCGGTGGTACAGCAGTAGGTGGATAGAGCAGGCACTCTAG" "5497" "1" "0.077052" "2.0288794" "-4.18" "1.75462711" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "19530" "1" "0.077072" "2.0287179" "-4.18" "0.35831568" "20469" "CTAATGCCTGTCCCTGTTTGTAAATATCCTGTAAAGAAAAGGAGACATCAGAGTTTAAAA" "62936" "1" "0.077077" "-2.0286714" "-4.18" "-0.30789444" "" "TTTACCTTTAAAACCTTAAATGTTACTATTGCCAGCCGCAGGCATGACGGGCAACGAGAG" "28990" "1" "0.077125" "-2.0282709" "-4.18" "-0.16573057" "108079" "GTCTTTGTATACTTCCAAAGCTTGATCTCTGTGACCTTCACTGTTGAACCTGATTGGACA" "40191" "1" "0.077141" "-2.0281361" "-4.18" "-0.26135812" "218793" "TGCTTGTAAATTTCTTAGGGACCTGCCACTTTTGACTGTGGATCAGTTGATGTATACTTG" "12088" "1" "0.077148" "2.0280791" "-4.18" "0.9540255" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "52766" "1" "0.077161" "2.0279684" "-4.18" "0.34378663" "" "AAGAAGAAGTCTGTTTTGACTGGTCTGTCCGAACAGCTATAATAGCGAGAAACTTTTCTT" "46922" "1" "0.077162" "2.0279593" "-4.18" "1.75510257" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "44082" "1" "0.077174" "-2.0278577" "-4.18" "-0.21055494" "103737" "GGGAGGAGTCTGGAAATTTCAGTATGAATGAAAACTAGCAGGCAATGGTGAGATGCAGTA" "56013" "1" "0.077199" "-2.0276556" "-4.18" "-0.17096987" "" "" "57694" "1" "0.077202" "-2.0276256" "-4.18" "-0.17271089" "13712" "GTTAGCCATCTCAAGGAGAAACATAGTTAAACTGACAGACTTAAGCTCTGATTGTGGTGG" "45477" "1" "0.077222" "2.0274638" "-4.18" "0.16376034" "" "TGTGCACATGGAGTAGGGTTAGAAAACAAGTGGGGACCACAAATTAAAGACCACACCAAC" "42101" "1" "0.077234" "-2.0273593" "-4.18" "-0.20675816" "195040" "TCAGACAGTGTTTCTGTAAAACTAAAAAGACTGATCTCAGTAACTTCTGAATCCAGTGCC" "1551" "1" "0.077239" "-2.0273192" "-4.18" "-0.25066742" "14105" "TACTAAAAGTAGATTTAAAGTGTATTCCAGGATTGTAGGCTGTTGGAGCTCCAGCACTCT" "36373" "1" "0.077254" "-2.0271919" "-4.18" "-0.28321026" "" "ATAACTCCTTATCTGTATACAAGCAAATGGTATCTGGGAAATAGACCACCAGTTGACAGC" "40766" "1" "0.077265" "-2.0271022" "-4.18" "-0.16141908" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "20744" "1" "0.077277" "2.0269988" "-4.18" "0.61768589" "72318" "TCTTTCCTGTTGTAACACTCAGGAGCAAGAATAAAAGCTCATGACGTCGCTCGTAGACTG" "50398" "1" "0.077279" "-2.0269832" "-4.18" "-0.14959175" "56378" "GGGCGATTTCGATTTTTGGCAGTTTTAAGCTGGTACTTAATATATAATAAATGTCACTGC" "55645" "1" "0.077302" "2.0267954" "-4.18" "0.61720234" "26364" "CGCTGCTCCACATCCAGGGCAGAAGGTCTCACAGCTAAAGACTAGGTTTTGTAATTTTTT" "7056" "1" "0.07734" "-2.026475" "-4.18" "-0.17353818" "" "GGAGACACTATTTTTGACAGAACACCGTCTTTCTTAGGTAAAACTCTGCTCACGTGTTAG" "19747" "1" "0.077349" "-2.0264017" "-4.18" "-0.20701676" "" "CCCAGTGATCCTGGGTTGTATGGAGTTACCTTGTAAAGCTAATTCTCACAGCTTTCTCGT" "27737" "1" "0.077358" "2.0263266" "-4.18" "1.69856579" "" "GTTCTGGTTGTCCCTGGAGCTGTGGTCATCAATGTTGCTGTGGTGGCTTTTGTGAGGAGA" "21228" "1" "0.077367" "2.0262494" "-4.18" "1.63461688" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "60517" "1" "0.077371" "-2.0262186" "-4.18" "-0.18546697" "" "GAGTAAAAGCTATCTGTAATCAATACCGTTACGAGTTTAAAGCTTTCAGGCAGAATCACA" "12879" "1" "0.077374" "-2.0261948" "-4.18" "-0.1821421" "27366" "AGCAGAATTTGTAGCTCTAAGGAAAGAACACGCAGAAATTAAATTGCATTCTCTAACCTG" "61194" "1" "0.077379" "2.0261523" "-4.18" "1.3986888" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "60164" "1" "0.077397" "2.0259997" "-4.18" "1.57726899" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "38628" "1" "0.077454" "2.025525" "-4.18" "0.58359439" "19171" "GGAACTTCTTGAGGAAACTGTGCAGGCCATGGAGGTGGAATGAAGTGGCCTGAGATGTAG" "59657" "1" "0.07746" "-2.0254783" "-4.18" "-0.22088228" "81904" "GACATCTCTAGCGACGTCTCCATTCAGATGACGCAAAATTACCCCCCGGCCATCAAGTAC" "24092" "1" "0.077462" "2.0254621" "-4.18" "0.23276728" "19038" "GGTGACCCGAGGGTTTGTTTGAGGAAGGTGACTATAATGAAGGTTAGCATTTTCTGTTCA" "33427" "1" "0.077462" "-2.0254546" "-4.18" "-0.22394737" "" "ATTCACCAAGTTCAAAACAAACACCCACACTGGCTGGGTTGCCTTTCCCATCAATGAATG" "56528" "1" "0.077496" "2.0251751" "-4.18" "0.19025605" "387564" "GAGTCACCAAGGTACTACTGGGAGAATATTACTTTACTGTATGTATCTCTCTAGTAAAAT" "19456" "1" "0.077497" "-2.0251667" "-4.18" "-0.243443" "74309" "ATAACTATCCTGGCAAGAAGCCCTTTTTTAAAGACTCGAGGAAGCCAGGCCCCTTTGAAT" "31007" "1" "0.077502" "-2.0251238" "-4.18" "-0.17730119" "" "" "55274" "1" "0.077519" "-2.0249826" "-4.18" "-0.17593703" "68046" "GACAAGAACCCAAAGCTGGACTTCAGGCACTTCTTATCTTCTCTATGAAGAGAATGGCCT" "12061" "1" "0.077557" "2.0246634" "-4.18" "1.01979838" "" "TTATCCCTTTTACACTTCCCATTTTGGAATCTGAGCCACCCTGCCTGGGTTTACATCTGT" "3865" "1" "0.07756" "-2.0246389" "-4.18" "-0.35957523" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "57253" "1" "0.077561" "-2.0246304" "-4.18" "-0.30695168" "17391" "CCTGTAGGCTCTGAGAGAGGCTGAGGGTAGCACTCATCTTACCCTCAGATGAAGCACAAG" "60947" "1" "0.077574" "2.0245223" "-4.18" "0.42473504" "" "TTGTTCATGCAGCTGGGAACTGTGGGAATGTATGATTTGCCACATCTGAGGAACAAACTG" "31446" "1" "0.07761" "-2.0242267" "-4.18" "-0.29340304" "" "" "29662" "1" "0.077628" "-2.0240798" "-4.18" "-0.18410809" "105638" "TACAGTACATGTCAGATTTCTTCCTTTGTTTGTGGGAGGTGGGAAGGCATTGAACCCAGA" "41620" "1" "0.077644" "-2.0239458" "-4.18" "-0.21294882" "" "CAGGACTGCACCCAGGACTGTACCCAGGACTGTACCCAGGATCTTGTACCTCACTCTTAG" "18388" "1" "0.077657" "-2.0238374" "-4.18" "-0.19023298" "20438" "GCTGCTGTGGTTTTGGTTTGGTTTGCTTTTGGTTTTTGATGTGTGTGTATTTGATAATTT" "61904" "1" "0.077673" "2.0237052" "-4.18" "0.38686007" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "52335" "1" "0.077692" "-2.0235469" "-4.18" "-0.16493415" "" "TTGGGCTACAGGACCACCTGAAAATCATTTGGGATCTACTTGGATGGCTTTACAGGGAAA" "51311" "1" "0.077694" "-2.0235295" "-4.18" "-0.15913164" "223669" "TAATGCCTGTGGCAAGGCTTTTCATCAGATCGCAAAGCTCACTCAGCACCAAAAACTTCA" "38554" "1" "0.077706" "-2.0234317" "-4.18" "-0.27124497" "" "TTCTCTTTAGAAAATACTCCACAAGGCAGTAAGTCGGCAAGCCTGGTTTCATAGCGCTTG" "36475" "1" "0.077711" "2.0233912" "-4.18" "1.6503925" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "9947" "1" "0.077714" "2.0233618" "-4.18" "0.26133028" "" "TTTGACTTCTAAGATGAGTCCTCTTGCTCCTTCTGCTAAGAGTGGTCAGTGGTGAGTTGT" "24550" "1" "0.077739" "-2.0231542" "-4.18" "-0.34104183" "18045" "TAGTTCTAGCTCTATCAAAAATGGCTTATTGTATAGTCTGTCCAGAAGGAAATTTTGGGT" "56035" "1" "0.077782" "2.0227954" "-4.18" "0.17658409" "" "" "2491" "1" "0.077805" "2.0226086" "-4.18" "0.21118935" "231712" "GCGCCAGCCCCTCCCCTTTTTATTTTACTGTTCTAATTGTCTATTTCCTTGTAATAGAAA" "43440" "1" "0.077819" "2.0224935" "-4.18" "0.15611298" "" "GACACTCTTCTACAAACACATGTTGGGAATTTGAGATGTGAAAAGATTATATTGGTTAGG" "42844" "1" "0.077822" "-2.0224672" "-4.18" "-0.49608016" "" "TTTTGTTTTCTTCTGGGGAATGAGGCCTGTGTTCACTCTGCTCTTTCTAAGCTGTGGAGA" "37343" "1" "0.077846" "-2.0222686" "-4.18" "-0.23764" "" "AGGCCAAAACATCGAAAAGAAAGGTCCCATGACACCTTGGTCTCTAATTTAGAGGGTCTC" "31510" "1" "0.077854" "-2.0221997" "-4.18" "-0.30290378" "17144" "CAAGATACTAGAGACACTGAAACTGTAACTTTCTGGGCAATGGAAAAAATGTGAATGTTT" "9361" "1" "0.077884" "2.0219564" "-4.18" "0.96648343" "21939" "GGGTTTCTACCTGTGTGTTACCATTTAGTTCTTGAATAAAAGACACACTCAACCTTTATA" "21623" "1" "0.077899" "-2.0218273" "-4.18" "-0.19610106" "28000" "GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT" "49966" "1" "0.077911" "2.0217264" "-4.18" "0.2740528" "14613" "CCGACACTGGCACTAAGACTCTCTGTTCTGGCTATGGAGTGTGTGTTTGTTTTCTGAAAT" "24268" "1" "0.077913" "-2.0217163" "-4.18" "-0.1806569" "" "ACCGTGTCAGCAGCCCTCCTGGCTCGTCTTCTCTAATTAAATATGAAATGTTGTAAAGTG" "31630" "1" "0.077947" "-2.0214343" "-4.18" "-0.21347798" "269643" "AAGCCACAGACTTTGCCACTTTACTCTGCTTAAGTTCTCTGGTCTTGAGTACGTGGCATT" "36376" "1" "0.077967" "-2.0212661" "-4.18" "-0.20017897" "" "AGTTCATCACTTGTCCTGTGTCTGTTACTTTAAGAAAGCCTATGTCATCCTGTTCGACTA" "62037" "1" "0.077978" "-2.021173" "-4.18" "-0.21002448" "384732" "ACCCCAAAGTCTTCCAAAGAACAGGAGAAACTGGTGTCTGTCTTCTATGCAATGGTGACA" "38592" "1" "0.077983" "2.0211367" "-4.18" "0.21849064" "17172" "CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA" "28707" "1" "0.077999" "-2.0210021" "-4.18" "-0.27509208" "72097" "GAGAAGGAGAGGAAGGGACGTGGCAGGGTTTGTCAATTCATAGACTGTTTCCAAAAAGAA" "44761" "1" "0.078025" "-2.0207886" "-4.18" "-0.18355481" "230810" "ATGACTCTCCAGCCAGACACCGTCTCCTCGGAAACATGGTCAGGACCTGTGGGTAGAACT" "59798" "1" "0.078055" "-2.0205339" "-4.18" "-0.54242062" "60321" "CTTCCCACAAGCTAAACTCTTTTGAGTGTTTCATGGACAAATAAAATGTTCCATACCAAG" "2589" "1" "0.078057" "-2.0205206" "-4.18" "-0.83238091" "633640" "ATACGGAATGCGCATTGATGTCTGAGATGACCTTATATGTGGCTCTAAGAGAAGGAATTC" "30571" "1" "0.078064" "2.0204616" "-4.18" "0.40736951" "246228" "AGGAATGGGACGAGACCTTGGCATTTAGGGCCTCAGGGATAGGAGAGCCGCACTATGACA" "47416" "1" "0.078088" "2.0202658" "-4.18" "0.30773114" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "37111" "1" "0.078099" "2.0201704" "-4.18" "0.24238675" "20018" "GAGATTGTTTAAAAACTCCTAGTTTTTTGATGTACTGCTCTTTTGTGGTCATTTCCCAGA" "23149" "1" "0.078104" "2.020135" "-4.18" "0.85186454" "14462" "TTAAGGAATATAGGGGGATTAAAGTATGGAGATACAGAAGAAACCACTAAGTCTGATGTC" "34142" "1" "0.078173" "2.0195636" "-4.18" "0.27751056" "19746" "TTGGTTTCATGACAGAGACTATTAATACTTTGGGATGAATACACCTCATTAAAGTTCTGG" "32984" "1" "0.078173" "2.0195619" "-4.18" "1.93205487" "231507" "ATTGCTCTTTGACTTGGTTTCTTCTTGCTCCCATATCATCAAATATTGGAGCCTATAATT" "55188" "1" "0.078175" "-2.0195429" "-4.18" "-0.22206891" "17955" "ACTGTGATGGGTGTACAATAGACTGGAAGAAAGGAAAAAATGTCACAGTCAAAACCATCA" "37325" "1" "0.078195" "2.019385" "-4.18" "0.25629098" "11957" "CCAGTCCTGAGGAACATATAAAATCCATGTGGTAATTTGTCATGAATTAGTTGTACAACT" "41230" "1" "0.078201" "2.0193326" "-4.18" "0.33668809" "" "AATGAAAAGCGCAAGGATGGCAAAGATTGAAGGAATATGATGAAACATTGGCTGATCTGA" "28170" "1" "0.078257" "-2.0188688" "-4.18" "-0.20262103" "213234" "ATGTCATTAAACTGCCGTGGGAAAAGAGGGCTTGACCGTTCACTACTCTTCCATTCTGTA" "32772" "1" "0.078295" "-2.0185537" "-4.18" "-0.18022608" "" "GTCCATTTCTACATTCCCATTTTATGTGTGATTAGATCACATTCAGAGAAGTTAGTGTGA" "55987" "1" "0.078313" "2.0184062" "-4.18" "0.18816274" "" "" "21724" "1" "0.078351" "2.0180931" "-4.18" "0.68005641" "12487" "TGCTGTATCCCCAGTGCCTAGAATAATGCTTAGCCTGCAATAAATATTTATTCATTGACT" "6696" "1" "0.078354" "-2.0180703" "-4.18" "-0.17139325" "58172" "CAATCGCTACTCTACTCTCTGAATTGTCTTAATTGTGAAACCTTGCTCTTACAGATTGAA" "58819" "1" "0.07836" "2.0180183" "-4.18" "0.16040678" "" "TTTGTCATATACATAATCAGCATTCTCGCCTCTTCGACTTGGGAGTCACTTTCCATGCCC" "35912" "1" "0.078363" "-2.017998" "-4.18" "-0.19266276" "" "CAGCGGGAGCACCCCGTGCTCCAACCTGGTGCTCCTCCAACACCCACAGCTCTGCTTTTC" "33449" "1" "0.078372" "-2.0179244" "-4.18" "-0.31660247" "70981" "CGAAGCCCATAGTTATCATGACTCCTGAAAGCATGAAGTTGGCTACCATGAACAGCTGAA" "60051" "1" "0.078396" "-2.0177263" "-4.18" "-0.23030354" "" "" "23902" "1" "0.0784" "-2.0176935" "-4.18" "-0.28707167" "330941" "TGCCTGCATCTGATATACAGCAAAGGGGATCTTTCTTCTTCCCAAGTCTGGCCTAATTAA" "18431" "1" "0.078419" "2.0175334" "-4.18" "2.900287" "16061" "TTGCGTGTATCAGCTGAACTCTGGAAACAGGGTGACCAGTACTCCTGCATGGTGGGCCAC" "58311" "1" "0.078423" "2.0175056" "-4.18" "0.16459889" "" "CAGCCTCAATACTACTGACATTCTAGGACTTAGGTCCTAATTTTTTAATCCTTATCAATG" "40034" "1" "0.078441" "-2.017353" "-4.18" "-0.16953368" "" "CTGATTCTCCTCTCTGTAGCTTGAGATGTTTTCCTACATCTATGAAATTTCAATTAACTC" "59417" "1" "0.078448" "-2.0173001" "-4.18" "-0.19895148" "77329" "CACCCAATAACAGTCATGATAAGCATTTCAAAAGAATTTTACTTGGATGCCAAAGAGACT" "52701" "1" "0.078454" "-2.0172457" "-4.18" "-0.22617747" "66700" "ACTGTGTGGAGCAGTTTGAAAAGCTTTCTGGTATGCATGATCTTCACAAATGAGGACAGC" "23999" "1" "0.078491" "-2.0169433" "-4.18" "-0.21778972" "668166" "GTGTGTTTGGCAAATAAGTCTGTCAAGGATGAGCTAAATACACAAGTCATACAAATAAAG" "44379" "1" "0.0785" "-2.0168665" "-4.18" "-0.16639403" "74375" "TCTTTTGGTTAATTCTGTTCTTTAAGGAAAGTAGCTCTCAGAAAATTTGGGTCAAAGCAC" "13887" "1" "0.078502" "2.0168563" "-4.18" "0.82297618" "16160" "GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT" "59713" "1" "0.078502" "2.0168512" "-4.18" "1.77779422" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "29998" "1" "0.078531" "2.0166129" "-4.18" "0.50525953" "20732" "ATAGAAGGACCTGCTTATCCAAGAGCTGGAGAAAGTTGGTGTTTTGTGTCTTGTTCAAAG" "57632" "1" "0.078537" "-2.0165621" "-4.18" "-0.17143212" "80732" "CAGCGAGACTAACTTAACTGGAGAGAGTATGAAATACCACCTTTGTACAATAAACTTATT" "40686" "1" "0.078543" "-2.0165167" "-4.18" "-0.22719192" "619331" "TGAATGCGGGAAGTCCTTCAGCCAGAGTGCTAGCCTGATTCAACACCAGAGAAGCCACAG" "49972" "1" "0.078559" "-2.0163823" "-4.18" "-0.28949011" "" "GTTTCATTGGAATTGGGCCACACATACTTTTTCTGTGAGTCATTCTGATGAATAAAAAGA" "38669" "1" "0.078576" "-2.0162469" "-4.18" "-0.21891127" "216877" "GCCTCTTTTGTTGGGCCTCCTTTCCCTTATTTAAAGAATGCTGTTTAGAATATTAAACAT" "28573" "1" "0.07861" "-2.0159669" "-4.18" "-0.24304231" "216021" "CAAAACCTTGCATCGAATTCCTTGTTTCAACTAACCCCAGCTATAAATGTCTAACTTAAT" "36638" "1" "0.078614" "2.0159338" "-4.18" "0.2510121" "" "" "51375" "1" "0.078704" "2.0151951" "-4.18" "0.61705477" "751865" "GGTCCCAGTGGTGACCAGAGCTGTTCTGGGACTGACACATGAACCACATAGTACCCCAAT" "36178" "1" "0.078716" "-2.0150944" "-4.18" "-0.29253257" "" "GAGTTCCTGGGCAGACTGGGCACCAAAAGGCCCTCTTACCAAGTCAGTTGATAAACACTG" "5318" "1" "0.07874" "2.0149019" "-4.18" "0.2908955" "" "ATGAACAATGCAGAGCAGTCTATATCAGATGCTAGAACCCAACGTTGGTGTCCTCACCAA" "22680" "1" "0.078743" "-2.0148757" "-4.18" "-0.38748661" "78938" "CTGCAGACACAGCCGACCCTCAGGAGAATCCCTTGCAGCCAATATCTGTTGGTGAAGAAC" "31830" "1" "0.078761" "-2.0147233" "-4.18" "-0.37206478" "" "CATTCTGTTGCTTGGAGGATGCAAAAAAGATGCTAATAAGATAACTCAAAATGCTGTTCA" "51685" "1" "0.078786" "2.0145258" "-4.18" "0.74079945" "192199" "CCGTGGTACACGTCACGGATGACCTGACTTGGAAACTGCTTAAAGGTTTATTTCAAATTA" "43992" "1" "0.078789" "-2.0145008" "-4.18" "-0.19398647" "" "TACCAGTAAAACTGTCAGACAACTTGCCTAAAATGTTATTGGGAGAGTGCTTCGCTTTCT" "1995" "1" "0.078791" "-2.014484" "-4.18" "-0.20407174" "" "AGGGTAGGGATTTGAACCATCGTAAACTTGTGACTAAATCAGAAGCTGTGGTTTGAACTG" "9657" "1" "0.078798" "-2.0144198" "-4.18" "-0.2177838" "" "TTAAAGTGCCTCACACCGAGATCCAGATCTGACCTAGGAGTTTCTGAGTTTCTGGAATGA" "11218" "1" "0.078805" "2.0143692" "-4.18" "0.21762856" "" "GAAAAAAGAAATAACTTCCTGGGAGTCCTTCCAGAATTTTCTTCAGTCATGGACCTGGGG" "31359" "1" "0.078805" "-2.0143628" "-4.18" "-0.19075091" "66139" "TCCTGCTGTCTCTCCCAAGGTACTTCCTATACTTTGTTATGCGGCCTGTACATGAGAAAT" "56481" "1" "0.078835" "2.0141188" "-4.18" "0.86947805" "" "AAAGAAGCTCACCCAGGAGCAGGCTCAGCTTTCAGAACCTTTAGGAACCGATAGAAAAAA" "21697" "1" "0.078871" "2.01383" "-4.18" "0.311949" "" "GGGATTTGTCACCCGATGGATTAGTCATTGTTCAAGGTAAAGGGGGAACTGAGTTTAATT" "12349" "1" "0.078892" "-2.0136554" "-4.18" "-0.46135858" "" "TGGGGCATCGTGTATCCAATAGAAGCTTGCAAACCTTTGTAGTGATAAGAGATCTAGGAT" "62317" "1" "0.078966" "-2.013048" "-4.18" "-0.17277367" "258165" "GTCTGAGGAATAAGGATGTCAAAGTTGCTCTAAATAAGTTACTTCGAAAGAAGACATTTC" "47012" "1" "0.078974" "2.0129843" "-4.18" "0.22314227" "225908" "CCGTGAATTCACATACCACTTCCGGGTGACATTGCTGGGTCAGGCCAACTGCAGCTCAGA" "27712" "1" "0.079008" "2.0127045" "-4.18" "0.84407344" "" "TTTAGAATGGTACCTGCAGAAACCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTTTC" "23716" "1" "0.079016" "2.0126395" "-4.18" "0.22913865" "" "TTAAGGACAATGGATTAATGCAGGAGTACTGTGTGAACACACCACCAACCAAGGGTTCTT" "43255" "1" "0.079026" "2.0125626" "-4.18" "0.51442089" "217122" "GTCAGACATGCACATACACTGGACATCCATCAAATAAGGATGAAGGATCTGTCATGCCAA" "2154" "1" "0.079033" "2.0125031" "-4.18" "0.16608965" "18817" "CCCCTTTGAAGGGGTTGCTGTGTGTAAGTTATTTTGTACATGTCTGGGTGTGGGTTTACA" "21932" "1" "0.079132" "-2.0116971" "-4.18" "-0.19851647" "" "" "44300" "1" "0.079146" "2.01158" "-4.18" "1.7873886" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "7221" "1" "0.079162" "-2.011453" "-4.18" "-0.19956906" "" "" "46988" "1" "0.079217" "-2.0109985" "-4.18" "-0.23478988" "237758" "CCACAGTTGGATAGTAGTGCCTTTTTATTGGCCTGAATTACTATTAGAACCAAAATGAAA" "9448" "1" "0.079235" "2.0108555" "-4.19" "0.66624819" "" "TTACATATATCTGCCGTGGATCCAGAAGACTCAGCTGTCTATTTTTGTGCCAGCAGCCAA" "8875" "1" "0.079259" "-2.0106559" "-4.19" "-0.1961647" "" "ACCATTCACAGGACCATTGCCAGTCTATGATGTAGAAACCATCAACTCACAACTTTTCAT" "29471" "1" "0.079262" "-2.0106377" "-4.19" "-0.23049215" "15357" "GCTAAGTAGTGCTAAATAGTTCTTGACGAAGAAAACAGTCACTGCATTTATCTCTGTGAG" "38173" "1" "0.079262" "-2.0106325" "-4.19" "-0.30757579" "" "TTTCAGTCTCTGGCCAGGGTCTCTCACAGCCGATGGGGTCTTGGAAGACAGGGTGAAGTT" "2649" "1" "0.079296" "2.0103535" "-4.19" "0.59117314" "" "" "26450" "1" "0.079315" "-2.0102039" "-4.19" "-0.21392876" "" "TTGATACAAGAAGAATACAACCAGTGTTACCTCCCTTCTGCGAACCCAAGGATGGATGCT" "53090" "1" "0.079331" "2.0100758" "-4.19" "1.00387468" "22029" "GGTCAGACATTAATGTGAATTTAACCTGCCCTGGACTGAGTTCCTATGTTAACAGACACG" "51362" "1" "0.07935" "-2.0099173" "-4.19" "-0.25243055" "68910" "TGTTCTCTGAGGAGGAAACATCTCATGTCTCCTGATGCCTGCTCTTCAGTTTCTGTCTAG" "47924" "1" "0.079364" "-2.0098014" "-4.19" "-0.19929143" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "13931" "1" "0.079406" "-2.0094609" "-4.19" "-0.19676869" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "53119" "1" "0.079423" "2.009323" "-4.19" "1.1013802" "57765" "GAGGGGGGAGGCTATTTATTGTAGAGAGTGGTGTCTGGATGTATTTCTTCTGTTTTGCAT" "41762" "1" "0.079429" "-2.0092743" "-4.19" "-0.21678583" "64050" "AGCATATGTGAAGAAGATCCAGTTTAAATTACACGAAAGCTACGGCAATCCTCTAAGAGT" "23421" "1" "0.079431" "2.0092562" "-4.19" "0.21616294" "67768" "ATTGAATCCATTCCACTGAACATGTAGCCATGAAACAAGGCACTGTGTAGATCCTGCACC" "34627" "1" "0.079461" "-2.0090129" "-4.19" "-0.19373527" "27215" "CTCTAACTAGTAGTAACCGTTATCAAAAAGGATTGCTAGAACAGTCTGATGGGTGTTAAC" "27963" "1" "0.079461" "-2.0090126" "-4.19" "-0.25653741" "" "ACTCTGAGCTTTTGTGAGGAAATAGCAAGTGCTCGTGTTTTTCCCTTAGCAAAACCATAT" "4779" "1" "0.079472" "-2.0089264" "-4.19" "-0.34831822" "" "GGGGCAGGAGATGCATGGGACTGGGGAGTGAAATTCACAAAGACTCAATAAAGGTTTTTT" "7108" "1" "0.07949" "2.008782" "-4.19" "0.17586282" "" "CAAAAAACACCAATACAGTTGCACAGTGCACATCTTTAACCACAGTATCGGGGTAGGACA" "33147" "1" "0.079516" "2.0085661" "-4.19" "0.17670752" "" "GATCCACGTGGAGCTTGAAGAGATCAGCAAATTTGGAATGAAAAACTTAATCTCCGGGCT" "10273" "1" "0.079522" "2.0085179" "-4.19" "0.19763493" "242285" "GACCTCATGGAAAAGTCATTTGATGTCAATTTCAAAGCACATTTATGGATGTATAAAGCC" "20333" "1" "0.079528" "-2.0084742" "-4.19" "-0.18005432" "" "TAAAATTGACTTCTTAATAAAAATATTAAGGTGCAGTCAGTCCAACAAATGAGGGGGTGC" "29477" "1" "0.07953" "-2.0084584" "-4.19" "-0.20633734" "20730" "AAACGCATAGAGCCTGTCCTCATTCGAAAAGGTGGGCCTTGCTGAAAGTCAAGATTTGAA" "49709" "1" "0.079581" "2.0080369" "-4.19" "0.24515222" "16949" "AACGTGGTGAGATGCAACATCCACTACACAGGTCGCTACGTTTCTACAACAAACTGCAAA" "18451" "1" "0.079587" "-2.0079888" "-4.19" "-0.1786441" "107568" "CTCAGTCACCTACCTGTCTTTGGGAAAGAAGCTACTATTTGTTTTAGAAAATGAAAATGT" "57912" "1" "0.07959" "-2.0079685" "-4.19" "-0.18945376" "" "" "2989" "1" "0.079601" "-2.007881" "-4.19" "-0.23083996" "71954" "TGCTCTGAGCAGTTTCCAGCGAACACGATTCATTTAGGTATGCCCGTCCTTGTTCAGGGT" "41122" "1" "0.079611" "-2.0077988" "-4.19" "-0.41345667" "71912" "CTGGGCGAATCCTGTGTCCCTTCTCCCTGTAGCACCAGCAAATAAAGGCCGTGTTGTGAC" "55260" "1" "0.079615" "2.007764" "-4.19" "0.29103847" "21858" "CCGTGAGCGTTCTTGTGCCGTGTTGATGCCTTTCGTAGCATTAGACTTTGCACTTTTAAA" "25437" "1" "0.07962" "-2.0077279" "-4.19" "-0.20405252" "258559" "AACAGGGATATGAAGGAGGCCCTGAAGAAAGTTATTGGTAGGACAGCTTCTCTTCTGTGA" "17728" "1" "0.079643" "2.0075389" "-4.19" "0.44036333" "71956" "GAGCTGGTCTGGAGTGTCTCCTCACAGTGACCTCTGAGGCCTCAGAATAGCCTGCCTAAT" "6961" "1" "0.079669" "-2.0073241" "-4.19" "-0.3747464" "" "TACTGACCCTAAGAGAATGAGACGCTCTGCAGAAGACAGAAGATTCCTGAAACTGGGAAA" "25197" "1" "0.079713" "-2.0069731" "-4.19" "-0.25173979" "118445" "GTAAACAGGGGGAAAGGACTGAGGTTCTTAGGAGTTAACTCCATAAGCAATCAGAGCTTT" "20413" "1" "0.079729" "-2.0068421" "-4.19" "-0.30030524" "73845" "GTTTGTGAGAAGGTACTAATCAGTGCAGTAAGGTTAAATACATCCTGATTTTCCTTCACT" "24246" "1" "0.079731" "-2.0068278" "-4.19" "-0.19079124" "" "AGCCAGCAACGACAGGCTCTGTGTAGTAGGGACCAAACTGTTTCTCATACAAGAGGTTGA" "16660" "1" "0.079759" "-2.0065993" "-4.19" "-0.17536948" "" "ATCAGGTACTAAGTCCTTGTAGTTTTCAGTGTTATCTTCATGTTCAAGTCTAACAGCTAA" "62185" "1" "0.079772" "2.0064909" "-4.19" "0.18154647" "" "ATGACATCCTCTGAGAGTTCCATGGAGTTTTCTCCTGGTATTAGCTGCCCTGTTTCAGAT" "41015" "1" "0.079784" "-2.0063926" "-4.19" "-0.3145281" "" "GTTAGCAGAGTGGTAAATTATAGGTTCCTGCAGTTCTGTGCTCAGCTCGATAATTTCTGA" "12924" "1" "0.079789" "-2.0063588" "-4.19" "-0.1601491" "" "" "2015" "1" "0.079791" "2.0063413" "-4.19" "0.18426143" "" "GTGTCCTTACAGTATGATACATTTGTCTTTGTCATTTCACTGGTTTTTATGCTTATGCAC" "44282" "1" "0.07981" "-2.006187" "-4.19" "-0.18477578" "" "CCAGGTAATTTGTACATGGTATCATGCATTAAAAGGTACTATGTTTGTGGCACTATCTGA" "33230" "1" "0.079817" "-2.0061317" "-4.19" "-0.33175662" "" "GTCCCTGCTAAGATAGAATATAGTCCCTCAAACTGTAAGCCAGAATAAACCCTTCCTTCC" "45397" "1" "0.07983" "2.0060237" "-4.19" "0.1730335" "" "GAAGAGCACGTGACCCACTTTTACTCAGAAGTGGTTTACCCAAAAGAGCTGATACATTGA" "24030" "1" "0.079872" "2.0056814" "-4.19" "0.52298481" "52668" "CCAACTTGTCTAACACAGAGAAGGATTAATTACCCCCAGGCGACAATCTCCTAACACATA" "5668" "1" "0.079885" "2.0055765" "-4.19" "0.43660845" "22040" "TCCTGGCCTCACCTGGGCAGTAAGTCAAGAGGGGAAATATGATGAATAAAGACTTCCATA" "5346" "1" "0.079898" "-2.0054706" "-4.19" "-0.39753645" "74400" "CTGTGAAAGGCTTTACCACAAAGTCAATTCCTCATCCATGTTTTTAAATAAAGAGACCTA" "1949" "1" "0.079908" "-2.0053946" "-4.19" "-0.18604365" "" "GCTGGGGTTCTCAGGGGGCATCTCCCTGGCCCTCATAGCCTCTTGCTGGCAGATCAGATG" "46195" "1" "0.079912" "2.0053596" "-4.19" "1.21150946" "216445" "GGTGATGCTTGTTCTCAGTATTCCTTTATTGTCAGGAAACTGTGTCATTATTAAAGTTTG" "48497" "1" "0.079917" "-2.0053222" "-4.19" "-0.2225154" "" "TAATCATGGTGGAAATGGGATGCACCCACCTAAGGTTCTTCATTATGCTCTTGGCCAAGT" "30515" "1" "0.079926" "-2.0052507" "-4.19" "-0.16870077" "" "" "954" "1" "0.079948" "2.0050685" "-4.19" "0.24674071" "" "GCAACCTGAACACTCGATAAACCATTAATTCTTAATAAACGACAGGCTGTGCATTATTTA" "12275" "1" "0.079973" "-2.0048689" "-4.19" "-0.17217512" "78369" "CTGGAGCGCTTCACCGGTTCAGATTTGGCTAATGTCACTTTGACCTACGTGATGCGGGCC" "13983" "1" "0.079973" "2.0048657" "-4.19" "1.58980936" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "38760" "1" "0.079987" "2.0047541" "-4.19" "0.20841155" "212974" "TAAATGAAGTCAGACTGGCGACCAGAGGGAATGGAGTCAGATGGACAGGGTTCCAGGCCA" "12302" "1" "0.079994" "2.0046966" "-4.19" "0.55243176" "23920" "CAGCCTCTCTGGGGAAGACTGGAGAAGACTCAATAAATACGGAGGTCTGTTTGTATCTGG" "35398" "1" "0.08" "2.0046524" "-4.19" "1.76846071" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "61381" "1" "0.080031" "-2.0044014" "-4.19" "-0.44558534" "320495" "ATGAATCCCACGTCTTCTGATTGTGTGGAAAATTCTCTTTGAGCAGATGCCCAGATCCCA" "37346" "1" "0.080085" "-2.0039672" "-4.19" "-0.2057594" "" "CCTGACTTAATGAAATAAGATGTTTTTGGATCTACTATTTAGACTTCTCCACCTACCTTC" "50569" "1" "0.080108" "-2.0037809" "-4.19" "-0.53662303" "13492" "CCACAATTTCTAGGGTCTTTTAGATGTGATATGCTTCAAAATGCTTCAAAACCGAAATCC" "62619" "1" "0.080121" "-2.0036766" "-4.19" "-0.19380327" "22428" "GTTGGAGAGAGGTGGGTCCTATTGTAACGACCGCTATAATTTATATGGACTATATTGTCT" "17452" "1" "0.080214" "2.0029286" "-4.19" "1.68685312" "110557" "GTAGCTATTCTGGTTGTCCTTGTAGCTTGGCCATCATTGGAGCTGTGGTGGATTTTGTGA" "20679" "1" "0.080216" "-2.002913" "-4.19" "-0.23448608" "68385" "GGACATTGTGGTTAGCAAGCAAACTCGAGCTTCTTGGGAATACCTTGTTCATCATGTCAT" "15281" "1" "0.080216" "-2.0029063" "-4.19" "-0.26157096" "636808" "AGTCACACCGCACCAATCAGATGAAGAAGGAATACCCAGAGAACTTGGACAATTCCTTTA" "13412" "1" "0.080235" "-2.0027584" "-4.19" "-0.16976827" "" "AACACTGTTGGTGAGTATTAGTGCCTTTTTGTTGTTGTGATAAAATGTCTAAGGTATTGC" "60773" "1" "0.080238" "-2.0027282" "-4.19" "-0.1749969" "74315" "GCACCCTTTCTTTGACAAGGATGTGTCATATTTAAATTTTTACATTCATCATGGCTACAG" "28211" "1" "0.080251" "2.0026299" "-4.19" "0.25282819" "224481" "TGACCTCGTGACTTTACTATCCAGCTTGGTAAGAAAAGAAATACCAAGTAGATACAGTGC" "27522" "1" "0.080252" "-2.0026196" "-4.19" "-0.25187073" "" "TTTCTCATGAAGCTCAGAGGAGGCGTGGTTTCAAGGATGAGTTGGAGAACTCAGTGAATA" "54769" "1" "0.080273" "-2.002447" "-4.19" "-0.20013586" "69089" "CAGCCATACTTTAAGAAGAAGCTGAAGTGTTTATGCACTAGCTTTTCCCATTCATGACAT" "21718" "1" "0.080339" "-2.0019209" "-4.19" "-0.21168234" "231861" "TGCTGTTTGTACGCGGTTTTGGTAATGCCAAGCTTCATTAAACATACCGAGTTCATTTTT" "2541" "1" "0.080342" "-2.0018981" "-4.19" "-0.55133557" "23956" "CTGCCTGTTTCCCCATGCCTAGTGTTTGAATGAGTATTAATAAAATATCCAACCCAGCCC" "9405" "1" "0.080342" "2.0018916" "-4.19" "1.80805973" "229898" "GTAAAGTTTAAAAATGATTTCTCACTATTCTAAGCCTGTCTCTGTTTCTGGGTCGATTTG" "37495" "1" "0.080349" "2.0018385" "-4.19" "0.58708193" "52855" "GCTCCTTTTCCTTCTGCTGGTTTGCCTTATCTGACTTTGATGTGGTGTTTTTTGTTGTAA" "26068" "1" "0.08035" "-2.0018329" "-4.19" "-0.16064008" "" "AATATTAACATGGTCACTGTGAAATGTCCCCACCACAGCTAAAGGAGAGCAGGGAGGAAA" "27672" "1" "0.080368" "2.0016886" "-4.19" "0.28774796" "" "TAACATTTACCATCATAAGATGGCGCTGGCTCCGCCTTATGCCACCTAAACAAAGAGCAA" "14743" "1" "0.080393" "2.0014848" "-4.19" "0.65740388" "" "ACGCTTCAGCTCTCCTCCGGCAGGAAGAAGATTTCTCCATTTCGAGCATTACAACTCTGA" "24322" "1" "0.080408" "-2.0013676" "-4.19" "-0.21052572" "67890" "TGTTACACTGTAAATCATGGCTACCTTTATTTTACAATAAGACATACTAGCCAGCATACC" "55580" "1" "0.080453" "2.0010042" "-4.19" "0.27153389" "15975" "CCTCACTACTACCTTGTATCTCAGTCTCCTCAACAGAGAGAGAATGCAGATTGATTTTCG" "29848" "1" "0.080472" "-2.0008516" "-4.19" "-0.18121896" "" "AACCTCGGAGAAGCCAATTATAGTGGCGGGAGCGGTAATCACTGTAATAAAGGTAATGAG" "58595" "1" "0.080485" "2.0007482" "-4.19" "0.17651374" "12902" "TGGCCTACAGATTGTTCTTGTGATATTTCAGAGAAGGTAGTGGCTGCTCTCTGCTCTTGT" "13749" "1" "0.080495" "-2.0006676" "-4.19" "-0.30295147" "216565" "GATGAACCAGAAACTTTTGTAATGATAAAGGATTCTCCACCCCAGTCTACACGAAGAAAA" "60722" "1" "0.080496" "-2.0006617" "-4.19" "-0.25828358" "74479" "ATGCCATTCTTTCCTATGCTATGTCCAACTGTGGCTGGGCCCAGGAGGAGAGGCAGAGCA" "44163" "1" "0.080511" "-2.0005397" "-4.19" "-0.20091091" "" "TAGAATACACATCTGAAGAGGCTCTCTTCTCAGATGATTCTTCTGTTGGGGTTTTATTGC" "12696" "1" "0.080514" "2.0005147" "-4.19" "0.43010296" "319293" "CTCTTTGCTACACCCCTTCTACACTGATATTTTACTCAAGTGCATAAAATCTAACTGATA" "32769" "1" "0.080519" "-2.0004705" "-4.19" "-0.21413771" "" "CGGGGCTGTATCTGTCCTGACCATGGCTGCTGACCGAGCCTGCTACAGGGAAGGTACTCA" "26960" "1" "0.080526" "2.0004203" "-4.19" "0.27862318" "258344" "AATGTTGAACCCTTTTATCTATAGCCTGAGGAACAGAGACATAAAGGGAGCTCTAAAAAA" "15086" "1" "0.080551" "-2.0002183" "-4.19" "-0.16727911" "" "CATAGGCCAGGACCACCTTGCTCCAGTCTTTCACATTATCTGTAACGACCTTGGTTTGCA" "36287" "1" "0.080567" "2.0000853" "-4.19" "0.20200648" "12488" "CCCGGTCTTAACAGAGGACTCCTTACACTCCTAACTGTGATCACAGACAAGAAATACCTT" "17177" "1" "0.080573" "-2.0000408" "-4.19" "-0.65237181" "" "CCAAGGCACAATGCCTTGTGTTCTGGGAAAACCATAAATTCACTTTTATATCCTCTTCCC" "51380" "1" "0.080593" "1.999882" "-4.19" "0.21727288" "" "TTTCATTTCCATTGACCTCTGTTTGGCCCCATTGTTTTTTCCAGGGAACCATGGCAACAG" "31020" "1" "0.080594" "1.9998695" "-4.19" "0.39775876" "320923" "AACTCCCAAGGCCAAGACTCAAAATTGTCTCCTTTTAGACTTGAACCTGGCAAAATAAAT" "49486" "1" "0.080621" "1.9996535" "-4.19" "0.19642368" "" "ATTCTCAGCTCTGACTGCACAATTATGGTCTAGAGTGCGTCTAATGAACCCATCTCAGCA" "2021" "1" "0.080636" "1.9995325" "-4.19" "0.18898248" "258056" "AAACTCATTTCCCTCTTGAGAACTTTGAGCTTGGAGATGAACTCTAAAAGCAATGGGTAA" "19630" "1" "0.080644" "1.9994702" "-4.19" "0.69105425" "17345" "ATACTACTGCTACTGCCTGAGTTTAAGGAAGGAAGCTTTGAGCTTTCCTGGTCATACTCT" "34653" "1" "0.080653" "-1.9993967" "-4.19" "-0.19578511" "170930" "TTTCTACCTTCCATTATTCCTTGGGAGGGAGAAGGTTGAGGCAGTGTCTACTATGTAACC" "30966" "1" "0.080657" "-1.9993712" "-4.19" "-0.26092675" "435518" "CACAAACACCCAGACAATCTCAAGGTGGCCTGTGAGAAAACAGTGTCTGCTGTGCAGCAC" "43577" "1" "0.08071" "-1.9989399" "-4.19" "-0.53208578" "14455" "GCGCAATGTAAGCAATTTTGTGTGTGCATGTGGTCCCATTACAAGGAATACCCAATGGCA" "21734" "1" "0.080732" "1.998766" "-4.19" "0.27497271" "24013" "AGATTACGAGGTATGGTCTTGGAGTGAGTGTGACCTTTTTGGAGTGGATGTGTCCTTGTT" "43100" "1" "0.080756" "-1.9985779" "-4.19" "-0.16768352" "13684" "CACCATAATTACATTCCTAACTAGAATTAGTATGTCTGCCTTTGTATCTCTATGCTGTAC" "49517" "1" "0.080769" "1.9984714" "-4.19" "0.61142465" "71520" "TGCTGCTACCCAGAGTCAGAGCATCTGCAGATTGGGGAAACTGAGTCAGACTTGGCAAGG" "50535" "1" "0.080776" "1.998413" "-4.19" "1.69781071" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "34237" "1" "0.080781" "-1.998379" "-4.19" "-0.30640027" "435815" "ATGAGGCTGCCTTTCTGGAAATCAGACATAATTCTGGTTTAGAGGTTTCACCTATCCTAG" "50619" "1" "0.080819" "-1.9980713" "-4.19" "-0.2278748" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "18259" "1" "0.080841" "1.9978985" "-4.19" "0.57668755" "110749" "ATGCCCAAAACCTGGCCCCTGATGACTCTTCCAAGACTGTCTGAGCCTGCTATGCACCTG" "41852" "1" "0.080874" "-1.9976341" "-4.19" "-0.21189612" "" "CATTCTGTGAGTGAACAATTTGCTGGAAGAGATGGCCTACAGTGGAAGGAACATCAAATG" "38139" "1" "0.080896" "-1.9974582" "-4.19" "-0.16216459" "78581" "TGTGTATACCAGAGGACTAACTTATTTTTGTAAACTACTACTGCTACATACACTTTTGCC" "26618" "1" "0.0809" "-1.997426" "-4.19" "-0.23913181" "240068" "CAGCCCCTTGATAGCATTTTCTGATCAGTGATTTTTGTTTCCCAACCACTTAAAATAAAA" "53395" "1" "0.080905" "1.9973823" "-4.19" "1.65759825" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "22845" "1" "0.080914" "1.9973142" "-4.19" "0.42773629" "226422" "TGTTTGGCTCCTTTTCTATCCAGGTCTCTGAGTCATTCCAATTCTTCCTGTTGGATGCCA" "54004" "1" "0.080951" "1.9970186" "-4.19" "0.26094753" "11820" "CAGGATGATTGTACAGAATCATTGCTTATGCCATGATAGCTTTCTACACTGTATTACATA" "16324" "1" "0.080957" "1.9969707" "-4.19" "0.19739501" "12235" "AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA" "5112" "1" "0.08099" "-1.9967099" "-4.19" "-0.20400409" "109222" "ACATAGCAGATGGATCAACAATTGCTTTGGGAAAAGGTTTCGTCTTTTTTGTTTTGAGTT" "17082" "1" "0.08101" "1.9965504" "-4.19" "1.7169574" "15040" "ATCATCCTTGGAGCTGTGGTGGCTTTTGTGATGAAGAGGAGGAGACACATAGGTGTAAAA" "3604" "1" "0.081035" "1.9963444" "-4.19" "0.23109738" "70314" "CCCCAAGATATAAGGAAGCAAGGCCAGACTTTTCTGTCATTTATTTTCAATAAATAAGCA" "50164" "1" "0.081065" "1.9961099" "-4.19" "0.18533276" "18505" "AAATATTAGTCTCGATCCTTTGATACCGTGGTATTAAATATGACATTGTCAGCCTGTAGC" "25068" "1" "0.081076" "-1.9960235" "-4.19" "-0.16280896" "18807" "TGGGCCCAGACCTTTGGCCCACCCCCAAAGGGCCAAGATTATAAGTAAATAATTGTCTGT" "48442" "1" "0.081093" "1.9958817" "-4.19" "0.94087803" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "23641" "1" "0.081111" "1.9957419" "-4.19" "0.50335072" "" "GCTTCTCCGATGGAAAAACCCACTGTGCCTCCAAGTGCATTTCCTTCGGGACAAACTTCT" "11350" "1" "0.081116" "1.9956998" "-4.19" "2.20800309" "14969" "GGCACTTCTGAGCCAGTCTGCTGTCATATGCTTTTTTACATTTTTCTCAAATAAACAAAT" "38794" "1" "0.081122" "-1.9956549" "-4.19" "-0.24970994" "68691" "TTTTGTTATGCAAAGAAAGGTTACTCAATTTGTAGTTCCCATACTACTGAAAATCCTGGC" "32906" "1" "0.081157" "1.9953755" "-4.19" "0.34511915" "" "ACAAAGAGTTGCAGCAGGGTGGTGAAGTTTGATCCTCTGAGCGTTCCGTAGCTCGGTCGG" "43659" "1" "0.081162" "-1.9953333" "-4.19" "-0.2431295" "16563" "ACGACCACTCAATAAAAAAGAAACTCAAATGAAAGATCTTGATGTGATCACAATCCCTAG" "10368" "1" "0.08117" "1.9952752" "-4.19" "0.20609755" "677289" "ACCTGGGATGTAATGGGTATTACAGTTGTAGATGGAGCCATGCAATAAATGTATGTATAC" "27756" "1" "0.081182" "1.9951795" "-4.19" "0.28605453" "" "ATGGGGGCTCTACTTCTACAGACTCAGAAGCAGATGTTGAAAACCCCAAAGAACTCACAT" "3723" "1" "0.081188" "1.9951323" "-4.19" "1.54575587" "246730" "TGATGTGTGGGTATGGTACCCATGTTTTATTAAAAAGGATGGTTCCCGAGTGAGCTCCTG" "42888" "1" "0.081234" "-1.9947619" "-4.19" "-0.25468289" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "15228" "1" "0.081291" "-1.9943091" "-4.19" "-0.17243442" "" "TTCCTTCTCTCTGGCGAAGCAGTGGCTGTTGAGGATCCGCTGCAGGGAGGATTTCACCAT" "12840" "1" "0.081337" "-1.9939444" "-4.19" "-0.271419" "" "TAGAGAGAGTGAAACCTTGTTCTTGCTGAGTCTTCGAGAAAGAGGACCAAGTCCCAAAGT" "33519" "1" "0.081342" "1.9939056" "-4.19" "0.83776727" "77011" "CAGGAATTCTTGGGGGACATATTTAAGATGTAAGCCATAATGAGATTACTCCTGTTTATT" "62751" "1" "0.081356" "1.9937975" "-4.19" "0.84899784" "" "AATGGAGAGTGAGCTGGCTATAGTAAAGAGACAATCTACAAGGTCTGCTTGTTGCTCACG" "51903" "1" "0.08143" "-1.9932087" "-4.19" "-0.20131203" "11431" "TGAATGTATGTCAGAAAGGAACATGAATTCAACTGGGAAGTTATCAAATACAACTGAGAT" "33530" "1" "0.081442" "-1.9931104" "-4.19" "-0.23767272" "217517" "GAGACAAGTTAACAGCTGTTCTTTTGGTTCACTATTAGAGCAACTCAGATTTTGTCATTA" "29413" "1" "0.081443" "1.993101" "-4.19" "0.61181906" "17082" "GCCATTGACTCCTTGTGTGTTTTCTTCATGTGTGTTTGAAGAGTTCTAGCTTATTAAAAA" "3678" "1" "0.081445" "1.9930835" "-4.19" "0.26960121" "" "GGTTCACTGGGTAGCCAGAGATTTTAAACTCTATTTCTCAATATAGCTGGCTATCCATAT" "7012" "1" "0.081468" "-1.9929068" "-4.19" "-0.2341913" "67429" "AACCAATGATCCTATTTTAGGCTTTCAGGCAACAAATGAGAGATTATTTGTTCTCACTAC" "56128" "1" "0.081501" "1.9926467" "-4.19" "0.23160716" "100715" "AGATCTGAACAGTGTGCTGCCTTTGAGAGCTGCTACCCTGAAAAGATAACTGGTCTCTAA" "37614" "1" "0.081507" "-1.9925957" "-4.19" "-0.24050641" "217698" "GGAGAAGCCCCAGATTGTCTGCTACCCCAAAACAGGACACCACATTGAACCCCCTTACAT" "3591" "1" "0.081535" "-1.9923725" "-4.19" "-0.3532337" "15558" "AGAAACCGGGCTGCCATGTTGTTGATGGGTAGCATGGGAGTAAGTTGGTGACATATTGTT" "30653" "1" "0.081539" "-1.9923406" "-4.19" "-0.25456444" "" "GAACCTTACACCGTGTCTTAATTGTCTTAAGAGTGATCGTGTATGTTTAAAAATGTTGCT" "49081" "1" "0.081569" "1.992102" "-4.19" "0.62196052" "78317" "CTGATATCTGAGCATTGTCTGGGACACGAGGGAAAGAAGAATAAAGCTGAAACCCCTTGA" "32601" "1" "0.081577" "-1.9920383" "-4.19" "-0.24402322" "73336" "GCAGTTTTGGAGAGGATAGATGTTAGATGTTGACTGAATAAACATGTCTCATGTGTTCTG" "21776" "1" "0.081636" "1.9915703" "-4.19" "1.756349" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "17710" "1" "0.081638" "-1.9915544" "-4.19" "-0.17191267" "56494" "ACCTGGTGCAATGCAGAATTTGTGTGAGGGTTAATGTATCTTGAGCACACATTGTATTAA" "49585" "1" "0.081658" "-1.9913968" "-4.19" "-0.30481862" "11911" "TCTTCACGAAATCCAGCAGCAGTGTTGCTGTAACGGACAAAGATACCTTCGAGTTAAGCA" "37929" "1" "0.081665" "-1.9913453" "-4.19" "-0.24758642" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "43224" "1" "0.081673" "-1.9912812" "-4.19" "-0.21401238" "" "TCTCCAGGTAAAACCCATACATGGTCATCCCTGTGATGTTTGGTGTGTATTTAGAAAAAA" "56794" "1" "0.081687" "1.9911678" "-4.19" "1.16677835" "54167" "CTTCTCCATTGTAAAGGGATTCTGCTCCTGAACAGCCAATAAATATGCTTTGTGAGAGAA" "37473" "1" "0.081687" "1.9911671" "-4.19" "0.66563762" "" "TCATATTTCACTCTGAAAATCCAACCCACAGCACTGGAGGACTCAGCTGTGTACTTCTGT" "13200" "1" "0.081694" "-1.9911155" "-4.19" "-0.22457205" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "1404" "1" "0.081694" "-1.9911118" "-4.19" "-0.49951382" "" "AAGCATATCATGAGTTGCATTCAGACTGAAGCACAGACCTATTGGGTATGACCCACTGAG" "31455" "1" "0.081698" "-1.9910816" "-4.19" "-0.27993757" "81012" "CTCCATCTTGATTGGTAAAATAAAGGCTTGAGCTTGTAATGGGCAGAGGAAGGGAATGTG" "38498" "1" "0.081739" "1.99076" "-4.19" "0.4130704" "" "CCCAGTCTATGGTACAGAAGAAACTGACTGCCTAGATATTTTCAATTCATACTTAGATAT" "27865" "1" "0.081747" "-1.9906931" "-4.19" "-0.23615558" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "27179" "1" "0.08175" "1.9906719" "-4.19" "0.28076376" "" "CTGATTAAGTACTGTGCTGCTAATAAATACAGTGCACATGAGAACAGCAAAACTGTATAT" "60620" "1" "0.081786" "1.9903853" "-4.19" "0.49844104" "98752" "CTGTTCGAGTGTAAATAAATGCATACAGGGTTATACCCAGAATTTCCCTATAACTATGTT" "11443" "1" "0.081799" "1.990282" "-4.2" "2.09803335" "110454" "TATGAGTTATAGAAGCTCCAAGGTGGGAGTAGTGTGTGAAATACCATGTTTTGCCTTTAT" "26233" "1" "0.081812" "-1.9901816" "-4.2" "-0.28003677" "" "TTTAATCCAAGCTAAGCATTTCAGAGTTACAGAATTCCTCACTAAATTCATTCGTAAGCC" "55033" "1" "0.081831" "1.9900333" "-4.2" "0.52886517" "654818" "GTGTGGAACATTGTAAACAAAACAAGGCATAAAATGCAGTGATCCCTGCATAAAATATGT" "43655" "1" "0.081838" "-1.9899738" "-4.2" "-0.22830908" "330301" "GGGGGTCTAGTTAATATCAGCTCTACTCTTTTGTTCTTTCCAGATTATAATTCGGTTAAA" "15757" "1" "0.081844" "-1.9899295" "-4.2" "-0.20811108" "73360" "ATCTAGGTATTCATGATTTAGGAATCTCAAAAATGGTCTGCAACAGCATCATGAACTGTG" "40949" "1" "0.081879" "1.9896542" "-4.2" "1.65790477" "630499" "TCACACATCTCCTGTGACATCCAGAGACCTCAGTTCTCTTTAGTCAAGTGTCTGATGTTC" "33623" "1" "0.081884" "1.9896168" "-4.2" "0.51904667" "" "TTGGAGAAAGACCTCAGTTTCCAGGGTGAAGCTTGGAGAAACTTCACAGTTTACCATCCA" "23790" "1" "0.081906" "-1.9894384" "-4.2" "-0.19014956" "228839" "GAAGCAGCAAGAGCCAGCGCCACCTTTGCTACACACTCCGCTGCCTTTCGTCTCAGAAAA" "51345" "1" "0.081928" "-1.9892645" "-4.2" "-0.20271217" "" "CATGATTTAGGATTTACAAAACTAGCTTATAAGAAGGCCAGGAAGAGCTGGTTTCCCAAA" "22239" "1" "0.081941" "1.9891628" "-4.2" "0.17610506" "" "CAAAAATGGTCCCCCAAGAAACTGGAATTTCCCCAGGAATCTCATGCTGGGAGAAAGAAA" "35623" "1" "0.081952" "1.9890756" "-4.2" "0.27445348" "667666" "CCAGGAAAGAAATCTTACATATATAGTGAAAGTGACAAATGCTTTACCCAACCTTCCCAT" "40648" "1" "0.081956" "-1.9890466" "-4.2" "-0.19987403" "" "GACCTTCCTGGAGTCAACATTGAGAACTGAGAAGGTATTAAACTTAAAAATGACTGAATT" "33084" "1" "0.081978" "-1.9888726" "-4.2" "-0.23265483" "22589" "ATTTTAAAGGGCCTGAATTTAGAAGCAGAAGTAAAATGAAAGCTGACAATCTCATAAAAC" "9679" "1" "0.081983" "-1.9888319" "-4.2" "-0.31574701" "268902" "CAAATCTGTTTGACCCATTTTGAATGAGTAAATCGGAAAGAACAGTCAAAAGGGAGAAAA" "17592" "1" "0.082022" "1.9885234" "-4.2" "1.68816258" "14972" "GCTGCAATAGTCACTGGAGCTGTGGTGGCTTTTGTGATGAAGATGAGAAGGAGAAACACA" "61287" "1" "0.082027" "1.9884853" "-4.2" "0.39311463" "" "AAGAAGAAGAAACTTTATAGAGACAAGCTGTCCTGCATGCTAAAATACCATCCTCATTAG" "28466" "1" "0.082049" "-1.9883123" "-4.2" "-0.24117496" "332110" "TGGTCATGATCCTGAGCATGTGGAAGTTCGCAGGCAGAGCTCAGACCCCCTGTTCCAACT" "56923" "1" "0.082089" "-1.9879995" "-4.2" "-0.16312108" "" "TATCCAAAAAGCCACCGAGTATTTGAGAGCTGCCACTTTACAGAGCACCATGGGTCATTT" "4202" "1" "0.082118" "-1.9877726" "-4.2" "-0.1810906" "71146" "ATTGCGTGAGTATACATGTCTATGTGTAAGTATGCATGTGTTTGTGTGTGTGTGTGGGGA" "52467" "1" "0.082121" "-1.9877467" "-4.2" "-0.30943158" "" "GTGCCTAGGTATGAGCCTTCATCAAGTGGTATGAAGGCCCTACCCCAACAGAAAGTGCTG" "27032" "1" "0.082141" "1.9875858" "-4.2" "1.47840905" "12775" "CAGCCACTGATACCTTTCCTCATGTTCTGCTTTTGATTCATATATCTTTTATGAAGAAAC" "20483" "1" "0.08219" "-1.9872015" "-4.2" "-0.21774833" "" "" "27009" "1" "0.082243" "-1.9867896" "-4.2" "-0.1663772" "21869" "AGTTGGACTAAATGCCTAGTTTTTAGTAACCTGTACATTATGTTGTAAAAAGAACCCCAG" "45304" "1" "0.082246" "1.9867635" "-4.2" "0.25888854" "192232" "CCAGTTCCAGGTTTATGAAGCAGATTCCCAAAGGCTCAAAAATAAAATGACCAAAGTGAG" "13143" "1" "0.082254" "1.9867024" "-4.2" "0.92364273" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "6342" "1" "0.082336" "-1.986059" "-4.2" "-0.14760389" "66801" "GGAGTTTCAGCAGTCGTGAGCCCAGCTCATTCTGTGACCAGCCTCAGAAGAGAAATGGCT" "53349" "1" "0.082345" "1.9859864" "-4.2" "2.07480293" "634650" "CTGGAAACTACTTAAACATCCCTGAGTTAGATTGGCAACAAATTTTTATATGGCTTGATC" "61632" "1" "0.082346" "-1.9859766" "-4.2" "-0.21100727" "" "GATAAGAAACATCACTGAAGAGAGCGCCTCGTGATGTCTCTTTCATAAAAATAAGATTCT" "16514" "1" "0.082372" "1.985773" "-4.2" "0.28833459" "" "AGGACCAATCAGAGTCTACCAATACAGAAAGCAGAAAGGCTAGCACTCTGTGACAATTGG" "25085" "1" "0.082403" "-1.9855278" "-4.2" "-0.17956986" "" "AACTTAAACCAGTTGTCAAACATCTCCCAGCTTTGGTGAAGGAATCCCAGCCTGGATTTT" "3761" "1" "0.082405" "-1.9855177" "-4.2" "-0.22827412" "259105" "CGCGTCAATGTTTGGTATGGCTTGTCTGTCCTCCTCTCTACTGTAGTGCTCGATGCTCTG" "61223" "1" "0.082426" "1.9853522" "-4.2" "0.19308762" "619517" "CTGTACTCTGATGAAAAGTGAGTGGAAATGGTTTATGTTTCAAACAATGAAGCTTTGTAG" "39991" "1" "0.082429" "-1.9853264" "-4.2" "-0.14993186" "" "TCAATACTTCGCCTAGAACTTTAGGGCGCGCGCTGCCGGGCAATTAGCTGAAGAGCTGGA" "41777" "1" "0.082446" "-1.9851932" "-4.2" "-0.23411894" "12069" "GTTTGTGATGTACTGTTGTAATATTTCTGGTGTCACTTGTTTCCCCATGGGGCTCCAACT" "57931" "1" "0.082457" "-1.9851084" "-4.2" "-0.16008345" "433931" "TGCATCGTGGATTTGAGTATTGAACTGCTTACATACAAGATTTTTCTGAGGTGGAAAAAA" "11940" "1" "0.082466" "1.9850382" "-4.2" "0.19558363" "" "CAAGGCCTTTCAATTGTAACACTTCTCAATTCTGATTGTAAATATTGTCTCATTCTGCTC" "39960" "1" "0.082478" "-1.9849428" "-4.2" "-0.19905704" "28000" "GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT" "9131" "1" "0.08248" "-1.9849255" "-4.2" "-0.24053141" "18386" "GCAGGTTTGACAGAAAGGACCTTTATCCACCAACCCCAATTAAAAGAAATTATTTATTTG" "36025" "1" "0.082494" "-1.9848147" "-4.2" "-0.22129915" "238871" "GCGGAAGAGGAAAGCCAGCCTGAAACTTGCGTCCCAGATGACTGCTGTCCTGATACGTAA" "61108" "1" "0.082497" "1.9847913" "-4.2" "0.80058762" "71088" "AAGAACTTATACACTGGGAAGAGATCTGGGGCAAAGAAGACAAAGGAGTTGCAGTTGGTA" "41353" "1" "0.0825" "1.9847696" "-4.2" "1.6689301" "100044874" "TTTGTGATGAAGATGAGAAGGAACACAGGTGGAAAAGGAGTGAACTATGCTCTGGCTCCA" "61769" "1" "0.082506" "-1.984721" "-4.2" "-0.18173093" "545861" "TTTAAAAGACACTGAGAAAATACACTCATTGCTGGCATGGTATTGACCAGCAGCCCTCTC" "60013" "1" "0.082515" "1.9846534" "-4.2" "0.90592032" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "54463" "1" "0.082519" "-1.9846248" "-4.2" "-0.33539493" "" "TCTTCCTGGCCTCACAACGGAAAGGACTGTTTTCTTAAAGCTGTTGACTTCAGTCACAGA" "41922" "1" "0.082521" "-1.9846067" "-4.2" "-0.22907265" "117600" "AACTGGAGAGTTTGGCTTTTCTATGTTGTGTCGAATGTAATGATGTCTGGGACTAGCTAA" "62738" "1" "0.082523" "1.9845929" "-4.2" "0.24838657" "" "TTCCCTGCAGGACACATCAGGTGGCAGGTAAGTCATTAAATGACTACTTGACATTCCTCT" "781" "1" "0.082526" "-1.9845684" "-4.2" "-0.16393267" "19179" "GCTGGCTTGATGGCCTTACGGGGACGCAGAATGAAAGTAACAAATGAAGACTACAAAAAA" "17369" "1" "0.082564" "-1.9842693" "-4.2" "-0.25297635" "" "CTCTCCAGAGCTCTGAGAGCTAAATAAACAAACAAACAAACACACATGAATTGTTACAAA" "14582" "1" "0.082566" "-1.9842505" "-4.2" "-0.16210658" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "10613" "1" "0.082577" "1.9841652" "-4.2" "1.50888531" "69368" "ACCCCTCCTCCCATTGTTAGCTGCTTTGAAGACAGAATGACTCCTGTGGATTTATCCTAA" "34373" "1" "0.082626" "-1.983784" "-4.2" "-0.20213874" "68550" "GAACTGGAAGCTTTCAGGTTGCTTCGAGGAAGGAAGTCCGTCAATATTGTAGAACACAGA" "50041" "1" "0.082642" "-1.9836558" "-4.2" "-0.30266507" "382089" "GAGGGGCTGGCCTGTGAAAATCAATCTAATTAGTTACTTCTGTTGACAATTTGAATTTTG" "8276" "1" "0.082681" "1.9833567" "-4.2" "0.30195464" "" "TTGGTTGGATAGGGGGTGAAATGTCTCGCATATTCTTTTAGAGTCATGGTTTCCAGGCAG" "24226" "1" "0.082705" "1.9831664" "-4.2" "0.21080253" "" "TAGTAACACATCAACACAACTCACTAAGAAGGGTAGCTGCAGGTGATTACTCCAGAAGAG" "36092" "1" "0.082711" "-1.9831184" "-4.2" "-0.17179244" "83962" "GCATGCCTTGTGCTTTACTGAACAACTGTAACTGAATGTAGTCATGGAAGGAACAAGATA" "21160" "1" "0.082711" "1.9831178" "-4.2" "0.41045091" "18726" "TGAGGCTTGGCAAAGCCATAGACAGACCCACCCTGCAGCTGGAAACTAATCTAAAGAGAA" "57003" "1" "0.082746" "1.9828428" "-4.2" "0.3826223" "545047" "AGGGAATCTTGGCCAATTATTGTAACAAGAATTTGAATGACAGGATCAACTTTGAGACAT" "41622" "1" "0.082748" "1.9828293" "-4.2" "1.77179866" "14972" "TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG" "10084" "1" "0.082789" "-1.9825121" "-4.2" "-0.21163272" "66403" "GGTTCAGATCTGCTCTTTCTTTCAGTTTACAGAAATGCCGAACTTACAAGGGTAATTTAG" "58497" "1" "0.082846" "-1.9820679" "-4.2" "-0.25452379" "381903" "GCTGGTACTGACCATTGTTAGGATATAGTGCATAATTAGATTCTGTACCTAAGGAAATAT" "56491" "1" "0.082853" "-1.982011" "-4.2" "-0.19276706" "26877" "GTATTTTGAGATCTTTTAGTTTAAGAGGTGCTACATAATGCCATGTATCATGCATGATGC" "47833" "1" "0.082858" "-1.981974" "-4.2" "-0.18574141" "" "GGATTTCAAGATGATTGTGCTGTAGAAGTGCTTTAAAACATTGCCAATATTCATGGGATT" "49900" "1" "0.082858" "-1.9819716" "-4.2" "-0.1738102" "381406" "GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC" "1838" "1" "0.082889" "1.9817256" "-4.2" "0.21426793" "27386" "GTCACATACATGGTTGTCTTTATGTAACTTAATTTTTTCATCCGCAGGTGCCATTTTCAT" "38650" "1" "0.082896" "1.981672" "-4.2" "0.18743937" "21959" "GAACATGTCACTGCAGCAATTTCTATGCAACATGGATTAAAGCTTGTACCCTGGAAGACT" "11472" "1" "0.08291" "-1.9815637" "-4.2" "-0.17880595" "100042869" "GGGGCTGATTTAAATAACTAATAAGCTCAGAGAAATTTTACGAGGGGAACTTTTCCTTTT" "32114" "1" "0.082939" "-1.9813396" "-4.2" "-0.24322822" "" "ACAGGAACAAATATGGGTCAGAGATGTGACTATGGGATGGGAATCCCATCACTCACTTGA" "1223" "1" "0.082948" "-1.9812694" "-4.2" "-0.19824529" "258347" "CTGAGGAACAAGGACATCATGGCCGCTCTGAGAAAACTCCTTAGTAAGATACTAGTGTGA" "11755" "1" "0.082953" "1.9812292" "-4.2" "1.00888553" "14204" "CTCTTCAGGGCAGACAGACCACCTACACTAATAGCCCACAATAAAGTTATTTTTGTTAAA" "39336" "1" "0.083" "-1.9808665" "-4.2" "-0.23466546" "258933" "CCAGAGCAGGCTCTTCTGTCACCACAGACCGCATCCTTAGTCTCTTCTACACAGTGGTCA" "34151" "1" "0.083048" "1.9804898" "-4.2" "1.22755165" "12511" "AGCCAGGCTACAGTGGCCTGTCCTGAGTTCCAGAGATTAAACGATTACTGAGTGAAAACT" "10879" "1" "0.08305" "1.9804762" "-4.2" "0.29560136" "12526" "AGTAGGAAGTTTCTAAGCTTCACTTCTTCTCTCTCGTGGCTTATATATTTCTTCTCTCAC" "39173" "1" "0.083109" "-1.9800171" "-4.2" "-0.18965544" "" "CTAATAATGCAGGAACAGTATAGAGATATGAGATATGCTGAACCTGAGTATTCCTAAGTG" "45894" "1" "0.083143" "-1.9797508" "-4.2" "-0.22961386" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "46280" "1" "0.083178" "1.9794776" "-4.2" "0.23421381" "" "TGAGTTTTGTCAGTGCAGCATGGCCCACTTGATACTTACCAACAGTAAAACTGAATGAGC" "13643" "1" "0.083221" "-1.9791435" "-4.2" "-0.25966123" "68236" "GCGCCAACTGTCACCCAATGTTCGTCCTTAAGAGTTTTGTTCCCCAAAAACTTGTTTGTG" "39359" "1" "0.0833" "1.9785292" "-4.2" "0.40967573" "54135" "GTCGGGAAAGTTTAGTCGTCTGATCCCACGTTTTGTTATGTAGCTTTTATACTTTTTTAA" "46170" "1" "0.083317" "-1.9783989" "-4.2" "-0.23431777" "70382" "CTCCAGAGAACTAAATAATTCTACCAATGGCATCGTCATAGAGCCGAGCGAAAAGGCCAA" "27262" "1" "0.083345" "1.9781836" "-4.2" "0.31012915" "" "TTCGTCACACAAATAGCCAAAGAGGGAGTGATAAGGCAAGTGCTAGCTTCACAGTTCTGT" "34239" "1" "0.083351" "-1.9781351" "-4.2" "-0.31384648" "269060" "ATGAATATATCTGTATATAAAGTTTTCTGTATATTGTATAGAGCTGTGTATAAACTGAAT" "46855" "1" "0.083388" "-1.9778496" "-4.2" "-0.17604809" "" "CGGTCAGAAAATTATATACTTCTTTAAGTTAGCAGAACTGGTGGAGCTGTTCCCAAGGAG" "25693" "1" "0.083388" "1.9778469" "-4.2" "1.41988135" "381308" "GTCACCTCTAAATGACAGCTTTAGTAGTATATCCAACCATTGATTAATCTTCATACCTGA" "53907" "1" "0.083407" "-1.9777016" "-4.2" "-0.26776168" "" "CACAGCAGAGAAGATATGAGAGTTTTTGTGCTAAGGCTCATATTGTTACACATGTAAATA" "49718" "1" "0.083429" "-1.9775275" "-4.2" "-0.18826502" "71835" "GTGTTCACAAAAAGTGTTTGGGGTTCTTTGGTTTTGTTAATAAAAGACAGTTTTGTGGTG" "5383" "1" "0.08347" "1.977211" "-4.2" "0.2345356" "207213" "TTACATCTTTCTTCCAAGAGCAACAAACAACAACGTCTAGTGTTGTGACCAATGACTTCT" "46561" "1" "0.083483" "1.9771088" "-4.2" "0.29420726" "110948" "GCTGTTGCAAAGGTTCATTTCTCAGACTTTGTAATATAAGGCTGTTCATCTCTCAGAACC" "53197" "1" "0.083497" "1.9770038" "-4.2" "1.04881392" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "59618" "1" "0.083517" "-1.9768509" "-4.2" "-0.37319802" "19419" "CTGACCACTTGTGAAATTGTCTAAAGATGTATACTGTAAAAGCTTCGAAAGAACTGTACA" "38234" "1" "0.083526" "-1.9767794" "-4.2" "-0.20106074" "20638" "GAACTCCAAACAAGCAGAAAGGGAAGAGAAGCGAGTCCTTGGTCTGGTGTTGCTTCGAGG" "15780" "1" "0.083532" "1.9767354" "-4.2" "1.28438215" "15024" "TGGTACCAAAAGCCTTGGATTTGGATTGTTGCCACGGTTTTTTCCATTTTGCTCATTTGT" "45849" "1" "0.083567" "1.9764605" "-4.2" "0.22922755" "71803" "ACTAAACTTTCTGAACCAGAGATGTTCGGAAGCCCCAACCTCTTATGTACTATGGCAGGA" "43692" "1" "0.083575" "-1.9764005" "-4.2" "-0.20054459" "" "AGCATTTATCCAGTATTATATTGGCTTACAAATCCTAACATTATACGTAATAGAAACATA" "44560" "1" "0.083594" "-1.9762497" "-4.2" "-0.38768494" "" "TGTCTTTGGGGCTTCTGTGGTTCTGTGCATTGTCTCAGACCTCAGGATAACAAAACAGTT" "22541" "1" "0.08362" "1.9760492" "-4.2" "0.30312925" "" "AAGGAGCGCCACAGGTTAGTGCATATTGAGTCTGAGCTCCAGATTGCCACCAGGTTCACC" "61262" "1" "0.083674" "-1.9756379" "-4.2" "-0.23660382" "16467" "TGGTGGTTTGTAAGTTGTCTTTATCCAGCATCAGAAGATGAGAACCAAGATGGTGCCTGG" "25812" "1" "0.083701" "1.9754288" "-4.2" "0.17509801" "" "" "45612" "1" "0.08372" "-1.9752789" "-4.2" "-0.17086278" "67863" "CATAGGGGGAGGTAGCTGCACAAAGAAGCTTATATCTCTGGAAAACAAACTGGAGTTTTA" "22099" "1" "0.083741" "-1.9751197" "-4.2" "-0.16666658" "70357" "TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA" "54934" "1" "0.083753" "1.9750222" "-4.2" "0.20956306" "14284" "GATTGCTGAGCTGCAGAAGGAGAAGGAGAAGCTAGAGTTCATGAAGGTGGCTCACGGCCC" "49381" "1" "0.083754" "-1.9750136" "-4.2" "-0.21764363" "" "ATGTGTAAAGCCAGTTCTAACTCCTGTTTTGTGACTATGGCCAAGTCACAAGCCCCAACT" "52842" "1" "0.083769" "-1.9748972" "-4.2" "-0.2162958" "" "ATGATGACCCACATTTACAGACTAGAGTTTCTGATGTCCACGTGACGCCACTCCTTGTAA" "22770" "1" "0.083799" "-1.9746726" "-4.2" "-0.17984536" "20482" "TGCCAATGCATATAGTTTTATGATTAAAATTGCTGTGGTTGGTTGCATTACATGACACAC" "23261" "1" "0.083801" "-1.9746529" "-4.2" "-0.18807114" "" "AGCATATGGCCTCAAGGTCTGGTGTTACAGAATGGGAAACCACCCTGGTAATTAAGGTAA" "41345" "1" "0.083818" "1.9745251" "-4.2" "1.63070835" "14999" "TCCTTGTCACGAGGGCACCGTGTCTTAGGTGATCACTAAGAAATAAACTGGTGGACTTTT" "62820" "1" "0.083818" "-1.9745214" "-4.2" "-0.38935683" "66234" "AAATGTGATTTTTGTCCGATCCTTCTGGTTTTCATGAAGATTAGCTGCCATGTTTTATTC" "46804" "1" "0.083824" "-1.9744746" "-4.2" "-0.19971771" "" "GCCTCTTGAGCATATCCTTCTTGCATGCACCACCACAATTGACTTAAAATATTTTAAAAA" "5162" "1" "0.083853" "1.9742546" "-4.2" "0.26546758" "100033459" "TGGTTTCTGCCAGTCTTTATGTATGCATCTTTTGTTTTGTGTCAGATTACTTCAATGTAC" "5385" "1" "0.083857" "-1.9742183" "-4.2" "-0.22952477" "66932" "CAGTGCCTGCATGCACCTTGTCATCTGGAAGATCCGAGAAGATGCCAAGACCAAGCGATG" "9388" "1" "0.083879" "1.9740481" "-4.2" "0.94720546" "69146" "TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA" "47291" "1" "0.083906" "-1.9738466" "-4.2" "-0.18636199" "76041" "CAAGCGAACCCTTATCACATGTCCTCCAAGAAATGTCTTAATATTTGTGTTGACATTTTT" "41935" "1" "0.083907" "-1.9738375" "-4.2" "-0.16144797" "277854" "AAGCTCCACTCAGCCAGCTGAGAACAGCAGTGTTGCCATGACTCCCACCTATGTGGACAG" "57280" "1" "0.083963" "1.9734014" "-4.2" "0.21724719" "" "TGTAGACTGTTGCTGCAGAACTTGGGTGTGGTTCCTGTTCCTATTGCTTGGGCATTTTGA" "31635" "1" "0.083967" "-1.9733741" "-4.2" "-0.23583845" "18667" "GAGATGAGATCAAGCTATATCCGCGAATTGATCAAGGCAATTGGTTTAAGACAGAAAGGG" "31221" "1" "0.083967" "-1.9733703" "-4.2" "-0.34087386" "319352" "CTTCTTGTGGTGATAATCTTGTGGGATGTAAGTTTCAAAATTTTCAAATAAAGCCTTTGC" "36653" "1" "0.083979" "1.9732823" "-4.2" "0.23995995" "" "" "22003" "1" "0.08399" "1.9731941" "-4.2" "0.46638864" "16773" "CCTGACCACCAACATTAGGTTCCGAGGCTGCATCCGATCTCTGAAGCTCACCAAAGGCAC" "39085" "1" "0.083992" "1.9731845" "-4.2" "0.24793915" "73254" "GACATTGATAATTCAAGGGTGGAACTGAAGAGTTTAGAAAAACTGATAACCCAGATACCA" "5475" "1" "0.084005" "1.9730835" "-4.2" "0.95441172" "18173" "CCGGTTTCCAGTTTGGACAAGTGCTTTACCTCGGAATAATGACACCATTCTTATCACCAC" "41673" "1" "0.084023" "1.9729405" "-4.2" "0.26800294" "327766" "CAAAGATGTTTATTCAGGAAACTTCCTAAATTGGAGGCAACCATTAGACAATCAGTTGGG" "51390" "1" "0.084068" "-1.9725952" "-4.2" "-0.2713977" "" "AGAAATAGAAACCTACATCCCCCAAAAGGGGAGACCAAGAAGTTGTTCAAGGACCCCAAT" "26013" "1" "0.08407" "1.9725819" "-4.2" "1.01861177" "" "ATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTACTGCGTGC" "36004" "1" "0.084096" "-1.972379" "-4.2" "-0.17418721" "15115" "CTGCTGGAGGAGAGACTGAAGCTTGTCTCAGAGTTATGGGATGCTGGGATCAAGGCTGAG" "14204" "1" "0.084105" "1.9723153" "-4.2" "0.25885942" "75778" "ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT" "27271" "1" "0.084123" "-1.97217" "-4.2" "-0.2537297" "" "CGAGGTCAGTGACCGGCCCGTCCGGCCGCACCCGCGGGGTCGGTCGGCCTCCCCGACTGC" "22495" "1" "0.084157" "1.9719084" "-4.2" "0.20144884" "74249" "GTGCTTAAGGACAAAGTCTAGAAACTACTACCATCATCACTGTTAAGAAAGATAACATTC" "38871" "1" "0.084161" "-1.9718817" "-4.2" "-0.19566769" "69556" "ATCATTTCCCAAGTGGTAGACCCCAAACTAAACCACATCTTCAGGCCACAGATAGAGAGA" "25470" "1" "0.084182" "-1.9717195" "-4.2" "-0.27911121" "240239" "CTTGAAAGGCCTATGGAAATGGATGATAACCAGAAAGCCAGCAGTTACTTCAGAGGTTCA" "12132" "1" "0.084191" "-1.9716544" "-4.2" "-0.20325885" "107869" "ATCAATGACACACTGATACGACTTTCTGTGGGCCTAGAGGATGAACAGGACCTTCTTGAA" "16387" "1" "0.084205" "-1.9715463" "-4.2" "-0.33747886" "100042510" "ACATATTTGTTTCCCCGAGTCTATTGATCTCCATGGATTGTGCAGAAATGCATTCTAAGC" "47947" "1" "0.084211" "1.9714986" "-4.2" "0.2110308" "" "CCAGAGCCATAGGCTTCTTTGAGTGGGAATTTATTGATAGATAATAATACTGTTAACTGT" "61350" "1" "0.084225" "-1.971393" "-4.2" "-0.19056241" "108062" "TGGTTGGTTGGTTTGTTTGCTGTTATTTTTTACTGTTGTAATAATACAGTTAGCTACCCC" "23833" "1" "0.084243" "1.9712534" "-4.2" "0.31605459" "619548" "CCAGATGGCATTTTGTAAGAAGCTTTGCAATAAATGGCACCCCGTGGTCTTCCTTGTCTT" "7447" "1" "0.084265" "1.9710817" "-4.2" "0.2006781" "" "GAGAGTCAAAGGTTTTCTTCGAGCACTAGGGAAACAGCAGTAAAGGTAGAGAAGGAAAAA" "46734" "1" "0.084286" "1.970921" "-4.2" "0.17169943" "" "ACCATGAGATTCTGTATGAAGTAAATAATATATTCAACAGAGGGGCAGATGTGCAGACAG" "20434" "1" "0.0843" "-1.9708145" "-4.2" "-0.20947093" "14077" "TAAAACTGTATCCAAAGGGTGCTCCAAGGTCAATAAAGCAGAACCAAGGCCACCCAAAAA" "44028" "1" "0.084308" "1.9707534" "-4.2" "0.87698865" "100038947" "CAGAAGTTCTATCCTCGAAGGTTTCAGGTGACCTGGTTAGAGAATGGAAATATATCCCGG" "8052" "1" "0.084309" "-1.9707441" "-4.2" "-0.16328306" "" "AAATGGAGCATTGGTAAAGGACACTCATGTGTCTGCACATTTGATGGGGAGTGTACTGAG" "34406" "1" "0.084315" "1.9707009" "-4.2" "0.46822186" "15896" "GCAGCAGATGCGGGGGACATTTCCTCTCCTTTTTAGCCTCAATACAAATATCTGGATTTC" "16079" "1" "0.084332" "-1.970569" "-4.2" "-0.16227255" "" "CAGTTAGGAGAGTGGGAACAGGACGGGTACATAAGCTAAATAATAATTACAACGGAAGGG" "18348" "1" "0.084359" "-1.9703621" "-4.2" "-0.18723261" "66643" "GCCCTATTCCAATGTCCTAAAAAGGTGATGGTGTGTAGTGTTAGATGATTTCATTTTAAA" "24835" "1" "0.084374" "-1.9702437" "-4.2" "-0.34479918" "" "GGTCCCAAGTGTTACATTATCTTGTTAAGACCAGAAAAGAATTCATTTACTCATATCTGG" "26531" "1" "0.084386" "-1.970157" "-4.2" "-0.19182284" "" "TAACTTGATTATTTCCACTGCCGTGACCATCAGACAGTATTTGCCACACGGAAGTCTGCA" "14854" "1" "0.084411" "1.9699629" "-4.2" "1.66313343" "" "ATTCTGGTTGTCCTTGTAGCTTGGCCATCATTGGAGCTGTGGTGGATTTTGTGATGAAGA" "53091" "1" "0.084419" "-1.9699029" "-4.2" "-0.30104922" "381511" "CTCACCCATGATTTCCTCAGTGTAACAGTAATATTTTGTTTTGCTACACCTAAAAGACAA" "45283" "1" "0.084447" "1.9696891" "-4.21" "0.34867134" "67367" "AATTTTTGCCGATATCTTGTACATTTAGCAGATACAATTTACAGGAACAGTATTGGGTGC" "5722" "1" "0.084456" "-1.9696141" "-4.21" "-0.18534448" "233410" "ATATTGGGGTATTTGTATTTTTGTTCCTGTGCCATTAGAGCTGCTGCTGCCTCAGGAAGG" "21007" "1" "0.084465" "-1.9695495" "-4.21" "-0.18388221" "78890" "AGGGCTATTGGACAGTTTTTCCTTTCAGGAAAAATCATTTCCATTTAAATTTGTTTTCAG" "44743" "1" "0.084476" "-1.9694664" "-4.21" "-0.18295848" "" "" "28396" "1" "0.084496" "-1.9693137" "-4.21" "-0.29479366" "13909" "GGTATGCCTTCCAGGAATTGCTGGGTGATATCTCGTTCATCATTCCTACCTTGAACTTCT" "34763" "1" "0.084536" "-1.9690085" "-4.21" "-0.28375441" "" "ATCTTGTATCTGGTATCTGCCTTAAGGGAAACCCAATCAAATAAAATATTCCTCAAGGGT" "679" "1" "0.084548" "-1.9689148" "-4.21" "-0.37359291" "" "GACACTGACATAGGCTTTTTATGTATCAAAATATGGATCATGCATTGTTAGTTAGGGCAA" "1475" "1" "0.084551" "-1.9688885" "-4.21" "-0.33613134" "" "TGATTGGGGCTGACCTTCTGACAGCTTTGGGTGCCTCCTCTTCACTTTTCCTTAGGCCGC" "50847" "1" "0.084571" "-1.968739" "-4.21" "-0.15524088" "" "AAGACCCTAGGTTCTTCTTCAGACGCACCCTTATTACTTCTTCCTCTGTCCTTGAATTGT" "4645" "1" "0.084573" "1.9687186" "-4.21" "0.16459689" "" "AGATGAGCAGAACCAGGCAGCCAGAAGCTGCGGAACAAGAGATGCATTCCATAGCCCCGA" "34943" "1" "0.084618" "-1.9683759" "-4.21" "-0.21010535" "71876" "GTCATCACCAGGCATAAGCTTTTTAACTACAATAAACTTTAATGATGTCAGTGCAAATGC" "11672" "1" "0.084662" "-1.9680432" "-4.21" "-0.18261987" "" "GAATCTCTGTTACTAAGCACTATTCACTCAAAGTTGCCTCAGAATAAACTTTCTTTTGGT" "27272" "1" "0.084678" "-1.9679187" "-4.21" "-0.16236843" "12626" "GATCCACATGAGGAGATACTGAAAGCATTTAAACTATTTGACGATGACGATTCAGGAAAG" "32638" "1" "0.084751" "-1.9673637" "-4.21" "-0.28820055" "320522" "CTGCTGCTGAACTGAGAGAAGCCCAGAAAATGATCAAATAAAAAGGAAACATGTCTTCTC" "31619" "1" "0.084756" "-1.9673267" "-4.21" "-0.30579498" "100039861" "TAAACTATTCTATCAAACCCGTTTCTCTGTATTGCTTTGAATGTGGTTTGCACTAAATTA" "5464" "1" "0.084776" "1.9671689" "-4.21" "0.27678764" "627178" "CAAGCTTGTAAACACAAAGTACTCACAATTATCACTCAGGAATTACTTCACAACTTACTG" "33768" "1" "0.08478" "1.9671431" "-4.21" "0.3286439" "" "GGAGTCTCATACTCAGGCCTTTGTATTCGCGTTTCTCTGGTTGTCTGGTGTTGATGGAGA" "22460" "1" "0.084789" "1.9670731" "-4.21" "0.53273301" "" "CTTTGTAATTTTGTATATGGTATTGCCATTGTGATGAGAGGGAAAACTCAATGTCTCCCA" "60211" "1" "0.084881" "-1.966369" "-4.21" "-0.1731957" "234129" "GAAGTACAAATCATAATGTGGCAGGAGACTGTTTTTTCCTTTTGTAATTCCAGGAATTGT" "30066" "1" "0.084891" "1.9662915" "-4.21" "0.239336" "258904" "TTGGTGTTTGCCAATAGTGGTTCTATCTGCATCATTATCTTCTCCTTGCTTCTTGTCTCC" "16440" "1" "0.084898" "-1.9662414" "-4.21" "-0.23786403" "" "TAATATGGATCTCATCCGACGTAGGAGCCCGGATTTCCAGTTGCAGACGTCCACGGCGCT" "983" "1" "0.084906" "-1.9661802" "-4.21" "-0.52416906" "" "ATTTCCTGTCTCTCAGGAGCCAGGAGAAGAGGGACCTGAACAAGAGAGAGAGAAAGAGAG" "3811" "1" "0.084924" "1.9660455" "-4.21" "0.20586561" "223254" "TGACTAGTGTCAGAGATTCACATGGATAAGGAGTAAGATGTATCAATCATTTGCCTTACA" "46549" "1" "0.084968" "-1.9657088" "-4.21" "-0.32258447" "" "CTGCCTATAACCCATTACCCATTGCTCTATCAGTAAGCCAAATAAACTTGTTAATTCCTC" "35506" "1" "0.084974" "-1.96566" "-4.21" "-0.18975691" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "12205" "1" "0.084984" "-1.9655822" "-4.21" "-0.84998028" "" "GGGAGGATTATTATTCGAGAGAGGATTGTTATTATTGGGAGATATAAACGAGGGAGAGAT" "59300" "1" "0.084991" "1.965533" "-4.21" "0.15808821" "68298" "CCCCACCCTTGTAGAAGTGCTTGTTGTCTGTGGTTTTAACATGGAAATGGCCTTTGCATT" "35385" "1" "0.085012" "-1.9653743" "-4.21" "-0.26892636" "" "AGAGCCCTTAGAAGAAAGGATTTCCCGCAGGATGGAGGTTGGGTCGTTCCGGACTCCCTA" "25508" "1" "0.085029" "-1.9652401" "-4.21" "-0.28266918" "18045" "CACCACCTTTTTGACAGGTATTTGAGAATACCACTGATACACAATACAGTATTTCATGAC" "12505" "1" "0.085066" "1.9649631" "-4.21" "0.56085393" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "23296" "1" "0.085066" "-1.964958" "-4.21" "-0.20480727" "" "AGGGAACAGCTGAGGCAAGCTCTGTTTTGCTGTATTCTACCTAGCTAATACTTGAAAAAA" "10849" "1" "0.08511" "-1.9646279" "-4.21" "-0.1990174" "" "" "13454" "1" "0.085118" "-1.9645641" "-4.21" "-0.1757281" "" "CCATAAGGCAAGACAGATTACAAAAGAAGACTTTGAAAACAATCTGAGAGATCTCAATAG" "40546" "1" "0.08517" "1.9641714" "-4.21" "0.58269059" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "43095" "1" "0.085205" "1.963908" "-4.21" "0.53455122" "72121" "GAACTTTGAAAGCTCACATCCAAACTCAGAACTGTACTCAAAGCTGCATTTTTTGGCAGA" "62837" "1" "0.085224" "-1.9637617" "-4.21" "-0.19203476" "69902" "CTTTGTTTCTATAAAGAATAAAATTGTGTCCGCAGGGTGTTCCCGGGAGACAGCAAAAAA" "2409" "1" "0.085249" "1.9635737" "-4.21" "1.95142912" "14469" "GTTTCTCCTGTATAATCTTAAGTGTTCCTCTTTCCTACAGATAGCTTCTGTAATCACAGA" "47636" "1" "0.085261" "1.9634779" "-4.21" "0.46467678" "320415" "CCGAGGACGAGGACAGTCCCTGGATCCTACACAGCTAATCCAAGCCAATAAAGGGCTCTC" "52856" "1" "0.085271" "1.9634045" "-4.21" "0.30334381" "" "" "13975" "1" "0.085299" "-1.9631914" "-4.21" "-0.16375789" "235180" "GTCCTGCTACAAGAGATGCAGGCCTTGACACAGACCTTCAACGACAACTGGTCCTATGAA" "61011" "1" "0.085308" "-1.9631196" "-4.21" "-0.22884722" "74238" "TACTGAGATTGAGTTGTGTTCAAGTTACCTCTTAATTGGTAGTTTCTGACTCATTTGCTG" "10080" "1" "0.085402" "-1.9624101" "-4.21" "-0.19957279" "94109" "TACCTTCCAAGAGTAACCAGAGACTTTATCCAGCCTAGAATCCTTCTCCTGGAGATTGGA" "29303" "1" "0.085432" "-1.9621812" "-4.21" "-0.30853116" "" "TTTGCGTCCTTGCATCGTGGCTTTGGAATAACTGAAAGGAGTGGTTCATGCAATGAACTC" "17155" "1" "0.085436" "-1.9621535" "-4.21" "-0.17491791" "" "TTGTTCCTTCTCCGCTCCCACTGCTTCACTTGACCAGCCTTTTGTTGAATGAGCTATTAA" "58893" "1" "0.085436" "-1.9621513" "-4.21" "-0.25890579" "21869" "AGTTGGACTAAATGCCTAGTTTTTAGTAACCTGTACATTATGTTGTAAAAAGAACCCCAG" "62528" "1" "0.085455" "-1.9620061" "-4.21" "-0.28908897" "" "ACAGACTACAGTGACCCTGATGTGAGAGATAACGTTATCCGATTAATACTCAAACTCTAA" "46179" "1" "0.085464" "-1.9619411" "-4.21" "-0.17600278" "13798" "CTGCTTACGACCGTGTATATATTTAATTTCAGGTAAGGAAAACAAATATGTGTAGCGATC" "22899" "1" "0.085487" "1.9617705" "-4.21" "0.23457257" "100043801" "AATCATTGCATCAGATGTGGGGGAGTAGTTACAGGCACACTGTACAACAGAAAAGACTAG" "5208" "1" "0.085501" "1.9616597" "-4.21" "0.20038699" "245610" "CCTGCTACTGTAGGCTATATAGTTTCATACGTTGAACATCCTTTCTAACCCTGTTAAAAC" "28023" "1" "0.085558" "1.9612278" "-4.21" "1.09544629" "20287" "TCTCTAGGACCCTGGCTGGAGTAGGGATTGGTTGTCCTTGGCATCAATAAAAAAGGAATT" "61136" "1" "0.085571" "-1.9611328" "-4.21" "-0.19877771" "66882" "TGCTTTTCTTTTTGCTATCCATTTATAGTTAGTAGTGGAAGATGTAGCCACCTTTTTTGG" "23351" "1" "0.085591" "1.9609821" "-4.21" "0.25108587" "16779" "GCCCTGAAACTGAAACGGGCAGGAAATAGCCTGGCAGCATCTACAGCGGAAGAAACAGCA" "44363" "1" "0.085597" "1.9609363" "-4.21" "0.79647927" "16160" "GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT" "45689" "1" "0.085607" "1.9608626" "-4.21" "0.33706571" "" "TTCAAAGTCCCACCTGTAACTGGATCTCTGCCAGTTCAGAAATCAGCATTATTATAATAC" "53390" "1" "0.085619" "-1.9607674" "-4.21" "-0.15962975" "71904" "TCACTGTTTCCTGGGGCTCCAGGCTTTAGAACCGTTAGGAATTGTCAAGGAAAACTCAAA" "47665" "1" "0.085619" "1.9607672" "-4.21" "0.15229961" "622708" "CTACTGAGTGATTGAGGGTGTCTAAATGCTTGAGATCCTGACAGTCAAACGATGCACAGA" "55819" "1" "0.085637" "1.9606326" "-4.21" "0.25083379" "" "TTAAAACTTGGTGGCAGTACAAGGGGAAATATAAATGCCAATAGCTCACGTCCACAAACA" "62530" "1" "0.085654" "1.9605066" "-4.21" "0.84909222" "320139" "GCTCCTGGATGTGCTAAGTGACACAAGTCCTCCATGAAAACCCCGAGGAGTTGGAGGAGT" "9640" "1" "0.08567" "1.9603844" "-4.21" "0.22284395" "" "TGTCTCAAAAGTTAAGAGGAAAGTCTCACCCAAGGGAATAAGTCCTAGAATGAGGATCAT" "21982" "1" "0.085683" "-1.9602876" "-4.21" "-0.2753216" "100042480" "TACCAGTTCCCACTGTTGATTATCTACTTCCTTGAAGAGGCCTTGATGGCCCTTTGTGAA" "49995" "1" "0.085685" "-1.9602689" "-4.21" "-0.18878446" "" "GCTTTCAAAAATGCTCTAGACAGTTTAAGATACATAACCGTCTTCCATGGCTTTTAAAGT" "24578" "1" "0.085697" "-1.960182" "-4.21" "-0.2265674" "14711" "AGGCACTGGCAGAGATGGCTCTCCTGGCTTCAGTAAGTTCCGGCTCTCTTACTACCCACA" "9898" "1" "0.085698" "1.960171" "-4.21" "0.17246881" "18596" "CCACATTTAGACACCGGAAGTGCTATTTTATATGCTGTTAAGTTTTCCTATCTGTACTTT" "16830" "1" "0.085703" "1.9601301" "-4.21" "0.20835027" "12337" "AAGCCTTGAAGACTGGACAAGGGAGGACAGGGTGGAGCAGGGATAGCCGTGGCTTCATTT" "5591" "1" "0.085738" "-1.9598729" "-4.21" "-0.27394748" "18619" "GCTATGTTGTTATCAATAGTTTGTTACCTCATCTCTCCTGACGAAACATCAATAAATGCT" "3325" "1" "0.08579" "-1.9594759" "-4.21" "-0.18377744" "69641" "AGGATATACAAAGGGACGCAGCCCACTTGCCATGACTTCAACCTCCTCACAGCTACAGCA" "45607" "1" "0.085831" "1.9591659" "-4.21" "0.24456359" "69743" "CGGTGACTTTGTATCATAAAGTGTGTGGCTTCCTGTTCTCAATAAAAAGTAATAAATTGG" "13483" "1" "0.085853" "1.9589983" "-4.21" "0.81550977" "16988" "CCTGGGTGCGTGCTCAGTCACACTATGGTCATCTAGTAAAGTCTGGTTCCCCACTTCTGC" "60333" "1" "0.085881" "-1.9587908" "-4.21" "-0.1662908" "170740" "CATAACCTGTGATTCTTCAACTCTTCGTATATTTCAAGTATGTTTTATTGAGGCCTTAGG" "33831" "1" "0.08589" "-1.9587265" "-4.21" "-0.27617601" "56495" "AATATCATCGAGCAGCGTAGCCTTAAGTGGATCTTTGTCGGGGGCAAGGGTGGCGTTGGT" "27511" "1" "0.08589" "1.9587227" "-4.21" "0.35021106" "321007" "CTACAGTTAAACATTGGTTTAAAAATAAGGCTATTCCAACTGTTGTCCTGTTCCCCACCC" "47961" "1" "0.085923" "1.958474" "-4.21" "0.31541969" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "17298" "1" "0.085933" "-1.9584004" "-4.21" "-0.16676912" "" "TGGCAACAATTGATGCTCAAGAAGGAGGTGACTGTCCGAGAAGTAATGATGCCACATCAA" "59208" "1" "0.085983" "1.9580206" "-4.21" "1.66005575" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "5164" "1" "0.085991" "1.9579584" "-4.21" "0.26067702" "" "TATGTTTTTTTCTTTATATTTCTCTCTGGGAGAATTGAGTCTGGTGGGAAATCTTGAATA" "10193" "1" "0.08601" "1.9578166" "-4.21" "0.23363587" "106389" "TTTTAAAAAATAGAGGTGCACAATGCTCTGGCCACTCCTCGAACCTGTGTGTCTGCCAAT" "29995" "1" "0.086016" "-1.9577727" "-4.21" "-0.31036485" "" "ATCCTTAAGACTCAGAAGCTAAGGCTTCTTTCATTTCTGGAGGGGTGGAACGGACATGAT" "45822" "1" "0.086043" "1.9575701" "-4.21" "0.6886545" "80861" "GGAAGATGAACGCAGGAGAATTATTATGCCATGATGTTCTAAGAACTACAACATCCCTCC" "11917" "1" "0.08607" "-1.9573702" "-4.21" "-0.18862224" "" "GAAGAGGATGTGAAACCTGTAAAATACATGAGCGCCTACATAAAGAAAAGCTGTCTGCTG" "19802" "1" "0.086077" "-1.9573113" "-4.21" "-0.15678797" "113850" "ATCTCCTACTCAAGAACTATTATTACAGGGAAATCCACTGCCCTATTGTGTCCAGATTCT" "33359" "1" "0.086078" "-1.9573045" "-4.21" "-0.25785782" "68870" "CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT" "40450" "1" "0.086106" "1.9570974" "-4.21" "0.3778367" "21946" "ATCCAAAGCTGGGAACACTACCGAGAGTGAGAGACCTTGAGACCTAGTGAGAATCCCCCC" "61559" "1" "0.086123" "-1.9569662" "-4.21" "-0.26376088" "" "TTCTTAACCCTCTTCACCTCCTCTGCAGCCGGCTCACAGGGTTCCTTCCAGGACCAGTCT" "22274" "1" "0.086134" "-1.9568845" "-4.21" "-0.1724877" "" "TTTCGGGGCCACGCTGGAGTGAGTACAAGCGAGAAGACCCTCGTTAACGTGTGCATTGTG" "9480" "1" "0.086138" "1.9568583" "-4.21" "0.7815687" "" "CTTATCTTCTCTCACAAGCAAAGGGGACATTTGTGAATGGAGAATTTGTAGTATTTAAGG" "12793" "1" "0.086158" "1.9567035" "-4.21" "0.21730818" "76484" "CTGTTTTGGGACTTTTCTATAAGGATTATGTTCTGTTGATCAACGCCTACATTTTCAGAT" "43886" "1" "0.086245" "-1.9560553" "-4.21" "-0.20293588" "97820" "CATGGGCAGCATCCCCTGGAAGCCAGTGATTCCAGAGCGCAAGTATCAGCATCTTGACAA" "36963" "1" "0.086254" "1.9559831" "-4.21" "0.4506347" "" "TATTACCTAGATGGGCTTTAAAAGTGGCATCTTCAGTATTTTACAGCAGTAAGTTGGCCT" "50731" "1" "0.086281" "-1.9557804" "-4.21" "-0.23619891" "268451" "ACTTGGTAACTTTTGTACAGGATTTTGTTACAATCTTAAGCATAGGGACCACTTAATCCC" "18963" "1" "0.086295" "1.9556747" "-4.21" "0.50285465" "" "" "5660" "1" "0.086345" "1.955303" "-4.21" "0.23854881" "74387" "GAGGAACCACAGCAATTACTAAATTGTTCACCATTACATAAAGAAAAGTTCCCCTGTAAT" "37886" "1" "0.086349" "-1.955273" "-4.21" "-0.24323059" "" "" "426" "1" "0.086359" "-1.9552001" "-4.21" "-0.19013347" "" "AACCCACAGGACTTGCCCCAGAGAAAGTCCTCACTTGTTACCAGCAAGCTTGCGGGGTAA" "61322" "1" "0.086372" "-1.9550985" "-4.21" "-0.20554159" "" "CAGTGGTATAACTCATGAGAGCTAAATAGAAAAACGATGAATTTAGATGCAGAACTAAGC" "32031" "1" "0.086381" "-1.9550314" "-4.21" "-0.21124657" "109910" "AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC" "45314" "1" "0.086396" "1.9549167" "-4.21" "0.23797351" "" "TCTTCAATAAAATGGACTTAACCGAAGATCCCCGGACGTGGATACAAAAGCAGGGACAAC" "14493" "1" "0.086419" "1.9547445" "-4.21" "0.3421381" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "23429" "1" "0.086441" "-1.9545856" "-4.21" "-0.19638706" "" "CCTCTGAAAAGCTGTAACATCTGCCTTAGAGCCATGACTGAAACTGGACATCATGTTCCT" "23789" "1" "0.086444" "1.9545613" "-4.21" "0.83735486" "16638" "TCTGTATTTGTGGTAAGAGACTGGATAAATTTCCTCATTGACTCTCCAATGAGTGTAAAA" "15865" "1" "0.086455" "-1.9544803" "-4.21" "-0.18108748" "73229" "CAGAAAATCCATACTTCTGAAGAACACTGTAGTTGTCCAGAATGTGGCAGGGAATTTCAT" "18799" "1" "0.086465" "1.9543998" "-4.21" "0.2990444" "" "" "3318" "1" "0.086483" "1.954272" "-4.21" "0.36891193" "15201" "GAGAGAAGGTCATTAGTGACGAAGATCTAGAATTACTGTTGGATCGAAGTGATCTCATTG" "29824" "1" "0.086498" "-1.9541556" "-4.21" "-0.25177041" "67876" "CTTTGTGCTGATTGTGTGTCAAAATTTTGTCTGCCACTGTAGGCAACAGATAAGTAAGTA" "28566" "1" "0.086537" "-1.9538669" "-4.21" "-0.17145261" "" "TCAAAAGTTTTGGTTCTTTTTGAGGACTTGACCTTATCAAAGCACAAGAATTCTTAACCG" "52980" "1" "0.086597" "1.9534146" "-4.21" "1.37384797" "" "CTTCGGCTTCATCTAACATTCCTTCGGCTAAGGGTACTCACTTCTTCAAAACACTTAACA" "46481" "1" "0.086635" "1.953133" "-4.21" "0.18480398" "" "GTGTGTGTTCTATGAGATAACCTTCACTAATGTTTATGGCATCAGATGTTTTATGTTCAC" "34195" "1" "0.086656" "-1.9529768" "-4.21" "-0.2315564" "11752" "GTATACCGCCCACCCTAGCATTACCTCTGAGCAAACGGAAACATCAACATGAAGAAAGAA" "45639" "1" "0.086659" "-1.952952" "-4.21" "-0.27416887" "30049" "TTCAGGGTAGGTGTCTCAAGCCAAATCCAACCAGCTCTTCCTGGATGTTCTCTGTTAATT" "24219" "1" "0.08666" "1.9529482" "-4.21" "0.67168761" "" "ACTCTTGACCTTCTCGAGTTTTCAACATATCCAAATCCTGGGATTGCAGGTCTTTGCCAC" "15511" "1" "0.086683" "-1.9527706" "-4.21" "-0.18414845" "" "AGAACTAATATGGTGACACCTTGGGCTTTGGGGCTAGAATATAAAGATACCTTGAGAGAA" "6653" "1" "0.086699" "-1.9526498" "-4.21" "-0.16459739" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "62799" "1" "0.086729" "1.9524312" "-4.21" "0.54717752" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "34379" "1" "0.086739" "-1.9523585" "-4.21" "-0.21514564" "28040" "CTCAGTCCCTTTATGAAATAATAGCTCTTCTTTCTACTTATATGTCCTATCAGGGAATGA" "62887" "1" "0.086747" "-1.9522941" "-4.21" "-0.39298208" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "52737" "1" "0.086755" "-1.9522385" "-4.21" "-0.22374466" "93892" "TAGCAATTTGTTGACTCTCATCATGGTTCCTGATGTACACTGGTTCTTTTTAAACATTCT" "55538" "1" "0.086765" "1.95216" "-4.21" "0.18204961" "" "" "53916" "1" "0.086793" "-1.951951" "-4.21" "-0.285643" "" "AAGTGCACAGAGTCCTCCTATGCTGGGTGTGCTTGCAAATGAGGCGAGGGGTCAGTGCAT" "10068" "1" "0.086814" "1.9517937" "-4.21" "0.38267645" "" "GGTTTCATCAACCAGAAAGGCAAGTGTTTCTTAAAAATAGAAGGTTGCAGCTTTAATTCA" "2354" "1" "0.086833" "1.9516549" "-4.21" "0.2750348" "" "GATCAGGCTTCGTGATGCGATCATACTGAGTGTCAAGGTCTTCTAGTGTGGGGTCACAGG" "14136" "1" "0.0869" "1.9511553" "-4.21" "2.11938916" "15019" "GACATGGACATCTACACTAGGCTGGTTCCCCCAGTTTCTAGAACTTTCCAAAGAATACAG" "35483" "1" "0.086929" "-1.9509347" "-4.21" "-0.35008838" "" "GGAGATGAATTGGGAAAGAAGAAAAACATCAAAATATATTGTATGAAAACAATTTTTAAT" "139" "1" "0.08694" "1.9508564" "-4.21" "0.71619243" "" "GGGCCCTCAACACTAATAAAGAATGGACTGGCTAAGCAAACAAACAAATCTCTACTCCAC" "15856" "1" "0.086944" "1.9508254" "-4.21" "0.38741957" "" "GCTTATTATATACTGTGCATTATTCATTTAAGAAGTCATTACTCTTGAGGCCCTACCTCA" "6821" "1" "0.086954" "1.9507547" "-4.21" "0.35176188" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "33713" "1" "0.08696" "1.9507072" "-4.21" "0.320976" "71586" "TATTGACACCCTTCAGGGTTTTAAATACACCTACGCATTATAGCAGCTGTTTTGTATGCC" "43738" "1" "0.086968" "-1.9506482" "-4.21" "-0.18283096" "232798" "CATTACCTACTTACCCCATAGCTGTGTGTAGACTTTATTAAAATCTGGGTTTTTGCTTTT" "29886" "1" "0.087075" "1.9498477" "-4.21" "0.33621847" "" "GCATGTAAACCAAGTATCACTATAAATTTGGTAACTAATAGAACTACAGGGAAAAGGTGC" "965" "1" "0.08708" "1.949816" "-4.21" "1.63680516" "100529082" "TTTGGAGCTGTGATCATCATTGGAGCTGTGGTGGCTTTTATGATGAAGAGGAGAAACACA" "28649" "1" "0.087084" "-1.949785" "-4.21" "-0.28044477" "" "TGCAGCAGGCTCATGGCCGCCATGGCTACACCGGCCACGGAAGGAAGTGGGGAGGGCTAA" "10304" "1" "0.087106" "1.9496216" "-4.21" "1.61952241" "23833" "GGGAAGGGTTGATAGCAGATATCCAAGGAGGCTAAAGTTGACAGCCAATGGCCGGAATGG" "20807" "1" "0.087106" "1.9496205" "-4.21" "1.1729421" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "35066" "1" "0.08712" "-1.9495146" "-4.21" "-0.19983398" "14941" "CCTACATGGCATTCGTTATGTCTGTGGATATTAAGGGGAACAGGATATACTGTGGAGGCT" "42534" "1" "0.08716" "-1.9492205" "-4.22" "-0.15091995" "66225" "CTAAAATAGTCTTAAAAAGGCCATCAGTGGATCTTACCAGTAGTACTTACTTGAAGTGTT" "12452" "1" "0.087203" "1.9488978" "-4.22" "0.30908247" "433759" "GTGGAGGTTGATAGCCTAGCTTCCTTTTTGAGATATTTTCATTTTGTGAAACTCTTTGTA" "16342" "1" "0.087213" "1.9488242" "-4.22" "0.28218933" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "47729" "1" "0.087216" "-1.9488016" "-4.22" "-0.33076278" "" "GGGTACACGACTGAAGATCTGGATGTGGATCAGGAAATGTTTACAGCAGGATTCGTATGA" "1802" "1" "0.087221" "1.9487675" "-4.22" "1.59945819" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "28896" "1" "0.087251" "-1.9485464" "-4.22" "-0.21538652" "211147" "GAATGGCAAAACCATAGCACTTCTAACTGTACATCCACGAACTTTTTAAAATCTATGCTT" "9402" "1" "0.087273" "-1.9483776" "-4.22" "-0.15809321" "380959" "CTTGGAAGAGGAATTTCTGGTTTCATAGACATCTCTGTTTGTCCTGTTACAAGATGCCCA" "30567" "1" "0.087291" "1.9482503" "-4.22" "0.35861408" "" "" "14443" "1" "0.087336" "1.947911" "-4.22" "0.92685834" "" "GAAAGAAAACCTGTGATTGTGCATTTGAGGTGGTTTCTGAATAAATTGACCATCTCAGGT" "27447" "1" "0.087338" "-1.947895" "-4.22" "-0.19132301" "" "AAGTGTGGACCCGACATTCGCACTGGCACCTGATACGCTGTTCTGACCATGGCGTTCTCA" "26373" "1" "0.087357" "-1.9477592" "-4.22" "-0.16125945" "" "TTCTCTGATTGTCTCTGCCACAGCACAGGCTAGACCAGGGAGAGGTTCTGCTCAGAGGCA" "47163" "1" "0.087376" "-1.9476127" "-4.22" "-0.25385297" "20312" "TCCCAGAGCAGAATGTGGGCCGTAACAATCTGAGGAGGACTTTAAAAGTTGTTGATCCTT" "54985" "1" "0.087379" "-1.9475966" "-4.22" "-0.30164378" "76898" "TGACCTGGAGCCCAAGGCAGCAAACTGTACCAAGATCTTGGTCTGGCATACACGAACAGA" "43352" "1" "0.087388" "1.9475285" "-4.22" "0.40496172" "" "AAATATACCCTCCATGAAATAACATGGTTTTCACACTCATCGGACCAACTCCAGCAGTGA" "10295" "1" "0.087429" "1.9472214" "-4.22" "0.16288045" "" "" "13053" "1" "0.087492" "1.9467587" "-4.22" "0.29264045" "" "TGAGCCTATTCTAGGGAGACATGTCATCTTTCATGAAGGTTCAGTGTCCTAGTTCCCTTC" "61972" "1" "0.087496" "-1.9467299" "-4.22" "-0.21768128" "58180" "ACCACGCATCACATTGATTTGAGTTTACTTCCCTAAAGAGTTTGGATGGATGCATTCAGG" "10966" "1" "0.087498" "-1.9467122" "-4.22" "-0.22763725" "68922" "TTCTCCATGGCCCTCAGCCTCCATTATACCCTCTTTGCACAAATAAAGGCCAGCTGGACA" "44472" "1" "0.087502" "1.9466864" "-4.22" "0.66452469" "" "ACATTTCCTTTTCTTGAGAGCCTCCGAGACTGTGAATTCATCACTGGTAAAATGTATGAA" "40072" "1" "0.087591" "1.9460226" "-4.22" "0.22597226" "" "" "29331" "1" "0.087597" "1.9459779" "-4.22" "0.65861198" "21745" "GACACACAAGGAAACTTGTATTTTCTATCTTGGGAATGAAGATGCAGTACTCAGGACAAA" "31833" "1" "0.087633" "-1.9457161" "-4.22" "-0.18767233" "68260" "AAGGACGTTGGGGGTATTCTGCATATCCACCAAAATGTGGAGTCTTTCTCAGGAAAGACT" "48573" "1" "0.087658" "1.9455256" "-4.22" "0.3736664" "" "TCAGAAGGGAGCACAGCTCTGATACCTGGTCTCTGTGTGCTCCCTGGAAGGGGTCACAAA" "32317" "1" "0.087671" "-1.9454334" "-4.22" "-0.16695991" "100039319" "TTGGCTGTCTACAGCAATATGGAGCTAAGTGATGTGTTCCAATTCATCACCATCTCCCAG" "17463" "1" "0.087681" "1.9453576" "-4.22" "0.17392008" "" "TGTAAAGCTGCAAGAACAGGCAAAATGGAACCAAGAATGAAGCAGTGTTTTAAGGTGGGG" "34280" "1" "0.087683" "-1.9453452" "-4.22" "-0.28711028" "" "AATATTATTCATGAAGGGCAGAAAGCCCACTACACCCTCACAGAGCCAAGCACTACTGTT" "39163" "1" "0.087706" "-1.9451781" "-4.22" "-0.37268884" "12299" "TATGATTGACAGCGAGGACACGGTCTGGATAGAGCACTACTATTCGTGGTCTTTCGCCTG" "50902" "1" "0.087724" "-1.9450406" "-4.22" "-0.21600818" "100504710" "CCTATTTGTCCAGACTAAGGAAATCTCCAATGATAAACTTAAAGTATAGCCTCACTTCTC" "19907" "1" "0.087807" "-1.9444265" "-4.22" "-0.25757675" "193043" "CATCAGTGTAATGAGTGTGCAAGAACCTTCTGGGATAATTCTGAGCTGTTGCTTCACCAG" "49696" "1" "0.087816" "-1.9443604" "-4.22" "-0.18884428" "" "CTAAACAGAGAAAAATGCTTTTACGGGGCGACTTCTGCCTCCTACTTTTCTATGGACAAG" "53359" "1" "0.087866" "1.9439958" "-4.22" "0.26931572" "" "TCACTACAGCTGTTCCACCCAGAGTCACAGAGCCTCACTCTAGGACACAAGCTAGCCTGG" "62257" "1" "0.087913" "-1.9436493" "-4.22" "-0.18395259" "30945" "GCAGACTAACCTCATAGTGGTCAAGTACTCCACCTTAGGTGTTTCCTCTAAGTGTTACCA" "42931" "1" "0.08793" "-1.9435225" "-4.22" "-0.17239036" "" "TCAATGGAATTAAGATTAAAGGAAGAACTATCCGTGTGGACCATGTGTCAAACTCAGGAA" "56858" "1" "0.08794" "-1.9434487" "-4.22" "-0.15675967" "" "CCAAATTGTGTCAACCTTGATTTATCACCTGGAATTAGCATCCACTTTATTTATTTGGGA" "46805" "1" "0.087944" "-1.943419" "-4.22" "-0.16929186" "54326" "GGGAGGCAGAAGCCATTTTTCTTTTAGATGAAAAGCATTCTGTGTGATTGTTGTATAATA" "31307" "1" "0.087957" "-1.9433234" "-4.22" "-0.16049211" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "59719" "1" "0.087972" "1.9432093" "-4.22" "0.25270157" "320747" "ATTCCTACACAGAACTCTCCTATTTCACATTGTCCGCGGTTCCCAGTGTTGTGTATTCCA" "6649" "1" "0.087979" "1.9431626" "-4.22" "1.10718404" "" "TCACGTGTGAACCAGGCAATAAACTTAGACTTGTCTGCTTTGAATTGAATCTCATTGAAG" "44514" "1" "0.088" "1.9430048" "-4.22" "0.52241878" "231932" "ACCTTCGTGAGGAAGCAGAGAAGAACATATTCAACCAGATTATTGAAGAAGTTAAGAAAG" "16553" "1" "0.088061" "1.9425593" "-4.22" "0.26459071" "67946" "GGAAATACATTTTGATGCAAACAGAATAATGAAGCAGCCTGTGTTAGTAAGCATGTAGAA" "4334" "1" "0.088083" "-1.9423923" "-4.22" "-0.17328128" "54189" "GCAGTGTTCAGCTAGCAGAGAGGTGTAGTGTGCTATATGAGTATTTTATATTAAAATATG" "34068" "1" "0.088085" "-1.9423811" "-4.22" "-0.2051659" "" "CTTTCATCTGGCTGCATGAACCAAACAGCTGGGTCCTAGTGGGCAGTGACAGGGAACAGT" "49213" "1" "0.088112" "-1.9421852" "-4.22" "-0.35618227" "" "CTCAAAGTCCATGCATCTCAAAGACAATAGCTAGCCTGGGTTAAATGTGAGACACTATCT" "988" "1" "0.088135" "-1.9420144" "-4.22" "-0.54305836" "21350" "CCCTTAGTTTGACACACTTGGTACTGACTCTTTTAATTCAGCCCAAATTCATGCTGACTT" "29865" "1" "0.088139" "-1.9419823" "-4.22" "-0.23139972" "" "TGTTGGGTCTCTGTCCATCGGTGGTGGGTGGCACACTGATGTCCACCACGTTGTTGCCAG" "44447" "1" "0.088143" "-1.9419548" "-4.22" "-0.22842119" "432939" "CCGCTGAGCATGTTATTCTCACAGCACCTTTAAAAGAAGTTTGTTTTCCCAAATTGAGAT" "20343" "1" "0.088157" "-1.9418496" "-4.22" "-0.19007211" "" "CTTGTCTGCCCAATTAGCTAGGACAATTATTAAAATTCAGAGGCCTAATTATGTCTCAAT" "30717" "1" "0.08816" "-1.9418284" "-4.22" "-0.20993129" "" "TGGACAGTCCCTTCTCCAACCACACTGGTCTGCTCTCATGAAGCCTTCAGTAAGCCATTC" "25762" "1" "0.088175" "-1.9417198" "-4.22" "-0.29146558" "72180" "CTCTGTGTCTTACAGCGTGCCTTGCAAATATTAGGTGATCAATAAATGTTTATCTAAATG" "61389" "1" "0.088185" "-1.9416451" "-4.22" "-0.25782083" "" "" "62745" "1" "0.088199" "-1.9415462" "-4.22" "-0.18809915" "331188" "AAGTAAAGGTAATCTTCAAACGCACCAAAGAACTCACACAGGAGAGAAACCTTATTGCTG" "22877" "1" "0.088199" "-1.9415457" "-4.22" "-0.2063336" "68017" "TGTGGACATCCTGCATCCCGGAGGGACACTGCTGTGTAAAACCTGGGCCGGAAGTAAAAG" "201" "1" "0.088201" "1.94153" "-4.22" "0.55179406" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "1960" "1" "0.088211" "1.9414575" "-4.22" "0.5262674" "12925" "TACCCCCGGACAGCAGGGCTCTCGGGAACCCTCAGTGCCTTTAATAAACCTGATCTTTGG" "42197" "1" "0.088245" "1.9412057" "-4.22" "0.22744707" "12549" "GCTCTTGGAATATGAAAAGACCTAACCAAGACCAAGACCTCGCTATGAAATACTAGCTTA" "18860" "1" "0.088252" "-1.9411548" "-4.22" "-0.31678079" "210108" "GTGAGCACAGACATTCCCAAGCTCTGAAATATGCTCCTAATGAGGGGAAAGTGGTCGGTC" "16864" "1" "0.08826" "-1.9410937" "-4.22" "-0.18492802" "258910" "CTCTCTACATGTACTTCTCATATTATAGTGGTTGTGCTGTTCTTTGGACCCTGCATTTTC" "35297" "1" "0.088306" "1.940761" "-4.22" "0.54201411" "68662" "GTTGAGGGGAACCTGGGAAAATTCTGCCTGACGAGATGCCTGACGAGATATTTTTCTTTA" "13338" "1" "0.088318" "-1.9406699" "-4.22" "-0.29759371" "77781" "GTATTTCTGGAAGTAACTCTAGCTGCATGGCAGTTTTTTCTTTCCTTTTTCCGTTTTAAA" "48411" "1" "0.08836" "1.9403582" "-4.22" "1.43355437" "227929" "GACTCTCATTATTTTCGCCCATTTCAATTTTTATTTTCTGCCTGAACATTCATGCCAAGG" "8733" "1" "0.08837" "1.9402876" "-4.22" "0.30653563" "72792" "AGCCTAACCCTATTCCCTCTCAGTCTCAAGTAGAAACTGTGAAGTCGAAAGAGACAGTGT" "35094" "1" "0.088377" "-1.9402394" "-4.22" "-0.23596787" "22342" "CCAGGGTCGTGGAACTACCGAAGACTGATGAGGGTTTGGGCTTCAACATCATGGGTGGCA" "9203" "1" "0.08838" "1.9402173" "-4.22" "0.51254615" "22038" "TAACTCCCTGAGAGTTCTTGAGGTTTAAGGACGACAACTTTATGGACCCTGAATGGAAAC" "34253" "1" "0.088415" "1.9399576" "-4.22" "1.7981263" "60533" "TTGATGAGTCTCATGTTAATGTCTTGTTTGTATGAAGTTTAAGAAAATATCGGGTTGGGC" "32046" "1" "0.088423" "1.939896" "-4.22" "0.60550139" "85031" "TCTAACGCTTTACATAAATGCCCTTTTAGCTTCTCTATTTCGACACAACTGTGATTACCT" "32495" "1" "0.088442" "-1.9397626" "-4.22" "-0.26636132" "402757" "TCTGTCTGAAGGACTTTCTACTACTGTTGCCTTTGCCGTAGCAAAAACAGATTATTTTTT" "49747" "1" "0.088456" "-1.9396594" "-4.22" "-0.15123522" "69792" "ACAGCGTGTGGATGCTTTACTCATAGACCTTAGACAGAAATTTCCACCCAGATTTGTTCA" "8137" "1" "0.088471" "-1.9395471" "-4.22" "-0.23746048" "74901" "GTTGGGCCAGCTGTTTCTGGGTGTGCAGTTAAAGTGCTGACGCTTGAGTTTCCCCCTAGG" "17935" "1" "0.08849" "-1.9394097" "-4.22" "-0.17432715" "234723" "TTCTAAGAGTCAGATCCCTAATGCTACTGAAGTCCTAGGTGAACAATAAATGTTCCTCCA" "56761" "1" "0.088493" "1.9393869" "-4.22" "1.71431503" "246730" "TGTCCACCTGTTGGAAGGTTCTGTCTGACAAAGTCTGATCAACAATAAACCACAGCAGGT" "41643" "1" "0.088555" "-1.9389331" "-4.22" "-0.37220962" "239134" "AAATGCAGAAGTTCAAAATGTGGTCCTTTCCATATCTTCCTCAGGACCCCTTTGAGAATA" "33627" "1" "0.088559" "-1.9389015" "-4.22" "-0.190153" "218506" "CAAGGATGGCTCTATGCCAAGACACTGTCTGCCCATCTAGATGTCAAGGGCCCTGAACTA" "52334" "1" "0.088564" "-1.9388642" "-4.22" "-0.38914242" "" "TTAATGCTAAAAGGAACAAACGGTGTAGATGAGTACACACCAAATGAGAACACAATCATA" "34949" "1" "0.088575" "1.9387869" "-4.22" "0.39648502" "194227" "CCATGATACCTGTGTGGCCCTTCCCATACCTTTCTTTAGGAAAGCAGATAAATAATTGCA" "12049" "1" "0.088593" "-1.9386514" "-4.22" "-0.1911151" "242864" "ATGTAAGTTCCACTCGTGAAGTACACCAAATCTCTCTCACACAACCACCCTATTGAATGG" "11887" "1" "0.0886" "1.9386016" "-4.22" "0.20412254" "94190" "CTGGCCTTGTAGGGTTCAGTGTCTGGGAACCTATAAAATAAGGAACACATGTCTTAGGCA" "51888" "1" "0.088629" "1.9383944" "-4.22" "0.19060813" "" "GGGAAGTCCCTTCAGAAAGGAAGGGGCTTAGTGGTCTTGAACTTATTTTGGATTCTATAA" "1397" "1" "0.088704" "-1.9378413" "-4.22" "-0.27728183" "216963" "TGTCAGAACGTGTGTCATGTACATTTGTATCAAAAATAAATAAGTGACCATGTGCCACTT" "10358" "1" "0.088712" "-1.937783" "-4.22" "-0.17387981" "" "ATGGATGGACTCCAAGCAAACTTAGTGACTCCAATCAAGCACGGCTGCCCCACAGGGCTG" "56934" "1" "0.088717" "-1.9377519" "-4.22" "-0.27841845" "17933" "CCAGAAAATAAAGCCCTACTGGAAAATATAAAGCAGGCTGTGAGAGGAATTCAGGTCTGA" "21707" "1" "0.088718" "1.9377378" "-4.22" "1.19584945" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "24248" "1" "0.088756" "-1.9374606" "-4.22" "-0.16577515" "" "TGCTAAAATCAGACTGCCCTCAATTAAAATGGCGGTGCAGGCACAATTGAGCTTCTTTGC" "44025" "1" "0.088758" "-1.9374464" "-4.22" "-0.22743386" "11859" "GTCGGGGAACGGAACAAAATGGTTTTCCTTTTCCTTTATTTTTTCTTTGAAAAACGTGTA" "20573" "1" "0.088763" "1.9374104" "-4.22" "0.20622088" "12235" "AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA" "16339" "1" "0.088773" "-1.9373363" "-4.22" "-0.19659696" "67115" "CAGGGGGTACCATGACAGTACAACAGTGTCGTTAACCCTAACAAATAAATTTCCCACCAA" "23305" "1" "0.088803" "-1.9371226" "-4.22" "-0.28631851" "" "TATCTCGGAAGGCCTGCAGCTCTTCAGTAGACTCACTTTTAGATTTAAACAATCACTGCT" "24120" "1" "0.088803" "1.9371226" "-4.22" "0.92975828" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "36353" "1" "0.088816" "-1.9370233" "-4.22" "-0.16112098" "" "AACGTAACTTAAAGACTTGGGTCTTACCTAGGTTGACTAGAATTAAAGTGACAGCTTAAT" "15900" "1" "0.088827" "1.9369465" "-4.22" "1.8086569" "68487" "TATTTTGTTCAGTGCCTGTATATCAGAAAACCTACGTGGCAATGAGTTCTTCATTCTGTG" "51290" "1" "0.088834" "1.9368969" "-4.22" "0.25392825" "" "CCAGCACATAGAGGGTCAACTATTTTTGAATCCACAATTCCTTGCTCTTATCTCTGAGTT" "28997" "1" "0.088875" "-1.936597" "-4.22" "-0.37854916" "" "TTGCAAAGAAACTAGGAGAGATATGCAGCACATGACAAACAGCCCTATGAGAAGAAGGCT" "46518" "1" "0.08888" "-1.9365586" "-4.22" "-0.22727583" "67030" "GAGAAAACCTTGAATGGAACCTACCTGTGAAGAGATGGAATGCTTAAAAGTTGTTTAAAA" "4352" "1" "0.088897" "1.9364313" "-4.22" "0.23442159" "546272" "CGTGAAGTGATTACAAAGTTAAATAGGAGGTATACCTTCAGAGTCAAAATAGAACTCCTT" "57200" "1" "0.088939" "1.936128" "-4.22" "0.226301" "14261" "GATCTAACTGGCTTTTCAAATGTATGGAGTATAACGTTCCAACTCCTCTAATGTAACAAC" "45851" "1" "0.088981" "1.9358254" "-4.22" "1.58444657" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "57355" "1" "0.088989" "-1.935764" "-4.22" "-0.1723578" "259026" "CTTCATCTACAGCCTGAGTAATAGAGACATAAAAGATGCACTAGAAAAGATAATGTGCAA" "61138" "1" "0.088993" "1.9357351" "-4.22" "0.60618507" "433759" "TGTTAAACTTTTTAGGAGGGGTCTGGGTCTCCTAGGACCCCTTTTCAGGCTTGGGTAATA" "58535" "1" "0.089017" "-1.9355598" "-4.22" "-0.25451963" "" "TGCAGTTGTGAACTTCCTATGTCTCTATTGGGCCTCCAAATGACACCTTCTAAAACATAA" "23760" "1" "0.089018" "1.9355552" "-4.22" "0.24704083" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "19957" "1" "0.089038" "1.935408" "-4.22" "1.66969433" "" "ATAGAGCTTGTGGAGACCAGACCTGCAGGGGATGGAAACTTCCAGAAGTGGGCAGCTCTG" "33584" "1" "0.089056" "-1.9352756" "-4.22" "-0.17677378" "217700" "TGTGCTGATATTGTAGTTCTACACGGTCATGCCTAGTGCTATGCCTTGCCAAGGACAAAA" "24149" "1" "0.089062" "-1.9352295" "-4.22" "-0.44926113" "16010" "GAGAAGAGAAACCTCATTCTTGGAGTGAGAGAGAAAGAAAGTGGTGAACATTGAACGCCC" "24592" "1" "0.089109" "-1.934891" "-4.22" "-0.7905509" "675812" "ACTCAAAAGAGTTTATACAGAGATGTGATGTTGGAGAACTGCAGCAGCCTTGTCTTCTTG" "58904" "1" "0.089165" "-1.9344822" "-4.22" "-0.20787317" "100038948" "GAAACAAACCTAGTTGGCTACCAGTCATTTTTGAATGCTGGAGAGTCCTATCCTTATTCT" "26666" "1" "0.089181" "-1.9343674" "-4.22" "-0.17747096" "67490" "TAATGCCCCTAACTGACTTTTGTTACATAGTATTTTCCCCAAAGTAGGTGAGTGATCACA" "8962" "1" "0.089224" "1.934055" "-4.22" "0.56011938" "54519" "CAATATACCCTAGGGACATGTTAGTATTTGGGATGCTCTCTATTAAAATTCATGTTTTGG" "25044" "1" "0.089231" "-1.9340018" "-4.22" "-0.15620831" "67872" "TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG" "25639" "1" "0.089238" "1.9339505" "-4.22" "0.25509972" "" "TGCAGCCAGCAAGAAGATGATGCTGAGCCAGATTGCCAGCAAGCAGGCTGAAAACGGCGA" "24919" "1" "0.08927" "-1.9337187" "-4.22" "-0.14976111" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "40002" "1" "0.089319" "-1.9333623" "-4.22" "-0.15528732" "53975" "CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG" "38999" "1" "0.089332" "-1.9332718" "-4.22" "-0.23869892" "74264" "TGGATGAGGAAACCCAATTTCAGATCGCCATTGAAGAGTCCTTCCACGTCAACATCTAGA" "20012" "1" "0.08934" "-1.9332159" "-4.22" "-0.16816898" "208768" "CTTCATCAGCGTTTGCTAAGTTGTCAGTTGTATATTAATTCAGTGACTTTATATGTCTGG" "62419" "1" "0.089341" "-1.9332037" "-4.22" "-0.21165905" "321008" "GAGGGAAGGGAACTAAGTGAACAGCTGTACTTTTAGATTGAAATAAACAGCATTATTTTG" "52869" "1" "0.089411" "-1.9326944" "-4.22" "-0.23635762" "23859" "GTATTGTGTGGCTGAGTACAATCCAATTGAACCACAAACCATTGGTTTTGTAGTAATATA" "51424" "1" "0.089433" "-1.9325388" "-4.22" "-0.25202617" "76742" "CTGTTTTGAATATGCGCGAGGAGAGAAGAAGCCTCGATGGGTTAAAATCTTCACACCATA" "60242" "1" "0.089439" "1.9324947" "-4.22" "0.28260551" "" "GGTAGCTGAGCAGGACTTTCCAATGTGACTATAGTATCACATCCTTAGAAATCACATCAC" "1598" "1" "0.089453" "-1.9323964" "-4.22" "-0.25143895" "68310" "GAACCTGAAAGACTGGGGGGAATTGTCGAAAAGTTCATTAGTCAAATGAAAGATACGTGA" "41104" "1" "0.089457" "1.9323632" "-4.22" "0.28924272" "107766" "CTGTCCCCATGTGCCCAGCAGCCTGACACTAAGAAATCTCTCAATAAAGGCATCCTGCTG" "20886" "1" "0.089478" "1.9322104" "-4.22" "1.17985124" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "6726" "1" "0.089483" "-1.9321766" "-4.22" "-0.19882502" "57785" "TGGATGTAAACCTAAGACACCTCCTCTGCAGAAATAAACTTGCTTTATGAAGAACAAAAA" "34745" "1" "0.089504" "-1.9320252" "-4.22" "-0.23432385" "320438" "GCGCTATCATTCTTTCTGTTTTCTTTCCAAGTACATGAAAAGTCCATTCTCTTGGTATCA" "55661" "1" "0.089533" "1.9318103" "-4.22" "0.30877267" "320923" "TCTGTCCCTTTGACCAATGTTTTGTCCCACCTCCACATAACTGGAAGAGCATCTAATCTT" "3145" "1" "0.089539" "-1.9317687" "-4.22" "-0.15619568" "67862" "TGGGTCCTGGGTTACCAGTCTAGTGGTTCTAAGAGGGTAGTGCTCTTGCCTTGTCCCCCT" "52949" "1" "0.08957" "-1.9315456" "-4.22" "-0.17509497" "" "AGTCAGACCTAGTGAAGCTTTACTTGTGACTGTTGGGACTGATTAAGAATATGGGGGCAG" "23800" "1" "0.089585" "1.931435" "-4.22" "0.67557296" "102626" "GCTGGGAAACCTTAGATCTTATCAATTACAATGCTGCTGGGTTTTATATTCTGATATCAA" "46652" "1" "0.089619" "-1.9311923" "-4.22" "-0.20858074" "" "TGAAATGCAGTGTTGAAGGCGTTGGTTTTCTCTGAATGGTGTGACTATTCCGGCCATTTG" "28830" "1" "0.089635" "1.9310762" "-4.22" "0.47259718" "" "TTTCTGCTAATGCTACTTTTGATTCTGAGATGGTGCAAAGAGGCTCCAAGCTTGTCCACG" "24491" "1" "0.089662" "1.9308792" "-4.22" "0.36280439" "56417" "AAGTCCCCACCTCCCTTTTCTCAAGGGAAGAGGCCAAGATTAAAGGAAATGGAAATGCTA" "57294" "1" "0.089683" "1.9307283" "-4.22" "0.35397103" "" "TGAAAATAGCCCGATCAAGGATCCTAAGGTCAAGGTGAAGATTTCCTGTTGCCAGGAAGA" "38751" "1" "0.089722" "-1.9304475" "-4.22" "-0.29262132" "" "ATGTGATGAAATGGTGCTTTGGACAAGACTTTTCCTCCAAGTTGGTCCTATCCAGGGGTT" "32853" "1" "0.089726" "1.9304198" "-4.22" "0.27614985" "56429" "TATAACTTGAGCTTCAGATTCAGCTTCGTGAACTTGGAGAGAAAGAAGGAGCTTGAGAGA" "23119" "1" "0.089767" "-1.9301204" "-4.22" "-0.18090114" "" "AGCTCCCCCAAGCCAATCATCCATGACAACTTTTCGCATTGTGAAAGGGCTTATGACTAT" "39292" "1" "0.089784" "-1.9299978" "-4.22" "-0.29430999" "53970" "CACCACTGTGTGCTCTTTGTAGGCATAATATTAACTACTGGTTCAAGTTACTTAATAACT" "10801" "1" "0.089821" "-1.9297312" "-4.22" "-0.28249681" "108699" "TCCTCCACTGTCTTGCAATTCATTTGTTGAAAAATACCAATACTGATTTGGAATTTTCCC" "29666" "1" "0.08983" "1.9296642" "-4.22" "0.27616823" "171199" "TCCTTCACCTCAACCCTGTCATGGATGTATGTACCCGTTGTACTGACTGTTCAGAAATTG" "26342" "1" "0.089842" "1.9295794" "-4.22" "0.2345079" "" "CCTTCTGATCATCTGCTAGGACAAGGAGACATGCAGGGAAGGCTCAGTGGGGATGCCTGT" "14732" "1" "0.089846" "-1.9295543" "-4.22" "-0.20990923" "" "GGGAAGAAGGTAGGAGCTCTGAACACTTAGGGCAAGCCATTGAACCCTTTGCTAACTCAG" "53351" "1" "0.089874" "1.9293499" "-4.22" "0.22702517" "" "GGCAGGTATATCAGATCTTGATAAACTTATAAGCAACAGCATGTTGGAGTATTTAGTTCT" "276" "1" "0.08989" "-1.9292361" "-4.22" "-0.34095833" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "37739" "1" "0.089892" "1.9292188" "-4.22" "0.33450585" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "10451" "1" "0.089896" "1.9291939" "-4.22" "0.36289424" "630322" "ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT" "14669" "1" "0.089913" "1.9290697" "-4.22" "0.79097793" "" "ATCCAAGACAAGCACCGGTCATCTGGATCTTGCAGATGGCGCATGCGTGGCACTCCAAGT" "11996" "1" "0.089914" "1.929063" "-4.22" "0.48210431" "11796" "ACAGATAATGCCCAGCTAATAGAACAGGGTCTGAAGGAGAACGTGAAGAGACAACTGTCT" "18826" "1" "0.08994" "-1.9288748" "-4.22" "-0.19592731" "" "CAAAGTTTGCAGTAAATCTTGCTTGTGAGTCCAAATTGTAGCAATCTCTCAAAACCTAAA" "16054" "1" "0.089976" "-1.9286154" "-4.23" "-0.19735114" "75712" "AGTACACAGCAGGCCTGTCCATCAGCGTGACTGTCCCTCTGTCTTCCTCTTCCTGTGACT" "38423" "1" "0.089983" "1.9285634" "-4.23" "0.99668391" "13058" "TTTCCTTGTCTTTATTTTTCTTGCAGACAATAGATCCAGACTGCAGACTGGCCCCTCTCC" "27799" "1" "0.090041" "-1.928142" "-4.23" "-0.26590044" "" "TGTGGGTGAGAGACAATCGTGTACTAACACAGTCTGATGTCCTTTGTTTACTAGTGCGTG" "57333" "1" "0.090058" "1.9280216" "-4.23" "0.2133547" "70866" "AGGTCAATATATTGATGCTGTTTCTGGAACATGTAATACCAGATGCCTTACATTGCCTTT" "33248" "1" "0.090107" "-1.9276736" "-4.23" "-0.22169085" "" "GGCCTGTATCTTCATGTTGTCAATTGCTGGCATTCATGATAAAATAGCTCCACGAATGAA" "22034" "1" "0.090111" "-1.9276397" "-4.23" "-0.23866747" "" "TTTATGGGAACCTTAGTATCCAGGATAGTTTGGTACTTGAAATTCCCCAGCCTCGGGTCT" "24061" "1" "0.090138" "-1.9274471" "-4.23" "-0.17151751" "" "TTCCAAGAAACACCATGCACAGCCCAAGTTGTAACAGGTTGGGATGGGGCTGGGTGCAGG" "28168" "1" "0.090223" "1.926839" "-4.23" "0.52336451" "21803" "ACTGCCCATCGTCTACTACGTGGGTCGCAAGCCCAAGGTGGAGCAGTTGTCCAACATGAT" "51092" "1" "0.090225" "1.9268188" "-4.23" "1.62566573" "" "TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT" "45626" "1" "0.090237" "1.9267333" "-4.23" "0.8810562" "16408" "TGGGGAAGAGACCAAAGATATGGGCTGTCTAGAGCCCCTCCGGGAGAGTGACAAGGACTA" "29968" "1" "0.090258" "-1.9265857" "-4.23" "-0.24102157" "" "" "48388" "1" "0.090268" "-1.926513" "-4.23" "-0.17382405" "23945" "TATGATGAGCTGGCTCATATGTTGAAGGGGCTGGACATGCTGGTATTTGCCCATGACCAT" "61104" "1" "0.090292" "-1.926342" "-4.23" "-0.26538249" "77015" "TGGAATGTGAGGGACGGTCTACAAACTGCCATTTTTCTAATTATAAACTCACATTCTCTG" "3961" "1" "0.090301" "-1.9262733" "-4.23" "-0.15906865" "71834" "TGAGCAGAATACAACTGAGGCTAACTAAAAATAGGGTCTGGCCCTTGAGTGGCATGCATA" "42528" "1" "0.090303" "1.9262641" "-4.23" "0.16178286" "" "GGTTTGCAGTATTTGTTAGCAGTGTTCAGACTTCATATACCATCAGAGTACCATCTTACA" "29955" "1" "0.090306" "-1.926236" "-4.23" "-0.16962757" "242406" "AACAGGTGCCTGTAGACACCTTCAGCTGGGACCTCCCCATCAAAGTGCTTCCTACAAGCC" "48247" "1" "0.090324" "1.9261088" "-4.23" "0.22259721" "14238" "TTTTATGATCTTCGTATACTCACACTTCGCTTGTATTGTAAAAGGAGGGTATATTTGCAC" "40853" "1" "0.090325" "-1.9261058" "-4.23" "-0.17352821" "239096" "TGATGGTACTGGAGGAGGAGGACGTCCGCGAGAACATCATCACCTATGATGACGAGGGTG" "11890" "1" "0.090325" "1.9261047" "-4.23" "0.54182713" "257996" "AGGAATAAGGATGTCCATCTTGCACTGAGAAAAACATTGATGAAACTGAGGTTTTCCTAA" "39012" "1" "0.090342" "1.9259791" "-4.23" "0.86222119" "108995" "CCAGCCCCAGGCATGTATCCTCTATTGCTGTGCTATGTGACAATGCTGTTTCCAGCAAGG" "26007" "1" "0.090349" "-1.9259335" "-4.23" "-0.34460226" "" "CCAGGAATCTTTAAAACCTGAGAGCGTGGATGGTGAGAGGCCGTTAGAATCCCTCCGTAG" "12361" "1" "0.090372" "-1.9257682" "-4.23" "-0.15307615" "17252" "AAATCTGGCAGTCTGAAGCTTTGGCTTCTGAGACACTTTTCTATGTCCAGACCACTGAAG" "23316" "1" "0.09039" "1.9256383" "-4.23" "0.34243507" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "42087" "1" "0.090392" "1.925619" "-4.23" "0.34546691" "207781" "CTTGGTTGTTTTTCCCAATAATCTTGTCTTTGAAAGGAACAAAACAATCTGTGTGTATGG" "50071" "1" "0.090394" "1.925606" "-4.23" "0.27566388" "" "CTTCCCAAGGGTAAGCATTGAAATCTAAAGGGGATACTCATGAAGGAAAAGACAAAAAAC" "5634" "1" "0.090407" "1.9255115" "-4.23" "0.98915713" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "54120" "1" "0.090422" "1.9254092" "-4.23" "0.85098173" "20708" "CCTTCATCCTCTCTGCAGCAATACTGGGATCTCAATTTTTTGGTTACTTAGTAATTTATT" "36137" "1" "0.090432" "1.9253381" "-4.23" "0.4481076" "" "TCTTTAACTGTAGAATCTGTTTAGGGACTCTCCGCAGTGCTGTCATTTATAGTGTGATAC" "61553" "1" "0.090439" "1.9252825" "-4.23" "1.59136973" "243262" "CCTGTCCACCTGTTGGGAGGTTCTGTCCAATGTCTGATGCACAATAATAAATCACAGAGA" "43668" "1" "0.090441" "1.9252709" "-4.23" "0.59102406" "70450" "CACCTGCCACCTAGAAATGTTCTCAGAGAAAATAAAAATAAAACATTATCCACTGCCCTC" "4232" "1" "0.090489" "-1.9249262" "-4.23" "-0.21863135" "67145" "CCCTCGGGCTCCTTTGTTTTGTTTTGTTTTGTTAATATGTTGGAGTTAATTGAACTGATT" "23720" "1" "0.090492" "1.9249055" "-4.23" "0.25869279" "19951" "CGCAGCGAAGAAAATGAGTAGATGGCTTGTGTGCATGTTTTATGTTTAAATAAAATCACA" "58822" "1" "0.090529" "1.9246406" "-4.23" "0.47915093" "" "TTTGTTCTATGTGCTGTCCTCAAAAATGCCAGCACTGCAGGCCGCTCTTAGAAATGGATA" "7435" "1" "0.090539" "1.9245653" "-4.23" "0.19552399" "107527" "TTCACAGAGCAGTCACAGTGTGCCAAGACCAAGTTCTGGAAGAAAGTGAGATACCATATG" "29059" "1" "0.090556" "1.9244479" "-4.23" "0.4100747" "331195" "GGGACAGATTAACTAGATCCTTTGTCATGGACTTGTAAACTTTTTGTTCTTCACTGTAAT" "47170" "1" "0.090577" "-1.9242994" "-4.23" "-0.25083558" "" "TTTCAGACGCCCCATGCTTCTTCTCATTGTTTATTCTGGAATAATATTTCCCTATGCTCA" "41076" "1" "0.09059" "1.9242052" "-4.23" "0.38964632" "" "CATTAGAAAAATCTATTGGTCAACTTGGGTTGACAGTGTTGAAGGGGACTCAGGTATCCA" "32929" "1" "0.090637" "-1.923864" "-4.23" "-0.35581972" "16498" "TTCACTGGATACTGTCCGACAACGGATGCCAGGGGATGGCATCAGTTAGGGGGACATCCA" "7489" "1" "0.090648" "-1.9237896" "-4.23" "-0.19178803" "270163" "GTAGTTTCCATAAGTTATAATGTCAGAAGCATCATGTACTAGCAATTGTGGGACTAGAAC" "25857" "1" "0.090649" "-1.9237782" "-4.23" "-0.20320658" "12283" "CTCCTGAGGAAAAGTGAATTTCTTATCAGAATATCTGGCTGGCCCTGTAATTTAAATTAA" "20829" "1" "0.090683" "-1.9235402" "-4.23" "-0.23919768" "241520" "TTTGGAATGCCGAAAATGAATAGACTGTGGAGACAAAGGGAAATGGATATTCTGTATAAT" "1725" "1" "0.090711" "1.9233394" "-4.23" "0.43355333" "170829" "AGAAGCCTTGGCATCAAAGGGGGAGTTCCTCTCTACCTTCTAGTCTTTCTCTTCTTTCAT" "37094" "1" "0.090715" "1.9233055" "-4.23" "0.3375588" "382864" "TTCCGGGGCTTCTGGGTGGGCAAACAAGGAATAAAGGTGATTCTTGGCTGTGGCCCACTC" "53636" "1" "0.090716" "1.9233005" "-4.23" "0.37419203" "73910" "CTTTCAGAGTAAGTCTTCAGGGTATGACAATCATTTATGTGAACAAGCTTTTGTCGGTGT" "12930" "1" "0.090728" "1.9232146" "-4.23" "0.2531069" "" "CAGAACTTTGCCTTGAGCATCAAGGTTTTAGCTTTAAAGGTTTAGATGAAATTGGTATGA" "10339" "1" "0.090753" "-1.9230335" "-4.23" "-0.18529386" "276920" "CCTGGAGAAGGTGGTGGAGAACTCTGAGTTTGAAGAGATCCACGAGGTGATTGCCCGCTA" "18921" "1" "0.090773" "-1.9228934" "-4.23" "-0.22029751" "" "CTCTTCTCAACCCTCAGAGTATAAGTTGTCTGATACTCTAAATAAAGCTGGCTAATGCAG" "3339" "1" "0.090783" "-1.9228193" "-4.23" "-0.2000654" "67433" "TAATTCCACCTTCAGATAAAGCTCTTGTCCGTAGCTATTTACCATGTCTTTCTGCTGTAT" "44159" "1" "0.090802" "-1.922685" "-4.23" "-0.2213323" "" "AACTTCAACTCATGACCATAGGCTAGTATTTCTATATTTCTATTTAAGAAGATTGCAGTC" "20650" "1" "0.090814" "-1.9225979" "-4.23" "-0.28715539" "" "AATCAAAGGATCCTTCTGTGGGCCAGTTGGTAAAGTGGGCCTTTCAGACATGCAGAATAT" "2151" "1" "0.090817" "-1.9225797" "-4.23" "-0.21291326" "" "TCCACTACACCTCCCGTGCACTCCATAACCTTCTAGGATGTAAACCTGACAGGCTTTGTC" "6798" "1" "0.090824" "-1.9225306" "-4.23" "-0.24479894" "15182" "TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC" "58016" "1" "0.090864" "-1.922243" "-4.23" "-0.18602835" "69934" "AACACTCCTCTTTATCCAAAACCTGAGCTCGTAGGTTTTTAAGATTGTGGGAATTCTGTT" "19331" "1" "0.090871" "1.9221952" "-4.23" "1.03416612" "12870" "TCTGATGTCTTTGACCTTTTCCCTGGAACATACCAAACCCTAGAAATGTTTCCCCAAACA" "60482" "1" "0.090949" "1.9216348" "-4.23" "0.3979042" "107526" "GACTAGACCTTATTTCTATTTTCTGCATTTCCCTTGATAACCCTGCCCTATAGTGCTCAC" "12772" "1" "0.090987" "-1.9213672" "-4.23" "-0.2028744" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "44813" "1" "0.090998" "1.9212915" "-4.23" "0.19127334" "" "TTCAAGTAGTTCAAACAACGCATCCTCTGACTACCTTACAGGATAAGACTGGAGCCCAGA" "58361" "1" "0.091016" "-1.9211598" "-4.23" "-0.2167096" "277854" "CCATTAGGGTCCTTTTCCTTCACCAGCAGTGGGATATTCGGAACAGAACCTCCTGCTTTC" "29370" "1" "0.091017" "1.9211529" "-4.23" "0.56301835" "98878" "CGGGAGGTCTTGACTTTCCTCCTAGTTGTCTTCTGCTTTCTCTGCACAGTTGTCATATAT" "24448" "1" "0.091083" "-1.9206839" "-4.23" "-0.1623548" "101148" "ACTTGGTTAGCAGGAACTATCCAGGGATGTTGTATATTCCTCAAGATTTCAACAGTGTAG" "15300" "1" "0.091093" "1.9206114" "-4.23" "0.99640037" "15000" "TAATTTCAAATATCCTCAACGAACAGGAGAGCCTTATTCATCGCTTGCAAAACGGGCTTC" "21544" "1" "0.091153" "1.9201818" "-4.23" "1.47158374" "67775" "CTTTCCTGGACATGCTCTGAAAATAGCCTAAACCATGGCCCACACATAATGGACCCAATA" "60792" "1" "0.091169" "-1.9200709" "-4.23" "-0.14626211" "" "TAAGAGATCAGACTGACCTTGGTTAAGTGCAGAGAGGAGGCGGACACTTCACATACCATT" "30479" "1" "0.091196" "-1.9198774" "-4.23" "-0.18550214" "246196" "CCTGTGTACACTGTCTGACAGTGAAAGTGACCTAACAGCTCAAGAGCAAACGGAAAATGT" "55077" "1" "0.091201" "-1.9198431" "-4.23" "-0.21382725" "" "TACGGAAGGTGTGGCCACTGCTCACACCATGCTCACATCCAGGGGCCCAAGAGACACCAG" "38645" "1" "0.091208" "1.9197953" "-4.23" "0.30445093" "" "TTCTTTACAGCCAGTTGCACAGTCAAACATTTTATATGAAAATTCTGTATGGTTAGTGGC" "23798" "1" "0.091212" "1.9197672" "-4.23" "1.07989296" "16985" "TCTTGGGTCCTGCCCTGTTTACGGATCCCTCATTTTGTGTAATAAAGTGCATTGAGTGTC" "487" "1" "0.091222" "1.9196899" "-4.23" "0.20299137" "" "ATGCTGAGCAAAAATTGCCCAAATATAGTACGTACCTTTAAGACTTTAACTTCCCTTTAG" "60867" "1" "0.091264" "-1.9193924" "-4.23" "-0.35696199" "76406" "AAATACAGTCACATAGAGCCCCCACTGGGCAGACAACGTTTCTTCTCTACTCAGAATCAA" "54431" "1" "0.091306" "-1.9190985" "-4.23" "-0.29153563" "76022" "TTTGATGACCTCACCCAAGATGAAGAAGATGAACTGTCATCAGCTTCTGAGGAGTCTGTG" "51855" "1" "0.091359" "-1.9187187" "-4.23" "-0.17682231" "276952" "TACATCCTGGTCTATGACATCTGCTGCTTTGACAGCTTTGAGTACGTCAAGACTATCCGT" "57954" "1" "0.091367" "-1.9186659" "-4.23" "-0.19457662" "" "TCGATCCTTTGGGCTTCGTTCCTCTTATGAATCGCTAGAGCCATCCATACCTCTGTCTCT" "35355" "1" "0.091382" "1.9185529" "-4.23" "0.53894929" "259119" "CATCGCTTTGGTGAGCACCTTCCCCGCATTGTACATCTTCTGATGTCATATGTGTATCTA" "21733" "1" "0.091393" "1.9184758" "-4.23" "0.36221532" "29875" "TTTTCATTGGGTTAATCTGTATATCTGAATTCTTGAAGCTTTTCTCTAGCCTACAGTAGG" "33040" "1" "0.091425" "1.918249" "-4.23" "0.23362775" "101202" "TTTATCACCCAGACTGGGAGGAAGAAGAGAACGAAGCTCCCTAGTTACTTGCTACTGAAA" "27437" "1" "0.091428" "1.9182263" "-4.23" "0.2761409" "14390" "TGAAGACTCTTATTGGATACAGTGCAGCAGAACTGAACCGTCTGGTCATAGAGTGTGAAC" "42474" "1" "0.09144" "-1.9181409" "-4.23" "-0.17266539" "77605" "ATTATGGAAGTTCTGACAAATGCACAGAAATAAAGAAACTAGCACTAGTGTGACAAAGCC" "14484" "1" "0.091466" "-1.9179612" "-4.23" "-0.19796091" "109910" "AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC" "18313" "1" "0.091466" "1.9179589" "-4.23" "0.38635047" "" "" "45597" "1" "0.091467" "-1.9179527" "-4.23" "-0.1965551" "" "TTCCTCCACAGGGCTGGGGACAATTTCTGAGGTTCCTGACTCTAGCTTTGGCTATTCAGT" "57427" "1" "0.091499" "1.9177276" "-4.23" "1.86307178" "58203" "CAAGCTGGTCTTGAACCCACAGAGATCTTCTTGCTTCTGCCTATTAAATTCTGGGATTAA" "20341" "1" "0.091513" "-1.9176242" "-4.23" "-0.17547125" "56284" "AGCCATGGATTGAGTTTGATATGATGAGAGAATATGACACTTCAAAAATTGAAGCTGCAT" "50346" "1" "0.091546" "1.9173899" "-4.23" "0.24448839" "" "" "53673" "1" "0.091549" "-1.9173722" "-4.23" "-0.17386179" "74670" "TGACCACTAACTCCTTGCCCATACTCCTATGTGTAACTCCAATAAATCTCATTGATTCAA" "9938" "1" "0.091563" "-1.9172722" "-4.23" "-0.22941907" "" "AGCAGCAGGGTTCATAAAAACCAGAGCCAATGTGAGTCTGCCAGCTTGGGGCTCGGGATC" "38842" "1" "0.091576" "-1.9171815" "-4.23" "-0.15043505" "11532" "GAATTCATCCACATGGGTTTAGAATAGCCGAAATCAGAATATTCTTTCTTTCTCAGCAAA" "27388" "1" "0.09159" "1.9170842" "-4.23" "0.89863217" "93969" "ATGACATGACAGAGCAGAGGACATCTTCCTTCCTTGTGGAAAATGGACAGATCTTCTCTG" "27550" "1" "0.091607" "-1.9169632" "-4.23" "-0.19227917" "" "TGGCCTGCTGGGCTGGGCACTGCAGATGAAGGGTGATCAGCTGGGATGGTTGTTGTAGGT" "23439" "1" "0.091626" "-1.9168233" "-4.23" "-0.37309534" "12371" "CCAGGGGAATCTTCATTTCTTACGTGATACACTCTTGTGTTCCTTTTATAAGCAATATTT" "55857" "1" "0.091661" "1.9165797" "-4.23" "0.21903622" "257915" "GGCTTTATTAACTCTTCCATCATCACCAAGAAAACGTTTACCTTTGATTTCTGTAATGAC" "5058" "1" "0.091664" "-1.9165589" "-4.23" "-0.18940367" "258493" "ATATGAGCATATGATTGTCATGAGTGTCCTTGTCCTTGTGTTGCTCCCCTTTCTGGCCAT" "24827" "1" "0.091669" "1.9165213" "-4.23" "0.46424552" "" "" "18776" "1" "0.091683" "-1.9164254" "-4.23" "-0.18258085" "14617" "GGCAAGAGTAGCATTGAGATAATATGTTTTTATGGAAGCCCTCTATTTCATTTGAATCCT" "57406" "1" "0.09169" "-1.9163757" "-4.23" "-0.14224138" "66592" "AGAGATGTCCAGGCTACAGACACGAGTATTGAAAAACTGGGTAGAGACAAGCTCAGTTAG" "10774" "1" "0.091691" "-1.9163657" "-4.23" "-0.20304181" "67057" "CCTCTTAATGCACCTGCTGGTACTTGGTGTGATTAAATAGGAAGTTGTTATTAAATAAAG" "51219" "1" "0.091693" "1.9163544" "-4.23" "1.60875141" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "55747" "1" "0.091701" "-1.9162941" "-4.23" "-0.28634952" "381229" "ACACATGACTGGGATTTCAAAAAGTGTATATTGAGAGTGATTTCCACGTGGGACATCGTT" "62054" "1" "0.091707" "1.9162496" "-4.23" "0.95075158" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "42404" "1" "0.091727" "-1.9161102" "-4.23" "-0.26633307" "" "CTACGGGTTCAGTGGTTATACACCAAGGATTTAAAGTAAGAGATATGTATATTCGTTGGT" "57464" "1" "0.091727" "-1.9161098" "-4.23" "-0.30782026" "" "TCAAAGCTGGATTCCAAGCAATCAGACCCAGTCACATTTTTCTCCCAATACTTAGTATGG" "27671" "1" "0.091746" "-1.915975" "-4.23" "-0.1709188" "" "ATAACTAAATGAGTTGGATTTTTGTGCCAACTGGCTCCCAGTGAGCACCTCTGAGAGATG" "48710" "1" "0.091765" "-1.9158404" "-4.23" "-0.21018655" "" "TGGTCTTCTTATTATTTAAATAAGCGGGGTAGATACAAATGAACCTGTCCTGGTAGGCCA" "54979" "1" "0.091783" "-1.9157181" "-4.23" "-0.37350055" "77805" "CCCTTTCAGGGAGTTTCTTTGGTTTGGGACTGAAATAAGATTAAAACACAGGCTTCTTAA" "40891" "1" "0.091796" "1.9156259" "-4.23" "0.6089134" "20612" "TTTTCTCCATTCCCCAAGTGTTGCCTTTGATTATGAAGCTCAGGTAACTGCAGTGCCCAT" "45478" "1" "0.091801" "1.9155841" "-4.23" "0.36379865" "29810" "TGAGGGGTAGGAAGAGAGTTACAGGAATAGAGAACCTGTTTTTGAGACATGTTGTCATTT" "43145" "1" "0.091804" "1.9155636" "-4.23" "1.41539961" "58203" "ACAGATGTGACATGAAAGTACATGTAACACCAACCAGGGGATGAGGATGGTGCATGGGGA" "39985" "1" "0.09187" "-1.915101" "-4.23" "-0.17385105" "" "AATGAAGAAGTTGATGCTACTTTGTCCAGTGCTAACTTGCAGCGGTCCTGGCATCTTCAT" "19034" "1" "0.09188" "-1.9150303" "-4.23" "-0.18723465" "16979" "CTTGCTACTTTGTTGAATGATGTTAGTTGACTGTACTGTAATGTTGTATCAACTGAACTG" "45887" "1" "0.091937" "-1.9146239" "-4.23" "-0.32941661" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "21741" "1" "0.091955" "-1.9145011" "-4.23" "-0.18580155" "17877" "TTGTATATGCCTTAAAATAACTTGATAAATAAATGTACTATTATTATCAATAAAATATTT" "62533" "1" "0.091964" "1.9144379" "-4.23" "0.8780215" "74487" "GGATTTTAGAATGTTTTAGTTAAAATTTTATTATATATACATATATAAAATATCCTTTGA" "62050" "1" "0.09198" "1.9143202" "-4.23" "0.23440113" "666168" "TGATACTATCTACAAACTTTCTTCCAATGGCCGCTTGTCCAACCAAGCTTGTCAACTTGC" "35884" "1" "0.091994" "-1.9142227" "-4.23" "-0.26681145" "70487" "CTGTTCACCATGCTCCAAATGATGGTTAAAGAACCGAGACAATAAATATAAATGAAACAG" "19661" "1" "0.092004" "1.914156" "-4.23" "0.33424177" "434215" "CCCTGGGACCCGCTCTTTGTATAACTCACATGAATGTATTAAAGTATAATTTTGGAGAAA" "26453" "1" "0.092011" "-1.914105" "-4.23" "-0.19741858" "" "" "2280" "1" "0.092021" "1.9140306" "-4.23" "0.69912969" "244179" "ACCAGAAGCCTCAAGTTGATAAGGATACTACCATCACTCTAGGTATCTCTGACCAGTGGT" "42201" "1" "0.092024" "-1.9140154" "-4.23" "-0.35815291" "56526" "AGACACCAACATTCTGCTGTCTCGTCTCTTGAGAGAGCCTCTTTGCATGTTTTCCAGAAT" "55208" "1" "0.092031" "-1.9139626" "-4.23" "-0.18743973" "18426" "AGCACCCGTCCAACTAGTAAAGTGAGAGAACTAATACTTTCTGTATTTCTGGGGTTTTGT" "2645" "1" "0.092045" "1.9138637" "-4.23" "0.54469329" "58205" "ATCCTGGCAGCCTCTGAAGTTCTAATTAACTGGAAGCATTTAAGCAACACGTCAAGTGCC" "28845" "1" "0.092059" "-1.913763" "-4.23" "-0.16533018" "" "CGTTAAAATACCTCGTGGTGAGTCTTAGGATTTCTATTGCGGCAACTAAACACCATGCCC" "24820" "1" "0.092084" "-1.9135905" "-4.23" "-0.1737713" "70572" "CAGAGCAGTAACTGATGAGCTGTTGTTTCCTTTAAGTAATTTTCTAAGGGATCTTAATAG" "43633" "1" "0.092126" "-1.913292" "-4.23" "-0.15702108" "" "TAAAAATCTGTGCCACTGACAAACATGAAAGAGGGGGACAGACAGATGGGTCGACAGTTT" "57986" "1" "0.092154" "-1.9130945" "-4.23" "-0.215469" "107971" "GTTGATTTTATTTATCAGTTTATTTTTCTATTTATTGTTTTAAATGTAACTTAACATATT" "35796" "1" "0.092166" "-1.9130107" "-4.23" "-0.15420681" "13731" "GCTGCGTTATCCAAGAAGCAAGTATTAGGACCAAAACCTGTTACTGTATTTAAAGGAACT" "27860" "1" "0.092174" "-1.9129531" "-4.23" "-0.21179973" "56380" "ACAAGCAACATTGGGAGCATCAATATGTCTGTGGATATTGATGGTACCACCTATACAGGT" "41421" "1" "0.092186" "1.9128698" "-4.23" "1.04126303" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "33815" "1" "0.092195" "1.9128069" "-4.23" "0.71005331" "" "GCTCAGAAAATATTTGTGGGTCTGTGACTGGGTGAGTCAGGCAGGCCTCACAGGAGCCGT" "38620" "1" "0.092196" "-1.9128003" "-4.23" "-0.34810057" "52897" "CTTTTGAAACTAGCTCAGATGCTGAGCCGAGCCCGGGAGAAGCTGAATGGGACGATCGTA" "14747" "1" "0.092208" "1.9127169" "-4.23" "1.05161983" "100039796" "TTACATTCTCACTGGCAGCCCTGATTGTCACATTGCCAAGTGGTATTTTGGAAACAGGGA" "55776" "1" "0.092212" "-1.91269" "-4.23" "-0.16821606" "68295" "TGAGTCTCTTACAGCTAATCTGCCCAGTTTCCAAAGTAGCCAAGCTGTGTGCATAGACAA" "53628" "1" "0.092217" "1.9126497" "-4.23" "0.28251495" "" "AAGAAGAAGAAGAAGAAGAAGCAGAAGAAGAAGAAGAAGTTGGTTCTAGTGCAGTTTTTT" "22126" "1" "0.09223" "-1.9125632" "-4.23" "-0.21712288" "93886" "GGGATAACCAGTGAATTTAAGTTTCTAAGTCCAATTGCCTCTAACTTCCTAACCGAAAGC" "52523" "1" "0.092231" "-1.9125575" "-4.23" "-0.19479697" "59028" "CGGCCTCTTAACATTACAGACTTTCTTTTCCACTGAAAATACTGATTTGCAAATACAAGC" "12559" "1" "0.09225" "1.912424" "-4.23" "0.42911268" "" "AATTTGGTTATGATGCCTTGGGAAGTGCTCGTTTGAGGTGGAACATTTCTGTACGTGCCT" "30889" "1" "0.092277" "1.9122282" "-4.23" "1.75158766" "" "AGAAACACAGGTGGACAAGGAGGGGACTATGCTCCAGCTCCAGGCACAGAAGAGCTCTGA" "59777" "1" "0.092305" "1.9120372" "-4.23" "0.16277018" "" "ACTGTGTCTCCAAAGCCTTTAGCCTTAAACTTGCACGAGTGTGGACATGGACACATATCT" "32627" "1" "0.092319" "-1.911938" "-4.23" "-0.25887379" "665374" "TTATTTCCATTACAACAGATTGTTTAAAGAGATGTTATTTAGTTTATGATTTTTTCCTAC" "2397" "1" "0.092323" "-1.9119059" "-4.23" "-0.1602663" "319953" "TTTCCTGAGCAGGCCTTGTAAATAAAGACTCAATGCAAGGTGGAGGAGTCCACATCACTG" "38626" "1" "0.09237" "-1.9115804" "-4.23" "-0.22544035" "76273" "CAATCATTTTTCTTTAAATGTTTAATTTGTTAAGTGTAGAAAATAAAATCTTGTTCTGTT" "15284" "1" "0.092382" "-1.9114943" "-4.23" "-0.17491679" "" "AGAGGCCCCAAACTGACCCTTGGCACGTGAGGCCAGGAATGCCTGTCCATTCCAATTAAG" "42107" "1" "0.092388" "-1.911454" "-4.23" "-0.19006605" "" "TTCCTGTGGACAGACTAGTGTAAGAGGCTGAGTAGACAGACTTTAGGAATGTTTAATTCA" "30911" "1" "0.092398" "-1.9113808" "-4.23" "-0.15519491" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "49004" "1" "0.092404" "1.9113368" "-4.23" "0.62359602" "" "TAGGAACAACTTGATGAGCTTCACAAACTCAGCGGCTTGAAATTCCTGAGAGAGTTTAGT" "32038" "1" "0.092423" "1.9112022" "-4.23" "0.22452687" "545951" "TGACAGTGTGCTTTTAGAGCTAACATCTTGCTACATTTGAGAAGGTGTCTTTTGTTTGCT" "57119" "1" "0.092464" "1.9109137" "-4.23" "0.21205397" "16801" "CCTGGGACCAGGAGGCCCAGATATATGAGCTGGTGGCACAGACATCTTCGGAACGCAAAA" "15434" "1" "0.092473" "1.9108535" "-4.23" "0.33892222" "269955" "CTGGGATTAAAGGTGCATGATTTCAGAATAAGACAAAGCTTACAAGGCATGTATGAAAGA" "36820" "1" "0.092482" "-1.9107939" "-4.23" "-0.63811756" "212712" "ACAGGGAGAAGACACGTTGCAATACAAGCTAATTCTAGCTGCTTAGTAACCTCTGGAGTT" "21399" "1" "0.092508" "1.9106048" "-4.23" "0.78440245" "14663" "GAAGAACTGGGTAAAATAATTGAAGGATTTGTAACTGGTGCAGAAGACATAATCTCTGGT" "21387" "1" "0.092514" "1.9105639" "-4.23" "0.62607044" "" "CCTGAACCTTGAAGTCATTATTTGAAATTCACATATTTCTTCAACCAAGTAGCTTCTGCT" "43776" "1" "0.092523" "-1.9105026" "-4.23" "-0.4241905" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "6763" "1" "0.092538" "-1.9103952" "-4.23" "-0.26676607" "12411" "GCACCCACTTTCTGTCTCAATGGATCTCCCTGTTCTGGACTCTTCCTATAAATGGAATCA" "29815" "1" "0.092578" "-1.9101139" "-4.23" "-0.22299541" "" "TTAATGGCTATCTGGGTGGGACATACTGCTAATTAGGAAGGAGCGTATCTGTGACAAACA" "5290" "1" "0.092584" "1.9100723" "-4.23" "0.38814514" "16194" "AGGACCAAGTGCAGTAACGGTAGCCCAAACACCAAGTCAAGTGAAAATCGAGGGAAAAAA" "59067" "1" "0.092605" "1.9099258" "-4.23" "0.33386609" "67213" "GAGAAGTGTATTTCTACGTTGCTTATATCTGATCACTTTTGTATTTGTTGATTTAAAGCC" "9506" "1" "0.092609" "-1.9098965" "-4.23" "-0.24281213" "14860" "GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA" "30634" "1" "0.092618" "-1.9098343" "-4.23" "-0.19163454" "" "TAATCTCATTGCTGACCCGGACTCTGTTACCTGGCATCTAATCCCTAATTTAGTCCCTTA" "35249" "1" "0.092629" "-1.9097564" "-4.23" "-0.29113388" "245865" "ATGACGAGACAGAAGTGTTCTTGGGGAAATTCATCTTTGATGTGCAGAAATCTGAAATTC" "35015" "1" "0.092648" "-1.9096241" "-4.23" "-0.17337135" "" "CTTACTCAAGCCAGCCTTGCGTTTGCTCCTTACTAATCACGCACTGGATATTAGGAATAT" "29440" "1" "0.092694" "1.9093018" "-4.23" "0.21089563" "233005" "AGTAGTGTGGGTAGTAGAACATGCCATGGGTCACATGTGGAAACAAAAGAATGATTTTTG" "25644" "1" "0.092696" "1.9092921" "-4.23" "0.78094833" "16641" "ATACTTTTTCCTGTTTCACAGAATGACTTCTGTGCAGAGACTATTTAGAACATGTATAGG" "40142" "1" "0.092702" "-1.9092492" "-4.23" "-0.1638754" "" "TTGGTCTCTTCTCCTCTTAGGCCTTCATGACAAAAGAGGATGCTGTGTGTCTCTTAGACT" "42202" "1" "0.092726" "1.9090763" "-4.23" "0.15705056" "" "" "5976" "1" "0.092738" "1.9089965" "-4.23" "0.64646947" "19188" "AATCTTTTCCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCC" "36825" "1" "0.092744" "1.9089539" "-4.23" "0.20936966" "237759" "GGTGACACAGTGGTAATCGACTATGACGGCAGGATCTTAGATGCCCTAAAGGGTCCCCCT" "9303" "1" "0.092782" "-1.9086877" "-4.23" "-0.19100303" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "22236" "1" "0.092789" "-1.9086394" "-4.23" "-0.17773821" "19656" "TGTGTAAGACTTGACTTGTACTAGTGTTGTAATTTTCCAAGTAAAAGTGTTCCTAAAGGC" "37349" "1" "0.092791" "-1.9086236" "-4.23" "-0.16333454" "66585" "TGAAACTGGGGAGAGAGTGAAAAGGCTAAAGGGGCATACTTCCTTTGTGAACTCCTGTTA" "26157" "1" "0.092809" "-1.9084996" "-4.23" "-0.18313288" "14167" "ATCTCTACAGCTCAGATGTTTTTACCCCAGAATGCAAATTTAAGGAGTCTGTGTTTGAAA" "15149" "1" "0.092835" "-1.9083183" "-4.23" "-0.19730656" "243834" "GTTGAGATACACCTGTATGAACAATAATATTGTTTTTTACCTTAAAACAAAGCAGATGAT" "18195" "1" "0.092917" "-1.9077404" "-4.24" "-0.15781601" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "39970" "1" "0.092937" "1.9076075" "-4.24" "1.45917937" "12047" "CACTTGGCATTTCCATTTACAAACATGAAACTTGTCTTTCCAGAGTTGCAGATATTTTGT" "16513" "1" "0.092947" "-1.9075337" "-4.24" "-0.17938" "15289" "CTTGTTGGTGCACAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGTTTTTTGTTTT" "20984" "1" "0.092949" "-1.9075182" "-4.24" "-0.25218092" "21374" "GCCAAGAGTGAAGAACAATCCAGACTAGCAGCAAGAAAATATGCTAGAGTTGTGCAGAAG" "33136" "1" "0.092969" "-1.9073813" "-4.24" "-0.18029533" "105590" "GTCACACTCAAACTGGTGACACCACAGGAAAAGAAAGATACAAGATGTTGGAATGGCCGT" "6217" "1" "0.092982" "-1.9072902" "-4.24" "-0.20351566" "219181" "ACTGTTCTTTAAAACCAGTTTTATTTCCCTAGTTCAGCTATTGGTACTTGTAGATTTCCC" "32073" "1" "0.092983" "1.9072836" "-4.24" "0.30005561" "20183" "AGGTCTTTCCGGCAGTTCTTGGGAAGAGTGGCCAAGCCTCTGTACATATAATTGGTTTAA" "56942" "1" "0.093018" "-1.9070394" "-4.24" "-0.18127367" "" "TACTCAACAAAGGAACTCTTCGTCCTCCTTGACCACTGAAGGTGTAGTATGACCAGAACA" "62442" "1" "0.093058" "1.9067583" "-4.24" "0.34410452" "71413" "ATGTAGAAGAATTGTCATTCTCAGTCCTGAGATTGTCCGGGTGGACCTAGGTCATTGTCT" "29609" "1" "0.093062" "1.9067305" "-4.24" "1.60009952" "" "TAGGGGACATCTGCATTCTGTCACCTCCATGCTGCCCTGAGCTGCAGCTCCTCACTTCTA" "11587" "1" "0.0931" "1.9064653" "-4.24" "0.32435965" "234577" "CCACCCTCCTGCCACTCTAAGTATTGAATGTACTTTGTATAATTTTAGTGGAATTATTGT" "41171" "1" "0.093155" "-1.9060801" "-4.24" "-0.21568693" "94041" "AGTACATACCCACTGTCTTCAGTGTTCTGAACACCTGGTGGTTCCAATAAAACGATCACC" "45306" "1" "0.093167" "1.9059989" "-4.24" "0.18762256" "" "CATACTCTGGAAATAAACTGTGGAGAAGGTCAGTTATAAATCTCTATCTATTACTACCCC" "61097" "1" "0.093174" "1.9059507" "-4.24" "0.40995991" "19672" "TAGTGGATTTATTATTTGTTGAGTCCTGAATCTCTGAGCCTGCTTCTAGCACAGCTTATG" "50721" "1" "0.093179" "-1.9059132" "-4.24" "-0.15809579" "100336" "CAGGACAGGCTAATGGGTTTGTACAGTATTGTTGGACTTTACCTATGTTTCTTGTCCACA" "24247" "1" "0.093195" "-1.9058017" "-4.24" "-0.25467872" "72535" "AAATCTGATTTCAGCCTGAGTTCCCAGTGAAGTGTTACAAGAAGTGTCAACCAATAAAGT" "17308" "1" "0.093196" "-1.905795" "-4.24" "-0.20960448" "" "CCCTGTAATGCATCTCCGACCCTTTCTAATTTTTATACAATACTTAGAATTATACACCTG" "42405" "1" "0.093216" "-1.9056578" "-4.24" "-0.19278868" "63828" "GCCCCAGGGTGTGACCAAGTTTGGCTTTCACACAGTGACATGCTGTGGCTTTATCCCACA" "55004" "1" "0.093229" "-1.9055648" "-4.24" "-0.2777221" "268903" "ACAGTTGCAAGTCTGGACAAATGTATAAAATAAACCTTTTATTTAAGTCTGCGTACCTGC" "28294" "1" "0.09326" "1.9053534" "-4.24" "0.22599736" "23961" "CAGAAGGAGAATATTATGGTTTGTATATGGTTGGCCCAGGGAATGGCACTGTTAGGAGGT" "5555" "1" "0.093266" "1.9053121" "-4.24" "0.45775627" "545056" "AAAGAGAAAGCAAAAACCAAAATGTGATCTGGAGGAGGGAGACTGGTGGTTCTCAACTCC" "26045" "1" "0.093284" "-1.9051836" "-4.24" "-0.16362424" "" "GCTGGGATTACTGGCTTGTGCCCCCATCTTGACCTCCATTTGCTATTCAGTATCAATTAA" "11699" "1" "0.09331" "-1.905002" "-4.24" "-0.19616668" "21854" "TGGGACATCAGCGGCCAAGCGGGCCATAAAGAGACATTTAGCACATTTTTCTATTTAAAA" "27485" "1" "0.093322" "1.9049186" "-4.24" "0.37632106" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "50183" "1" "0.093328" "-1.9048753" "-4.24" "-0.16670764" "" "CTCTGTGTAATACACAGGATGGAAAGTGACCAGGGTGAGGACACAGATATTAAAGGGTCA" "48773" "1" "0.093334" "-1.9048366" "-4.24" "-0.3298756" "230777" "ATTCGTTCAGCATGGAGGCCAGCAGCCCGGAGCAGCTGTAATTAAAAGCCTGGCACTGAA" "38477" "1" "0.09336" "-1.9046565" "-4.24" "-0.19415638" "" "AATGAACACAGCCTAGTGATCAATACACTGAAGGAAGTGGATGAGATCCGCAAGAGCTAC" "15087" "1" "0.093383" "-1.9044985" "-4.24" "-0.38554769" "78806" "GAATCAGTTACTAAGTTGGACGGTGTCCCTGAGAGATCATGGCTTGTGGGAGATCTGACC" "54160" "1" "0.093394" "1.9044193" "-4.24" "0.35782898" "110095" "CTTCCCTGATTCTGTTTTTGTCATTGAATAGTTAAGTGTCTCCGGGGATGGGAAGGGAAA" "4349" "1" "0.093425" "-1.9042062" "-4.24" "-0.26888364" "" "CCACAGTGTGTCATAGAGAGATGTCTTAAGATGTGTAGGTCACTTTTTTCTGAGTTTACA" "16984" "1" "0.093425" "1.9042021" "-4.24" "0.83939498" "19264" "GAGGAACCAGAACATGCTGCCAATGGTTCTGCGAGCCCAGCTCCAACCCAGAGTTCATAG" "48596" "1" "0.09343" "-1.9041687" "-4.24" "-0.20973602" "18221" "GGCAGAAGTCCATGGGCTTGCCCACCTCTGATGAGCAGAAGAAACAGGAAATCCTGAAGA" "41188" "1" "0.093432" "1.9041543" "-4.24" "0.30873959" "72565" "CTCTTCTGGGCCTTACTCTGATAGTATCAGTAAAATAAACTATATTTTGTTCCGTTGTTG" "36375" "1" "0.093443" "-1.904081" "-4.24" "-0.22339728" "29818" "GGCCTAGGTAGACTGCCTCAGGGAAGCCAGAGAGATAGCCATGACTGTTACCTTCCTTGT" "9985" "1" "0.09359" "-1.9030586" "-4.24" "-0.40289176" "54216" "TAATATGGGGCTGCTTAAATATCACTGGACAGTGAAATCATTGGTTATAGAATCACACAG" "59589" "1" "0.093592" "1.9030462" "-4.24" "0.43100137" "226422" "GATCACCTCATTCCTCGACTGTGAGATGAGTTTATGAAAAGAATTAAAAGTGAGCACTTG" "43099" "1" "0.093635" "-1.9027447" "-4.24" "-0.19645172" "17764" "AACTTGGAAACTAAGGTTACGTGTATGCATAAAAGTTCTAAATGAAAGGGTGTGGTTTCC" "59412" "1" "0.093659" "1.9025811" "-4.24" "0.9660145" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "41488" "1" "0.093666" "-1.9025317" "-4.24" "-0.23026126" "74081" "TAAAGGAAGCACCGTTGTTGTAACTAAGCTGTGGAAAAGCTTTTCCTTCTGGACTTTGCA" "55886" "1" "0.093708" "1.9022391" "-4.24" "0.29125718" "55951" "CAGTGATAACAAGTATCGGTGTTTTCCATATGTAACTCAGATCTGTAACTTAATGGCAAT" "31118" "1" "0.093724" "-1.9021277" "-4.24" "-0.28508907" "245511" "CCAAAAGACCTAATCTTAGTACATGAGATTTTATGAGGCCTTCAACTCTACGTTCAAATA" "57027" "1" "0.093731" "-1.9020802" "-4.24" "-0.37523161" "263764" "GGGGAAATTGGGGTGGAGGGGTATGATAATATTTCTTTGTAAACATATACTAAATTGTCA" "62344" "1" "0.093781" "-1.9017331" "-4.24" "-0.2577976" "" "TGCTCTCATTGCAAAACTTGATGTAGGAGCTCAGCAGGAAGTTGATGTGGAAACTCAGCA" "14301" "1" "0.093797" "-1.9016235" "-4.24" "-0.19000779" "103468" "ACTAGAGGAGGATGCTTGCTTGCTTCGTTGAGTTGCTTGGTTGGTTGGTTTTGGTCAAAT" "20820" "1" "0.0938" "1.9015998" "-4.24" "1.09461955" "12260" "ATTCTGGGGACTACGGGGCTACACAGAAAGTCGCCTTCTCTGCCCTGAGGACCATCAACA" "19437" "1" "0.0938" "1.9015989" "-4.24" "0.14854848" "" "TTAGACATCAATCACACTTTGTAAATGACGTAATGGGGCTTACAAGGGGGACAGGTGGCT" "40460" "1" "0.093812" "-1.901515" "-4.24" "-0.21546015" "30947" "GAGTGCTGAGATTAAAGTTGTGTGCCACCATGCAGTGTTCTTTTATGAGATTTTTATATT" "45113" "1" "0.093839" "-1.9013331" "-4.24" "-0.21399346" "" "TTTTGAAATCTATAATTTTATTAAGACAAAAACTGACAGAAATATTCACATACATCTTAA" "13941" "1" "0.093853" "-1.901232" "-4.24" "-0.14755782" "" "CCTCTGTCCTGGGTAGCTCGCTCAGTGCCCATGAATAGCTCATTGTTGAAGACAAACCCA" "57832" "1" "0.093859" "1.9011959" "-4.24" "0.44690842" "18726" "AAGAATGCATCTTTCTATGTTCTACACTCTGGGAAATATATCTGATGACCCAAAGTTGTC" "61673" "1" "0.093873" "-1.9010965" "-4.24" "-0.14710138" "258658" "GGGCCCAATGAACTAGACAATTATTTTTGTGACATCACTCAGGTTGTCCGGATTGCTTGT" "26318" "1" "0.093887" "-1.9009976" "-4.24" "-0.16981902" "381406" "GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC" "30510" "1" "0.093909" "-1.9008466" "-4.24" "-0.15149992" "234959" "ATAAGTGACGAGTACTTTGGAATGAAAAATGTATGTACAGTTATAGTATGCAGTATGGGG" "34910" "1" "0.093944" "1.900602" "-4.24" "0.86468423" "16633" "CATTGTGGGCCTTAGTGTGAGACTCTGTTATGAAATATAATTATGATGATGATGATGATG" "8851" "1" "0.094013" "1.9001277" "-4.24" "0.38072651" "100041654" "AACCATGACCTGAGGAAGTTATCTTTCCTGTCCTTCCTGAATTATATCAGAACACTGAGA" "5964" "1" "0.094022" "1.9000684" "-4.24" "0.6852036" "21926" "TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG" "20790" "1" "0.094037" "-1.8999656" "-4.24" "-0.23563675" "" "GTATCTCAATCAAGCTGCAGGAAGAAGAGAGGAGAGCTGATTACATCCCTGAGGTCTCAG" "44086" "1" "0.094051" "-1.8998649" "-4.24" "-0.16947661" "" "GCGCGCCAGGGCTTCTTCGAGTTAGGGGCCTGACTCCCCGGCGACAAGACAAGATGGCTC" "11465" "1" "0.094105" "-1.8994902" "-4.24" "-0.1589459" "" "CATTCACAGTTGGCATTTGAAAAACTTCTCTGAATGTGTTCTAATCACATACAAGAAGGA" "42628" "1" "0.094136" "-1.8992783" "-4.24" "-0.18628153" "245007" "GGCCCTTATATGTGGATATTTTTTAAGTGGACTTGTATGCTGATAATTCTAGACCAAAGT" "57471" "1" "0.09415" "-1.8991848" "-4.24" "-0.22568355" "76246" "TCGGAAGACCTGTTCAAAGTGCATGACTTTGACGTGAAGATTGACTTACAGGTTCCAAGC" "22149" "1" "0.094156" "1.89914" "-4.24" "0.26342041" "" "ATCTTAGTAATTTTCTAACTTGTCTATTATAACTGCCATATTAAATATGAATATATTGAA" "40746" "1" "0.094162" "-1.8990986" "-4.24" "-0.16664118" "67204" "GATGGGGGTAAGGAGGTACTTTTTAAAATCGTTCATAGACTTCTGTAAAATGCAAGATAA" "44757" "1" "0.094173" "1.8990258" "-4.24" "1.08565294" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "14898" "1" "0.094187" "-1.8989273" "-4.24" "-0.15463522" "70601" "CAGTGGATGTAGACCTGAACCTGATTTCAAATATACTGGAATCCTACAGCTCCCAAGCGG" "53045" "1" "0.094198" "-1.8988491" "-4.24" "-0.23798917" "16159" "AAGTACATGAGCCTATTTATATTTATTTATTTTCTATTTATTATAATATTTCTTATCAGA" "30906" "1" "0.094218" "1.8987154" "-4.24" "0.36076162" "68720" "CTGCAAAGTTGTGACTTTCCCCTAAAATGACAAAATTGCAATAATAAAGTCTCCCCTTGC" "58901" "1" "0.094236" "-1.8985911" "-4.24" "-0.18663341" "" "CGTGACACGGAAAGTGCCGGCATTTCGGGACGCTTGGAGCTTGGACTTGACTATGGGGTG" "55280" "1" "0.094239" "1.8985686" "-4.24" "0.95688219" "14581" "GTGAGGGTTGTAGACGTTCCTAAATCTTCTTGAGTGCATTATGTATTAGCATAATCATAT" "23154" "1" "0.094256" "-1.8984525" "-4.24" "-0.21847873" "108100" "GGTTCCCCTTCTCCTACACCCGGGTCCTGGACAGTGACGGAAGTGACAGATTGCATATGA" "24908" "1" "0.094257" "-1.8984464" "-4.24" "-0.18597905" "" "TTTGCTTGCCAGACCCTTTACGGAGCCCCTGATCGCTTACCTAGAACTACAGTTTAGGGC" "31609" "1" "0.094259" "-1.8984285" "-4.24" "-0.20965102" "59048" "CAATGATGCATTGGTTTTCTTACCTCCAAATGGTTCTGAGAATGACTGACAGAAAGCAAG" "6120" "1" "0.094274" "-1.8983237" "-4.24" "-0.27956557" "16512" "CATTCCTTGCATGTGCCCGTCTCCACTGTCCTCATGTTTTTTATATTAAAAAACATTAAA" "46776" "1" "0.094326" "1.8979687" "-4.24" "0.19512899" "" "TTCCAATGCACAAAGGCAGGGAGGACTTAGAGATCACACTTCCAGTCTCAAAGCTGAATA" "41987" "1" "0.094331" "-1.8979333" "-4.24" "-0.20085083" "" "CCTCACTCCCGCCATGAGCCCGGCCGACGCTAAGCGCGGAGCCAAGCGCCGGAAGAACAA" "8111" "1" "0.094354" "1.8977745" "-4.24" "0.51736532" "541307" "CCAGGGGCCAAATGGGTGCAGAGATTCATCTCTCTGGTGAACACCAGGAACCATTTGTGA" "27095" "1" "0.094372" "1.8976485" "-4.24" "0.26711187" "77914" "CAATGAGGTGGTCACCAAGTTCAATGTTCCTGACTTCATTTACATGAAGTTACACGCCTC" "11093" "1" "0.094392" "1.897512" "-4.24" "0.15638467" "" "GAGGATAAGGAGGTTTTTAGCCTCTGTTCTCAGGGACTTGATAGTTTCATTGACAAGCAG" "9344" "1" "0.094414" "-1.8973645" "-4.24" "-0.21792283" "" "TTCTGCTTATACCCAGAGCTTTCGTAGATTAGACTGGCTTCCGGAGTCTTATAAGTGTGG" "59357" "1" "0.094424" "1.8972926" "-4.24" "0.7869799" "" "ACATCCATCCTATGGAGGAGGATGATACTGCAATGTATTTCTGTCAGCAAAGTAAGGAGG" "5501" "1" "0.094444" "1.8971576" "-4.24" "0.19111534" "" "" "58157" "1" "0.094459" "1.8970542" "-4.24" "0.58669078" "67849" "TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA" "7755" "1" "0.094488" "-1.8968533" "-4.24" "-0.16951893" "108911" "TTTTATATCTATATTTCTGGGAGTAAACATTTTAAATAAACGGCGTCATTGTTTACTCTG" "17201" "1" "0.09449" "-1.8968414" "-4.24" "-0.18332729" "" "TATTCTGTAACCATAGTTTTTGATCTGGCACATCTGTGGGATTGGAGGGGACACACTAGG" "14162" "1" "0.094501" "-1.896762" "-4.24" "-0.19023588" "381406" "GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC" "57220" "1" "0.094551" "-1.896419" "-4.24" "-0.15085717" "69535" "CGAAGGAAGCACACTGCGAACATTTGGCAGGTTGTATCTCTATGACATGGCACGCTCCCT" "46473" "1" "0.094561" "-1.8963551" "-4.24" "-0.21215009" "14169" "TAAACCTGTGCTATCATGGATTTCTCTTCTCTCCATTTTTACAGGGCTGCTCGCTCCACT" "21270" "1" "0.094569" "-1.8962953" "-4.24" "-0.26213868" "16323" "TCAACATTTGCTGTAAGAAACAGTTCTTTGTCAGCTTCAAGGACATTGGCTGGAATGACT" "27556" "1" "0.09459" "1.8961535" "-4.24" "0.21430155" "65973" "GAAAGCCATCTTGCTCCTCAAGATGATCATTAGTAAAGCATTGCTGCATTTTATTTTCTA" "28772" "1" "0.094597" "1.896105" "-4.24" "0.24912675" "" "TGCTCATGGCCTTGACCTCCTGTTATTGGTCACAGTGGACCCAAGCAGTATGGGCCAGTC" "60166" "1" "0.094599" "1.8960932" "-4.24" "0.2387918" "" "ACTTAACAAATGGGGCCTTAGTTAATCTTCACAACAATGTTAGGAGGCGAGAGATCAAGG" "44684" "1" "0.094615" "-1.8959787" "-4.24" "-0.21606821" "76629" "TTCAGGCAGTGACCAGGCCCGCCAGCTTCCGGAAGTCATCATAACCTGTGCTCTGAGTTT" "20673" "1" "0.094622" "1.895932" "-4.24" "0.76769507" "12984" "AACCCTAAGCAGGCAGATCAAGTGTTCCTTGGTCTATGTTCACTGCAGCAAAGAAAACCA" "17226" "1" "0.094687" "-1.8954835" "-4.24" "-0.2128807" "319713" "AAATGTCCCCCCGGCCAGATGCGATCATTGAAACTGCCTCATTGTCACTGGTTAACAACT" "5052" "1" "0.094702" "1.8953854" "-4.24" "0.26375592" "70896" "ATTTAGGGTGTTGTTCCCTTTCCTGTTCTGGCAACACCTCTTGAGAAACAACTGAGGTGA" "38472" "1" "0.094712" "-1.8953137" "-4.24" "-0.23412897" "216578" "TCGCCAACAGTTTCTTCATGGATTAGGCATGCAGAAATAAGCAGTGGATTTTATTGAAAC" "50754" "1" "0.094732" "1.8951803" "-4.24" "0.29373661" "" "CTGACTATATCATCATGTCACACCCCAGCTCAAAACTAGTGATGCCTTGGACCAAGTTTC" "18995" "1" "0.094733" "1.8951725" "-4.24" "0.82049296" "80782" "TCTCCCAAAGGCAGGAACTTGACATTGACATAGGAGAGAGGAACCCAAAAGACATTTTTT" "39064" "1" "0.094749" "1.8950615" "-4.24" "0.2659011" "67103" "GCTTTTTACCATTCAGTGCAAGTGTATACTGTCCTATGTAAGATGTAACAGCAATGCGTT" "10847" "1" "0.094781" "1.8948418" "-4.24" "0.47085685" "171207" "GCAGCATCAGCAAAAACAAAGTCTTCTCCCGGGGACCTGGGGCTCCAATTTCCCCCTCAA" "30063" "1" "0.09479" "-1.8947802" "-4.24" "-0.17301219" "212892" "TCTAGTATCCCTTTCTGACATCCATGTGTAACACACACACACATGCAAAATACTCATAAA" "35955" "1" "0.094792" "-1.8947675" "-4.24" "-0.26583674" "54006" "CTCTTGCAGGGAAGCTGCTGTGACCCAGGCGAGAATGCAGGTTGATACAGAGAGGAAAGA" "31979" "1" "0.094816" "-1.894605" "-4.24" "-0.20833904" "" "" "57192" "1" "0.094832" "-1.8944904" "-4.24" "-0.22698915" "13164" "GTACCATTCTGTGACTAAATATCCAACTTACTATGAATGATAACCTAAATTCTGAGGCAC" "27521" "1" "0.094844" "-1.8944088" "-4.24" "-0.21031318" "" "AGTCCATAACAGCATGGTCTTGCTGTCTTTTACAGGGTCTGAAGTCTACCTTAGTGCAGT" "49192" "1" "0.094849" "-1.8943789" "-4.24" "-0.17601869" "" "AACTCCACTGCTTAGAAGTGTTTTCTTCTTACCATTGAGTGTGCCTATTGCTGTGAATGT" "27807" "1" "0.094881" "-1.8941569" "-4.24" "-0.23481909" "233877" "GCCATCTTTCTCTTACCATCTGATTCCCTTTCTGTTTTGTTAATACATTGAACACACGTG" "54793" "1" "0.094897" "1.8940444" "-4.24" "0.36703569" "" "TCAGAGACCAGAATAATAATGACCCTACTGAGGGCAGGTTCCTGTGAAAAAGAGGAAGTC" "2380" "1" "0.094907" "1.8939805" "-4.24" "2.11035145" "16149" "CTATAAAGGCCCGCAGACAGGGACAAGGGATGCCCTACCCTTAACCTAGGCTGGACACAT" "27686" "1" "0.094997" "-1.8933645" "-4.24" "-0.32627993" "" "" "32977" "1" "0.094998" "-1.8933569" "-4.24" "-0.27708671" "" "TTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTT" "62783" "1" "0.095046" "-1.8930267" "-4.24" "-0.26727327" "14860" "GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA" "9821" "1" "0.095051" "-1.8929939" "-4.24" "-0.24022627" "" "AGGTTTCAGCCAGCCTATCAAGGTAAGCAGGCACTTTTTCTTTTCTTTTTTCTTTCATTT" "43447" "1" "0.095053" "-1.8929818" "-4.24" "-0.23422676" "" "GTAAATGCAAAGGGAACCTCCATATGTCCAATTGCACACAATGAAGGGATATGTCACGTC" "53935" "1" "0.095057" "1.8929487" "-4.24" "0.18849605" "" "AGTTGCTTTTCTAGCTCATGAAGTACCTCATTCTTCATGTCAATGGCGTGGTGCAAACTC" "30473" "1" "0.095067" "1.8928829" "-4.24" "0.91019873" "14938" "TGTCTTTCACTCCATCCCTGTCACTTCTGTGTCTGATCACAAATAAAATCAACTTGAATG" "53277" "1" "0.095075" "-1.8928314" "-4.24" "-0.22453666" "" "TTTTACAATAAAGTTGTTTGATGATCTTTCCCTAAGGCCTCAAAAAATAAAAAACAAAAA" "59546" "1" "0.095081" "-1.8927878" "-4.24" "-0.14585406" "67106" "AATGGAAAACTAGTGAGTAGCAGTGGTCTCTAGATAATGAATTCCTCAGTTTTTGAGGAG" "35811" "1" "0.095088" "-1.8927378" "-4.24" "-0.29790639" "71066" "AAGGAAAGAGTAGCATCTACCACGTTGGCATCAACATCAAACCATCACTCATCTTCTTGA" "62834" "1" "0.09512" "1.8925243" "-4.24" "0.53200196" "" "AGAGAACTTGGAGAAATCCAGTATTCACCTAAGTGCACACACAACACAGGGGAACAGACA" "14801" "1" "0.095129" "1.892463" "-4.24" "0.3178292" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "46870" "1" "0.095169" "-1.8921835" "-4.24" "-0.14853288" "" "AGGTTGTGGTCTGTCCTCTACCCTAGTGAGCAAACCCAGCAACCTTCCTCTGCTTGCCCT" "17087" "1" "0.095173" "-1.8921594" "-4.24" "-0.17312498" "" "TTTATAGCCTGAACCTCTTGGTTTGTCTACCTTCCAGGACTTGCCACAGTTTCCCATCAT" "58777" "1" "0.095192" "1.8920304" "-4.24" "0.50777869" "" "TAGAAAACACACTCACTCACTGGTGGTTGGATCAGAAAGGATCTCTGTTGGCAAGGTAAG" "26710" "1" "0.095211" "-1.8919027" "-4.24" "-0.22940892" "" "" "57849" "1" "0.095211" "1.8918994" "-4.24" "0.30417163" "" "TTGAAAGGGCACAGGAGTTGCAAAATGTCTTAAGGGCCATGAATTGTAGACTCCTTCCTG" "31506" "1" "0.095225" "-1.8918015" "-4.24" "-0.18888572" "218461" "GCTTTCTATTGTACTGCTGCGTTATCTACATGTGATGAAATGTTTTTGTGAAGTACTTGT" "47386" "1" "0.095292" "-1.8913448" "-4.24" "-0.22695599" "" "GACATCCAAGAGTTGTGTTACTTATGATTACCCAGCAAGGCCATTAAAGATTGCGTGTCT" "7351" "1" "0.095347" "-1.8909715" "-4.24" "-0.15817177" "" "TGTGTTTAATTCCATCTTCAGTTTCTTCTCCCCAGAGCTGCCCATCATCAAATAAAGGTG" "26535" "1" "0.095347" "-1.8909704" "-4.24" "-0.15536223" "70238" "GTTGAGCTTCTATCTTTTGTTAAGACAACTTAGCAAGCTGTAGTTTCAGTAGATTCTCTT" "62911" "1" "0.09538" "1.8907463" "-4.24" "0.571397" "66695" "CTCAACTCATAATAAAGCTTCAAGTATTCACAGATAATATTCATCAGAGTTGGTTTGGGC" "16824" "1" "0.095397" "-1.8906326" "-4.24" "-0.45580911" "13837" "ACCCAGAGAATTATATGTTCTTTTCTACAACTGTTGAACAATCCACTTACATGTACCAAC" "21397" "1" "0.095398" "1.8906255" "-4.24" "0.19304151" "16612" "TTACACCCGTCAAATATGAATACCCAGATGAGCTCCAGTGTGTGAACCTCAAGCTCCTGC" "7581" "1" "0.095409" "-1.8905517" "-4.24" "-0.21833119" "258552" "TTCAAATCCACAGTCCAGTCATATCCTACGTGGGCTGCCTCACTCAGATGTCTCTTTTTA" "12441" "1" "0.095413" "-1.8905252" "-4.24" "-0.43311226" "104582" "GCTCATCAAGTCCGAGAGCATGATCAACTTTCTGATGCAGGAGCGCAGGCCCTCCAAGGA" "1196" "1" "0.09543" "-1.8904053" "-4.24" "-0.21087798" "668976" "ATAAGTATTCATAATGTAGAAGGAAGCCATGACTCTGGAGAGAATGATTCAAACTTGGCA" "34618" "1" "0.095468" "-1.8901446" "-4.24" "-0.19665518" "" "TTGAGGTTTATGGCATATAGTTTAGGTCAACACACATACAGAAGGAGGAAGAGGACATGG" "18886" "1" "0.095489" "-1.890008" "-4.24" "-0.16664029" "224893" "CATCTAAGAAATGAGGAATAACTTTCCATACCAAATTCAATTTCCCCACTGAGCTCTCTC" "33907" "1" "0.095498" "-1.8899454" "-4.24" "-0.15014877" "" "AGGAGATTTTGTATTAATCCTAATGCTGGATTTGTCCACCAACTTCAGCTCTGGCTGTCC" "36929" "1" "0.095545" "-1.8896266" "-4.24" "-0.17370606" "" "" "20323" "1" "0.095577" "-1.8894037" "-4.24" "-0.28827576" "320840" "CATTTTGTTACCAAAGTAGTATTGTCTAATTCACAGCATGATATATGCAATTAGCACCCG" "32468" "1" "0.095579" "-1.8893894" "-4.24" "-0.18340363" "433486" "AATGGTTTAATCAGAGGCCTGCGAACTTTATGTTGCTGCCTGCCAATCGAAAAGAGAGTG" "19162" "1" "0.095586" "-1.8893462" "-4.24" "-0.18029267" "209018" "AGCGGGCAAACTCAGTGAAAATCCTTCTGAAAACAAGAAAGGACGGATAACCTCGTCTCA" "5239" "1" "0.095595" "-1.889284" "-4.24" "-0.32229971" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "54913" "1" "0.095617" "-1.8891349" "-4.24" "-0.18582913" "" "CACTCCTAGACCACATAGTACTCAGCATGAACACATAATACTTTATGGAGATATAGTTTT" "1683" "1" "0.095623" "-1.8890942" "-4.24" "-0.19987613" "" "GCTCCCCCACCTACCTCTAATTCTCAGAAAGGCCTTGGAGCTGAAAGCATGAGCTCATAG" "9599" "1" "0.09563" "-1.8890427" "-4.24" "-0.2358636" "" "CAAAGTCCGTAGGACACAAGGAAGGTAGGTTTGTAACTGGAACTCAGAGGGTCTAAACAT" "54224" "1" "0.095692" "1.8886272" "-4.24" "0.22563633" "12525" "CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT" "49395" "1" "0.095756" "-1.8881869" "-4.24" "-0.28139913" "" "GGCCATCCTTCTGGCTCCCTTGGGTCCATTTCCTTTCATCAGGAGAGTAGTGCAATTTCT" "41933" "1" "0.09576" "1.8881656" "-4.24" "1.16808021" "" "AATTATTGAAACAGCTCAAAGCTCACTCTCATGGATCCCTGAACAACAATGGTAATGATG" "4963" "1" "0.095769" "1.8881044" "-4.24" "0.29420077" "234396" "TGAGCCATCAAGGTGTCTGAGCATCTGGCTGGTTCCTAACTGTTCCCAGCTCTAGCTTCA" "34971" "1" "0.095769" "-1.8880983" "-4.24" "-0.23250283" "" "CTCTTGCTTTAGAAGAATTTGGGACTCTGCCAATGCCAAAGCCTTTAAATATTTTGAGAC" "48113" "1" "0.095772" "1.8880802" "-4.24" "0.19844988" "329260" "AATCAGGTACTAACTTGTACATAGGCTGAAAGTGTGTTTTGAATTTAAGCTTTCCCAGTG" "61115" "1" "0.095791" "-1.8879548" "-4.24" "-0.24616018" "66822" "GATCAGCTTCATCAAATTCGCATCTAACTGAATGGTAGTGTCTTTAAAATGTGCTGTTTT" "23135" "1" "0.095792" "-1.8879429" "-4.24" "-0.20920676" "238161" "CTGGTACATTCTACTATTAAGTTTGTTTTTGGTTTCTATGCTTCTTGAGGTGGTAATGAG" "28066" "1" "0.095802" "-1.8878799" "-4.24" "-0.22412589" "" "CCAATGTCCTTTGCCTTACTGCAAAACATGTCTTTTGTATACGCCAATTTAGTTTTATGG" "10105" "1" "0.09582" "1.8877558" "-4.25" "0.47598268" "" "" "36741" "1" "0.095825" "1.8877182" "-4.25" "1.74669615" "15018" "TGCACTGAGTGACAGACGATGTGTTCATGTCTCTCCTGTGACATCCAGAGCCCTCAGTTC" "62016" "1" "0.095889" "-1.887285" "-4.25" "-0.25993215" "" "" "37357" "1" "0.095896" "-1.887242" "-4.25" "-0.27974446" "" "AATAGAAGGCAAAAATTGTCCTGAATCAAAAGAAAGTAGGGGGCAGGTGACTGGCTCAGC" "8163" "1" "0.095911" "-1.8871351" "-4.25" "-0.18143521" "217666" "GGGTCTACCGGCTGCGTTTTAAAATTAGAATTTAAGAAAACAATTTGAAAACCATGCCTT" "62064" "1" "0.095931" "1.8869991" "-4.25" "0.63425635" "11690" "AGAGACGCATCATAACGCAATGCCGCGAAGGCTTCTGCTCCTCTTCAAGCTGTAGATGCT" "22545" "1" "0.09594" "-1.8869403" "-4.25" "-0.15917522" "17749" "GTGGGAGTTCAGAAGTATCTTCATTCATACATTTGCCTCATTGATGTTTCTCTTTAATGT" "19428" "1" "0.095952" "-1.8868619" "-4.25" "-0.15573978" "16700" "GTCATGACTCTGTCACATATGCTTTTGGTTTTTAACCAAGAGGATTTTCTCTTTTCTCAA" "23190" "1" "0.095959" "-1.8868128" "-4.25" "-0.16856491" "" "AATAATGAGGAAACCCACGAGCAGATCCCGAAAGCCAAGTTAGAAGTTAGAAAGCGCAAG" "31800" "1" "0.095971" "-1.8867278" "-4.25" "-0.23580286" "" "TAGCTGGTAGGTTCAGGCCCAGAATCCTTAGAACTCCTCAGTTACAATCTTGTGTTCTTG" "15853" "1" "0.095979" "-1.8866762" "-4.25" "-0.1646521" "14169" "ACAAGTGCATCTGCAATAATGAATGGAGGCAAACCAGTCAACAAGTGCAAGACCACATAG" "746" "1" "0.095995" "1.8865697" "-4.25" "0.421634" "214968" "TAAAGAGGACACCATCCTTAAAACCTGATGTGCCACCAAAGCCTTCCTTTGTTCCGCAAA" "37420" "1" "0.096001" "-1.8865261" "-4.25" "-0.16568998" "235459" "GCGATAATGTTTGGACTTTTGTATTGAATGATGTTGAATTCAGAGAGGTGACAGAACTTA" "8211" "1" "0.096014" "1.8864429" "-4.25" "0.34901724" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "44783" "1" "0.096048" "-1.8862106" "-4.25" "-0.24283836" "110835" "GGCTTTTTGTTCCTGTTATTTATAAATGGGCCAATATAATAGTCCCAGTTCACATTGGAA" "15260" "1" "0.096065" "-1.886092" "-4.25" "-0.17078713" "100042150" "GGCAAAGACGTTTTTATAGGGAAACTATTTATATGTAACATCCTGATTTACAGCTTCGGA" "1050" "1" "0.096083" "1.885972" "-4.25" "1.50443369" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "7020" "1" "0.096095" "1.8858938" "-4.25" "2.1565288" "" "AGGGGCACAGACTGAGGATGAGGCAATATATTTCTGTGCTCTATGGTACAGCAACCATTT" "57351" "1" "0.096108" "1.8858067" "-4.25" "0.97354527" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "62792" "1" "0.09617" "1.885386" "-4.25" "0.21584541" "258538" "TCATGCTTATCCACAAGTTAGATTTTTGTGCTTCCAATACCATTGATCACTTCTGCTGTG" "53611" "1" "0.096175" "-1.8853514" "-4.25" "-0.24000727" "72180" "TAGGTCTCTGTGTCTTACAGCGTGCCTTGCAAATATTAGGTGATCAATAAATGTTTATCT" "62081" "1" "0.096184" "1.8852926" "-4.25" "0.1854212" "" "GAAAGCCTAAGAGAGCCCAACCTTTGTACCTACAGCCTTAGATATTGTTAAATAGCCATT" "46940" "1" "0.096198" "1.8851935" "-4.25" "0.17126651" "100041655" "GAGCTGGAAAGCTGTCAGCTGCCACGCCATGGTGCCAAGCACATAGTAGGACTTCAAGCA" "55334" "1" "0.096212" "1.8851026" "-4.25" "1.20470786" "80885" "CCCAGGAGGGACTGAACTCAGTGCTGGAGAGAAACAATAACAAATTCAGCTGAGCTTTAA" "5576" "1" "0.096214" "-1.8850895" "-4.25" "-0.52199269" "" "TCAAGCAGCAGCTCTTCTCCTATGCCATATTGGGTTTTGCCCTATCTGAGGCCATGGGAC" "21478" "1" "0.096214" "-1.8850847" "-4.25" "-0.28221371" "103768" "TCACCCCTGGCGCTTGGCTGGCTTGGTTAAGTTCTAATAAATAAAGCGTGATGATGCATT" "12951" "1" "0.09625" "-1.8848406" "-4.25" "-0.16418803" "226861" "TTCTATGTGAAGTACCTGGTGCTCTTTGGTGTCCCGGCTCTGCTCATGCGCCTGGATGGA" "29559" "1" "0.096272" "-1.8846961" "-4.25" "-0.14746907" "" "ATGAGCTTAGAAGATAAAGGACCAAAGGGCAAATAACAGTGACACTCAACCGTCAAAAAA" "10167" "1" "0.096365" "-1.8840653" "-4.25" "-0.22269313" "67048" "GCAAAAAATTTCCCATAATGTTAACTACCTGCAGATTATCAGTAGTTTAGTTCACAACCC" "35410" "1" "0.096383" "-1.8839439" "-4.25" "-0.29182139" "108116" "GTGGTAGTCTGTATTTTTGCAGCTTCTATTTTCCAGATGAGCAGTTTAGAGATACATGAT" "34505" "1" "0.096393" "1.8838779" "-4.25" "0.21414286" "338363" "CATTTTGCATAATGTAGCTGAAGTTCTCACCTGTGGGTACCAGAAGTGTGTCTGGAAAGA" "48853" "1" "0.096407" "1.8837819" "-4.25" "0.52693523" "20343" "CTGTAGGCTATCTCATTTTCTCGCTTCACTCTGCAAGGTTTATAACATGATGAATTTAAA" "39393" "1" "0.096437" "1.8835794" "-4.25" "0.32210842" "69627" "CAGTGCTGGAAAACATTGTTTCCAAGCAGTACTTACCCGAAGCCTTAATATTATTTATTA" "30520" "1" "0.096462" "1.8834094" "-4.25" "0.18819419" "13496" "CAGCCTGGGGGTTGCACACAAACTCAGGTAAAAGTGAAAAAATAAATAAGTGGATTTTAA" "9172" "1" "0.096466" "-1.8833827" "-4.25" "-0.25363798" "93891" "GTCTAAATGTTGTTGTACCTGGGTAGAAACTGTACTGGATCATTTGTAGTATTCTCTGTT" "36938" "1" "0.096469" "-1.8833669" "-4.25" "-0.14976985" "" "ACGAGAGTCTGCTTGCATAAGAGTACTTTAAATGATATGAAAGTGATGTAGCATTAGGAG" "26065" "1" "0.096481" "1.8832853" "-4.25" "1.12899147" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "50443" "1" "0.096483" "1.8832725" "-4.25" "0.87180076" "94094" "AAATACCCATTTAACTGTCTTGTACATAATACATGGGCCTATAGTCCTTTGTACTCAATG" "58367" "1" "0.096489" "1.8832273" "-4.25" "1.11735214" "12363" "CCAGCCTAAGCAACACAGTGGGATTCTGTTCCATAGACAAGCAAACAAGCAAAAATAAAA" "46186" "1" "0.09652" "-1.883022" "-4.25" "-0.27267712" "" "ATAGTAAATTCATGACTAGGACCAGGTCAACAATGTACATTTGCATTGCTTCAGAAGGTT" "15559" "1" "0.096523" "1.8830032" "-4.25" "0.27934658" "" "TAGTGGCCCGGTTTGCAAGTGCAGAATGGTGAGGAGGTTCCCTAAAGCAGCCTCGACCAT" "29840" "1" "0.096558" "1.8827627" "-4.25" "0.77311789" "" "TGACTGAGAAAAGCTTTGAAACAGATATGAACCTAAACTTTCAAAACCTGTCAGTTATGG" "451" "1" "0.09658" "1.8826179" "-4.25" "0.57026963" "" "TTTTGGGAGTTCCTAGCCAGCGGAAACACTGCAGTTGGGGAGCGCAGCTGAAGTACTTGG" "17812" "1" "0.09659" "-1.882548" "-4.25" "-0.21135404" "" "TCTACTGTAAACTATAACTGGGCCTAGTTTGAAAGTAGCCAAGCTGATGGACCAGAACTT" "52115" "1" "0.096593" "1.8825271" "-4.25" "0.36316215" "384309" "TGTGAGATCAAATCCAGATGCAGCATCACACACACTCACACACACCTGTTATCCCAGCAC" "12708" "1" "0.096619" "1.8823576" "-4.25" "0.89258754" "19073" "AAGACTCTTGAATCCTGTTACCCCTTTCCTCATTAACTCGTAAGGAATTATGCTTTAATG" "18013" "1" "0.096645" "-1.8821827" "-4.25" "-0.18998399" "30946" "CGTCAGGAAGGTCTTGATCCAAACAGTCACAAAGGTAATAAAAGTCAGATTTACATCTTC" "22448" "1" "0.096645" "1.8821797" "-4.25" "0.39245799" "109857" "TCTGCAAACTCAGTCTGAACAATTCGCTGTGTCCACACTCTCAGCTCATCGTGTTTTCAA" "23735" "1" "0.096676" "1.8819698" "-4.25" "0.25270647" "54139" "CCAACTTGGAAAGTCAAAACTGTTTGTCTTAGATTTATTGCCAGGTCTTTAGCAGTGTCT" "37875" "1" "0.09669" "-1.8818746" "-4.25" "-0.18103536" "432870" "GTTAAAACTGATTTATCTGCTCTGGCTGGAGCTTAAGAGAGTATTTGGCACATAGAAGGC" "19172" "1" "0.096723" "-1.8816567" "-4.25" "-0.16493069" "51960" "AAAGGGAAGTTAAACAAGTTAACTTTTTAACTCGTTAGTTGGTTTAGAAGTGACCATGGG" "40861" "1" "0.096775" "1.8813077" "-4.25" "0.49271452" "72049" "CTATGAGTAAGAAGCTTTTCTTTGAGCTGGGAAAGGTACTGTTAAACCAAAATTAATCTG" "58597" "1" "0.096804" "-1.8811103" "-4.25" "-0.23444585" "226418" "GCTGTACATTAAAACTGTAAAATTGGGTTATGCACCGTATTTATAGAGCTTACCTTTACC" "48927" "1" "0.096875" "1.8806353" "-4.25" "0.1931032" "" "GTGTTAGTGCTGTTTTCCTATGCTTTTGTTTGCCTGTAGACTCTACTCTTTGTACTTGTA" "27888" "1" "0.096896" "1.8804909" "-4.25" "0.25652693" "214704" "ACAAGTTTCCATGGTTTTAGAGGGAAGAGAAGGGGAGTTAATGGTTGAACAGTTATGGAG" "55581" "1" "0.096902" "1.8804531" "-4.25" "0.57067364" "12959" "CCAGCCCATGCCCCGCCAGCTCATGGAGCTCAAAGAAATAAAATGAAAAACAAAAGACTC" "32362" "1" "0.096914" "-1.8803752" "-4.25" "-0.21222653" "225998" "CCTGAGTGGGGCTCTTTTGTTTGTTCGTTTGTTGTTTGTTTGTTTTTGAAATGATCATAA" "21636" "1" "0.096931" "-1.8802578" "-4.25" "-0.17631176" "" "GGGGCGACATGAAACCACTCATTAGATTTTATGTTGTATGCTTCCACAGACGATAGACCT" "3039" "1" "0.096944" "-1.8801703" "-4.25" "-0.28498372" "68870" "CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT" "19985" "1" "0.097016" "-1.8796877" "-4.25" "-0.22591" "" "TTTCTGTTTTAACTCGGTGTGGACTCAGTGTAGCCACTGCCTTCCTAATTGTTGTCCAGT" "21165" "1" "0.097019" "1.8796707" "-4.25" "0.93691643" "209387" "ATGTAACGTTTCAGCCTAAATGTGGCTACTGGGTTATAGGGATGAAGAATTCATCTGTAT" "17224" "1" "0.097048" "-1.8794721" "-4.25" "-0.16624316" "66810" "CTAATCATTGTAGTGGCATAAAAGTGATTTAACTAATTTGAAGTCATACCCTCAGAGAGG" "23142" "1" "0.097053" "1.8794374" "-4.25" "0.79074739" "76905" "CAATGTGGTCCCATGTCAGTGTGCAGATTCCTCATTCCCTCAGCCAGGAATGCTATTCTC" "50317" "1" "0.09706" "-1.8793953" "-4.25" "-0.25267632" "19293" "AGTTTGTTTGTGTTATTTTTTACTCCCCCATCCTCTATGGCCCTCGGATGACGCCATTCT" "11858" "1" "0.09706" "-1.8793901" "-4.25" "-0.17342737" "258759" "TACTGTGCCAGTCATCAATCAAGTCTTGACATTAGTACTCACTCTCATGGTCCTCACAGC" "59807" "1" "0.097066" "-1.8793494" "-4.25" "-0.35672873" "192161" "TACACCTTGCCCAGTGGCCGAAGTGGGAATGGAAAGTCATTCTGTTGGAGGAGACGTGCC" "36210" "1" "0.097075" "1.8792923" "-4.25" "0.34619753" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "52940" "1" "0.097108" "-1.879068" "-4.25" "-0.24308936" "" "AATTTGAATAGTAAACCTACTTGCAAATGAAAATGATATTAATACTGCCATTATTTTTAT" "25515" "1" "0.097126" "-1.878948" "-4.25" "-0.24812148" "403180" "AAGGAACAGAGAGCTTCAAAGACCATGCTGAGCACCAAATCAAAAGCAAGTTCAAAGTAA" "264" "1" "0.097127" "-1.8789411" "-4.25" "-0.22970399" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "10436" "1" "0.097131" "1.8789158" "-4.25" "0.1522584" "" "ATAAATAAGTGAGCTATGTCTAAATTTTAAAGCTGTAAGGCTTTTAGCAAAGGAGAATGT" "57065" "1" "0.097136" "-1.8788805" "-4.25" "-0.15836552" "638532" "TATCTTGACCAGATCAACATGATTGAGGACCAGGCAGCCTACAAGCTCGATGCTTATTCA" "51520" "1" "0.097161" "-1.8787131" "-4.25" "-0.1971743" "" "GTCCTTTCCTCTATGACCCCACGTGTACAGTTGGAAATCCTTCCTAATCATGCCTTGATT" "24683" "1" "0.097172" "-1.8786425" "-4.25" "-0.23217894" "235048" "CACGTGTGGTCCACAGATATCCATGCTGGTAAAATACTCATAACACATGAAATAAAAATA" "32676" "1" "0.097187" "1.8785393" "-4.25" "0.29473087" "666468" "GTTTTGGTTGAGAACTATATGTAGAAAGAACTATTCATGTGGTGACATTCAATCTGTCCA" "38731" "1" "0.09719" "-1.8785238" "-4.25" "-0.3014842" "" "CAGAACTGTGGAATACTGCAAATAAGATACCTAAACCTTTATCTTAAATACTGCCCCTTT" "34287" "1" "0.097198" "-1.8784707" "-4.25" "-0.35705102" "" "CTCGTCCCATTATCTTCTCCAAAGATGGGGGAAAGATTATTCGGATTATATTCAAAATAT" "16164" "1" "0.097212" "1.8783777" "-4.25" "0.19973327" "14007" "TAACCGTGTAGTTGAAACAGTCAGACTTATTTTTGTAATGTATGTTATTGTGTGATGCGG" "7227" "1" "0.09723" "-1.8782518" "-4.25" "-0.38596576" "73442" "TGCATGCACCAATATAAACAGGAGTTCAAAATGCATTATTAACCGAAGATGAACTTCACA" "46350" "1" "0.097236" "-1.8782124" "-4.25" "-0.25694606" "57750" "TAGCAACATTTTACTGTCTTTGTCCTTCGTGCTTATAAAATACAGTAAGTATGTGGTCTG" "38130" "1" "0.097255" "-1.8780876" "-4.25" "-0.18779193" "76123" "CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT" "29542" "1" "0.097275" "1.8779558" "-4.25" "0.95951544" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "9608" "1" "0.097276" "-1.8779457" "-4.25" "-0.22975604" "52705" "GCCACAACTACCAGATGAATCTGGTTTTGAGCTATGGTTGAAACTAAAGATTAAAATATG" "1602" "1" "0.097293" "1.8778338" "-4.25" "0.5612465" "19200" "TCTACGACTACACTGCACAGAATTCTGATGAGCTGGACATTTCCGCGGGAGACATCCTGG" "2677" "1" "0.097299" "1.8777914" "-4.25" "0.21301763" "" "CTTCCTCTGCCTCAGCACCTCTCACCTGTGCTCCCCCTCCTCCCACCCTCCATTTCCTTC" "35382" "1" "0.097319" "-1.8776576" "-4.25" "-0.54294659" "" "AACCAGGAAGGGCTCCTGCTACTTTAAGACGGAGAACAGTCGATTCGCGTTGCCTGGGCA" "21509" "1" "0.097324" "1.8776258" "-4.25" "0.67101721" "" "AGCTCAAACCCCACTGGCATGCCAGCCCTTTGAGGGGAAAATAAAGTTTACGTAAACATG" "41875" "1" "0.097358" "-1.8773989" "-4.25" "-0.16649437" "" "TGAAGACAGAGGAGACTATAGCCAAGGATCCAGGTATGTTTGAGGGATTGAGCAAGGTAT" "27176" "1" "0.097435" "1.8768861" "-4.25" "1.12938668" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "6361" "1" "0.097439" "1.8768568" "-4.25" "0.18144529" "" "TCCCAATTAGTTAGCTAGAAACTAGTAAAACTAATTTCAGTATGTGGCTTTCTCTGATGC" "17247" "1" "0.097446" "-1.8768128" "-4.25" "-0.17904628" "" "TCTAGCAGTTCCTGTTAAGTGGGGCCTTCCCATAGGAAGGCTGCAGGGGAAAGGGCAAAG" "37693" "1" "0.097471" "-1.8766456" "-4.25" "-0.34697439" "" "GTATGTGGTGGGATCAGAGGTTACTATCTTTTGTCTTCTATTTTAAAAACTGAGTGTGTT" "5627" "1" "0.097472" "1.8766356" "-4.25" "0.80499417" "" "GAGATCACCTGCGTGCACCATCACCCGCCTGTGAGAGTGACTTTTGAGCAGCACCATTAG" "29729" "1" "0.097502" "-1.8764337" "-4.25" "-0.17668814" "76123" "CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT" "46653" "1" "0.097507" "-1.8764007" "-4.25" "-0.15540372" "19696" "AAGGTGAAAAACGTGTAATGGCTATGCATTGGGTAAATAAACTCATATTATTGTTGAGGC" "2749" "1" "0.097527" "-1.8762726" "-4.25" "-0.23826976" "" "TTCCGGCAAGAAGAATTAATGTTACAGAGCAGTCGACTTCTGAAGGGTAAGCTCTCAGCT" "28007" "1" "0.09753" "1.8762468" "-4.25" "1.54199512" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "25216" "1" "0.097557" "-1.8760683" "-4.25" "-0.14518397" "" "TCTCTTGACACAAAATTCTATAGTCTAGTGAAAAAAATTGTAGTTAATAATCAGAGAAGC" "59118" "1" "0.097575" "1.875952" "-4.25" "0.71494799" "" "AAGCTACTTTTACATGTATCTGCCGTGGATCTAGAAGACTCAGCTGTCTATTTTTGTGCC" "58654" "1" "0.097578" "1.8759296" "-4.25" "0.19784674" "" "TGGATTAATACTAGCCCTTTTAAGACCCATCCGGTGCCGACGTGAGGTAGACAACTTTTT" "14358" "1" "0.097589" "-1.8758589" "-4.25" "-0.17599044" "68202" "TGCAGCCTATAGAAAATACACAGAACAGATCACCAACGAGAAGCTGGATATGGTCAAGGC" "2342" "1" "0.097604" "1.8757581" "-4.25" "0.23269579" "" "AGAGAGAGTCCACTCTACTCCGCGGGCGAAGGAGACGCGTTAAAGATGGAAGACTTCCAG" "51266" "1" "0.097665" "1.8753467" "-4.25" "0.32666707" "11836" "TATCTCCAATGGCTGTGACTCAGTGCAAGGATTCCACTCAGAACCTCTTTCTAAAGTTTT" "16141" "1" "0.097676" "1.8752756" "-4.25" "0.32809555" "74112" "CTGTGATAACAAAAAGTGCTTTCTCTGGAAATACACCTATGGCTTTTATACTGGCTATTA" "2672" "1" "0.097693" "1.8751622" "-4.25" "0.21226102" "13512" "TGACCCTCTACAGCTTGGGAACTACTTGCTCACAGAAACTTACTCAACTTCAGGTTCCTT" "27214" "1" "0.0977" "1.8751197" "-4.25" "0.29073136" "232984" "ATGTGCCGAAGACCTTCTTTGAAGGGGACTATCCAGCCTATGCGAGTGGAGGTGGCTATG" "21568" "1" "0.0977" "1.8751159" "-4.25" "0.25599718" "" "AGAATTTCTCTCTCATTCTGGAGTTGGCTTCCCTTTCTCAGACAGCTGTATATTTCTGTG" "26542" "1" "0.097706" "1.8750797" "-4.25" "0.37445668" "18725" "CCATTTTTCCATTCTGTGTGACTACTTACATTATTGTGCCTAATGTCATTTCACTGTGAA" "36798" "1" "0.097712" "-1.8750355" "-4.25" "-0.32472578" "19716" "TTTTTACTCGGCCTATAATTCTTTTGTTAGCAGAATTTATCAATTGCATGGGAAGATCCG" "36456" "1" "0.097756" "-1.8747419" "-4.25" "-0.25453852" "22775" "TTGAGCCATTTGAATAGCTGTATAATAACACACTGTATAGTCTTAATTGCTTTTTTCGTG" "5928" "1" "0.097801" "1.8744472" "-4.25" "1.10299723" "384059" "CCGCGGGGTATGTGACATTCCCAAGATCTTCAAATCCTCAGTAAACTTGCTAAATTCATG" "50385" "1" "0.097825" "-1.8742828" "-4.25" "-0.22632271" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "26670" "1" "0.097826" "1.874276" "-4.25" "0.43811955" "" "AGCTTGTGGGCAGAAAGGAACGATATGCCCAATCCCATACAAAGCCTGCAGGTGCCCACA" "46645" "1" "0.097838" "-1.8741954" "-4.25" "-0.17255106" "" "TAGTAATTTCTGACAGTTGCATAATGGCAGCACACAGCACAGCTTAGTTTTGTTGGGCCG" "5824" "1" "0.097863" "1.8740348" "-4.25" "0.39014885" "328795" "GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC" "5470" "1" "0.097867" "1.8740029" "-4.25" "0.1945053" "667240" "TCCTAAGAATCCTTGTCTTGAGCTCTTCCACTGTTTTAAACCAGAGTCGCTACAAAATTT" "3640" "1" "0.097882" "-1.8739073" "-4.25" "-0.25238965" "68127" "GCATGGTTGTAAAGTCCTTATTCTTTGTGCTTACCTATAAAGCATTGAAACAAAATGGCT" "44013" "1" "0.097959" "1.8733968" "-4.25" "0.19160119" "100503880" "GGAAGTGACTGCTTTGGGTGTAGTTTCATTTGAGGACATAGATAAAAAATATTGTAACTG" "58340" "1" "0.097988" "-1.8732023" "-4.25" "-0.16702735" "69641" "TATGCTTTAACTGGGATATTTTTTGCGTAACCACTCAACTAGATTATTGTATACCTGGTC" "62951" "1" "0.097992" "-1.8731721" "-4.25" "-0.24959488" "69260" "CGCTGCCTCATATTGGCAAGATGTGGATTATTCAGCATCATGGTTCAAGGTTGAACAATT" "27600" "1" "0.097998" "1.8731322" "-4.25" "0.6895288" "" "TTCTGTGTGAGCACGTGGACAAAACATTTAGAGATTGAAGGTGTCACTAATTTTCTGTAG" "54749" "1" "0.098041" "-1.8728517" "-4.25" "-0.25959122" "320873" "GGAGACCAAAACTACGATTACCTCCGAGAATGGGGACCTCGGTTTAATAAACTAGCAGAA" "46477" "1" "0.098042" "-1.8728404" "-4.25" "-0.22392896" "271786" "GCATTCAAAAATCCCCATGAGAAAGTAGTGATGCAATACAGTCTTTTGTCAATAAATGTG" "28120" "1" "0.098064" "-1.8726972" "-4.25" "-0.24449529" "192157" "TGTGTTTGTATCTCCTTTTTATGATTGCTGTACCGACCCATGTCTTTTTGGGGAGGGATG" "26082" "1" "0.098109" "1.8723988" "-4.25" "0.33583431" "" "CACACTGTACACATACACATGTGCAGGGAAAACACTCACTCACGTAAAGTAAATAAATCT" "13653" "1" "0.098115" "1.8723596" "-4.25" "0.24882407" "17242" "CCCTCTTTTGTTCTCCCCACCCTGATACTTGTTATTAAGAAATGAATAAAATAAACTCAC" "35393" "1" "0.098166" "-1.8720173" "-4.25" "-0.18743138" "" "CAGTGTTGAAGCCGAAAGCTTCTAAAGAAGTGGTTTCAGAAAAATTAAGAGTTGAATGTA" "62249" "1" "0.09819" "-1.8718575" "-4.25" "-0.17610541" "" "" "49636" "1" "0.098191" "1.8718556" "-4.25" "0.27567696" "" "AGTGTGTCCCTCTTCATCTTGACTATACATTCCTCAGGGATTTGCTAATTTAGCTTTTTT" "774" "1" "0.098198" "1.8718089" "-4.25" "1.08415507" "" "ACACCCTTTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTA" "60709" "1" "0.098222" "-1.8716503" "-4.25" "-0.18845421" "12662" "TTCCCTAACCTGGCCAGGTTTCAGCGATGTTAAAGCTCCCAGCACAGATTCATAAGAAAT" "40867" "1" "0.098227" "-1.8716173" "-4.25" "-0.17296958" "210105" "GGAAGATGTCCTCATAGAAATGGCTTCTTTGTAAAAGTGACTAGGCTGTAGGCAAACTTG" "31095" "1" "0.098231" "-1.871588" "-4.25" "-0.20056882" "208595" "CATCAGACCTTGAAATTGTAAATATTTTGGAGCGTTCTCCTGAATCCTTTTTTCGATCTA" "22990" "1" "0.098239" "-1.8715389" "-4.25" "-0.18928623" "105283" "ACATCCAAGTGCCTATATGCTCTCTTAACTAAACAAAACAAGCACATAGGCTGTAGAGTA" "34008" "1" "0.098287" "-1.8712154" "-4.25" "-0.22253349" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "30679" "1" "0.098287" "-1.8712146" "-4.25" "-0.79619657" "" "GGGAGGATTATTATTCGAGAGAGGATTGTTATTATTGGGAGATATAAACAGGGGAGATAT" "44452" "1" "0.098292" "-1.8711861" "-4.25" "-0.1695236" "170656" "CTGTGGAGGCTGTGGATACGGCTCAAGATATGGCTATGGCTGTGGATACGGCTCAGGCTA" "25428" "1" "0.098309" "-1.871075" "-4.25" "-0.19865247" "" "CCCCGGACAGCGTCCGGACTGAGGGCGGCTTCGAGGGCGTTCGGGACGGCCTGCCGCTGA" "23823" "1" "0.098311" "-1.8710569" "-4.25" "-0.21412615" "217201" "TTGTGAGTTCTGATTCCCCTTTGTTCAGAGGGAGTTTTAAGATGAGCCTAAGATGAAGTC" "24212" "1" "0.098342" "-1.8708518" "-4.25" "-0.24186302" "236915" "CGACTGTTTGACCCTGTCAAACAAGTGTCAAAATTGTGTATTTGGAAATGTTTAACAACA" "60703" "1" "0.098344" "1.8708436" "-4.25" "0.24289904" "18439" "TTTCGGCACTGGAGGAAAATTTGACATCATCCAGCTGGTTGTATACATTGGATCCACCCT" "25715" "1" "0.098402" "-1.8704589" "-4.25" "-0.3165846" "171188" "GCCTGTATATTTGTACCTCATTTCACCCACCCTGTGAAATATTGATAAATAAAACTGTGT" "33828" "1" "0.09842" "1.8703355" "-4.25" "0.67170075" "21817" "AAAGCGTGGAAGCCTGTGTGGGGGTCATCATCCCAAGTTAGCCCACTCCTACCTCTCTGT" "19175" "1" "0.098434" "-1.8702467" "-4.25" "-0.20498411" "73754" "GGAAAAACTTCAAGCCCACCAAGTACAGCAGCATCTGCTCGGAGCACTTCACCCCGGACT" "1709" "1" "0.098436" "1.8702317" "-4.25" "0.59495796" "258519" "GTTCAACAGTTTCTAGTTCTTCCAAGGAAAGTATGGTGGCTTCGGTAATGTATACAATGG" "2465" "1" "0.098466" "1.8700354" "-4.25" "0.20860258" "57783" "GCTGTCTGTTGCTAGGCAGCCGTTTGCACAAATCTTGGACATAAATCCAACTTGAAGATC" "39612" "1" "0.098469" "-1.8700108" "-4.25" "-0.19180302" "67608" "CTGGTTTACCATTTGAGAGAGTGCAGTCATTTATGTCAGAGAAGACACCTCGCATCTCAC" "59266" "1" "0.098515" "-1.8697066" "-4.25" "-0.20639793" "78232" "GCATTCACATGTGGCTTAATCAGAGGTGGTTTGTCGAACTTGGGAATAAAAAGTATTGTA" "18188" "1" "0.098537" "-1.8695639" "-4.25" "-0.42452799" "68939" "GTTGTTGTTTTTCTTCTTTAAACTGTGGCATCAGGTACAGAAAAAAGTGTTAGTTGATGG" "37020" "1" "0.098559" "-1.8694189" "-4.25" "-0.16030096" "" "TGTAACTACACAGAACGCTCCACTTCAGTTTCTGGTCCTCCACTTTGACAGTTAACAGAG" "20204" "1" "0.098601" "-1.8691429" "-4.25" "-0.14242035" "67618" "ATGCTTCAGCTAGTTGTGTTTTACCTTTCTTTTACCTGAAGATTGGTTTGTTGGTTTTTG" "10901" "1" "0.098607" "1.8691022" "-4.25" "0.36460971" "104086" "TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA" "17" "1" "0.09861" "-1.8690803" "-4.25" "-0.18636726" "26572" "CCGTGTACAGTTATCTGGACCACAGGAGGCAGAAAAATATGTTCTACACATGATAGAAGA" "14840" "1" "0.098615" "-1.8690486" "-4.25" "-0.16543398" "" "" "5500" "1" "0.098624" "1.8689883" "-4.25" "0.22313244" "11806" "TTCAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAA" "42064" "1" "0.098625" "1.8689822" "-4.25" "0.4440064" "" "ATTCCAAGACCCTTATGGGGAAACCAAGATTCCACGATAGACTGAAGAGAGGATAAGGAG" "27019" "1" "0.098635" "-1.8689178" "-4.25" "-0.17392796" "" "GATGGCTTTTCCATCCAAGGACTTTCCATTCATATCTCTAGCTGCATCTTTAGCATCTGC" "38550" "1" "0.098678" "-1.8686302" "-4.25" "-0.21016674" "270802" "GGCAACATAAACTTAAGTCCCTATGCACTGCCAGGATTGGAGGAACCTCGAAGATTAGTA" "27827" "1" "0.098681" "-1.8686138" "-4.25" "-0.2250947" "544717" "AGAACTCTAAATGGAGCTTTTGGGACTGAAAGAGAGACGCCACGAACCTCATGTTTCACA" "61768" "1" "0.098684" "-1.8685968" "-4.25" "-0.18388446" "675812" "TTTGCACAAAAGTCCCAGCTTGCTATCCACCAAAAGACTCACTCAGGAGAAGAACCAGAA" "41768" "1" "0.098706" "-1.8684472" "-4.25" "-0.23757921" "432769" "AAGCACTTTGTAAACAGTGTTGCAACACTTTGCTCATCATGTAAATCTTGAGAGATTGGA" "36220" "1" "0.098765" "-1.8680624" "-4.25" "-0.26628842" "226744" "CTGCGGGGATTTGATGATCTTTGTTTCTGCCAATTTTATGTCAAGAAAAGTTCAAATCTC" "23518" "1" "0.098766" "-1.8680503" "-4.25" "-0.28965002" "23829" "GTGATCCTGCATCTGGACGCAGGGGATGAGGTCTTCATCAAGCTGGATGGAGGCAAAGCA" "60268" "1" "0.098773" "1.8680083" "-4.25" "1.32991282" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "13140" "1" "0.098778" "1.8679706" "-4.25" "1.4905727" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "31433" "1" "0.098805" "-1.8677983" "-4.25" "-0.16504096" "66202" "AGAAAGAACTCACAAAAACAAATAAAAAATAGCAGTCTCCTTTCTTTTGACAGTGAAGAT" "28224" "1" "0.09882" "1.8676995" "-4.25" "0.26692856" "545030" "TTGGATTTGATGCTTCAGTGGCTTCTTCAGAAACATCATCAGCAAGAAGTCCTCCAGGCT" "2770" "1" "0.098865" "-1.8673989" "-4.25" "-0.2583437" "" "TTCTCCTCTTTCTAGAGATGCTCACCACCAGGTGCGCCGCGAAGCTTCTGCTTCTCAGAC" "22940" "1" "0.098872" "-1.8673518" "-4.25" "-0.48789348" "66573" "TTGTCACTACGGGTTTGGGTAGAAATCAAGAGTTGTGTTCCAGACTCTGTGTCTACCACA" "42490" "1" "0.098878" "1.8673163" "-4.25" "1.47706318" "69550" "AGGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGT" "10146" "1" "0.098878" "-1.8673139" "-4.25" "-0.1833867" "" "" "38893" "1" "0.098889" "1.8672449" "-4.26" "0.16834217" "" "TAGTGTTAAGTGCAGAGGGCATGGACACAACATCTCTGTTGCAGAAACAAACGGAACACA" "5487" "1" "0.098897" "-1.8671872" "-4.26" "-0.29411753" "329152" "GTTCTGCTATTGTGTTAAAGATAAGTCCTGGATATGGGAAAATGTTCTAGGAGAAAACAA" "48940" "1" "0.098904" "1.8671428" "-4.26" "0.19591404" "226548" "GAGCAATGGTTCATGGGAGTGACTAGCCTCCTAAGTGAGAGTAGACCTAGAATAGGAAAT" "53879" "1" "0.098906" "1.8671321" "-4.26" "1.49087481" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "10734" "1" "0.098914" "1.8670809" "-4.26" "0.39320458" "625360" "GTGTCTTCGCAGCCATCTGGTTTGTGTTTGTTTGTTTGTTTGTTTGTTTGTTTACAGCTT" "51099" "1" "0.098945" "-1.8668724" "-4.26" "-0.38496231" "56744" "CTGGAGAGTTAGGTATCAGCTGCCTAAATGTCAATTGTGTTACAAGACTCCTGGAATCTT" "45892" "1" "0.098947" "-1.8668615" "-4.26" "-0.25064735" "14806" "TAGAAAATATACATCAAGGGGTCTTAGGATCTCAAAGTTAGAATCTTCCCAACTTACAGC" "1370" "1" "0.098949" "-1.8668446" "-4.26" "-1.15918161" "245839" "AACAAAGCTCATGGAGTTTTGTCTTATGTGAAATCCAAGAAGATCTCTTCAGGAGTCTTC" "1921" "1" "0.098959" "1.8667817" "-4.26" "0.5452671" "" "TCTAGAGAACGATTGCAAAAGGCCAAAGGCTGCACTATCACACAAGTCAGTGTTGAGAGA" "28342" "1" "0.099038" "-1.8662647" "-4.26" "-0.17389747" "" "CAAAAATAATGATTTTGATGTTTTTGATATAAGTCACTGCTGTGCTCTCACTATTGTATG" "50" "1" "0.099041" "1.8662405" "-4.26" "0.26604541" "18129" "CCACTTGAAGTCTTGCATAGAAATGAACCAAAGGTGTTCAGTGTTCACGTGTGATTTCAG" "9102" "1" "0.099043" "-1.8662309" "-4.26" "-0.25520568" "15893" "CATGGCAGCCATTCATGAGAGCTTCAAAGGTTATCAACCATATGAATTCACAACGTTAAA" "26770" "1" "0.099052" "1.8661669" "-4.26" "0.29878854" "100041864" "CATCCTGTGAGAACTGGAGAGCGGAGGCGCATAGCAGCAAAAGACAAATATGGAACACGG" "41497" "1" "0.099083" "1.865967" "-4.26" "1.0775971" "" "TGGAAGGGCGTTATACGTTGTAACGGGGAGACATTAAGACATCTGGAGCAGGTATTGTAA" "23340" "1" "0.099093" "-1.8659019" "-4.26" "-0.23335459" "" "GAGTAGGCTGCACTAGGGACAAGAAATTGCAGAATGTTCTTATGTCATTTATTAAAGTTT" "54423" "1" "0.099096" "-1.8658818" "-4.26" "-0.3141807" "72795" "CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA" "57692" "1" "0.099105" "-1.8658243" "-4.26" "-0.15423556" "60507" "AGGTCTGAGTGGAGGAGAAAGCAAGGCACAGTTCTGGAAGATGGTGGCGTTGAGCACCTC" "57293" "1" "0.099118" "-1.8657371" "-4.26" "-0.19153287" "15182" "TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC" "1847" "1" "0.099134" "1.8656321" "-4.26" "0.18148166" "574429" "CACTAAGGATGATATTCTCAAGTTCCATTCAACTGCCTTCAAATTAATGATGTCGTTGTT" "20565" "1" "0.099143" "-1.8655689" "-4.26" "-0.16725831" "67736" "ATGAGGACAAGCAGCGAATGAAGCGGACAGAGATCATCCACCGCTCTTGGTTCCCCTCAG" "2097" "1" "0.099144" "-1.8655641" "-4.26" "-0.42030661" "100044339" "GCGAGATATGTACATTGTTTGAGGCCCAGAGGCTTGACCTATGGCATCCTCCAGAAGTCA" "13991" "1" "0.099145" "-1.8655612" "-4.26" "-0.24421722" "" "CAGCCAGATGACTTAGATAATAGGGGAGTTTGAAATGAATGAGCTGATACTATCTGTAGG" "30411" "1" "0.099165" "-1.8654286" "-4.26" "-0.4218912" "68891" "ACCCGTGGATGTGAGCGAGCGCTGCAGTCCTCCGTCAGAAACAACAGAGTTGTCCTGTTA" "59364" "1" "0.099175" "1.8653632" "-4.26" "0.23693685" "" "TGAGATAGCTGTCGCCAGTTCTCGTAACTCCATGCTAGGATTTGATGTATATGGTCTCCT" "30804" "1" "0.09918" "-1.8653283" "-4.26" "-0.19243176" "" "CCTTGCATATCTGAAGACTGTGAGAAATCTTTAAATGTGTGTTCCAGCATTATTCAAGAT" "33826" "1" "0.099282" "-1.864658" "-4.26" "-0.23342881" "210876" "TTGGGATGGATGGAATGGCAGCATGCTGTTTTCATTGCAAACCATGCCCAGAAAATGAAA" "40896" "1" "0.09929" "-1.8646085" "-4.26" "-0.45726779" "66236" "TCGCAGGAGCTGGACAGGTTGCACACGGAGCTGCAGATACAGATCCTGAACCTTAATTGA" "27625" "1" "0.09931" "1.8644733" "-4.26" "0.93004881" "237887" "TATTGTAACGAACTGAGGCTGAAAACAAAGCTGGAGAGAAGGCTGGCAAGGCAATGTACA" "41327" "1" "0.099323" "-1.8643925" "-4.26" "-0.14349867" "232946" "TAGTGGTGTCTCTCTAGTTTACATCCCTAAATGATGATCACTCCTGACCCGAGGATACCT" "25192" "1" "0.09933" "1.8643481" "-4.26" "0.79895275" "" "TGGATGCTTGACCATACAGAGTGGCACTATTAGGACATGTGGCCTTATTGGAGTATGAGT" "60932" "1" "0.099353" "-1.8641961" "-4.26" "-0.1725837" "226255" "ACCTGCACACGGGAAAGTGTTTTTGCACAACCAAGGGGATCAAGGGTGACCAGTGCCAGC" "38403" "1" "0.099354" "-1.8641872" "-4.26" "-0.20466684" "" "TTAGAAACAGGGCTTTCTTTCCTGTTCTTACAGCATGGCGGCCATATTTGAAACCACGAG" "30008" "1" "0.099358" "-1.8641609" "-4.26" "-0.1587183" "" "GTTAGACTGGTTCCTCATTATGGTGCTCTGGATGTTGCCAACAAAATTGAGATCACCTAA" "30318" "1" "0.099434" "-1.8636611" "-4.26" "-0.19517015" "" "AGTCAGCATGCTTTATACAGATGCTTGGTGGTGGGATGTGGCATCCGAGCTGAAGGTGAA" "25147" "1" "0.099437" "-1.8636407" "-4.26" "-0.16229151" "30931" "CGCTGTAGGGACCACAGATGCAACATGGACCTGAAGCTCCTGGAGCCTCCAGAGATGAAA" "19984" "1" "0.099491" "1.8632878" "-4.26" "0.31487286" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "31783" "1" "0.099509" "-1.8631717" "-4.26" "-0.23109173" "" "TCCTTTGAAAGCCACATACCATCGCACTGCACTAAATAAAAGTCTGTACTGAACCCTGGG" "36635" "1" "0.09953" "1.8630329" "-4.26" "0.45493118" "100040894" "GTGTTTAAAAGAGACATCATGAAGCATACTCTGAAGTACTCTTCTACATTCCCATCTTGA" "50942" "1" "0.099552" "-1.8628885" "-4.26" "-0.17962523" "218194" "CTTAACCAGGTTTCATCGACCTTAACAGTGGGATTACTCTTGAGTGCTCTGCTGTCTTCA" "62594" "1" "0.09957" "-1.8627764" "-4.26" "-0.20291513" "11496" "TGGGAGGCAACAAAAAGAAAATCAGAGGGAAAAGATTTAGACCTCGATCTAACTCAACTG" "14884" "1" "0.099573" "1.8627546" "-4.26" "0.62874232" "14058" "TGGCATCTACACAAAGGTCACGACCTTCCTCAAGTGGATTGACAGGTCCATGAAAGCCAG" "38383" "1" "0.099589" "-1.862649" "-4.26" "-0.19886471" "93736" "ACATGCGTTTAATGTGTATTTTTAAACAAATTTATGGCAATTAAAATATTTGGAGACAAG" "45427" "1" "0.099605" "1.8625425" "-4.26" "0.23100307" "52570" "AACTGCAAGAGACACAATCCAAGAAACAGGAACACAGTGTTGTTTTTACTGAGTAGAGAG" "50315" "1" "0.099614" "-1.8624834" "-4.26" "-0.14877654" "" "AATCTAATTCCTGCTCTCTGACACAGCGTTTGCAACACAGCAGGTAGAACTTGCCATATC" "58285" "1" "0.099646" "1.8622787" "-4.26" "0.20067519" "" "TCATGAGTCTCCAAAGGGTGACATCTATTCAGGTATCCATTCAACTCCTCAGGCTTCACT" "7207" "1" "0.099666" "-1.8621455" "-4.26" "-0.16243771" "65116" "TTAGTCTATATGGGATTGGCCACCTGCCTGGACACCTCACCTCACAGAGAGCAAAACCAA" "52680" "1" "0.099737" "-1.8616846" "-4.26" "-0.20324508" "16561" "CTTCTGATCCTTCTAGCATAGCACATTGTTTCTCCTTTCATAGGTAACACGACAAATAGG" "6275" "1" "0.099752" "1.8615812" "-4.26" "0.26053862" "212980" "AGTCTCCCACCCCCCACTTGTTTCAGGAAATGGCTCAGCTTGTTGGCCACAGAGACACAG" "3513" "1" "0.099761" "-1.8615265" "-4.26" "-0.25685427" "270120" "TGGTTGTGTGTCGGAGGGGGTTTAAAGTAGCCATTCGTGGGTTTGACATCAGTGAATATT" "956" "1" "0.099786" "1.8613597" "-4.26" "0.23631711" "" "AGCTGTGGAGGGGACACCTCTGATTGCTTTCATTCTAACAGCTCGGAGAGGCTGGGGTTA" "21795" "1" "0.099804" "-1.8612467" "-4.26" "-0.18610974" "69962" "TTTAAGCACCCCAGTTAATATGCACCGAATGGCGTAATGAAATAAAAAGAATACCCCAGA" "60555" "1" "0.099893" "-1.8606628" "-4.26" "-0.28872294" "" "TATTCTGAGAAAAGCTAAAGTCCTGGTTTCACCTGCCACCAGGCTGTCCTCTAAACAGTA" "45957" "1" "0.099896" "1.8606467" "-4.26" "0.2246191" "57783" "TGAGATGACTCCGGCCTCCACAGTTAGATGTTTATGGTGCCAGAGGTCTATATTAAGGTA" "31282" "1" "0.099896" "1.8606443" "-4.26" "0.95933788" "667977" "GGAGTTGTGATCATCATTGGAGCTATGGTGCCTTTTGTGTTGAAGAGCAGGAGAAAAATA" "16317" "1" "0.099916" "1.8605119" "-4.26" "0.2104688" "" "TCCTTCTTAATTGAAGTGAAGAGAGGCTGTTCCTAAGCAAACACCAAGGTTGACCGTCAT" "42461" "1" "0.09992" "-1.8604855" "-4.26" "-0.15894076" "66268" "CCTGGCTGTTGCAGATTCTTTTGTAGCTGAAAAATACTTTTCAATAAAATGTCTTATGGG" "33792" "1" "0.099925" "-1.8604526" "-4.26" "-0.38440493" "20269" "GAGAAAGAACACCTCTGAAAGATACCTTTCTAGAAAAGTGTTGTTATACAAACATAGAGG" "5971" "1" "0.099928" "1.8604354" "-4.26" "0.1965825" "" "TGCACCATGTGCAGAACTATCCCACACAGTTAAACAAAACAAAAAACCCAAAGTGCAGCA" "53926" "1" "0.099946" "1.8603155" "-4.26" "0.30659189" "" "GAAGAAGAAGAAAATGGTGGAATTCTTTGTCACTTCCTATATCCCTGCCTTATAACATTA" "30356" "1" "0.099995" "-1.8599975" "-4.26" "-0.17728016" "66361" "CCACTATCAGTAGACAGTCAGCTTTGTTGTGTTTGTTTTGTTTGTTTTACTACAGATACT" "52021" "1" "0.100009" "1.8599047" "-4.26" "0.30229172" "18476" "AAGGCATCCCTCTGCCAGAGACAGCATCCTAAGCATCTTTCCTTCCCTTGATATTAAATG" "21265" "1" "0.100021" "1.8598324" "-4.26" "0.67111464" "79410" "TCATACATCTGTATTTGTAGTAAGAGACTGGATAAATTTCCTCATTGACTCTCCAACGAG" "23783" "1" "0.100029" "-1.8597802" "-4.26" "-0.23341392" "" "" "29363" "1" "0.100029" "-1.8597789" "-4.26" "-0.2690487" "18107" "AGGCTCTGAAGAGGTTTCATGGAGCTGTCTACGTCTAAGAGAGAAAGAGACTCTCAGAAA" "45022" "1" "0.10005" "1.8596402" "-4.26" "1.59265006" "15013" "AGATCCCCCAAAGGCACATGTGACTCATCACCCCAGATCTCAAGGTGATGTCACCCTGAG" "50220" "1" "0.100054" "1.8596123" "-4.26" "0.81089223" "229323" "ACCAATAGCTAGCAAACGGGACTGGTTCATGCAGAAAGTCCTTTCTTCAATCCAAGCCAA" "5147" "1" "0.100113" "1.8592286" "-4.26" "0.84513562" "" "CCATCTGGGCATTCACATGTTTGAAATATAAAACACAGACTTTTTATCAAAGGATCCCTT" "12597" "1" "0.100118" "-1.8591958" "-4.26" "-0.2403977" "68729" "GGACACCATGCTTTTTTCAGTTCATTATGCTTAACCAAACACCAATAAAAAGCTGAACAA" "17766" "1" "0.100133" "1.8591027" "-4.26" "0.5666229" "101488" "CAGTTTGTACAGGAATAGCCTGGCTGTATACATACAGCTGATTATTAAATTTGTCTCTGC" "27241" "1" "0.100149" "-1.858993" "-4.26" "-0.56727944" "73301" "CCCGTGAATCCATAAGGGTAGTACATTACCAAGAATAAAGACTTTCTTCCTTTTCAATGC" "40240" "1" "0.100162" "1.8589123" "-4.26" "0.29291566" "53881" "GGCTTCAGTTTCAAAGAAAATAGAATTTGATATAAGCCAGGTTACTTCCATCTTGAAAGG" "27252" "1" "0.100194" "1.8587058" "-4.26" "1.5548387" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "34941" "1" "0.100237" "-1.8584213" "-4.26" "-0.15127958" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "24877" "1" "0.10024" "1.8584025" "-4.26" "0.32822914" "224440" "GGAGGATGTACCAGCGGCTGCGTCTTTACTGAGGTTGGAATAAACAGACTTTTATATGAA" "58905" "1" "0.100265" "-1.8582388" "-4.26" "-0.14565974" "258587" "AAAGTGCTATCCATAGAGTTATCAAAAAGCAGAAAGGCTCAAGACTTAAATTCAGAGTGG" "34744" "1" "0.100304" "-1.8579895" "-4.26" "-0.31551582" "57895" "GAGGAGTCCTGAGCATCTCTGATTTCATTGCTTTCAGGGATGAAATAAAATATATTGTTT" "36955" "1" "0.100317" "-1.8579056" "-4.26" "-0.22056468" "72745" "CCTATTGTCTACAAGTACTGTTACTTGAGAGTAGCAGGAATATTCTTTTAAAGTGAATGC" "48267" "1" "0.100335" "1.8577889" "-4.26" "0.16949428" "321020" "AGGTTTTGTGAATTCCAGTCGTCCTTTACGTGTCCTCACTGCTGTAGCAATTTCTTTCTT" "20920" "1" "0.100372" "-1.8575453" "-4.26" "-0.19480523" "17126" "TTTTCTGCCTTTTACCAAAAATAAACAAACTCTTGGGGGAAGACAAGTGGATTAACTTGG" "14019" "1" "0.100374" "-1.8575309" "-4.26" "-0.2720348" "12424" "CTTCAGTGACTCCCAGACCTAATGTTGCTATGCTATTAAAGAGATTTCCTTCTGCCCCTC" "20269" "1" "0.100392" "1.8574146" "-4.26" "0.38532698" "57781" "GCACATGGTTATGGTGAAATATCAAGTTGTGCAATAAAGTATGATGAAAACTGAGTTTCC" "28883" "1" "0.100398" "1.8573755" "-4.26" "0.39550704" "" "TTGGATGATTGACCCCTACATGCCAGCTGTATTTGAAGAATAAAAGTTCTGTGTCTTTAC" "26792" "1" "0.100415" "-1.8572703" "-4.26" "-0.26446994" "108067" "TTGTGGATGCCCATCTCTACTGCCTGAAGAAGTACGTTGTGGATTTCTTAATGGAGAATA" "19148" "1" "0.100415" "1.8572676" "-4.26" "0.21521829" "" "TGCAGCAGAAAGATGTAAGCTGCAGAGAAGCTAGAAACTCCTAACCTTCTACTGAAACCT" "35898" "1" "0.100429" "-1.857179" "-4.26" "-0.17702991" "66756" "TGAGCCGTGATGTATATGAGGATGCAGAGGCTTTAAAGAATGATTCAAGATGTGTGAAAT" "8856" "1" "0.10044" "-1.8571029" "-4.26" "-0.19572838" "" "GTAACACAGCTTCCTAATGTACAGCATGTTAAAAGAAAGTGATGGGTATCTCAAATGAAT" "16862" "1" "0.100446" "1.8570671" "-4.26" "0.31713478" "" "GTGTGGGCTCAGTGGGCTCAGTGTGGGCTCAGTGTGGGCTCAGTGTGGGCTCAGTGTGGG" "5690" "1" "0.100449" "1.8570489" "-4.26" "0.1695735" "" "" "11533" "1" "0.100455" "-1.8570091" "-4.26" "-0.18857884" "76367" "ACACCGAGACCGCGTTTGAAGCCTTTCTGAAGAGTTACGGGGCCTCGTCCAAGAAGTCCA" "16653" "1" "0.100469" "1.8569169" "-4.26" "0.2138077" "243910" "GTGATTGTTCCCCTTGGTCTGTGTATCCCTGTAGCTACCAATTAAACTCAATTTGGCCTC" "26037" "1" "0.100503" "-1.8566987" "-4.26" "-0.18834976" "619331" "ACAGTAACCGGCATTGGAAGAGTTACAGTGGTGAAAAGTCCTGTGAAAGGGATTCTCACA" "24317" "1" "0.100507" "1.8566696" "-4.26" "0.30285219" "" "TGCCCAGTAAACATGCCCTGTGTGGTCTGAGTCTCAGACTCATCTGCTACCCTGCTAAAC" "19090" "1" "0.100511" "1.856648" "-4.26" "0.33957177" "" "GCCATGTGTAATCTAATCCAAAACAATCCATACATGTGTGTATCTGGATTTGCCTTTAAA" "36259" "1" "0.100532" "1.8565068" "-4.26" "0.22592696" "" "AAACTCAGAAGGAGCTCCCTCTGTGACCTCATGCTCAGGATACTCAGAGGGAGCACTCTC" "11300" "1" "0.100553" "-1.8563736" "-4.26" "-0.2059074" "71886" "ATAGCCAGAGTCAGTAGGACCTGCATATGTCGGACCCATCCAAGATTTGATTTCCACATT" "24417" "1" "0.100563" "-1.8563112" "-4.26" "-0.23880356" "258994" "ACCCCTTTATTTACAGCTTAAGAAACAAGGAAGTTTTGGGTGCTCTAAAGAAACTCATAA" "42969" "1" "0.100572" "-1.8562493" "-4.26" "-0.20400276" "353155" "GGCGGCAGCGGCCACAGCAAAGCGTCGCTGGCTACCGTGCGCCAGGACCTGGCCATCTAG" "2444" "1" "0.100608" "1.856018" "-4.26" "0.23660158" "" "" "4530" "1" "0.100686" "1.8555103" "-4.26" "0.21157825" "" "ATAATGTTATACCAGACACACAGATGGGCAGGGAATAGCGATGAAGGAGGCTAAGAAGCA" "62350" "1" "0.100696" "1.8554467" "-4.26" "1.16681371" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "37523" "1" "0.100723" "-1.8552723" "-4.26" "-0.25029072" "" "TAGCAGTGCTGGGTGGATGCTCTATTTTATTACACTCTCCCAGCTTTAAACAGGCTTGGA" "53304" "1" "0.10073" "-1.8552281" "-4.26" "-0.21464769" "211712" "TCAGAAATGTCCCGGCTCTACCAGTTTCCACATTCGAGAGAATGAAGAAAGTCATTCTGA" "48312" "1" "0.10075" "1.8550956" "-4.26" "1.24267079" "320832" "AAATACTGCTGTTAATTGCTGCCACTGTCATTTACATGCATAAGAAGCAAAATGCCTGAA" "31181" "1" "0.100767" "-1.8549896" "-4.26" "-0.14167019" "71640" "AGACCTTTAAGCCTTAGAATGCATCAAGAATAACAAGCAAGAATCCACTCCAGGGGAGGG" "21731" "1" "0.1008" "-1.8547751" "-4.26" "-0.42494766" "" "AGCCACTGAGGAGTTCATGCTGAAACTGGGTGGTGAAAGCTGACAGCCAAAGCAGTTCTT" "1742" "1" "0.100813" "-1.8546887" "-4.26" "-0.42126942" "" "GTGAAGGCACTGCAAACACAATGGTAAGTCTTTGAAATGTGCATGTATTAGTTACTTTCA" "36879" "1" "0.100813" "-1.8546885" "-4.26" "-0.28950706" "" "CCATATAGACGGAGGGGCACTTGCCTAGCAAGTGAGGGGTCCCAGGGTCAGTACCCTGAA" "10119" "1" "0.100837" "1.8545332" "-4.26" "1.49548571" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "34149" "1" "0.100838" "1.854531" "-4.26" "0.62124485" "239849" "ATGGCCCTTTTGGTGATTATTCTTCTTAACGTAGGATTTGCTTTCTTCCAGAAGAGAAAT" "786" "1" "0.100857" "-1.8544074" "-4.26" "-0.15872367" "20482" "TGCCAATGCATATAGTTTTATGATTAAAATTGCTGTGGTTGGTTGCATTACATGACACAC" "58728" "1" "0.100865" "-1.8543532" "-4.26" "-0.1564339" "100042408" "TTTCAAAGCCACTGGCATTCCTAAATCTTATTCTGCTTTCTGATTAAAGATGTGAGCCCT" "61365" "1" "0.100938" "1.8538833" "-4.26" "0.63951759" "" "TTGAGAGTCTATTGCTGTTCTGAGAGCTCCTTTTTTTCCAAGATGCCATATTATTATTAT" "6725" "1" "0.100946" "1.853831" "-4.26" "0.79226039" "317757" "ATTAATTTCACTCTCATTTGATTCCCATGGATCAGACATGCCAGGGAATCTTCTTTTAAA" "30943" "1" "0.100964" "1.8537161" "-4.26" "0.20437636" "100046275" "AAGCGCTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGAAAC" "46090" "1" "0.100978" "-1.8536243" "-4.26" "-0.25042657" "230857" "AAAGGCAGAGTAATGACCTTCATATCACGTGGCACCCGAACACTCTAGACTAGAACATAG" "3496" "1" "0.101" "1.8534843" "-4.26" "0.16831248" "" "ACCCGAGTATCTTGAAGATTATTTTTGGACTACATTAATAAACAGATACTGTTGCCTGTC" "47074" "1" "0.10101" "-1.8534194" "-4.26" "-0.18512365" "" "CGCGGAGATCAGCGGATGGAAACTGAACACAGCATTGGTATTGTGCTTACCTCTTCATTT" "60359" "1" "0.101026" "-1.8533119" "-4.26" "-0.30295283" "107650" "TAGCCATGGGGAAATTTCTTACCCTGATCCTTTCCTCACATCCAGGGAAACAGCTTTTTT" "39595" "1" "0.101041" "1.8532178" "-4.26" "0.21267571" "19885" "TTGAGGTTGCAGCTCTGAGAAGCCTGAGGTTCTAATTCATACAGGACACCAGAATTCATC" "22833" "1" "0.101072" "1.8530204" "-4.26" "0.33470085" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "46761" "1" "0.101072" "-1.8530174" "-4.26" "-0.20215644" "67685" "CATAACCACATAGTTTTCTTTGTATCATTTGTCGTTTGAGGCTAGACCAGTTAGAGTATA" "45928" "1" "0.101089" "-1.852909" "-4.26" "-0.25734088" "212398" "GAGGGCGCCTCTCCTGCTAAACCTGTCAGTTCTTGGTGAGTGACTGAAACTTTTTTAAAA" "4066" "1" "0.101097" "1.8528558" "-4.26" "0.20323173" "229776" "TTGCCCTAGGAGAAGCCTCACGTGAAGTAGGAAGTACTAATGGAAGGGTGGAGACATGTC" "8352" "1" "0.101103" "-1.8528148" "-4.26" "-0.21800637" "" "GAGCGTTTGGTGGTGGATGGTGGATTCATCTTTTGATTCTTGTTATTTCATTTCTTATTT" "494" "1" "0.101107" "1.8527908" "-4.26" "0.46943115" "" "TGATGAACTAGAAATCTCAAATCCCAGGGACCCTCTCTCCATTTCTGAGCAGACTGAAAC" "9651" "1" "0.101163" "-1.8524341" "-4.26" "-0.19018988" "" "GGCCTTGACTTGGGATGTCCTGGAGGTGCATGTAAAAATAATACCTCTGTGAATCTCTGT" "56683" "1" "0.101165" "-1.8524175" "-4.26" "-0.15870762" "" "TTGCTGATGGAGAAAGAGACTTTACAGGCAAAGTTCTGAAGCACAGTGGATGGATGCTCT" "17690" "1" "0.101174" "-1.8523627" "-4.26" "-0.19842365" "72083" "ACTTGCAGAGACTCTGTCCAACACAGATCCCTTTTCAGGCTATACGAATGGCGGCGGCGG" "25892" "1" "0.101225" "-1.8520324" "-4.26" "-0.21722604" "" "AGCAGAGCGGAGGAGCCATCTTGTCTTGTCGCCGGGGAGTCAGGCCCCTAACTCGAAGAA" "36654" "1" "0.101252" "-1.8518563" "-4.26" "-0.32918428" "239857" "ATTTGCGGGGAAGAAGGATGATTGAATACAACATCCTATGCTAATAACAACACGAGGACA" "58147" "1" "0.101281" "1.8516733" "-4.26" "1.07177267" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "824" "1" "0.101289" "-1.851622" "-4.26" "-0.17307207" "" "GCAAAAAGGCCAGGAGCTGCAGGAAAGCATTCGTGGGTGCCGATGATAGCTGAGCTCTGA" "43784" "1" "0.101318" "-1.8514333" "-4.26" "-0.16894021" "66583" "GAATCTCATTTAAAGGCACTCAACAAACAAAATCATGTAATATTGAAAATACCTTATGCC" "2036" "1" "0.101321" "1.851414" "-4.26" "0.41505523" "" "TGAACAGAACAGGAAGTGCTTCCTATGTCAGAAAGAGCTTCAGACGAAGCATCTGTGAAG" "46349" "1" "0.101337" "-1.8513111" "-4.26" "-0.22851068" "" "GTGCCCACATCAATTTGTGTGATTGATTGTGCTCAGTTTTCTTCTCGTTTGAGATAATCT" "32120" "1" "0.10135" "-1.851228" "-4.26" "-0.17273187" "" "AATAGAGCAAAAAGGGACCATGTCTGCCCCGGTGCTGGCTAGATCTTATTTGCTTACTTA" "31358" "1" "0.101359" "-1.8511708" "-4.26" "-0.22143218" "26895" "CCTAAGGGGAGATGGAGACCCTGTACTGATTTAAACCTAATTAAGTTTTAAAAAGTACAT" "48578" "1" "0.101391" "-1.850963" "-4.26" "-0.24168619" "244911" "GCGTGCCAGTGTGGTCCGCCGCAGCCGCAAGGCCGCCCTGGACCAGGACTGCTGCTTTGA" "25400" "1" "0.101406" "-1.8508683" "-4.26" "-0.25164845" "15251" "CCTAATCTGTTACTACTTGTGTGTAATTGTCAACTTGATGTTTCTGCCTACACCATTTTC" "11177" "1" "0.101436" "1.8506712" "-4.26" "0.6378336" "78416" "TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC" "28725" "1" "0.101455" "1.8505498" "-4.26" "0.45376651" "319929" "TGGATAGCTGTCAATGTGGCCCAAGGCAAAAAGTGTAAGCTTACTGAAAAAGAGATTTGG" "7449" "1" "0.101458" "1.8505332" "-4.26" "0.18515606" "" "TACTTCCAACTAACAGCACAGCAGTGTCAAACATGTTACTAAGTCCCCTTCTGGTGAAGA" "22935" "1" "0.101461" "1.8505107" "-4.26" "0.20173333" "" "" "40572" "1" "0.101556" "-1.8499034" "-4.26" "-0.15543216" "" "CTTTGCCCTCAGCACACCTGGGCATCCTGACACAGAAAAGAAAGGGATGCAAAAATAATT" "54533" "1" "0.101571" "-1.8498082" "-4.26" "-0.29987508" "24109" "AGATTGGCGTGTAGCATTATAGACCAGTATTCCATATCAATAACTTTATCCAGCCTTTTG" "1395" "1" "0.101583" "1.8497311" "-4.26" "0.67961548" "100017" "TCTGGCATCCTGAATCTCAGCCAAACTAACAACATCTTTCCATCGCTTGTGAAAGCTGGT" "52354" "1" "0.101598" "-1.8496357" "-4.26" "-0.1524988" "68515" "CCATCAACTGAGTGTCCTTCAGGTCTTACAGCAGAAAATAAAAAGTGGATGTCTGGTTTC" "36581" "1" "0.101616" "1.8495183" "-4.26" "0.37652457" "" "TGAGGCACTGGCCATCAGGGGCTCTTCCTAGGACTTGCTACCATTTCCAATACCTCTTCC" "4277" "1" "0.101621" "-1.8494871" "-4.26" "-0.2121992" "70383" "CTCGACACAGCCAAAGAGAAAAAGGAAGAAAGGCAGTGGAAAGAGATGAAACTTCACACT" "5075" "1" "0.101665" "1.8492009" "-4.26" "0.55610879" "29862" "GCTCCAGGCCTCAATGTTCCCTTTCTGCAAAATGGAATCTATCTATAAAGATATCTGAAA" "42963" "1" "0.101716" "-1.8488796" "-4.26" "-0.25554586" "19352" "GGAGACATTTGGGGAGAAATTGATACAAGATTCTCATTTTGTGCGGTGGCAACTTTGGCT" "29707" "1" "0.101727" "1.848809" "-4.26" "0.23705083" "" "TGATACTCTGTCTAGTTGGGGATGTGGAGGAACGGCTACGGGCTGGAAAGCTTCCCGTTG" "14362" "1" "0.101732" "-1.8487766" "-4.26" "-0.2338816" "" "AATTGCAGGTGTTGAGTGGGGTGCTCTGGCTTGAATTGTGAATATTTCAAGGGACCACAT" "60884" "1" "0.101756" "-1.8486216" "-4.26" "-0.22416286" "231014" "GTGTGACTTGGATATTATTTTTGAAAGAAGTTTGACGGTGAACTTGATCAAGCTTGTGTA" "61551" "1" "0.101763" "1.8485786" "-4.26" "0.53438253" "" "TCATCAAAGTTTTCAACGAGTACTCTGAAGTCTCTCCTCACAGAGGAAGCCTGACTGTCA" "48345" "1" "0.101788" "-1.8484131" "-4.26" "-0.17172213" "77519" "GTGGAAAGGCCTTTAAAAATATGTCATACCTTAATGATCACGTTAGAATTCACACTGGAA" "58429" "1" "0.101794" "1.8483792" "-4.26" "0.24595937" "22268" "CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG" "20765" "1" "0.101816" "1.8482358" "-4.26" "0.17330781" "" "" "9208" "1" "0.10182" "-1.8482127" "-4.26" "-0.16381926" "" "" "56369" "1" "0.101825" "-1.8481806" "-4.26" "-0.14400155" "70556" "AGTGTTCAAAACTGAAACAGTGAAGGCCATAGAATACCTGGCTCATGTCACCTGTTGGAC" "31193" "1" "0.101827" "-1.8481636" "-4.26" "-0.5731873" "66977" "ATCTTTGTAAACTTGAAAAGTGCTCTGGAGAAGTACCATGAGGGCATCGAGAAGGTAGCG" "17254" "1" "0.101828" "-1.8481608" "-4.26" "-0.14219991" "57782" "GTTTCGCAATCTCGGCTTTGAATCATTTGTGAGAACATGTCAGCAAGGATTAAAATGACT" "34576" "1" "0.101841" "-1.848079" "-4.26" "-0.29957638" "" "ATGAAATCAAAAGAATACATTTTAATGTAACTGGGGATGTGCTAGGTTCTAAGGCAGCTT" "61882" "1" "0.10185" "-1.8480156" "-4.26" "-0.21155156" "544807" "AAACAGGTTTCCCTTTTCTACTGCTGGTTGTTTTGAAACCAACTCACACAAAACCACCTC" "24072" "1" "0.10186" "1.8479528" "-4.26" "0.47708331" "317758" "GGAGGCAGCCCTGAAGTACATGATCATCTTGTTTACTCACAAAGAAGACCTTGAGGATCA" "36874" "1" "0.1019" "-1.8476996" "-4.26" "-0.21209218" "" "TTTTAAGCAGTGTAAAAGGAACCTGTGCCCCATGGATTGGAAGTCATCTTGGCTAGGACA" "58959" "1" "0.1019" "1.8476959" "-4.26" "0.33604704" "320782" "CCTCTGTTATGGAAATAGAGATGGAAGAGCTTGATAAATGGATGAACAGCATGAACAGAA" "12815" "1" "0.101913" "-1.8476152" "-4.26" "-0.1449799" "212569" "TTTGGCCTGATATAAGAACTCATTACACACTTTGGATCATGCAGATAAGTCTGTGAGGAC" "37289" "1" "0.10192" "-1.8475735" "-4.26" "-0.50548615" "11553" "TGACTTCCTATGACCTGAAAAAGGCATCTGTCTGGGGGAGGAGAGATAGCACAGGCAATC" "30799" "1" "0.101933" "-1.8474856" "-4.26" "-0.17194575" "" "AGTCAACTTAGACAAGTACTAGCAGATTTCCACATAAGAAATCAAACAAGACTTGGGGGA" "22109" "1" "0.101936" "1.847468" "-4.26" "0.22504062" "56376" "AATGATGGCGTTTCGTGTTTTCTTCGTTTCTATAATGAATAAAAGCGTGTGATCCTGCTG" "23036" "1" "0.101958" "1.847325" "-4.26" "0.16415651" "78243" "ATGTCCAAAATTCAGCTTTTCCTTGTCATCACACATCTGATGGTATACGCAACTGCCAAA" "59018" "1" "0.101962" "-1.8473008" "-4.26" "-0.18889128" "20523" "AGCACAGTTCCTGCTATGTATGCTTTTGACCTTGGTTCTCATTAAAGTATTTATTGGTTG" "55612" "1" "0.101988" "-1.847136" "-4.26" "-0.17125333" "" "AGCTCTATACATCCTGCTTACCAGGAGGTTGGGAGCCACTGTGGGACTCTGAGAAGCTTA" "57381" "1" "0.101993" "-1.8471048" "-4.26" "-1.01330444" "238692" "CCTGTACCTCTGTATCTGTTGTTGTGGTATAAACTGCTCCTGGAATAGGCACCTATGTAT" "40100" "1" "0.101996" "-1.8470833" "-4.26" "-0.41805309" "67724" "CTGTCTCTGTCACCATCTGATTTAAGATATATTGTGGAACTGCGTGGAAACAAGAATTAA" "9255" "1" "0.102009" "1.8470015" "-4.26" "0.15508622" "140484" "AGGAACTGTTGCTGAAGTGCTTCCTTTATATCCTAATAACTCTTCCATTACCCGTGCCGG" "46231" "1" "0.102013" "-1.8469735" "-4.26" "-0.21481046" "545600" "AGCCTAGATGCATGTAACCTGTGTTCTTGGACTTGGATCCATTGTACTACAAGTTAAAAA" "26367" "1" "0.102034" "-1.8468425" "-4.26" "-0.14922727" "12176" "CTGTCCCACACTTAACTCAGGTGTGCTAAAATAAAAGTGACATTTTAACAGTCTTTTGTT" "26290" "1" "0.102036" "-1.8468275" "-4.26" "-0.22469945" "171382" "TAAGTGTTGACACTCCTTTCCCACGACTGTGACTCTGGCCCTGATTTTATACTTATACTG" "53843" "1" "0.102045" "1.8467694" "-4.27" "0.48469393" "16427" "GAGGCCGAGACCTTGATGGGAAGAGGATGCTCCCTTGTTACAAATAAAGAAGGGCAGTGT" "6903" "1" "0.102064" "1.8466516" "-4.27" "0.45689891" "" "TATTTTCCCAAGAAGATCTCAGAGCTGGATGTGTTCTTAAAGAAGCCAGCTCTCAATGAC" "29839" "1" "0.102081" "-1.846539" "-4.27" "-0.24019179" "67252" "CGATCACGCACATACACATTCAGTTGTACTTTAATAGTCAAAATGAAAATTGCCATCACA" "30221" "1" "0.10209" "-1.846484" "-4.27" "-0.55445141" "51800" "AACAAGAGATCCTGTGGATGAGGGGGTTTGTATAAGTTAAAATCCAATAAAGCTTTACCT" "57467" "1" "0.10209" "1.8464825" "-4.27" "0.18425123" "" "TTCTCAAATGGATGTCAACCAGTGTAATTTTTCCATGTGGCAGAACTATGCTTTTCTCAA" "47887" "1" "0.102115" "1.8463242" "-4.27" "0.88110552" "11857" "AGCTCTCCTTTTGTGGGAGACACTGTAAACAACACCAAAGGAAAAGAATAAAATCGTTGT" "40697" "1" "0.102146" "-1.8461286" "-4.27" "-0.15937755" "" "GAGGGCAGTTCTGGGCTTTTGTGTATCTGAGTGACCTTGGCCTACAGCTGCCCTGCAGGT" "49712" "1" "0.102152" "-1.846087" "-4.27" "-0.18274645" "71973" "CTGTTGTAATTGGTGACCCTGTGAGAATGTGAAACTGGATCATAAATGAAATGCAAAATA" "49737" "1" "0.102152" "-1.8460858" "-4.27" "-0.15509133" "56861" "AACAAAGAGGTTAAAGAAGCCATGAAAAAACTGATTGCTAAAACACATTGGTGGTCCTGA" "19345" "1" "0.102156" "-1.8460618" "-4.27" "-0.16495357" "22598" "AAGTGGTGGGAGTCATTCACATTTATGGGATGAAACGGTTCTGTGATGACATTGAATGGA" "57506" "1" "0.102194" "1.8458216" "-4.27" "0.50561122" "" "TGTATTAGCAGAAGCTAACTGAAGCGTTGAGGCAGAGACATGGCCTGATCCATAATACCT" "40780" "1" "0.102229" "-1.8455995" "-4.27" "-0.29029505" "93887" "ACTTTCTGGTGCAGTTAACCTTTTATCTTTGGCAAAATAATGCCCGTTGATGCCTTCTTT" "22326" "1" "0.102243" "1.8455041" "-4.27" "0.54056861" "13024" "AACACTGTGGTGTAAACTCTGAGGCACATTCATGCAATAAAACTACTAGTTTTGGCAGTC" "49408" "1" "0.102248" "-1.845478" "-4.27" "-0.14907346" "19226" "ACTGACATATGCTGCTACCTTTTCAAGCTTATGAAGATCACCAAGTGCTAATACTTCTAC" "54713" "1" "0.102257" "-1.8454186" "-4.27" "-0.20657433" "226791" "TAACATTTTTTCTTATTTGATCCTCACAAAAATTAAGGTTTTTGAAACAGCCCGTGCCCC" "13193" "1" "0.102274" "-1.8453076" "-4.27" "-0.29705202" "67897" "CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT" "3038" "1" "0.10228" "1.8452693" "-4.27" "0.23500101" "" "TGCTCTGAATACTCTACAGTTAGATTCTTGGCCACCTTTGTTTGGTTCTTTGAGAAAAAA" "56839" "1" "0.102282" "1.8452566" "-4.27" "0.341393" "" "CACGTCACCGCCAAGGTCACCTTCTGGGAGGATTTTGACTCAGGATACAATCTATTTTCC" "26863" "1" "0.102291" "-1.8452025" "-4.27" "-0.34237518" "72397" "TAGGAGAAGCCATTGTTGCTATGACAAATTATAATGAAGCTCTAGCTGCAGTTAAAGATC" "58827" "1" "0.10235" "1.844827" "-4.27" "0.67096072" "107526" "ATTCATGATTCTCTTGCTCACCAGGAAGGATGACTTAGAAGACACTGATATCCATGAGTA" "29909" "1" "0.102355" "-1.8447957" "-4.27" "-0.24141891" "232334" "TTATGAAGATGGACCTGTTGAACTACCAATACTTGGACAAGATGAACAACAATATCGGCG" "25151" "1" "0.102359" "-1.8447667" "-4.27" "-0.16769776" "242050" "CCTCATCTTAACAAATAAAACAAACAACGACAAAGGAATAACCATAGCCTTCATGTGCAA" "50804" "1" "0.102365" "-1.8447293" "-4.27" "-0.16721339" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "22405" "1" "0.102421" "-1.8443722" "-4.27" "-0.17277258" "" "AGAGCTGTTACCTCCTTTGGGCTAAGCAGATCGAATCGCTCTAGCACTCACTTGGGCGGC" "17356" "1" "0.10245" "-1.8441887" "-4.27" "-0.246481" "" "TTTTTTAGAATGAAGAGAGTTGAGGATGAGCCGCTGTCTTCAAGTGTACCCTGCACTGGA" "54389" "1" "0.102488" "-1.8439475" "-4.27" "-0.17625508" "20595" "ATGAAAGTCAAGTTTCCACAGACGACAGTGAACACTCCTCCAGATCGCTCAGAAGTAAAG" "20202" "1" "0.10251" "-1.8438033" "-4.27" "-0.2094355" "" "TACATCAAGATCTGCTAAGCATCCAGGAGGGCTCTGAGAATGCCAATTTTTGCTGGTACT" "56317" "1" "0.102519" "-1.8437482" "-4.27" "-0.21227816" "330695" "GGACGCTGCCTACCTATAATGCACGGTACAGTTTGCCTCAGAGACAGACCCAGAAACCCC" "10609" "1" "0.102523" "1.8437245" "-4.27" "1.38465329" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "18925" "1" "0.102532" "1.8436643" "-4.27" "0.73667334" "619326" "ACCCAATAAGTGGCAATCTTATAGGGGACCATTACATGTTCTTAAAGGACCAGGAAACAT" "56909" "1" "0.102536" "-1.843639" "-4.27" "-0.22133381" "30049" "AAGACATCCGTCCTGAAATGAAAGAAGATATATACGACCCCACCTATCAGGATGAGGAGG" "49903" "1" "0.102545" "-1.8435814" "-4.27" "-0.18847594" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "9990" "1" "0.102562" "-1.8434775" "-4.27" "-0.17835092" "" "ACCAACTTCTTGTTGCGGGCTGACCGTATTGAGGGAATCCTCACCCGCTTCCTGCCACAT" "38924" "1" "0.102572" "1.8434127" "-4.27" "0.25631907" "78267" "AAGTCAAGCGGTGGAAGCACTGTGTCTACGGGATGGAGTCTGAAGACCTGGTGAGACCCA" "33097" "1" "0.102577" "-1.8433769" "-4.27" "-0.18069213" "" "TCCCTGTTCTTTTGAAATCACAGCCTTAGTTTGTCCCTATTCGGCTTTGTTCCTGCACGT" "31991" "1" "0.102599" "-1.8432405" "-4.27" "-0.20512338" "" "GGGATTACATTTAATTTTTCCTTGGGATCTGAAACATTCCCCATTTGCATAGGATATAAC" "10693" "1" "0.102612" "1.8431598" "-4.27" "1.36884118" "547253" "TGACTAGCCAACCAATGTTACAGACACTTTCATTCAAAGTAAATATGTCATTGTCTTCAC" "17745" "1" "0.102643" "1.8429574" "-4.27" "0.2638825" "12479" "TCTGGGGATGAAGGAGAGGAATCCTGAAGAAGTGAAGAGCAGCCAGTACGCTCTTTTCAA" "19657" "1" "0.10265" "-1.8429131" "-4.27" "-0.19670077" "71675" "TCAACTGGCTGATAAAATATGTTAAACGGAACACTAAGGAGAGTAAAGATTGTGAGATTC" "1922" "1" "0.102666" "1.8428135" "-4.27" "0.27747531" "20755" "GTTCCCATGGAAACCAACATCATTGTATAAACCTTTGTGATATCAACTTCCTATAGATGA" "49387" "1" "0.102703" "-1.8425762" "-4.27" "-0.18827494" "" "ACAGAGTCAAAGTCGCCCAAGCAGGCTTCAAACTTGCTATGTAGCCAAGAATGACCTTTA" "19563" "1" "0.102722" "-1.8424569" "-4.27" "-0.15788725" "20021" "TGGTTTTCAGGCAGCATGGGGGGAAACACACACCAGCACGGAAAAGAAGGAATATTTATT" "9541" "1" "0.102723" "1.8424536" "-4.27" "0.47372584" "66988" "TTGAGTTCTTACTTCGATTCAGTAAAGACAGTTCTTAGTTCACTCACAGATTACTCCATC" "28310" "1" "0.102726" "-1.8424305" "-4.27" "-0.64109125" "16536" "AACTCTGGAGTTAGCCAGGATTTCCTGCCAGATGAATGTGGTCTCTGTATCTTTCTTTTT" "61772" "1" "0.102736" "1.8423668" "-4.27" "0.33842994" "70789" "GCACTTTTATACTGGACAGCTGTTCAACATTCCTGCCATAACAAAAGCTGGACATGCAAA" "342" "1" "0.102745" "-1.8423145" "-4.27" "-0.46895646" "" "AAAGAGAAGCAAAAGACACCCCAGTTGTTATTAATAGGCCAAAGTAAAAGATTCACTCAC" "30511" "1" "0.102752" "1.8422656" "-4.27" "0.29282441" "27027" "GCACTGGAATCGAATCAAGATTGCCAAATGCCAGATACTGATCACCAACTTCCTAGTCTT" "13409" "1" "0.102762" "1.8422039" "-4.27" "0.47480883" "" "GGTATGCCTGCATGTCTGTTGTCTGCATGTCTACTTCCTTGTTCTGTCACTTGGTTGCAC" "30806" "1" "0.102786" "-1.8420493" "-4.27" "-0.20020632" "" "GTCAACGCTGTCGTTTTTATGTACCGTTCAAGCACAAAAACTACGAGACTTATGTTATTT" "11169" "1" "0.10279" "-1.8420265" "-4.27" "-0.37839348" "320865" "AGCTCACTGGACTCCGCAACCACGCAATCAGACCAGGATTATCACTACCTTGGAGACTGG" "46930" "1" "0.102795" "-1.8419976" "-4.27" "-0.14572712" "" "AGCCTGTTCTGCCCTGGATGCTTTATTAAGTAATGAAGCTCAATAAAACAATTTGACCAA" "5840" "1" "0.102807" "1.8419207" "-4.27" "0.40903304" "" "ATCAATAGATGTAACAGTGGGAAGACTATTTTGCCAAGTTCCAGCCTCCAGCACGGCAAA" "2990" "1" "0.102808" "1.8419115" "-4.27" "0.74779125" "74923" "CTTTTCACCCTTAGATACTGCACTTCATTTGTAAAATGGAAATAAAATCACTCTGATCCG" "13921" "1" "0.102824" "-1.8418138" "-4.27" "-0.20960781" "232934" "TAATAGTTACTGTTCATGACTTAAAGAGAAGCAACGTGTGGGGACCTCCCTACTCCCCCA" "15493" "1" "0.102862" "1.8415699" "-4.27" "1.47135004" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "42360" "1" "0.10287" "1.8415182" "-4.27" "1.47564689" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "58025" "1" "0.102875" "-1.8414848" "-4.27" "-0.13663128" "19016" "GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG" "32946" "1" "0.102888" "-1.8414048" "-4.27" "-0.20582503" "14680" "TTATTCATTATCTGTCTCTCTATCTGCATTGCTAGGGATGAGCCCAGCACCTAGAGCATG" "30214" "1" "0.102906" "-1.8412915" "-4.27" "-0.29020385" "" "TTATGCAGATGTCTTACCAGTCTTGTGAATAAAGTGCAGATGACATACTTTGTATTGTAG" "15947" "1" "0.102912" "-1.8412535" "-4.27" "-0.1848724" "239650" "ATCCTTTCTTAGTGCTTTGCTTGATGTCAACCTTAATAAAAAGGCACCATGTCCCCTCTT" "19471" "1" "0.102922" "1.8411899" "-4.27" "0.16546277" "67718" "AAGACTTCAAACAAATGGTGCAGGAGGAGCACATGCTCAGAAGATTATCCATTGCCCGAT" "19098" "1" "0.102926" "1.8411666" "-4.27" "0.19872204" "17172" "CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA" "10655" "1" "0.102936" "-1.8410984" "-4.27" "-0.24968819" "224344" "CATGCTTATGAATGACAAAAGCCTTGAAACAGTAATATATTGTTGTGCGTTTGCATTTGC" "52279" "1" "0.102938" "-1.8410895" "-4.27" "-0.15998082" "66662" "GCTGAGGACTTGTTAAATAGGTAAGATTTTACAGTGGAGAAACTGTTGTGAGTAACATGG" "33004" "1" "0.102941" "-1.8410687" "-4.27" "-0.24056273" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "37482" "1" "0.102943" "-1.8410564" "-4.27" "-0.28075988" "18503" "TCAATTGTTGTAGTCATAAACATATTACTGGTGAGAGTCTGACTTCACCTGTTAAACATG" "52113" "1" "0.102957" "1.8409693" "-4.27" "0.27703281" "16992" "AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC" "61088" "1" "0.10299" "1.8407569" "-4.27" "0.14455253" "18140" "AGCTATACGGCAACATCAGGCTCTTGAATGACTCTCAGCTCAACAACTGTCGGATCATGT" "43858" "1" "0.10299" "1.8407557" "-4.27" "0.17279819" "69824" "GGTTTATGGTGCAAACGTTTGTGTCTAGAAAGCCTCCATTCAAGCTACTCCAATAAACGA" "37039" "1" "0.102998" "-1.8407091" "-4.27" "-0.16720478" "13929" "TTGCCCTATCTGCTTACGAAAGCTGCAGAGTGCCATTGGCTTCAATATTGTGGAGAGATA" "35207" "1" "0.103041" "-1.8404331" "-4.27" "-0.20728459" "19325" "GACTGACAGTTTTGTTGTTTGCATAATTATAATCGACATTGTACAGAGAAAGGATAAGGC" "6986" "1" "0.103043" "1.8404235" "-4.27" "0.26717071" "381417" "GGTGGAGGTGAGGGGAGATATTTTTAAAGTTATATTGGAAACATGTGTGAATTTAAAGAC" "16087" "1" "0.103096" "1.8400861" "-4.27" "0.70346259" "16184" "GTGGCTTCTGTTTGATCTCTCTCAATGATAGATTGTGACCTAGAAGTATAAGCTAAAATA" "3454" "1" "0.103097" "1.8400831" "-4.27" "0.26346251" "57376" "CCAGAAGACGAGAAGAAGGAGTAAATGTTGCCTTGTTTTATGTGACCTAAAACTTTTTTA" "35917" "1" "0.103097" "-1.8400808" "-4.27" "-0.20917537" "" "ACTATGAAAAATGTAGTACCTTATGAAATTCCTTTATCAAAACTCTTTCACTTCTAGCTC" "23941" "1" "0.103098" "-1.8400762" "-4.27" "-0.24134183" "100040257" "TTATGTTGTTTGAAATACTTTCCAGACTGCTAGGAAGTGTCCCCAAGTGGGGGGCATGAA" "31731" "1" "0.103104" "-1.8400376" "-4.27" "-0.19749812" "434377" "TGTATGGTCATAATCAGTTTGTTGGAGTATTTAGTTGGTGTAGTTATAGTTTTATGAGGA" "36120" "1" "0.103108" "-1.8400104" "-4.27" "-0.17545187" "" "CTGCATTGCAGTGCTTACTTTCCGGTGTTGAAATGAGGGGAAACAATCTTACATTGGTGT" "10997" "1" "0.103132" "1.8398586" "-4.27" "0.26825383" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "21803" "1" "0.103139" "1.8398183" "-4.27" "1.48369448" "21354" "TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG" "28438" "1" "0.103184" "1.8395319" "-4.27" "0.462405" "114643" "TGTCTGTGTGAGGGTGAGATTTGAAGCACTGAATTAAATCACAATGCACTGACTCGAACT" "178" "1" "0.103201" "-1.8394223" "-4.27" "-0.34216058" "" "AAAGGAGTTTCTCCATTAGCACAGAATAAACTTCTTTCATCTATGGTTTGTGGGTCATGC" "11557" "1" "0.103243" "-1.8391578" "-4.27" "-0.23408521" "" "AATCAAGAAAAGAACTCAACAAATTGGGAGAGTCTGGGCTAGGAAGAAGGCTCAGCAGCA" "24958" "1" "0.10327" "-1.8389889" "-4.27" "-0.32197859" "" "TTTAAAGGAAGAATATGTATTATTATGCACTCTTACACATAAAATGAAAAGATTTTTAAA" "8226" "1" "0.103278" "1.8389389" "-4.27" "0.87567105" "57444" "AAGATGCCAGGGCCACAATGGAGCTCTACAAAATCTCTCAGCGACTCAGAGCCCAGCGAG" "44217" "1" "0.103287" "1.8388771" "-4.27" "0.25052517" "21788" "ATACTGTAACTGATCGCAGTACTGTAAATAACATCGTGGTTCCCCAGTCTCCCAAAGTGC" "19997" "1" "0.103308" "-1.8387446" "-4.27" "-0.19434213" "239554" "CATGGAGAGTCCCAGTATGGGCAACTTAAAAAGATCCTCTCTCAAAGAAACTTTAAAAGG" "16792" "1" "0.103318" "1.8386848" "-4.27" "0.43527784" "77037" "ACCGGGACAAAACCAAGTTTACAAAGAGGACCATCACACACATTGATAGTGCAGCTAGGA" "5623" "1" "0.103343" "-1.8385257" "-4.27" "-0.19042591" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "50946" "1" "0.103354" "-1.8384545" "-4.27" "-0.21368534" "73942" "TTGACAAAATCAAACAGGTACAGCTTAACTGTTTGGACTGGAAAAGATGACATTTATTCC" "32910" "1" "0.103365" "-1.8383857" "-4.27" "-0.17712022" "21374" "GTACATACTTTTCTTTCTTCAGAGTACTCTGCACAAAAACGCAGCTTGTAAATTGTTAGA" "18294" "1" "0.103385" "1.83826" "-4.27" "0.28113176" "" "GCTTCTTTCTCCCAACTTTTGACATTAAGGATCTGTTCAGAAGACAAAAATTAGTGACTA" "33432" "1" "0.103396" "-1.838194" "-4.27" "-0.21581179" "54367" "TTTGAACTTAAAATGCTGCTCTTGGGAGTGAACCTTTAAGTGTGCATTCAGTTTTTGAGT" "25245" "1" "0.103436" "-1.8379392" "-4.27" "-0.20604307" "" "" "846" "1" "0.103452" "-1.8378378" "-4.27" "-0.20965522" "" "" "13163" "1" "0.103485" "1.8376319" "-4.27" "0.25544847" "258701" "GGTATTTTCAACACTGTCATCAACCCTATGCTAAACCCACTCATCTACAGTCTTAGGAAC" "60410" "1" "0.103485" "-1.8376293" "-4.27" "-0.36952102" "20606" "ACGCCTTCTTGTCTGACAACTTCAAGAAGAGCTTCCAGAATGTTCTTTGCTTGGTCAAGG" "51986" "1" "0.10349" "1.8375952" "-4.27" "0.60130886" "16855" "AGCACCTTTTCGACTTCTCCCATCGGTTCCAAGCATTCCAAATGGTAGACACGCTGGAGA" "48307" "1" "0.103507" "-1.8374926" "-4.27" "-0.18148822" "66973" "ACAGCGGACCCGAAAGACATGTATTCGTAACAATAAAGTTGCTGGGAATCCTTGCCCAAT" "24651" "1" "0.103528" "-1.8373562" "-4.27" "-0.32559079" "66112" "AGAATGTTCTGTTACCCCTGGACATGGTGCATACAACGGGAATTAAATACTCTCCCAAGT" "58318" "1" "0.103532" "1.8373346" "-4.27" "0.15989286" "" "GCTAAATGACATAAACGGGGCCACAGTCCCTGTTCTTCACATTTTCTAATTACCTTTTTA" "56209" "1" "0.103547" "1.837239" "-4.27" "0.38118188" "544881" "GAGGAGTCCAGAAACAGAGACACATTAAAAACGTGTTGGTATATACACATTGTTTTCTTT" "2477" "1" "0.103556" "1.8371841" "-4.27" "1.21203994" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "15283" "1" "0.103585" "-1.8369995" "-4.27" "-0.15658555" "110460" "GTCATCAAGGGCTCCAGAGTGAACAGCATTTTCATAACTTCCATGTTTATCGTCTTTACT" "44966" "1" "0.103605" "1.8368727" "-4.27" "0.18783601" "319887" "TCGGGCCCCTTCCCCTGCTTCATAACTGAGTGTCGGAATTAGTAAAATCGAACCTTGATC" "34551" "1" "0.103616" "1.8368062" "-4.27" "0.25197558" "268749" "ATTCGCTACCTACATTTAGCTCCTCAGCCCGCGGATGGAGAGGATCTGCCTGCTTACCAG" "34259" "1" "0.10363" "1.836714" "-4.27" "1.25076779" "21936" "CCACCAAGAGCACCACGTTTAGCACAAGATCTTGTACAAGAATAAATACTTGTCTAGTAA" "19711" "1" "0.103669" "1.8364674" "-4.27" "0.40803253" "230979" "CCGAGGAGGAGACAGCCTCCAACTGAACAAATTCTGGGTGACAAGACACCGAGGAGACGT" "47564" "1" "0.103745" "-1.8359933" "-4.27" "-0.30192798" "436062" "TGGGGTCTCGCTTTCTTTATTGGCACAGTAGGCCGCTCTACCGGCCTATACTCCCTGTGT" "54976" "1" "0.103747" "1.8359774" "-4.27" "0.4496355" "18617" "TGGAGTGAGATGGGGAGAAAGATGCCCTTTTGCGACACCGAGATTTTGATTTGATCACAT" "16222" "1" "0.103752" "-1.8359491" "-4.27" "-0.20566269" "" "TTGCTTGTTCAAAAGGCACTGACCCCTCTGCTGAGCTGCAAGATACTTAAGTTTGTTCAG" "4823" "1" "0.103782" "-1.8357588" "-4.27" "-0.14854047" "78926" "TGATCAAGGTCTCCGAGGGGAAGTACCGAGTGGGAGACTCCAGCTTGCTCATCTTCGTGA" "20831" "1" "0.103786" "-1.8357362" "-4.27" "-0.14283206" "28030" "TTCACTTCAGGTTAGCCTGGCAGAAAACTAGTTTCTTAAAATAATAACAATTCTTCTTTC" "15077" "1" "0.103792" "-1.8356951" "-4.27" "-0.22007519" "" "ATATTTAAGTGAGTAACAGAAGAGTGCTGCTCAGAGTTAACAGTCACGTGGAGGAGTGGG" "14196" "1" "0.103795" "-1.8356805" "-4.27" "-0.17682681" "240396" "GTAGGATAGTTGATTGTCAGTATTGAATCCTAATCTCTAGCTGCCGTCTTGTAGATATGG" "19980" "1" "0.103809" "1.8355884" "-4.27" "0.86127608" "21753" "CCATCCTTGGGTGTTTTTAATGTTTTCCCTTGTATGCATTCATACATAACTATGCACTAT" "60090" "1" "0.103831" "1.8354526" "-4.27" "0.229683" "15529" "TAATGGCCTTAATTCATACCTTTCTGTCCAATTACAGCTGTAATTCACCATGTTAAAAGG" "39977" "1" "0.103842" "-1.8353793" "-4.27" "-0.15370547" "57394" "TTTGCATTGTTACAGTTGCAATTGCACTACTGGTTCTATCTGGAATCCGGCAACGCAGAA" "615" "1" "0.103895" "1.8350483" "-4.27" "0.57977629" "353211" "TATGTGCTTACATGTAGTACTGTATGGCTGGGTTCAAAGGACACTGATGCATCCAGGACT" "59197" "1" "0.103995" "-1.8344241" "-4.27" "-0.14360382" "" "TTTGCAGGCTGCTCGTTGGTTTTACAGCCTTCTTGTTTTATTCCTTCTGCATTAAAACTA" "50355" "1" "0.104078" "1.8338984" "-4.27" "0.20697418" "17318" "AGGTTGGATGTCACCACCACAAGGGAAAACAAACACATGGGTTTTTCCCCAACACGATTA" "19529" "1" "0.104196" "1.8331608" "-4.27" "0.6850715" "109032" "ATATAAATGAAGGTGAACATCGCCTATGCCATCAACAAGCCATTCCCCTTCTTCGAAGCG" "30043" "1" "0.104216" "1.8330367" "-4.27" "0.6528307" "78416" "TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC" "48384" "1" "0.104289" "-1.8325794" "-4.27" "-0.21084162" "66816" "CACATAAGTTATGTAGTTCTTCTTCAAGTTTGTGAGCTTACCATATGAACATAACATGCC" "11340" "1" "0.104302" "1.8324981" "-4.27" "0.27778409" "52276" "TCTCCTATTCTGTTGTCATTTGTGCCCTCTATGGGCGGGTGTGTTTCAAGTTGGTTTTCT" "29810" "1" "0.104329" "-1.832328" "-4.27" "-0.1750039" "" "TACAAGCTTCTTTGTGGTCTTCTCTGACCTCACAGAGAACAGACCTCACCTTTATCTTGG" "59609" "1" "0.104331" "1.8323137" "-4.27" "0.20781287" "" "TTTATAAGGACAGAATTACAAAGTTAGAAGCAGCTGTGAAGGAGGCCCAGGAAATGGCGG" "55734" "1" "0.104351" "1.8321925" "-4.27" "0.13592781" "" "GCCAATCAGGAACTCCATGAAGCCGCCCCAATCAGAAGAAGAGGAGAGTTCTTCCAGGTG" "8250" "1" "0.104388" "1.8319615" "-4.27" "0.18426861" "" "TTTTTTTCTAACACATTCTAAATTGAGGTATAATTACATTTAAAAAAACAACAAAAAAAA" "39071" "1" "0.104412" "-1.831807" "-4.27" "-0.18856225" "17532" "GCTTTCCATGCTGTGGGTAAATTCTATGTTCAGATATGGACAGTGTCCCTGTTTGCTCTC" "37542" "1" "0.104422" "-1.8317452" "-4.27" "-0.18262754" "67458" "TTAGCAAAACTTCCCTTTTTATATGAGTTGATTCTTATTGTGTATGTAAACTGCCCCTGG" "48723" "1" "0.104423" "-1.8317372" "-4.27" "-0.17080258" "" "CTCTATGAAGCCCTTCTGCCCTTTGGTATCCTGTGCCAAGGGCTGTGAGGCCGGGACTCC" "37877" "1" "0.10443" "-1.831696" "-4.27" "-0.28577613" "" "TGGAAGGATGCTCCTCCTGCCAATTGGCACTTATCAATGACATCGAGGGAGAGGGACAGA" "84" "1" "0.104443" "1.8316178" "-4.27" "0.25424935" "233016" "AATAGAGGGGTCAATAAATTTTTAGCCAAAAGCTTCAAATTCTTTCAGGAAGCCTAACCC" "2553" "1" "0.104447" "-1.8315928" "-4.27" "-0.29117952" "237730" "ATGGAGAACGGGGAGAAACAGGAGTACCGCACGTGGAATCCCTTCCGCTCCAAATTGGCA" "44689" "1" "0.104455" "1.8315395" "-4.27" "0.16374734" "70310" "AGCTTCCGATTGTGGCACTCTGAGGGGATCCTTGCCTCCTCACTAATAGCTGTAGCGGTT" "28032" "1" "0.104458" "-1.8315212" "-4.27" "-0.18525422" "" "GTGTTGTTCATTCTGACATCATAGCCATCTATTGCAAATTCACCTTTCTGTTGTTTGTCT" "29984" "1" "0.104476" "-1.8314063" "-4.27" "-0.22999907" "240888" "ACTGCACTTGCCCACCCAAGAGGAGGAGCTCCGTGACATTTGAGGACGAAGTGGAACAGA" "50943" "1" "0.104498" "1.8312711" "-4.27" "0.44536583" "" "TACCATTTCCATAAGAGAAGAAAAGTAAAGCTTAAGGCTCATGGTCTTCTGGGGAAAAAA" "13243" "1" "0.10454" "-1.8310108" "-4.27" "-0.18939309" "" "ACAATTTAAACGGGCCTCAAAGCACGAGATTGGCTGGGGAACTGCCCTGAGCGCAGTTGG" "62971" "1" "0.104573" "1.8308005" "-4.27" "1.26330308" "238393" "AAGGTTTAAGAAGGGAACCTGCAACTGTGGTCCTATCTGCAGCATCTGAAATGTTTGGTG" "6541" "1" "0.104606" "-1.8305966" "-4.27" "-0.24729846" "71928" "GAGTGGTATGCTGTAAATGTTTTATAGAATTTAGTTGGAGATACAACCAGTATTGAAGGG" "59200" "1" "0.104606" "1.8305955" "-4.27" "0.22487777" "18127" "TGTAGACTCCCTTTAACTCTCTCTCTGGAGTATCTTACGTTTAAAGTCTAAGTCATCCCG" "13812" "1" "0.104618" "-1.8305241" "-4.27" "-0.25682701" "666021" "ATTCATTTGGAAACCCATCTCCAATCTCCAACTCAGATACCATGGTCAGCTCCTGTTGTG" "29555" "1" "0.104622" "-1.830497" "-4.27" "-0.14888447" "22717" "CTCACTGGGTGTATCAACACCTCAGGGCCCACACAAAATAAACTTGGTGGTATTTTTGTG" "26498" "1" "0.104634" "1.8304207" "-4.27" "0.16769953" "13649" "GTTGCAAGCCACTCTAACTGTAGCAATGAAACCCTAGTATTTTTGTACTTTGAAATACTT" "28358" "1" "0.104648" "-1.8303365" "-4.27" "-0.30059729" "77604" "GGATTGCCTTTAGGAGAAGCTATCGTTTCTATGACAAATTATAATGAAGCTCTATCTGCA" "29685" "1" "0.104687" "1.8300934" "-4.27" "0.5449092" "58179" "ACAGCAGACAGCTGTACAACTTTACATCCATATCTTTGTAAGTGTAAATTCCCCATCTGA" "39149" "1" "0.104697" "-1.8300311" "-4.27" "-0.24520961" "" "AAATTCTTGAGTATGTGCAGAGGGAAGGGCTAGGAGACGGGATTCTAGTTTTACTGCTTG" "3518" "1" "0.104704" "-1.8299882" "-4.27" "-0.59232048" "271970" "CCGTGATGAATCATGAGTGAGTTGACCAAACAGAATGCTTTGAATCCCTTGAATCACGAG" "23822" "1" "0.104752" "-1.8296848" "-4.27" "-0.27427801" "" "CTTTTCCGATTGCTTCCTGTGCCTGTCCAAATGTTGGAGGCCTGCAGAGATTTGTCCTAG" "26215" "1" "0.104762" "-1.8296253" "-4.27" "-0.15027221" "" "CCAGGAGGTGGCAATAAAGAATCTTATTTTTGCAGTGAGACTTCTTTTCTTAAAATAGCT" "24052" "1" "0.104767" "1.8295934" "-4.27" "0.70447699" "233328" "GCTTCGTGCCTGTTGGCTTCTGGCAACGGTTCATAGCACGGATGCTAATCAGCTTGGCTG" "62429" "1" "0.104787" "1.8294679" "-4.27" "0.36818896" "54698" "TGACAAGAGGCTTCCTGACTAACCATGAGCCAACCTGACAGGCCACTTTTATCCTAATTA" "23824" "1" "0.104805" "1.8293536" "-4.27" "0.41976557" "" "ATTGATCACCCTGGCTTGTCTATTGGAGATACTTCGAAGAAACTGGGTGTGATGTGGTCT" "47323" "1" "0.104834" "-1.829172" "-4.27" "-0.177512" "" "" "33795" "1" "0.104852" "-1.8290616" "-4.27" "-0.3475481" "56323" "GGGTTCTTAGGTTTTCTCACTTTGACAAGCCCCTGAATGTTTTTATAGTAGTTTTTTGTA" "62967" "1" "0.10487" "-1.8289529" "-4.27" "-0.16753419" "229333" "GTGATGTGCTGGTAATTCTGCTCCTTGTGTATGGTTGTTGGACATGTTTGGTGCTTTTTT" "27844" "1" "0.104871" "1.8289414" "-4.27" "0.52606969" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "404" "1" "0.104879" "-1.8288972" "-4.27" "-0.14591917" "" "CCGGTTATCAGTAGTTCTGAATGTTAGATATTTTTTCCATGGGGTCAAAGATATCAAAGT" "3166" "1" "0.104893" "-1.8288078" "-4.27" "-0.20600211" "81006" "GATATACTACTGGAGGATTAAGAAGTTCCACGATGCCTGCTTAGATATGATGCCCAAGTC" "31286" "1" "0.104906" "-1.8287269" "-4.27" "-0.14789642" "" "CATCCACATCTTGAAGTTTGAAGTTTGACCAAGAATATACATAGTAGATTCTCTTTCTCA" "49448" "1" "0.10491" "1.8287003" "-4.27" "1.35334325" "15951" "AGTCGGGAGAACCTCTCTGGAACCATACTTCTGAAAACCTGAATGCCAATGATATTTTTT" "36663" "1" "0.104939" "-1.8285196" "-4.27" "-0.16504047" "" "ACAGCTCTTCCTTTCCTCTGCATTGCAATGCATCCTGCACTAACCTGATTGTCATTATTT" "17084" "1" "0.104943" "-1.8284983" "-4.27" "-0.16253761" "56205" "GGTCTCTCTGGTTCTGCAGAACAAGTTGAGGATTTAGGATAAACTGTTCCTTTTAAAAAA" "16677" "1" "0.104959" "1.8283956" "-4.27" "0.32750794" "" "AAGATCAGGGGCAACTCAAGGGCATGCGGATCTTTCTAAGTCTTTTAAAGTTCATCAAGG" "37311" "1" "0.104965" "-1.8283567" "-4.27" "-0.18744403" "" "AAACCTGTGCTTTTAAACCCTTCCCCAGGGTTTTGTAAGTGCTAACAGGTACTTGGGAAG" "51165" "1" "0.10498" "-1.8282687" "-4.27" "-0.15239029" "66251" "ATGGTGCCGATTCCTACTGGAAGAAAGACAGCAGCAGAGACCCCGAGCCTGCCATGAGAA" "30247" "1" "0.104982" "-1.8282522" "-4.27" "-0.23454792" "214932" "CTTGCCATTACTTCCTGGGACAGAGAAGACTGTAGCTTCAGTAGCTACAGAAAGCCCTTG" "42026" "1" "0.105072" "-1.8276947" "-4.27" "-0.1769495" "" "TTCCAAAACGTAGCTCTTGGTCTTGGTGGGCAGAGTAGCTTCCTAGCCCTGAAAATCAAA" "32148" "1" "0.105105" "1.827492" "-4.27" "0.29393288" "" "ATCTGATCATCCGGCTTGTAGCTCATGATATTGGTCGAAAAGAGTCAGATAGTAGCTTAA" "46961" "1" "0.105109" "1.8274663" "-4.27" "0.1618713" "" "ATTACCTTTTCTGGTTACCTAAGATTGTAAGACCAAGAGCCTTCTGACTACAAGGGCCTG" "18322" "1" "0.105109" "-1.8274638" "-4.27" "-0.21879095" "72139" "CGTGATACATCAAAATGTTAAATGTATAAACCTGTTCTCCAAAGCAAAAATAAAAGGGTC" "32660" "1" "0.105115" "-1.827428" "-4.27" "-0.24359342" "" "" "56758" "1" "0.105128" "-1.8273441" "-4.27" "-0.16656462" "232493" "CTTTCCAAAGGGGAAGAAAAAGCTTCATGGAGAATATAAGAACTGACTGAGCTCAAACGA" "22170" "1" "0.105131" "1.8273285" "-4.27" "0.77182789" "" "CGGGAAGATGCCTGCCACCACCCCTTCCAGGCAAGTTTCTTGTCTACAGATACAGCCAAG" "56647" "1" "0.105167" "-1.8271066" "-4.27" "-0.15526151" "67872" "TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG" "12261" "1" "0.105189" "-1.8269667" "-4.27" "-0.19619775" "277939" "GCGGAATGCCATGTTGATTTCTGCAATGAACTCCAACCCAGATACTAGTATGCTGCTTGA" "29296" "1" "0.105189" "-1.826966" "-4.27" "-0.25989854" "" "TTAAATAAAGGAAAATCTTTTTTGAAATGTAATGACACATTTGAACCTTACTTCATGACG" "60656" "1" "0.105243" "1.8266321" "-4.27" "0.5959683" "57916" "CCTGGAGAATATAGCCTGGCTCCATTTGCAATGTTCCCTTAAATTGTTTTTATTAGTATA" "13025" "1" "0.105246" "-1.8266111" "-4.27" "-0.17628938" "66044" "ACAGGGCTGGTGTTAGGCAACCAATAATAACATATTGTATGAGACTTTGCATCTTGTACA" "28068" "1" "0.105275" "-1.8264314" "-4.27" "-0.2488842" "243548" "GGCAGAGGACAGTTGCATAGCAGGAAAAGACAGAAGAGCAAAAACTGTATCATTTCGTAA" "59139" "1" "0.105291" "-1.8263367" "-4.27" "-0.17424593" "76123" "CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT" "60322" "1" "0.105292" "-1.8263249" "-4.27" "-0.21725896" "" "TCTCCTTCAGCAAGGACAGAGGGGCTTGGCATCCAAAGCAGCTGAGCTGGCGATGGAATT" "2623" "1" "0.105294" "-1.8263151" "-4.27" "-0.31822991" "18754" "ACGTTCCTTTTGGACCCCTACATTGCCCTTAACGTGGACGACTCGCGCATCGGCCAAACA" "4875" "1" "0.105299" "-1.826285" "-4.28" "-0.20417739" "" "TGCTGTACACTCTAGCAAGCAGTGAAGAGACTGTTGGGTCAGTAGGTGACAGCTGCAGAG" "21507" "1" "0.105325" "-1.8261226" "-4.28" "-0.24114832" "" "CAGCAGTGTTTCTATTGGAGCTATGCTATGTGGTTTTCTTTATTGGTCTTTTATGATGAA" "60400" "1" "0.105382" "1.8257679" "-4.28" "0.15234984" "" "ATGGATCAGAGCATCTTACCTTCATGAGGGACTACATGTGTGAGAACTGTGCTGAGAAGA" "38535" "1" "0.105386" "-1.8257469" "-4.28" "-0.17890698" "" "CACTGGCTGTTTGCACAGCTAAGTTAACCCCCTTTAGCTTTTTATTAATTTAATCAATAG" "47889" "1" "0.105396" "1.825681" "-4.28" "1.250144" "23900" "GATCCTGTGGGTTTGGGGTGCGTGGGAACGCACTTCTTCAGGACAGGAATAAAGCGATTC" "15784" "1" "0.105413" "-1.8255756" "-4.28" "-0.20006248" "" "GCCTGTTCACAAAGTTCACAAAGGACCCGTTTTCACTGTGTCCTACAATTGGGTCATGTA" "34695" "1" "0.10542" "1.8255322" "-4.28" "0.29970168" "13548" "TTTCTGCTAATACAGGTCCTGCACATTACATGACTGAAGGACATCTGGCGATGAGACAAG" "49424" "1" "0.105436" "1.8254343" "-4.28" "0.26379129" "75778" "ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT" "35401" "1" "0.105441" "-1.8254031" "-4.28" "-0.20285676" "233905" "TTCCCCCAAGAAGGGCATGAGGTAGTCTTCATGTCTGTGCCCATGAAGGATGAAGGATCT" "33615" "1" "0.10545" "-1.8253512" "-4.28" "-0.16467696" "67949" "GTAAGAAATGTCACCATCTCCTGTTGTAAGTTTCTGTACCCTTTCTATGCTTTTGTTTTA" "31751" "1" "0.105458" "-1.8252983" "-4.28" "-0.34140965" "75873" "ATTTCAAAATCTTACCCATGGCTTACAAGTTCAGAACAGTTACACACTTAACAGACTCAG" "54229" "1" "0.105488" "-1.8251132" "-4.28" "-0.1940693" "74513" "TCTCCGCATCCAATCTTGTTCTATCAAATTTAGAAAGCCCTTCATAACTTATCATAATGC" "4296" "1" "0.105493" "-1.8250813" "-4.28" "-0.48610021" "12563" "ATTATGACTATTTGAGTGACTGGGGCCCTCGGTTCAAAAAGCTGGCAGATATGTATGGAG" "3356" "1" "0.105503" "-1.8250179" "-4.28" "-0.20082097" "193116" "ATTGTGTTCTATCTCTACCTCGACATGGGTGGTTCAACACAAAGTCGGTTATTGGTGTCT" "46795" "1" "0.105518" "1.8249284" "-4.28" "0.14804193" "" "ATCCTGTTGAGGTTCACACTGCATCTTCAGCCTTCCTTCTTAGTGGAGAAAACAGAATGG" "35024" "1" "0.105519" "-1.8249189" "-4.28" "-0.18289359" "" "AAAGAGCCATACTGTGTAGTCTTGAAGTCCCTCATTTAAACAGGTTGAGCAGTGTCCACC" "54089" "1" "0.105541" "-1.8247862" "-4.28" "-0.29624982" "19652" "ATGACAGTCGTCCTGGAGGATATGGATATGGGTATGGGCGGTCTAGAGACTACAGTGGCA" "43928" "1" "0.105544" "-1.824768" "-4.28" "-0.22071033" "" "TTTTCATGAGTCAGATGACTTACTGAAGTTTTGGGATCAAGGTGCCTCCTTGCCATCCCA" "5692" "1" "0.105549" "1.8247332" "-4.28" "0.18693233" "53877" "ACAATGCAGATACCAAACGACAGGTTCAGTGAAGTACTACAGAGTAGCCTGTGAGAACAG" "24975" "1" "0.105552" "-1.8247171" "-4.28" "-0.23900742" "258089" "GGGATCGGTATGTGTCTATGCATGTCTTGCTTTTACTGTGTTATGATATCCTACTTTTAC" "45869" "1" "0.105566" "-1.8246298" "-4.28" "-0.31198276" "71827" "TGGCAAGTTTACAGTGGATTTTGAGAGAGATCAAAGTTCAGAAGTCAAAAAGTATTCCAC" "38607" "1" "0.105597" "1.8244408" "-4.28" "0.36399941" "23853" "AGACAAGATCATACGCCCCTCCCTCCAGACCAAGTTATGGAGACATACTTCCAAATAAAA" "32632" "1" "0.105648" "-1.8241214" "-4.28" "-0.17763597" "68790" "GAAGATGATGGTGACACTTTCTGGGAAGACCTTCCCGGATCTCCAGAGGTACGGAACCGA" "626" "1" "0.105657" "-1.8240652" "-4.28" "-0.38373099" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "48221" "1" "0.105675" "1.823953" "-4.28" "0.20304756" "52398" "CGAGTAACTTGGTGTCTGTTATCGTAGTGTGGTGCCAGGTGACCTATGCATATATCACTA" "20577" "1" "0.105693" "-1.8238468" "-4.28" "-0.19681748" "" "AAGTGAGAAATTTTGAAGTACAGCGTGGTGACATTGTGTCATTGGTGTAAGTAACTCAGT" "8025" "1" "0.105749" "1.8234966" "-4.28" "0.63640957" "21926" "TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG" "34311" "1" "0.105777" "-1.8233254" "-4.28" "-0.15876004" "100191037" "AGATGTAGCCTCCCAACTTGTCCCTTGTGACTTGATCTCTCCTCCTGCTTCCTAGGAGGC" "37479" "1" "0.105784" "-1.8232829" "-4.28" "-0.2443573" "225280" "GCAGACTGACTGCACTTGTGACCTTGTTTCCTGGAAACAAACATTTCTGCTGTCAATCTG" "21017" "1" "0.105791" "-1.8232385" "-4.28" "-0.14283285" "74252" "CCCTTCTGTGCCTTTTTTATTTTGCCAACCATGTTTTATGGAAAAGACATTAGCAATTAC" "1441" "1" "0.105807" "-1.823139" "-4.28" "-0.27719167" "100043407" "AAAGTGGATTCAAATGCTAAACGGAACCAAGCAGACCGAAGACTGCAGAAAGGAAGGTCT" "37292" "1" "0.105838" "-1.8229508" "-4.28" "-0.20601834" "327900" "TCAATAGGTCGATGTAAGATTGGATCAATACTTGATGTGTATCATTTTAGTATGTAGGGG" "60145" "1" "0.105862" "1.8228017" "-4.28" "0.5231018" "" "GTCATAGGCATGTCCAGATTTAAGTGTTAAACATCTTATTTTCCACTGATGAATCTCAAG" "30865" "1" "0.105871" "1.8227472" "-4.28" "0.84208735" "20295" "TTTGGAGACGCCAGGGCTGCTGTCCATGGTTTCAACATAAAGCGGCCTGTGACCAGCAGA" "40000" "1" "0.105873" "-1.822735" "-4.28" "-0.17366608" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "37403" "1" "0.105899" "-1.8225723" "-4.28" "-0.25143834" "" "ACAGATGTATGAAAGAGCACACTTGGCACTGTGAATGATGCAGAAGGCTTTGGATAGGGT" "22155" "1" "0.105907" "1.822521" "-4.28" "0.43272913" "" "CACCACCTGTGTTCAAGGAGGGTTTCCCTCAGTTACACCTTCCTGGAAACACTCTCATAG" "4695" "1" "0.105923" "1.8224234" "-4.28" "0.18676432" "" "CTGTGGTGGGATAGAACAGATTGTGACAGAAAACTAAAAAGTCTCAACCAGAAGAATTAG" "58083" "1" "0.105935" "-1.8223522" "-4.28" "-0.20756265" "108654" "GATCTGAGAAGTTACATTGTTACAATTTGACATCAGTTGTGTCATAAAAATGCTGTTGCC" "50732" "1" "0.105956" "-1.8222196" "-4.28" "-0.24822296" "72124" "CCTTCACTGAGCTCAAATATTCCAAATCTTCAAAATTCATTAAATGGAACTTCTGCTAGC" "29320" "1" "0.105986" "-1.8220366" "-4.28" "-0.15926691" "" "TACACCAGATGAATACATTTCCAGTGCTGTCTTCCTTACCTGTAAGCCACAGCAACAGGA" "5118" "1" "0.105991" "-1.8220062" "-4.28" "-0.25288595" "12035" "GAGCAGGACACTTTGTTTCTTTTGCTGGTGAGGTTCTTTTGTTTTTTGTTTTGGTTGTTT" "438" "1" "0.105993" "1.8219932" "-4.28" "0.70524419" "" "AATGGTGTCCTTGGCTTTAAAATGTGGCCATTAGGGACTCAGTTAAAAATAAATTCTCTT" "44649" "1" "0.106014" "-1.8218629" "-4.28" "-0.31233808" "20743" "TCACTGGGGACAAAAGAGTGTTCCCACAACCTTCTCTTCTGCTATTTAATTCAACTGGTG" "10357" "1" "0.106024" "-1.8218024" "-4.28" "-0.36484013" "14560" "CTACACGTGCTTTTATACATGCAGTATGCACATGTAATCACGGTTGATTTCTTCTTTTAA" "11505" "1" "0.106052" "1.8216305" "-4.28" "0.47544418" "17305" "ATAGAAGGGTTTCTGGAATACATTCCCAGCCCAAGACCCCATCTTCCTACTATGAATGTG" "19491" "1" "0.106055" "-1.821608" "-4.28" "-0.27471924" "433198" "CTCTTCATGATGGATTGATTGTACCACTTTGTAACCTTAAACTGGAATAAACACCTTTTC" "43745" "1" "0.106106" "1.8212986" "-4.28" "0.20592601" "236930" "TGGTAATGACTATGAGAGTCTTGTAGCTCGTGGGAAAGAACTGAAAGAGTGCGGGAAGAT" "45" "1" "0.106111" "1.8212664" "-4.28" "0.66687492" "NA" "" "52590" "1" "0.106117" "1.8212297" "-4.28" "0.65900593" "21926" "TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG" "46472" "1" "0.106118" "1.8212244" "-4.28" "1.66009617" "" "ACTGATTTCACACTGAGAATCAGCAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGT" "33605" "1" "0.106157" "-1.8209853" "-4.28" "-0.18657058" "66169" "ACTGCTTTCCTGGGACTTTCTGTATTTTGTTTTGGCCTTTAAATAAAACTGTTTAGCATC" "46387" "1" "0.106215" "-1.8206238" "-4.28" "-0.17988947" "" "CTCTGGTCAGATGATACTTCAAATTCAACATCATCTACTTTTAAGTCCTGGAGGTTGCCA" "44216" "1" "0.106217" "-1.8206113" "-4.28" "-0.25451178" "12035" "ACGATGGAGAATGGCCCCAAGCTTGCAAGTCGAATCCTGGGAAAGCTGACTGATATCCAG" "8978" "1" "0.106221" "-1.8205887" "-4.28" "-0.27380866" "666794" "ACTTCCTACAATGGATAATTTTTATGGACTCTCTCCATTGTCACTGGATTTAAGTATTCC" "51972" "1" "0.106235" "1.8205042" "-4.28" "0.9014551" "320377" "CCTGATTGATCAGGAGCTCACGACCCTGAGAATCAGCTGAAAATTTATAAAAATAAAAAA" "56697" "1" "0.106251" "-1.8204068" "-4.28" "-0.18322052" "69149" "CAAATACAGGGACCCATGGTATTCAAATCATTTCTAAAAGTAATATTTGCATGAGAGCTC" "33270" "1" "0.106258" "-1.8203599" "-4.28" "-0.29181209" "14429" "TGGAGTATGGAGCCCAGAGGGGATGCCTTGCGCGGTGGAGAGACTAGACTAACCCTGTCC" "33508" "1" "0.106311" "1.8200333" "-4.28" "0.3185037" "252967" "CATTGATACTTGTTTAATGTTGAAGCCATGCTTAGGAGAAACCTTGGCGCCAAATACAGC" "2118" "1" "0.106326" "-1.8199406" "-4.28" "-0.22841471" "76561" "GTGGAATATTAAATTTTTCAATATGTTGCAAAGACTTGGTTTTAATAAAATCTTTAATAA" "34089" "1" "0.106352" "-1.819783" "-4.28" "-0.18172036" "232969" "GAACCCACTGAGACTGGAGGCTACGCCAGCTTGGAGGAAGATGATGAAGACCTTTCCCCA" "28272" "1" "0.106369" "1.81968" "-4.28" "0.33719556" "16164" "TAAGTGGTCCTGTCAATTCTGTGTTTTATTGAGAGGGAGACAAATGGAGCTCCAACTATT" "48364" "1" "0.106412" "-1.8194144" "-4.28" "-0.2081686" "320165" "ATTTCCCTTTTTATATGTCAGGTAAATATTTGTAAAAGTTATACTCACACAAAAGAAATT" "9019" "1" "0.106413" "-1.8194107" "-4.28" "-0.1434052" "" "CCCTTATGGACAAAAGGGGAGATGGTTAACTAAGACTGCAATCTTCTTAAATAGAAATAT" "33893" "1" "0.106416" "1.8193916" "-4.28" "0.25729368" "232449" "TAAATACACTTAAAACTGTGATAAAAATGAGAATGGGTGCTATAGCAAGGGGTTACTCTG" "641" "1" "0.106462" "-1.8191097" "-4.28" "-0.18585545" "15260" "TTATGCTCGGTACCTTGTGAATGAAGGGTTTGAATACCGCCTCCGTGAAATATGCAAGGA" "38615" "1" "0.106495" "-1.8189029" "-4.28" "-0.23378146" "18514" "CACGATGTAGGTTTTACAGTCTCCTAATTTGTACTGGTAATGCAGATTCCAAATAAATAG" "19338" "1" "0.106517" "-1.8187688" "-4.28" "-0.17065641" "" "CCAATTGCACCTGAAATTGCACTGGAAATGCTGATGGCCGTGAACTTCCTAGATTGTTAA" "52439" "1" "0.106563" "1.8184905" "-4.28" "0.333076" "12193" "GAGCAGTTGTTTAGTTTGTATGTAGGTACAGTTGGAGCACCGCGTGTGCACTCTGGACTA" "16673" "1" "0.106574" "1.8184185" "-4.28" "0.32408646" "65962" "TGCAGTCTGCCTCATAAGCCATAGCGCACGCGCGCCCTCAAATTAAACAGGCCTTGCCTT" "10576" "1" "0.106578" "1.8183983" "-4.28" "0.3809558" "16997" "AAATGCACTTCCATACAAGCTAGCTGGGGGTTCAGGAGCATGGGGGAATAAAATGTTCAT" "21495" "1" "0.106579" "1.8183876" "-4.28" "0.16583656" "" "CTTTGCTCCTTGCTGCAGGTTCAGCTCCATTGCTGAGCAGGCTTTTGTGGTTGGTGTGTT" "51563" "1" "0.106602" "1.8182469" "-4.28" "0.88942565" "17067" "AGCAGTTACCTGCCGCGCCTCTGATGGATTCTGCATTGCTCAAAACATAGAATTGATTGA" "60202" "1" "0.10662" "-1.818137" "-4.28" "-0.18352314" "12386" "TCTAAACTTGAACTCTGACTTTGCTAGACATAGAAGGCTCAGTGGTGGAACGTTAGCCGA" "16287" "1" "0.106626" "1.8181009" "-4.28" "0.80062096" "20846" "AGTGCCTGCCTTGCACCAGGCACTATTCTAGATGCGTTGAAGGCACTAATAAAAGAAATG" "59100" "1" "0.106653" "1.8179356" "-4.28" "0.3933229" "24058" "TTGCCTCTATCCCTGGGCCCCTCAGGAAAGGAGTGTGGCCCCAGGGTGTCACAAAATAAA" "23069" "1" "0.106704" "1.8176251" "-4.28" "0.23922848" "" "CAGAGATCACCGAAGGTAAAAAAGAAAATCTCCATTCTTTTGTCTGTCACTGTGTTTACA" "46651" "1" "0.106707" "-1.8176076" "-4.28" "-0.29364596" "68312" "AAATCCCTAACAGTTCTTTTACATTAGCAAAGTAGCCCTTTCTAAAGCTAAAGTCCCCCT" "18882" "1" "0.106742" "1.8173932" "-4.28" "0.55050687" "11846" "AACTCTGGGAATTAAGTATTTCTCCATGACTGAAGTAGACAAGCTGGGGATTGGCAAGGT" "46137" "1" "0.10675" "1.8173431" "-4.28" "0.24132976" "" "AGAGGCAGTATGCAGATTGTTCAGAGATTTACAATGACGGATTTAAGCAGAGTGGATTTT" "49920" "1" "0.106758" "-1.8172952" "-4.28" "-0.19591548" "28028" "AAAGTTCCACTGTGTTTTACTCCATAAGTAAAGGTGGAAGAAAGGGCAACGTGTTCTGGG" "37134" "1" "0.10677" "1.8172213" "-4.28" "1.06420264" "15900" "AACAGACAGGGTCGACAGAGTGTGTGATACATGCAAACAGAATCCTTGGAGTGTGTGATA" "31752" "1" "0.106772" "-1.8172066" "-4.28" "-0.16129877" "67239" "TGACCTGACTGACTACGAGCACTTTCTTATGGTTGTTTACTAAAGAGAATTGCTCTACTT" "55526" "1" "0.106779" "1.8171639" "-4.28" "0.97829397" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "46015" "1" "0.106796" "1.8170616" "-4.28" "0.26684355" "100042092" "GTACAGGGCGTCAATAATAAAAAGAGAGCAGCGTTGGGGGATAATGTCGACATTTCCACT" "21877" "1" "0.106809" "1.8169815" "-4.28" "0.26623865" "" "TTGCTTGTGGTTGAGCTCTATGAAGAAACCAGTCCTCTGCTCTAACACTTAGATGCCACA" "32913" "1" "0.106835" "-1.8168242" "-4.28" "-0.2173972" "76357" "CCCAGTAGACTTTATGTAAAGAAGTACAATTTGTAAGAGGTAAACTCTACCACACAGATA" "44525" "1" "0.106855" "1.8167011" "-4.28" "0.81608856" "50778" "CCCTTGGATAACCAGTCCAAAAGTATATAGCGCAAATAACAGTTGCTATTATTGACATGA" "22379" "1" "0.106877" "1.8165657" "-4.28" "0.19897939" "" "AGAAGGAGCAAAGCTGTCAGGAAATCAGAAACGTCACATGGACTCCATGACTGGGAAAAA" "17650" "1" "0.106896" "-1.8164465" "-4.28" "-0.19080452" "" "TTTTCATTTCAAACTGCCGCTTCTTTTCTCGCTCCTCAGGGGAGAGGTCATTATCTTCCT" "40375" "1" "0.106912" "-1.8163494" "-4.28" "-0.37979398" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "4853" "1" "0.106929" "-1.8162452" "-4.28" "-0.26158747" "19652" "ATGGCCAGAAAGTGATTTCTGAATGTACCTATGAACAATCCGAGTCAAGATCATGATTGC" "55490" "1" "0.106935" "1.8162086" "-4.28" "0.254627" "" "ATTGTTCTCCCACCTGCTCCTCAGCCCCACCCTTTTTCACACCTCTGCCCTGGCGGCTAC" "19804" "1" "0.106955" "1.8160903" "-4.28" "0.38148436" "243655" "TTGGAGTTTACTATAATGAAACTCGCAGACAGTGGCTGTGGGAAGACCATTCGGTTCTAC" "58039" "1" "0.106963" "1.8160403" "-4.28" "0.46494133" "18730" "CAATGTTCTACACTCTGGGAAATAAAGCTGATGACCCAAAGTTTTCTGTCAAAAGAAAAA" "32805" "1" "0.106964" "-1.8160336" "-4.28" "-0.18182417" "360216" "TGATGATGTCACCATCACATTTTTGCCTCTGGTTGACAGTGAAAGGAAGCTCCTCCATGT" "11001" "1" "0.106983" "1.815914" "-4.28" "0.70236055" "58809" "TGCCTTATACTCACATATATCCAATATAACCCATGGTGTTAAGCGCATCCCATCCAAGGG" "33391" "1" "0.106989" "-1.8158775" "-4.28" "-0.22955799" "28078" "CAGCAATCAAAAAGGAGAGTTCAACTTTTTGGTTTGCATAGTTTGTTTTTCTGCTTGAAC" "38738" "1" "0.107014" "-1.8157274" "-4.28" "-0.15630268" "67922" "CCAGATTTGGGGAATAGGGAACACAATGATTTTTGTAATATGTAATGAGGTGTTGCAGTG" "4683" "1" "0.107022" "1.8156765" "-4.28" "0.56233399" "58205" "CTGGCAGCCTCTGAAGTTCTAATTAACTGGAAGCATTTAAGCAACACGTTAAGTACCCCC" "24914" "1" "0.107027" "-1.8156451" "-4.28" "-0.2461577" "" "TAACCATCGGTTGACACCTCAAAGAAACAGGAGCTCTGGAATCGATTTTCCCACTTTTAA" "52170" "1" "0.107041" "1.8155593" "-4.28" "1.39552021" "229900" "GGAGAAGAATAGCTCATTGGGTGCAAAAATCCTTGATGGGTTTGGAGATGTATTAATTTC" "31508" "1" "0.107057" "-1.8154632" "-4.28" "-0.24249009" "77573" "TTGGCGTGGGTGTTTGTCCAGTGAACAGACACTCAGTTCTAATCTCATGTGTCTGCATTT" "9443" "1" "0.107067" "-1.8154007" "-4.28" "-0.26213728" "" "" "12830" "1" "0.107103" "1.8151841" "-4.28" "0.59218294" "" "GTTTGTTGCTTGGTGTTTAGTGAGGTTATACTTCTTACTAAAAGTTGCCTTCCCTACATT" "61227" "1" "0.107112" "1.8151315" "-4.28" "1.06956922" "65972" "GGATGATATGGAGAAGAAACTGGGACCGTGCCTGCAGGTGTATGCTCCTGAGGTGTCACC" "15033" "1" "0.107126" "1.8150429" "-4.28" "0.64370124" "665536" "ATGTGACACTCACAAATCTGTCCATGGTGGACTCAATAAAGTGCACGTGCTGTGAAAAAA" "47890" "1" "0.107146" "-1.8149221" "-4.28" "-0.22310155" "241846" "TAAATTTGTTGCATGAGTAAATGTGTCAGATCTTCTCTATAAGCATGCATCCTCTGACTG" "46342" "1" "0.107152" "1.814883" "-4.28" "0.20745622" "66985" "AAGTATGGACAGTGTATTCCTCCTGTGTATGTGCCTGCTATGTACCTCACTGTATGTGTG" "24414" "1" "0.107173" "-1.8147577" "-4.28" "-0.16903443" "" "AATCTCAGAGATTCCGTAAACTCCATAAAGCGGTGATTCATGACAGAAGCAGGGACGCAA" "30643" "1" "0.107176" "-1.8147388" "-4.28" "-0.35695032" "97209" "GGAGAGGTGAATATGGTCAAATCACAGTGCATAAAATCCTCAAAGAACAATAAAACTGAT" "12015" "1" "0.107187" "1.8146711" "-4.28" "0.25824801" "13830" "TTTGGCACAAACTACCCTCAGGAATGCGCTGGGCACCAAGAACCTGTCTCAAATCCTCTC" "34077" "1" "0.107213" "-1.8145146" "-4.28" "-0.19377569" "" "ACCAGTGAGGTCAATTTTAGAGAGATCCCTTCACACATGCTATCTGAAGTACCCATCCAT" "62262" "1" "0.107219" "-1.814473" "-4.28" "-0.17117221" "243906" "CATACAATAACGTCTGTAATTCTTACTGCCAGTATTGTCAATTCATGTGAAAGGAAGATG" "29757" "1" "0.107257" "-1.8142462" "-4.28" "-0.16253062" "67872" "TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG" "31328" "1" "0.10726" "1.8142284" "-4.28" "0.67029306" "12482" "GCTGTGCTTTGAGATTCTTTCCAAATGGCAGAGTAGTTTATTTGGTCTTTCATGATTCAC" "30398" "1" "0.107274" "1.8141429" "-4.28" "0.23008492" "56079" "CATGGACCCCCCTGAAAAGAGACCTGTGGAGAGACAATTTGACTATTTCAGCATTAGCAA" "54047" "1" "0.107307" "-1.81394" "-4.28" "-0.15943289" "" "TTCTCCTTTCATAAAACCCCATCTGACCTATAGGGGACCAAGAGTGTTCTTCGAGGAGAA" "46189" "1" "0.107308" "1.8139356" "-4.28" "0.14637642" "109791" "TGAGATCTGTTTGAACAGTATGCAGTGTAAGAGCAGATGCTGCCAACATGACACCATCCT" "15527" "1" "0.10733" "1.8137982" "-4.28" "0.41932395" "13713" "GAACTGAAATCCAGTAATGTCCAAGTGATGGGTTTTTATATAAGAATGAACGAAGCCATA" "36863" "1" "0.107337" "-1.8137593" "-4.28" "-0.20183816" "233812" "TTAGAGGAAAGGTCCTTAAGAAGTGTTGGAAACTAACTTTGGATCTGTTCTTAGCTGTTG" "26098" "1" "0.107347" "1.8136982" "-4.28" "1.28593616" "17071" "TTTCAAATATGTACTTCCTAGAATGCCATTTTGTGTGGCTTGCTAATCTTGGCCCTGGAG" "60684" "1" "0.107349" "-1.8136826" "-4.28" "-0.13858381" "100040067" "ACTTTCCTGACGATAAATTATAGGACATGTGGGGGAAATAAAGCTCTGCCATGCAATATG" "41110" "1" "0.107352" "-1.8136645" "-4.28" "-0.26192392" "243961" "TTCTCTGACACTTAGCACACCCCTCACACTCATGGCCCTGAACTCTTTCCAAATGTTTAA" "35493" "1" "0.107362" "1.8136052" "-4.28" "0.37191987" "" "" "58127" "1" "0.107372" "1.8135448" "-4.28" "0.22751664" "73710" "GGCTAAAATCACATAAACCTTTGTGTCCTAACGGTGTCCTCTTTTCTTTCTCTTCCTTTC" "56294" "1" "0.107384" "-1.8134693" "-4.28" "-0.19221585" "" "" "28988" "1" "0.107387" "-1.8134509" "-4.28" "-0.28298124" "232989" "GGTGTGAGCCATTATACCAGCAAGGAGCTTTCTCTTGAAAAGTTTACACACTCGTGGCTA" "28109" "1" "0.107397" "1.8133897" "-4.28" "0.21111663" "" "TTCACCATTGTGTAATTTTCTAAGTGCCCATGTTAAGATCCCACGATACAGCAGCCCCTC" "19929" "1" "0.107403" "-1.8133526" "-4.28" "-0.27609299" "22756" "GATGAGGGTCGCAAGGATTTGCCTGCATCAGAAGGCTCACAGGGGAAACAAACTCTATAA" "18997" "1" "0.107446" "1.8130945" "-4.28" "0.50983474" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "11231" "1" "0.107458" "1.8130173" "-4.28" "0.23841834" "" "" "29602" "1" "0.107459" "1.8130158" "-4.28" "2.34233072" "" "ATCAACAGTGTGGAGTCTGAAGATATTGCAGATTATTACTGTCAACAAAGTAATAGCTGG" "3361" "1" "0.107461" "1.8130012" "-4.28" "0.92761246" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "1902" "1" "0.107474" "1.8129227" "-4.28" "0.17608796" "69794" "TGTAAATTTGGCGAAGATAGTCCTGTGAAATAAAACCATCTGTATGGAGAGTTAGACTGG" "3040" "1" "0.107484" "-1.8128588" "-4.28" "-0.20269468" "380664" "CTCCCTGTAAGACAGATGGGAATGTGTATAATAATTAGGTATTTGAAAAGTTCTGCTTTG" "7480" "1" "0.107489" "-1.8128298" "-4.28" "-0.14916506" "54632" "GAAGTTCAGCTTTAGTCCCAGTTAACAAATATTGGCAATAAATCAAAACAGGAAAAACCC" "51553" "1" "0.107509" "1.8127099" "-4.28" "0.27920396" "75458" "CCACGTCAACCTTATCAGAAAAAGTCTACTAATGACATCGATGACAGAGAATAATTTTGT" "39761" "1" "0.10753" "-1.8125799" "-4.28" "-0.23521736" "" "ATGGGCTGACCCGCTAACCATTTGTCCATTCTCCAAAGGATTTGCAAAGTGATTGCGTTT" "19127" "1" "0.107531" "-1.8125732" "-4.28" "-0.17010626" "" "TCAACAACAAAATGGAGAAGGGGTCCTTCCAAAAGGAATAAGAAGGGTTCTGAAGGGCAG" "46123" "1" "0.107535" "-1.8125538" "-4.28" "-0.1887254" "330788" "GGATGAGCAGGAGGGATATGGAAACAAGCCATACGATTCTAGTTCTCTCACAAGTATTCA" "19919" "1" "0.107535" "1.8125487" "-4.28" "0.19951432" "436440" "TTGCGTTGAGCATCTTTGCACTTCCACACAGGAAGAACTCACTGGCTGCATCAGCAGAGG" "33383" "1" "0.107563" "1.8123834" "-4.28" "0.15437447" "328594" "CCCATACTCTCTTCTCTTTGGGTTGTTTGAGCTGGAGCAAAACTGTCCGTTTCCTTACTT" "12375" "1" "0.107578" "-1.8122895" "-4.28" "-0.24506109" "74386" "GATCCTGCGAATTGGCTTTGCATATGAGTTATTTGTGTTATTGTTTTAAAGAGACTAGAC" "39035" "1" "0.107584" "-1.8122552" "-4.28" "-0.14544098" "328381" "CTACAGGAACCCTGTGGACAGAGGGATAGCCCACCAGACTATCACCTGTTGTTTGAATGA" "17448" "1" "0.107684" "-1.811649" "-4.28" "-0.14579305" "66294" "AGTAAGCACACCAACAAGTATGAGGGCTGGCCAGAGGCCCTGGAGATGGAAGGCTGTATC" "4725" "1" "0.107743" "-1.8112873" "-4.28" "-0.1570044" "12176" "CCATTAATCAGGATCCAAAGCTGCTTAAATCGGGCGTCCTCCCAGTCTTCTCTTTTCTAT" "26348" "1" "0.107812" "1.8108688" "-4.28" "0.80202753" "" "ACCCAACAATGGTCATCTCAAATACACTGAGACAAAGAGCTAATGCAACTCCTAAAATTT" "34215" "1" "0.107821" "-1.8108146" "-4.28" "-0.20131892" "75796" "GTGTAAGTGGAAATTCTGATAATTTATGTGTATTATATGTAAAGCTAGTTTTGCAAAAAA" "28681" "1" "0.10784" "1.8106965" "-4.28" "0.43342745" "27047" "TAAAGATCAGAACTGCGTTTAAGATGTTGGTGAAAATGGCTTTACTTCATAAGCTTAGAG" "50387" "1" "0.107853" "1.8106186" "-4.28" "0.26046268" "" "TACCTTAGTGGGGGAAGGCTCTCAGTCAAATTGGGCCTGCTCCAGATGTCCAGAGGAAGC" "1052" "1" "0.107869" "1.810525" "-4.28" "0.27763321" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "30897" "1" "0.107881" "1.8104518" "-4.28" "0.30842289" "" "GCCCAACATGAATTAACTTACTTCTTTGAAAGGAAATGTGACAATCCACACTTACAACAT" "42117" "1" "0.107895" "-1.8103648" "-4.28" "-0.15726179" "" "ATCAAAGCCCAGGTGGACAGCCTGTTGAAGAGTCTGGAGTCCATGGAGCAGGAGACAGAC" "10349" "1" "0.107911" "-1.8102675" "-4.28" "-0.16495862" "" "" "37800" "1" "0.107923" "-1.8101971" "-4.28" "-0.17048124" "235459" "GACAAATCAAAAGTGGTTGCCTTCATAAGATTATTCTTCAATAAACTCGTTTTAAAACTT" "40693" "1" "0.10794" "1.8100904" "-4.28" "0.71288442" "16160" "GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT" "51422" "1" "0.10795" "1.8100353" "-4.28" "0.16205893" "329252" "TGGAGAAGAGCTCCTGCGACTCCACCCAAGCGCTGGTGGCTTTCTCAGATGTGGATCTTA" "45867" "1" "0.107956" "-1.8099942" "-4.28" "-0.20493879" "" "TGTTTCTTCTCACCTTGAGGTCTTGGCTCCATTCAGTGAAGAATAAAAGTAAAAAAGCCC" "20660" "1" "0.10801" "-1.8096712" "-4.28" "-0.25206735" "140474" "CTAACTTGTCATGGGTACTCCAGCCCAAGACCGTGGCTTGCTTCTGCAGTAAGGAGGAGC" "61481" "1" "0.108017" "-1.8096244" "-4.28" "-0.16513458" "" "ATATAAAAGTATAAGGTCCTAGTAGTACTACAGTTACTAAGGATTACCAGTGGTTTGATT" "20750" "1" "0.108026" "-1.8095701" "-4.28" "-0.24823374" "17261" "CAAAAACTACCCAACAACAAAACCCAGATAGTGGACTGAAACCCAAAGCTGGCTTGACGA" "58568" "1" "0.108034" "-1.8095235" "-4.28" "-0.23797797" "257885" "CAATGCTGAATCCTTTCATCTACAGTATAAGGAATAAAGATGTCCACATTGCACTGAAAA" "46267" "1" "0.108035" "-1.8095182" "-4.28" "-0.16754111" "215493" "GCTGGCTCATAAGGGCAGCTGAGCATCCAGTGTAGTAGCCATAAGTGAGATGTTTGAACC" "41151" "1" "0.10806" "-1.8093684" "-4.28" "-0.19885962" "230734" "CTCTACTGTGGTTGACTTATCTGTGCCTGGAAAGTTTGGCATTATTCGCCCAGGCTGTGC" "57354" "1" "0.108061" "1.8093592" "-4.28" "0.24165036" "236428" "TTCTACCCGAGTGGATCCTGGCTTGGCATTGGGAAATAATGGGCTGGGATAGGTGCCCTC" "6487" "1" "0.108064" "-1.8093408" "-4.28" "-0.19212846" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "52196" "1" "0.108101" "1.809117" "-4.28" "1.80099901" "105892" "GCCCTACTGCGTGCAGAAAGAGTTCAGGGGCTGGAATGCTACCAGTGTTTTGATGTCCCA" "38378" "1" "0.108117" "-1.8090191" "-4.28" "-0.23846003" "79221" "GGTGATCTCTTGTTTTGTGTTGTAAATATATTGTTTGTATGTTGCCCTTTATGCCTTCTG" "15695" "1" "0.108126" "1.8089667" "-4.28" "0.30446962" "" "CAAGGACTAATTAAAAGTGGGCATCATCACACTGGCCCAATTAACTACTTTAAAAATAGA" "10913" "1" "0.108132" "1.8089307" "-4.28" "0.49025674" "15451" "GGGGCGCTCTAGGGAGCCCCTTGTGCAGATGCTCTTTAAATAATAAAGGTGGTTTTGATT" "10676" "1" "0.108141" "1.8088787" "-4.28" "0.19626855" "22268" "CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG" "40148" "1" "0.108146" "1.8088432" "-4.28" "0.60989046" "12515" "TTTTGTCAATTGTTCTCCACCAAAGAATAAGAGTGGCCTTTTCTTTAACTTCCTCCGTGT" "25442" "1" "0.108149" "-1.8088286" "-4.28" "-0.29779096" "" "ACTTACTGAGTGTTACTTACTGAGTGTCTACTAAGCATAGTACTTAGCTCTGGTGCTTTC" "9765" "1" "0.108163" "1.8087413" "-4.28" "0.19547705" "" "AGTTTAGAGCTAGTGTCTGACAAGAGTTAGCAGGTAACAGGAGGTGCGGTCTTAAAAGGA" "42444" "1" "0.108189" "-1.8085842" "-4.28" "-0.19815483" "" "" "42998" "1" "0.108193" "-1.808562" "-4.28" "-0.18041533" "670533" "GCTTACTTTAAGTTGTCTTCTGGGTTCCATGTGTTCTCAATAAATCTGCATTTGTTCTTC" "26766" "1" "0.108193" "1.8085596" "-4.28" "1.17238347" "14190" "AAATACTATGTGTTCATCCTGAGTGTGTCTTTCTCAGGGTAACAATGAATCCATGTAAAT" "29479" "1" "0.108201" "-1.8085162" "-4.28" "-0.34255333" "104418" "CTGGTCTTCCTCCTCATGTATCCAGCCATTTCATTTCGGACTGTATGGCCTGGGGTGGGG" "19987" "1" "0.108201" "-1.8085116" "-4.28" "-0.2063793" "" "" "13301" "1" "0.108208" "-1.8084694" "-4.28" "-0.18479372" "68815" "GGTGGTTTACTGTCCAGTCTGCCTTATCCTTAATCTGTTCATATATTTATTTACTAATGC" "25004" "1" "0.108244" "1.8082563" "-4.28" "0.16763378" "" "CTCACTATATTTTCCCAGTAACGGATTGAACTTGCAAAGTGTTGTCCTGTGTCCTACTGC" "54033" "1" "0.108266" "-1.8081204" "-4.28" "-0.19200438" "" "" "15617" "1" "0.108277" "1.8080514" "-4.28" "0.24646248" "68682" "TATGCCCAGCCCTGTGCTTATGTAATTGCATTCCGGCCAGTTAATAAAGTGCCTCTTGTA" "23687" "1" "0.108278" "-1.808049" "-4.28" "-0.14644915" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "41058" "1" "0.108287" "-1.8079937" "-4.28" "-0.14275932" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "18227" "1" "0.108289" "-1.8079788" "-4.28" "-0.20190607" "406217" "CAAGTGGGGGTATTTTTTCTGTAAACTTTTGGTGTTTCCACTTAACGGTTTCTATGTAAA" "50029" "1" "0.108294" "-1.8079521" "-4.28" "-0.33424077" "338346" "AGGATGAGTAATGTGAGCACGGAATATTACTTTATAGAGTTTTGAAATGAAGCAACTGTG" "20035" "1" "0.108294" "-1.8079517" "-4.28" "-0.17416031" "240476" "TGTTCTCAACATTGTAAAATAGCCCCATTCCTCAAAGGCAAAATTGTTCTTGTTGTTTTC" "50000" "1" "0.108295" "1.807943" "-4.28" "0.3069336" "210789" "CCATCAGGTTCCTGTAACGTCTAGAATTATTTCCAATAAATATGTTGCTGCCATTTCCTG" "44166" "1" "0.108314" "1.8078302" "-4.28" "0.20362065" "" "CGTGTTCACAGTATGCTGTGTACCAGGCTATCTGCAGCATTTTTAAAAAATCATAATAAA" "3897" "1" "0.10833" "-1.8077367" "-4.28" "-0.19782658" "" "TTACTTAGAAGTGGGTGGGAGGGATTCCTCACTAGTATCTGAAGCAGTTGAGGTGATACA" "50330" "1" "0.108338" "1.8076877" "-4.28" "0.27230342" "12469" "GGTGGAGCTACCGAAATTGAATTGGCTAAACAAATCACATCATATGGAGAGACGTGTCCT" "55864" "1" "0.108348" "-1.8076251" "-4.28" "-0.19328261" "" "TTTAGTAAATAATCCCAATAAACGCTATGCTGATGCCTTTGCTGTCCTTGCTGGTTCTGA" "49263" "1" "0.108411" "1.8072429" "-4.28" "0.15872878" "21335" "AAATTGATGAGCTGACCCGGATCTGTGATGACCTCATCTCTAAGATGGAGAAGATCTGAG" "57439" "1" "0.108424" "-1.8071685" "-4.28" "-0.14036487" "12962" "TTTGAGAACCCAGCCTTCAGTGGGCGCAAGATGGAGATCGTAGATGACGATGTGCCCAGC" "46542" "1" "0.108449" "1.8070151" "-4.28" "0.26600727" "18074" "ACAGTGGAAAAGGAATTGGCCATTATGAGTTCTTGGCACACAAGTGAGCATTTTCAGTGC" "14851" "1" "0.108464" "1.8069245" "-4.28" "2.1475712" "16069" "CTGTACTAGTCTTTCTCTTAACCTCTCACTGTGTAGAGAAAACAGCCAATGAACACAGGA" "43572" "1" "0.108479" "-1.8068333" "-4.28" "-0.36656516" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "32382" "1" "0.108501" "1.8067047" "-4.28" "0.37078022" "" "AGACAGCTATTAAGTCCTAGTAAAAGGGAAAAACTAGAATATGGGGATAACCATAACTAC" "48400" "1" "0.108522" "1.8065765" "-4.28" "0.25214159" "12525" "CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT" "30942" "1" "0.108523" "-1.8065703" "-4.28" "-0.23944552" "58188" "ATAAACTGTATTGTATATTGCTGAACAATAGTTGTATTAAAAAGAAAACCTTTTAAATAG" "47327" "1" "0.108525" "-1.8065569" "-4.28" "-0.17187494" "" "CTTTAAATTATATGAAAGTGATGTAGAATTAGGAGAGTTGGAGCCAGGGTTCTAAAGAGA" "20519" "1" "0.108558" "-1.8063608" "-4.28" "-0.28361301" "" "ATTTGCTTTCGAGATCTGTGTGGCTTGTGACTTAAAATCCCATTCTGTGAAGAAATGGAG" "33820" "1" "0.108612" "1.8060359" "-4.28" "0.58505969" "67138" "GACTTAACTTTGGATGAAAAGAAAAAATTCCTCTTGTTTCTTACAGGATGTGATAGGCTG" "25101" "1" "0.108615" "-1.8060148" "-4.28" "-0.15842961" "" "GAAATCTATACAGAATTCTGACTAAATTATGTACTTGGCAGACTTCTTGCTTCCTTGTTC" "59277" "1" "0.108623" "-1.8059642" "-4.28" "-0.1796847" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "41082" "1" "0.108653" "-1.8057879" "-4.29" "-0.14875014" "66165" "TCAAGTCCTCTACAAAAAGTAGGGTTCTGTTCCATGTGTCTGTGACACATTTACAAAATG" "28373" "1" "0.108653" "-1.8057851" "-4.29" "-0.198358" "83410" "GTACAGAGTTTTCATTCCTAGGCTATTTTCCATCGACTTAGTTTTTTGTGCTAGTGTTAA" "61526" "1" "0.108717" "-1.8054004" "-4.29" "-0.25239773" "" "TAATATGCAAAACTTACCTAACGGCGTGTGCATGCACGTCCATAATCCTGCATGTGTGAC" "38601" "1" "0.108722" "1.8053709" "-4.29" "0.38254368" "14343" "TATTCCCTTCCAAGAGCAACTTCTATTCTTCTCAGGGAGTTTCCGGGCACTTTTTCCCAA" "62089" "1" "0.108724" "1.8053604" "-4.29" "0.1676095" "114142" "GGAGACTGTATTCATAGTAAATTGAGCATGTTGTTTTAAGCTAACAGATGCTGAGAGTTT" "4723" "1" "0.108767" "1.8050972" "-4.29" "0.19677428" "259045" "ACCAAACAGATCAGAGATAGTATCATTAAATTCTTTCACGGTGAAAAAGGTTCAAGGTGA" "40979" "1" "0.108769" "-1.8050884" "-4.29" "-0.13518491" "58245" "CAGTCAGCAAAATGGCAAAGTAATACAGTCTAGCCCGTGATTAAAACATTTCTATAGGTT" "28415" "1" "0.108772" "1.8050719" "-4.29" "0.25031933" "" "TGCACTCTGTAGGTCTTCAATGCACACTGGAGGAATCCATCAGTAAATCTGTACTCTGCA" "37761" "1" "0.108784" "1.8049972" "-4.29" "0.16234793" "" "GTACCTTAGTGCCAAATAAATACTTTCCTTCAAGAATCCTCCTCCCCATTGGAGTTAACA" "20804" "1" "0.108784" "-1.8049958" "-4.29" "-0.32430191" "75998" "CAAATCACTCAGTATTTTGGGAATACGATGAATTTGTAGCACCTCCAGGTATATAAAGTA" "43142" "1" "0.108878" "-1.8044353" "-4.29" "-0.22759202" "67826" "ATATCTGCCAAGATGCCAGAGGTCATTCCCATCTTAGAAGTGCAGTTCAGCAGCAAGATT" "55669" "1" "0.108916" "1.8042037" "-4.29" "1.26970248" "668101" "CTCTGCATATGTATTGCTATCCCAGAACTTTAAAGCTGTGCATATTGAATTGTATTCTTG" "415" "1" "0.108919" "1.8041889" "-4.29" "0.77358736" "279029" "TCCAGTATTAATTTCGTACCCCATGGTGACTAATAAAAGAAGCCCTAGGCTGTTTCTGGC" "31711" "1" "0.108919" "1.8041862" "-4.29" "2.06408293" "14961" "TAGTAAACCAATGTATGCTTATCCCCACCTAGATTACAAATAAACGAGACTCAGACTCTG" "28297" "1" "0.108961" "-1.8039316" "-4.29" "-0.17104791" "" "TTATGACTGTTCCAGAATTCCCCATCCCAGAACTTCAGTCTCATAGACATCTGAAACCTA" "57260" "1" "0.108965" "-1.803909" "-4.29" "-0.35450653" "442799" "AAGGCACACTATATACAAATTTGTTATTTTATCTAGCTAAGACAGTAATTGATGGGAAAT" "27028" "1" "0.108982" "1.8038084" "-4.29" "0.16562988" "" "GGCTCTCTTAAAGGGATGTGAGATTATGGGTTACTACAATTTTATTATCCATAGTTTCTG" "56177" "1" "0.109001" "1.8036937" "-4.29" "0.31681699" "211496" "GGAGCATGGATTTCGGAGTGGTGTTTCTGTTGCTCGAAGAGGAACATCCAGAGTTTTTAA" "33089" "1" "0.109035" "-1.8034913" "-4.29" "-0.1484381" "14894" "AGGCCAAACAATAACTGGATAGCAGCTAAGGGGACAGACTCTGGATGTGAGTCTTAGTTT" "2378" "1" "0.109036" "-1.803484" "-4.29" "-0.38397966" "384763" "AAGCAAATCCAAGAAGGAACATTCAGGCAAGAAATCTTTAAAGTGTAATCTTTGTGGGAA" "47616" "1" "0.109039" "-1.8034669" "-4.29" "-0.19648364" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "4004" "1" "0.109069" "1.8032871" "-4.29" "0.19507762" "" "GACTCAGCCTTCTTTCCATCTTTCTAAGAAATCAAACCTCAAACCACCCAAGGATGATGG" "52643" "1" "0.109076" "-1.8032463" "-4.29" "-0.18298406" "" "GTTCTTGTTGGTGCACAGCACAAATTAGTTATATATGGAGCCAGTAGTTTTGTTTTGTTT" "912" "1" "0.109078" "-1.8032333" "-4.29" "-0.51823895" "" "GGACAGACAGGTCAGTAAGGTCATGGCCATATTATTCTGTAGACAGTTGTACTTAGTAAA" "7132" "1" "0.109086" "-1.803182" "-4.29" "-0.2194591" "66236" "GCTTTACTGTGTATTCTTTTTGTGTTTTAACTTAACAGCCTGCACTAATGTGAATACCAC" "39588" "1" "0.109089" "-1.8031672" "-4.29" "-0.23997964" "226751" "TTTTAACCACATAGCACACATGGGTCCTGGAGATGGAATACAGATCCTAAAAGACCTGCC" "62753" "1" "0.109093" "-1.8031444" "-4.29" "-0.26721824" "114716" "CACTATATTTTTCAGGGTGCATTTTAAATACTATTGATTCAAACAGTGGTGGCTTGCGTT" "27848" "1" "0.109104" "-1.8030784" "-4.29" "-0.52936626" "" "TTCGTAGTGGGCGACGGGAGAGATGCTAATCACGTTGGATAGCTGGTCCCAGCTGAAGGT" "12212" "1" "0.109116" "-1.8030036" "-4.29" "-0.19368162" "" "AGTTCTGTCTTCACAAAATTGTTAACTGTGTTTTAGTTCCTATAATCAAGAAGAACTGGC" "4559" "1" "0.109122" "-1.8029671" "-4.29" "-0.16106292" "66361" "TTTTTTGGTATCATGTAATTGCACTGGATATGTTTCTGGTAAGGAGTTTTCTCTAGTAGG" "8028" "1" "0.109142" "-1.8028479" "-4.29" "-0.2259418" "26372" "AAGTTGGGGTTTTACTAACTTCCTCTGTAAGAATCTTCCATTCCCCAGCTCCCCTAAGGA" "36802" "1" "0.10916" "-1.8027423" "-4.29" "-0.18483195" "" "" "7547" "1" "0.109177" "1.80264" "-4.29" "0.15791738" "74114" "ACTTTCTAATTGCCAGAGGGATAAAGCACACGGTTAGAAGCTAATTTCTCTGACATCAGT" "40804" "1" "0.109183" "-1.8026007" "-4.29" "-0.20010044" "60532" "TGCCCTGTGACTCCAGTATATCTCACCTGTACTGACCAAACCTAAATAAACATTTTTATT" "44737" "1" "0.109192" "-1.8025499" "-4.29" "-0.16117887" "" "TCAGACCTATTTAATTGTACTTTATTTCAGGCCCCAATCCTTTGATTTACTCAGGTTATC" "54978" "1" "0.109192" "1.8025483" "-4.29" "1.13955305" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "52641" "1" "0.109211" "-1.802434" "-4.29" "-0.3013652" "20451" "ATTGAAGCCGTGTGATTTAGACTTGATTGGGAAAAGGTTATATTGCATTTGGAAGTATGC" "58470" "1" "0.109222" "-1.8023693" "-4.29" "-0.18234512" "78244" "AAGAATTAGAAAATAGGCCCCAAGAAAATACCTGTATTACAGAGACCACAGAAGCCTGTG" "9035" "1" "0.109223" "1.8023623" "-4.29" "1.46415007" "" "ATGTGAAGTCTTCCAGAACTTTCTCCAGTCACAAGCCATCATTGAGAGTTCCATCCTGCA" "61168" "1" "0.109229" "-1.8023254" "-4.29" "-0.19924186" "67973" "AATAAAATTCCTGAGCCCTCTCTTAGTTTGTTTCCTGTTGTTTTAATAAAGACCATCACC" "30006" "1" "0.109237" "-1.8022769" "-4.29" "-0.16325446" "" "" "28980" "1" "0.10924" "1.8022592" "-4.29" "0.33061388" "74589" "TTTCTAAGACAGGCCATCAGAAGGAACACGATGCTCCTTTGTGATGGCAGTTGCATTGAT" "666" "1" "0.109266" "1.8021053" "-4.29" "0.19895345" "108037" "CGATGCCTGGATTTGATGAACGTTGAGGACAGTTGAGGACACCTGGCGGTCGGTCAGAAG" "29281" "1" "0.109276" "-1.8020418" "-4.29" "-0.18511905" "28000" "GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT" "21516" "1" "0.1093" "-1.8018993" "-4.29" "-0.16935945" "" "AGCTAGCATGTGTAAGGGGCCATACCAAGTGGCTCACATATACTTCTACACAGGAAAAAA" "4163" "1" "0.109305" "1.8018687" "-4.29" "0.25340556" "" "CACTCAAAACCCACTGAGCATACCCAGCTCTGATGGGGGCTTAGAGGAAAGCACACCAGC" "23134" "1" "0.109346" "1.8016267" "-4.29" "0.3152455" "" "AGCGCTTTCAGACACGAGAGACTTCAGAAGATAATACTAAACAGAACTAAACGCAAAAAA" "7592" "1" "0.109351" "-1.8015953" "-4.29" "-0.22377915" "232023" "GCAGACTTGTGCATGCTCTTTCTTGGCAACACTTGGCTCATATTTCTTGTTCTCTTTTGA" "34484" "1" "0.109386" "-1.8013841" "-4.29" "-0.21049273" "" "AGCAAAGGCCAAAATGGTGGATGCATCCCTAATGGTTGGAGAAATGGTGGAGAATGTCAT" "25671" "1" "0.109393" "1.8013426" "-4.29" "0.76146133" "" "AGCCATCCAGAGAAATCCGCACAGAGGGGAACCTGAGAACAGAGGTGTACATATTAAAAA" "44567" "1" "0.109421" "-1.8011737" "-4.29" "-0.19457116" "194268" "CCACCCAGCTAAGGATGGAGACTTTTAAAAAGAAAGTGGCTTTGTTTTCTTACTATATTT" "6537" "1" "0.109442" "-1.8010522" "-4.29" "-0.22934756" "" "ATTGGAGCAGAAGTTTACTACAACCTGCAGAACATGATCAAGGAGAAGTACGGGAAGGAC" "34281" "1" "0.109453" "-1.8009865" "-4.29" "-0.19605443" "403187" "GAGCCTTTATTACATCTCTGAAGACCCTTTTTCTAAATGGAGACACACAGGCCCCAGGAT" "60725" "1" "0.109467" "-1.8009023" "-4.29" "-0.23787376" "" "CAATCGCCCTGGAGAAAAGCCCACCAGTTAAATGGTCCCATCGAAATCTTAAGAAACTCA" "34468" "1" "0.109475" "1.8008542" "-4.29" "0.77406583" "20973" "GGATGGCCCTGCCCTCAGATTCTATAGACTAGTTTGGAGATGGAATAAACGGTTTTTCTC" "55289" "1" "0.109481" "-1.8008186" "-4.29" "-0.34779434" "94047" "CACTGGATTTAGGACAGGAAGGCTGACATTTCCTTGGTACATCAAGAGACATGGTCACAT" "14485" "1" "0.109518" "-1.8005984" "-4.29" "-0.27303714" "320557" "GTTACCTTGTTGTCTGTGACAGAAGTTAAAGTTTGTATAGATCATAGAGGAAAAGTTAGG" "45749" "1" "0.109545" "-1.8004355" "-4.29" "-0.43964172" "270150" "GCCAAGCTGAGAGTGGTCAAGCCTCACTGGGATGCAAATGTGCTGAGACTCCACACCAGA" "39216" "1" "0.109549" "1.8004121" "-4.29" "0.80061361" "106512" "CCACCCTGCTGCTGAGTCTGTCTGATGTTTTGGTTGTATGAATAAACATAATTCCCCTCT" "51631" "1" "0.109549" "1.8004108" "-4.29" "0.18641653" "20724" "CCAAGTCTCAGGGAACTTGTCTGTAGTCGCAGAGCTCTGTAAACTTTGTATCCAGACAAT" "3175" "1" "0.109569" "-1.8002891" "-4.29" "-0.4308159" "386454" "TGTTTGTACCACCAGTGTTGGGAAACAGTCCTAATTTACCTCCAATCCCAAAAGGCTCAG" "24240" "1" "0.109575" "1.8002549" "-4.29" "0.74577764" "" "TTAGTCCCAATGGTTAATGTTGCCAATAAAATGGAAGACAGCCCCTCCTCCCTCTTCCTA" "13028" "1" "0.109576" "-1.8002504" "-4.29" "-0.25769124" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "19525" "1" "0.109643" "1.7998519" "-4.29" "0.26926133" "" "GGAATGCATCCTCAGTGATATTCAACAAAAGCATAAAATATGGTATGATGAGGAATGTGT" "1398" "1" "0.109673" "-1.7996696" "-4.29" "-0.18984497" "666244" "AGTCCTGATCCAGAGGTAACTGTGGACATAACTGCTGGCCTGAAGGGAGCCTTGGAACCG" "52341" "1" "0.109674" "1.7996656" "-4.29" "0.72024326" "72512" "GCTGTATACAATCACAGTGGGCTGGCCTGTCAACTGCCTTCTTAATAAACATATCTATTC" "5233" "1" "0.109678" "1.7996415" "-4.29" "0.21281855" "93689" "CAATGACATTGGAAGCCAAATGGAACTAGTTTTACATATATAAATATATAATTTCCTCTT" "585" "1" "0.109688" "-1.7995785" "-4.29" "-0.30733438" "" "GGATGAAGGTAAAGTGCAGTGGGTTGAACCTGTTTTGAGTCTTTCTCGTTTTTGTAATAA" "46581" "1" "0.109731" "-1.799322" "-4.29" "-0.20760103" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "48953" "1" "0.109753" "-1.7991963" "-4.29" "-0.17563921" "" "CTCTATCTTCACAGTGACGGTTAGACCATAATTACCATCTGTTCTAGTCGTAGCCTTGTA" "30898" "1" "0.109777" "1.7990509" "-4.29" "0.56283229" "319229" "TAGTTCTTCTAAGAAGAGCACTTCAGCGGCCCCAGAAGGGGCAGAGAAATAAAATGACAT" "22354" "1" "0.109798" "1.7989266" "-4.29" "0.17885653" "75131" "TTATGGTACCATGGGAATTTTCCTATGACCCATTGATAGAGCAAGAAAAGACACAACCCC" "14591" "1" "0.109825" "-1.7987641" "-4.29" "-0.16442066" "67178" "GGTACGACATGTTCCGAGATGCAGCTGCCATCTTGCTGGATGAACAGAACAAGCGGCCCT" "24330" "1" "0.10983" "-1.7987319" "-4.29" "-0.22769308" "330177" "CATTTTTCAGGTCCCAAGGAAGAGCATGATTAACTGTCAGGGCTTTTAATTATATTTGTA" "16408" "1" "0.109852" "1.7986017" "-4.29" "0.240359" "" "TATCGATAGCCCTTTGAACACACACACTGCTCTGGAAAAACCCCACAGCGTTTAAGAAAT" "56275" "1" "0.109856" "1.7985811" "-4.29" "0.68001263" "13078" "ACTACATTAAGCAGATAGATCACCATGTATGCTAATTAGTATGCTTTTCGCTGTGACACA" "35220" "1" "0.109859" "-1.7985633" "-4.29" "-0.18412013" "668572" "AGAATCCATACAGGAGAGAAACCTTAAAAATGCAAAGAATGTGGCAAGTCTTTTGCTGAG" "11691" "1" "0.109864" "1.798533" "-4.29" "0.18472987" "227292" "GAGAAAACGAACTCCCACAAGTTGTCCTCTGACCTCCTCACATGCACCATGGCACGAGCT" "24545" "1" "0.10987" "1.7984952" "-4.29" "0.17541037" "66712" "TCAAGACCATTTCATCTCTAGCTGCACCACGTGAGGCTCTCTCAGCTTTTGAAGAACATT" "4883" "1" "0.109888" "1.7983868" "-4.29" "0.16732642" "" "CACAGGTGTAGAAATGTTGCAGAAGATGAGGCGAGAGTTTTAGATATGGCTGGGTCATAA" "46437" "1" "0.109896" "-1.7983411" "-4.29" "-0.14111325" "" "TTTCAACACTCCTGGATTCCAGATCTCTTCCTCACACTGAGGACACAACAAGGATCCTAG" "52955" "1" "0.109907" "-1.7982763" "-4.29" "-0.16800673" "" "GGCCCGGCCCTCCTTCCGGGGACGTGTCTCGGGCCTGCTCTAATGGCAGCGGCGCCTCCC" "5363" "1" "0.109917" "-1.7982186" "-4.29" "-0.37837419" "17260" "AGAGGAATAGTATGTCTCCTGGTGTAACACATAGACCTCCAAGTGCAGGTAACACAGGTA" "50769" "1" "0.109924" "1.7981724" "-4.29" "0.22022577" "" "AGAGACCATCCTAGCTAAAATAGCACTTACAATAATCACTTGACCATAGTCACGGATAAA" "18182" "1" "0.109945" "-1.7980516" "-4.29" "-0.23697792" "97112" "ATCCAGAAGACATCGGAAATGAATACAGATAAACAGTATTTTTGCCGAACTCACTTGGGA" "30932" "1" "0.109975" "-1.797872" "-4.29" "-0.20554273" "" "GACATCAGTTAATGAGCATTTCTGGGTTATCTTCAGGGTTTATAAACACAATGATATGGA" "18940" "1" "0.109997" "-1.7977387" "-4.29" "-0.15448412" "639527" "TCAACATTCCAAAATATGAGGAAGGAGGTGACATGATTCAGCCCAAGCCCTCCTTAAGCA" "19837" "1" "0.110017" "1.797618" "-4.29" "0.18835837" "233912" "CTGGGAGAGGACCCAAGGGATGAGTTGGCTGTAAAGGAGGCTTCTCTCAGCCTGAGAGAA" "57167" "1" "0.110021" "1.7975989" "-4.29" "0.23556093" "210962" "CAGCAGTCCGGTCTTTCTGACCAGAAATCCAGTGACCCAGGTCAAAGTGGAATAAAAATT" "27991" "1" "0.110024" "1.7975777" "-4.29" "0.28475738" "55951" "GCTGCCTTATCAATGCTAAACCTTATTTGTCTTCATCAAGAGTAGTTCAAAATATGCAAC" "40754" "1" "0.110041" "-1.7974804" "-4.29" "-0.15584334" "56378" "GCAGCACCATCACGTGGAGACACATCATAGGACACACAGGCCGATGTGTCTGTTCATACC" "29510" "1" "0.11005" "1.7974225" "-4.29" "0.59760181" "19188" "AGAAGGGCATTAATAACTCACTTAAAGAAATACAGGACGAGGCTCGAGAGCTGCCAAGTG" "22137" "1" "0.110085" "-1.7972171" "-4.29" "-0.17136562" "68152" "TCGGCTTCAGACAGCAAGGATGGTTCAAAAAAGAAAAAGAAGTCCAAGGATGTAACTGAA" "48370" "1" "0.1101" "1.7971263" "-4.29" "0.47659297" "276950" "ATTAATTGCTATGCAAATGACTAACAAGAGTGAGCATCCTGTGGAGATGGGACAGGACTT" "37362" "1" "0.11011" "-1.797066" "-4.29" "-0.18116467" "" "CAGTTTACGAAGCACAAGACATTTGTGCTGCATAAGAACACAATGACCAAATTCTTTTTT" "22116" "1" "0.110119" "-1.7970159" "-4.29" "-0.14289166" "272347" "AGCCCACAAGTTCCGAAACCTACAGTAATTATATCTGTTACATAAAGGAATTTGAGATCT" "60689" "1" "0.110123" "1.7969894" "-4.29" "0.14406361" "" "CACAGCTAACAAAATGCTTCTAAGCTACCAAGATCATGGTGGGTGAGTAAATATATTTAT" "5548" "1" "0.110135" "1.7969179" "-4.29" "0.15346477" "639826" "GGTAAAATGTGTATTCTTTCTTCACTAACTGCCACTCTCACACATACTTGCTATTCTATT" "15020" "1" "0.110193" "-1.7965762" "-4.29" "-0.16767542" "233812" "CCTTTGGCACCACAATGGATTGCCGTTGCATTACTGCACCAAGAAGCCAATAGATCAAAA" "29896" "1" "0.110202" "1.7965176" "-4.29" "0.27580272" "56693" "TGACTTCCCCTTGTTCACACTCAGTATTCACGCTTGTCTTCATGGTTACACGTCTTCATG" "4182" "1" "0.11026" "1.7961759" "-4.29" "0.984685" "14991" "CCTTCTCGATAAAAGCTGTACTTCATGCTGTTAAAAGTGTAAGATTTGTACATTGGAAAG" "8472" "1" "0.110263" "1.7961583" "-4.29" "0.32846978" "14263" "ACAGAAAATAGCTAAGTTCCGGCATGTGGCACATGCTGAATAAATGCTCGTTGATATGTA" "23726" "1" "0.110287" "1.7960129" "-4.29" "0.25392211" "214642" "TCTGGAAACTGCCAAAAAGTATGGCTATGAAGTAGTAGACACATTCACTATCACAATGGG" "45191" "1" "0.110289" "-1.7960037" "-4.29" "-0.15028445" "12725" "TCGTTTGTTGAATAGCACAATTCTTTAATCTGCGGGACTCGTCCACTTTTTTCTTCTTTC" "34117" "1" "0.11032" "-1.7958212" "-4.29" "-0.18757479" "18198" "ATCCTGCAGCGCATGTGCGAGAGAGCAGAGGGAACGACAGATGGCAGAGCCCATTTCTTT" "43603" "1" "0.110332" "-1.7957509" "-4.29" "-0.19271048" "" "ACTTTCTTTGCATCATCACTGGAAATTCCTTGTGTGAGTGAGGAACTCCTGTCAGTGGGA" "28266" "1" "0.110351" "1.7956355" "-4.29" "0.3634238" "15980" "CAGGAAAAAGAAGTGCACGTGTTTCTTCTTTTCTTGTCCCTTACCACGTCGCCTTCTTTG" "28658" "1" "0.110365" "-1.7955525" "-4.29" "-0.20743832" "" "TTGAGTTTTGCTCAGAAAATTGATTCAGGCTCTCTGAGTAAGATCAGACTAAGTAAGTCC" "12083" "1" "0.110371" "-1.7955185" "-4.29" "-0.17483207" "" "TCTGACCAGACGTGCCAGGCTCACTGTCCCGGCTCTTCTTCACGCTCTCCATGTTAGAAA" "2592" "1" "0.110375" "1.7954944" "-4.29" "0.64218968" "21926" "TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG" "40654" "1" "0.110399" "-1.795352" "-4.29" "-0.14896611" "73754" "TCGCCGTTGAGACTTAAATATTGCAGTTTCTGTTCACACTGTGGATTGTGTTCTGTGAGA" "45795" "1" "0.110408" "-1.7952993" "-4.29" "-0.17171957" "70397" "AAAGTGTAAGGGCTGAGGACACAGCAATTGGCACTGTGTTTGCTGATGTGAGGCCCTAGA" "25255" "1" "0.110467" "-1.7949452" "-4.29" "-0.19559046" "" "CTGTCTGTCTACTATTGTACCACCTGGCTGTATTGCTTTTTAATATTGCACCGAAGGTTT" "24567" "1" "0.110494" "-1.7947882" "-4.29" "-0.2626349" "70626" "CCGACTCTCCAAATACTGAGATTAAAGGTGTGTGGTTCCACATCTGGCCTCAAAGTGTTA" "2224" "1" "0.110506" "1.7947157" "-4.29" "0.49844421" "" "TCTTCTACAAACCACTTTCAGCTAAGTGCAGCTCTCACTGGATAACCTTGACTCTGAGCA" "19734" "1" "0.110507" "1.7947085" "-4.29" "0.14172909" "" "" "61409" "1" "0.110512" "1.7946779" "-4.29" "0.21215569" "" "TAACTTGTGTGTTATTTAGGGGCTATTGTAGCTCAGTTGATAGAGTTGCCTGCCTGCCTG" "31418" "1" "0.110515" "1.7946644" "-4.29" "0.15257497" "" "CTCCTCTACCAGATTATGAAATGTCTTTCAACAGAGTGTATGGTCAGTTTATTGCTATAT" "11485" "1" "0.110549" "1.7944636" "-4.29" "1.05966152" "574428" "CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA" "49567" "1" "0.110549" "1.7944585" "-4.29" "0.25494673" "68001" "AACTCCCCGTGGGCTGACAACACGGCTTTGAAAAGACATTTTCATGGCGTAAAAGACATA" "61781" "1" "0.110588" "1.7942331" "-4.29" "0.1564757" "" "TCAGCAGCCTACAGGCTGAAGATTTTGTAAGTTATTACTGTCAACAACTTTACAGTACTC" "23480" "1" "0.11062" "1.7940406" "-4.29" "0.34641987" "" "ATCAGGTGTGACTCTTAGATCACTGCCTACTCATTTTCTAGTTCAGAGAGGAACGGCTAC" "49919" "1" "0.110636" "-1.7939456" "-4.29" "-0.19661653" "" "ATACAAGCAAACTGCTATGAGATCAAGGACCACTGCACCCTGTCAGAAAAAGTGGTGACA" "296" "1" "0.110643" "1.7939064" "-4.29" "0.14749871" "" "TTAGGTGGGTTAAGTGCACACAAATGGAAAATGGGGTAGGGTAGAATGTCAGTCCCATCT" "8068" "1" "0.110658" "1.7938147" "-4.29" "0.48731542" "" "AATGATTGGGATGTATTCCCAGTCGACACACCATACCATATGGGGATGTCCCTAATTTCC" "51361" "1" "0.110684" "-1.793662" "-4.29" "-0.2307005" "66315" "ACTCAGCACTTAACATTTGATTAAATGTTCAGGTAACAATTGTACTGAACTTGTGTGTCG" "31165" "1" "0.110684" "1.7936609" "-4.29" "0.25666404" "675759" "ACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAG" "49398" "1" "0.110697" "-1.7935873" "-4.29" "-0.153795" "" "CACAGGATGAAGCATGGACTCCAAATCTAATCAGAGGGCCAATGGGGAAATTTCAATCTG" "48907" "1" "0.110701" "-1.7935637" "-4.29" "-0.22452249" "" "TGCTTTACAGGACTTGTGATGTAGATCGTCGTCATTTTTGTTTCACAAACAAGGAAGGAG" "7605" "1" "0.110702" "-1.7935546" "-4.29" "-0.15523986" "101604" "AGAGATATTCCAGGAGTGTGGGGGATGGTCTTAAAGGCACCAACATAGAGGGTGAAATAT" "62330" "1" "0.110706" "1.7935348" "-4.29" "0.30114709" "" "ATTTCCCACTAACACAATTGAAAATGTCAGGGATCGAGTTGGTCAGCGGAGTTGATGACC" "42777" "1" "0.110749" "-1.7932762" "-4.29" "-0.13868189" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "18558" "1" "0.110757" "1.7932295" "-4.29" "0.41968992" "" "CTGGTCACCTGCCACAAGTGGACAGTTATACAGACTCCAAGCCTGTCCCAAAATGGCGGA" "38722" "1" "0.110763" "1.793192" "-4.29" "0.51992699" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "45163" "1" "0.110772" "1.7931391" "-4.29" "0.39348879" "21414" "TTTTTTCATTCTCGCTGTAGATAGCCTGAATCCAAAGAAAACCAAAAGGGGTTATCCAAG" "50140" "1" "0.110779" "1.7931007" "-4.29" "2.13397748" "14961" "AATGTATGCTTATCCCCACCTAGATTACAAATAAACGAGACCCAGACTCTGGTTATTTGA" "21125" "1" "0.110807" "-1.792934" "-4.29" "-0.16899383" "" "GCTCGGACACACGAGTCAATCAACTTGCCTCTCTGGGAACCTTGTTTCTCTTTGTGGCCC" "57552" "1" "0.110871" "1.7925535" "-4.29" "0.18418802" "70891" "ATGGCAAACCAAATGCAAGAGAACGAAAACGGGACTGTTACCCAGTTGTACAATGGCCTT" "34499" "1" "0.110887" "-1.7924597" "-4.29" "-0.22434429" "" "TTGGCCAGACAGATGGTGCAGAAAAACGCAAAGACTTGTATTGAGAAAGAAGATGACTAA" "2471" "1" "0.110911" "1.7923196" "-4.29" "0.325601" "20371" "ATTATGTGTTGGAGTGTGCCTGAACAGCTCTGCCTAGTAGTGAGCATAAAGTCCCTGTGT" "36324" "1" "0.110933" "1.7921885" "-4.29" "0.36487436" "27027" "CCTACCATGGCTTGGATAGAAAAGGCAGATACTCCCTGACACCACCAAGATCCCATGGTT" "12093" "1" "0.11094" "1.7921509" "-4.29" "0.4830555" "68394" "ATCGCACTGTGCAGCCAGTCCTTCTCCCTGGCTAATTCAAAATAAAGTAGCTTCATTCTC" "51610" "1" "0.110967" "1.7919889" "-4.29" "0.51423504" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "5301" "1" "0.110985" "-1.7918857" "-4.29" "-0.17943118" "66880" "CCTAGGTTTCTCAATAACAGGTACACCAAATACAGATGCTTGAATTGTAACAAATTTGCA" "30651" "1" "0.111008" "-1.7917454" "-4.29" "-0.13264782" "80907" "CCCAAATACATAAACCCTTTAAGGATACATTTCGTTCCCAAATACATAAACCCTTTAAGG" "16375" "1" "0.111014" "-1.7917123" "-4.29" "-0.33314164" "" "TCTGTTTTGTGTTAAGGAGTGGCTTATTCTCTTCCATTCCCAACACGATGTGCCAAGCCT" "26513" "1" "0.111024" "1.7916513" "-4.29" "0.2122197" "21940" "TGTCATGGTCATCAGAACCCTTTCCTGTGAATACTCAACAAACTGCCCTTCTGAGACCAA" "43034" "1" "0.111031" "1.7916133" "-4.29" "0.79792175" "15410" "TATTGTATTCTAGACAAGAGCTGTAGATTTATGTTAAACTCGTACATATGAGGAATTGTA" "11165" "1" "0.111033" "1.7915998" "-4.29" "0.24297281" "12525" "CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT" "14340" "1" "0.111077" "1.7913375" "-4.29" "0.35466508" "258258" "TGGCAATGATGAGAGTACTTAGACAGATAATGGGTTACAGACAAATTATTAAACACTTGC" "29778" "1" "0.11109" "-1.791264" "-4.29" "-0.34831545" "56485" "AGGCCATTTGCGAAGACACACTGAGCGTGGATTATTAACTGTAAGCGATACTACTTTGTA" "62059" "1" "0.111134" "1.7910049" "-4.29" "0.6456921" "27056" "CAGAGTCGGGGTAACAAGAACATAGAAGAGAGGCCTGAGGTTTCATTTCCCCTAAACATT" "379" "1" "0.111144" "-1.7909466" "-4.29" "-0.31776445" "242653" "TTGACTGCTGTCTCCTGGTATGCTACCCTGGTAACACAGGAATTCTTCAACCCCAGCACT" "30601" "1" "0.11117" "-1.7907915" "-4.29" "-0.34297716" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "26405" "1" "0.111173" "-1.7907733" "-4.29" "-0.20714307" "19340" "CGCTACCGGACAATCACCACGGCCTACTATCGCGGAGCTATGGGTTTCCTGCTCATGTAT" "37271" "1" "0.111195" "-1.7906475" "-4.29" "-0.18107978" "239114" "GCGAACTCCAGCATGGACAAGCTGCTGCTGGGGCCCGCCGACAGGCCTGCGGGGCGCTGA" "34746" "1" "0.111198" "-1.7906294" "-4.29" "-0.17527026" "14167" "TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT" "32230" "1" "0.111207" "1.7905742" "-4.29" "0.2155132" "215859" "GGGTACCTATTATAACTCAGCCATGAACCCTTTGATTTATGCTTTCTTTTTTCCTTGGTT" "18970" "1" "0.111266" "-1.7902279" "-4.29" "-0.22436386" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "4189" "1" "0.111292" "1.7900709" "-4.29" "0.2660006" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "58992" "1" "0.111304" "1.7900029" "-4.29" "1.10958602" "236451" "TATTAAAACTCCATCAGCATAGAGCAGAAGCTGTCCTGTGCATTGCTTGCTGTTACCCTG" "57384" "1" "0.111306" "1.7899896" "-4.29" "0.53489124" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "51776" "1" "0.111327" "-1.7898677" "-4.29" "-0.1544023" "" "ACAAATGCAAAGACTGTGACAAATCCTTTATCCACCTTTCAAATCTTAGAAGACATCAGA" "53940" "1" "0.111346" "-1.7897566" "-4.29" "-0.20005953" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "30870" "1" "0.111372" "1.7896017" "-4.29" "0.47470883" "78285" "TAAGACAGATGATGATCCCAGAGCTACTAATAAAACAAAAAGGGGGAGATGCGGGAAGCA" "14495" "1" "0.111379" "1.789562" "-4.29" "0.20116089" "" "CCCTGCATCCAGCTCTCTCCAGCTCTGCACCCTGCTCTCCCTTGCCCACCTGCAATCACG" "3125" "1" "0.111445" "1.7891729" "-4.29" "0.16319335" "77583" "GTCCCTCCCAGCCCCCACTGATCATGTTCGTTTGTATTATTTTATAAAGTGACTTTTTTA" "20393" "1" "0.111456" "-1.7891114" "-4.29" "-0.25073574" "" "TTTGCAAAGTGCCCCCACCTCTTAAAAGCTTCGTTTCATGTGTAAACTGCAAGGACAGTC" "38356" "1" "0.111469" "-1.7890321" "-4.29" "-0.15527219" "66268" "TCTTTTGTAGCTGAAAAATACTTTTCAATAAAATGTCTTATGGGAGAGGAACACGACCAG" "61412" "1" "0.111479" "1.7889722" "-4.29" "1.14620302" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "45232" "1" "0.11148" "-1.7889673" "-4.29" "-0.13967929" "234362" "CCCACCACACTTCTGGGTAACAGAAAGGTGTTTGTAGTTAATTTGAAGCTTTTAATTATA" "15776" "1" "0.111484" "1.7889412" "-4.29" "0.93509439" "20849" "AGAAGGAAGCAGATGAAACTGGAGAGTGTTCTTTACCATAGATCACAATTTATTTCTTCG" "38636" "1" "0.11149" "1.7889108" "-4.29" "0.58485318" "17313" "GCCGAGGAGCCAGATATTAGCGCGAAGAAACAGTCATTTGGTTGTGGAGTTTCGTTTTAT" "8006" "1" "0.111497" "-1.7888672" "-4.29" "-0.2367082" "20361" "TCCCTTATCTCTTCTCAATGCACTTTAATAATGTAACATATTACTAATAAACAAGCTATT" "44019" "1" "0.111503" "-1.7888313" "-4.29" "-0.19423016" "66176" "TTGTGAGCTTTGCAGTTTGCAAACTACGGCGCTTAGACGGCCGAGGAACCACGCAAAGGG" "60018" "1" "0.111528" "-1.7886881" "-4.29" "-0.18836809" "" "GTGTGTTCTACCCCCTGCCACTGACTATGTTTGGAGTATATACATAGACATAGCTGGTCT" "29315" "1" "0.111537" "-1.7886314" "-4.29" "-0.50030034" "" "GTCATTTCAATACACATACCTAATGTGTAATGACTAGACCTGGGTAATTGACATAATGTG" "7691" "1" "0.111545" "-1.7885852" "-4.29" "-0.31288074" "64009" "GATTGATGACATTGTGTGTTGTGTATCTGACTTACAGATTCAAAGTCAATATTGTGTGCA" "20240" "1" "0.111556" "-1.7885226" "-4.29" "-0.35083374" "239408" "GAGTCTGCAAAACTCTATGGTTCTTTCAACTTCAGGATGAAAACTAGTACTAATGAAGAC" "16853" "1" "0.111607" "1.7882201" "-4.29" "0.17091722" "258156" "TGGTATTAGAACAAAGAAAATTAGAGAGTACGTTCTTAGTTTTCTTAGAGTAAAATTTTC" "31142" "1" "0.111626" "-1.7881077" "-4.29" "-0.14758941" "21780" "CCTCTGAATTTAAAGCTGGTGTTAGCATACGGATGTACAGTAGCTAGAAAGCCTTCCTGG" "45193" "1" "0.111694" "-1.7877101" "-4.29" "-0.25808156" "" "AATATCTTGAGTGTACAATTCCATTCTCGAATGTGGAAAAGTGGCAGGCCACCTTCCCCA" "12922" "1" "0.111712" "-1.7876037" "-4.29" "-0.16781362" "" "AATTTTTTGGGGCCACTGTAAGGTGCATATAGAGAAATTACCTCTGAGGATGACATGCTA" "3352" "1" "0.111719" "1.7875612" "-4.29" "0.22837586" "383103" "CAGATCACTTCAGTCTTAAAAGTAGAAAAGCTCACAGTAGGTAATAAAATGTCTACACTG" "40218" "1" "0.11172" "-1.7875579" "-4.29" "-0.19359647" "17155" "AATGTGAATGCTGAAGTTTCTGTTTTTGAAGTCAACATACGCTTCGTCGGTGGACTGCTG" "40208" "1" "0.111742" "1.7874282" "-4.29" "2.24388153" "14960" "TTTGGCCAATTGGCAAGCTTTGACCCCCAAGGTGGACTGCAAAACATAGCTGTAGTAAAA" "34637" "1" "0.111747" "-1.7874016" "-4.29" "-0.14140587" "74648" "AAGGACATTTATCTCAGCAAAGTCATTGCTCATATAGAAGATCCAGGGGACTCTAACCAA" "17147" "1" "0.111824" "1.7869491" "-4.29" "0.16177398" "" "GGAGAGGACTAGGGAAATGAAGGCATCCTTACTTAACTTGGTAAATACATCAGCTTTTTG" "25367" "1" "0.111848" "-1.786806" "-4.29" "-0.14824899" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "297" "1" "0.111849" "-1.7868001" "-4.29" "-0.27068169" "494468" "GGCCATTTTATGGATGCTAGTCATCTTGAAAGATTGAATACTTGCTGGTTTTTATTGTGC" "42060" "1" "0.11185" "-1.7867952" "-4.29" "-0.18118913" "333050" "TTACCAAGCTCATGGACATGCTAGAGAAACTGCCAAAGCGAAACCGCCGCCTGTCGCACC" "46276" "1" "0.111872" "1.7866688" "-4.29" "0.4048106" "171395" "AACTTTCTATCCTAGAAAACCAATGGAAGAGAGCACTAGAGTCAAGGGCAGGTGACAGTC" "57652" "1" "0.111872" "-1.786667" "-4.29" "-0.17407832" "" "TTTCAAAGGAGGATCTAAACAGCCAAAATGGTAGCACAGCCTGCATTCATCACACCTGCA" "41617" "1" "0.111894" "-1.7865374" "-4.29" "-0.15337447" "" "ATTCATCCTTCATGGTTTCCTGAAACAAACCACAGGTTTTACAGTGAGATTCAGATCAGC" "31971" "1" "0.111897" "-1.7865189" "-4.29" "-0.1612253" "" "TTTTGCAACATGCTGAGCTCTTAGCTAAGGGTTGCTATAGCTCTGGGACTGGAGAAGATA" "35133" "1" "0.111935" "-1.7862964" "-4.29" "-0.17177485" "" "AGAAGCCTTCCTGCCCCTCATCTCCTAAGGAGTATCTGCTAGGGGCAAGGGCTTTGGTTG" "35165" "1" "0.111954" "1.7861883" "-4.29" "1.19543103" "327959" "CCTTCAACCCTTGCATTTATGGACTCTGGAAATCGAAGATCCACAGTGAGTAAAGATGTT" "36877" "1" "0.111955" "1.7861823" "-4.29" "0.37237075" "98256" "GCTTCTGTCTTCTCCAAGCTGGCTGACTGGGACCCTTAGAAGTTCTTTTCATTGTCAATT" "16894" "1" "0.111964" "-1.7861283" "-4.29" "-0.16848858" "" "AGGCATGGCTTTCTCTCTTTTCTCCGTCACCAAGTTACAGCTTGCCTGTTCTATTTTTTC" "38534" "1" "0.111971" "1.7860852" "-4.29" "0.1647215" "16796" "CCTCCTTCCTGGCCTTGTCCTTGGGATCATTTCTTTCTGGCCTGTTATGATTTTGAACAT" "7162" "1" "0.111999" "1.7859215" "-4.29" "0.15425687" "" "TCTGTGGGTCTAAAAACTGGTCAACATCCACCATACAGTAAGCCTGGCTTCAAGGTATGT" "17114" "1" "0.112049" "-1.7856291" "-4.29" "-0.1560824" "57230" "TATTTGTGTGACCTGGGGACTGACACGCTGCCCATGAAATCTCTAAAATGAAAACCCAGT" "12362" "1" "0.112059" "-1.785573" "-4.29" "-0.41461158" "16371" "CTTTGTTTCTTTTTTCCCCTTTCTGTATATAGCGTGATTTCAGATTGTAAATAGCGCGTC" "61383" "1" "0.112079" "1.7854558" "-4.29" "0.66591983" "" "ATGGAGATGGGCTGCCACAGCGCTAAGATTTATGGTTGACAAATGGCAATTATAATAACT" "45033" "1" "0.112096" "-1.7853542" "-4.29" "-0.16823467" "240817" "TCTTGCATTTTAGTAGCCCAAGAGTTGAATAGCATTAATTGGCAGTTGGTACTCATCACC" "57872" "1" "0.112098" "-1.7853444" "-4.29" "-0.1672455" "320633" "GTGTGTGGGTTTGTACTTTAAACACTAACTGCCCATTGAAATTTTCTTAAAACCCAGAAT" "48473" "1" "0.112103" "-1.7853174" "-4.29" "-0.17980995" "70699" "GGACATCTTTTCTGTAAACCTCTCTCATTTCTCCCTCACTTGTGAACAATAAAATACTTT" "57875" "1" "0.11213" "1.7851575" "-4.3" "0.42471225" "18724" "GCTGGGAACTAATCTAAAGAAAAAAGAATGCATCTTCAATGTTCTACACTCTGGGAAATA" "15141" "1" "0.112186" "1.78483" "-4.3" "1.12095239" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "39946" "1" "0.112187" "-1.7848261" "-4.3" "-0.24764706" "241175" "GGGAGTGTTGAGATATTAGGTTACAAAGAAAAGTTTGTAAAGTTGATAAGCTGTGTGAGT" "38505" "1" "0.112222" "-1.7846203" "-4.3" "-0.26047521" "" "TGATCCTAAATGGGGACCTGCATAAGTCATTGAGATGAATCAGCCTCTAGGAACCAGCAA" "40230" "1" "0.112231" "-1.7845671" "-4.3" "-0.34523282" "" "CTTTCAAACATAATATGGGAATAGCTGATGTTCCTCCCCATGTCACAAAAGGAAAATTAA" "58338" "1" "0.11228" "-1.7842829" "-4.3" "-0.19445698" "55960" "TGTTTGCTGTAGAGAAGTTATTTCAGGAGGAATATACCTGACAAGTACCTCTCAAGCTAG" "58272" "1" "0.112309" "1.7841127" "-4.3" "0.51572073" "" "CCCTCAAAACAAATGTCACTAAAGGAAAGGTGTTGTACAAATGACTGACTCAATTGTTAT" "42848" "1" "0.112326" "1.7840146" "-4.3" "0.26661782" "218442" "TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT" "57678" "1" "0.112346" "-1.7838935" "-4.3" "-0.13166101" "66687" "GTTAAACGTGTGGATAAAGAACTGTTTCAACCTTAGCAACTGGATTGGCAGTCTGGGTTT" "41278" "1" "0.112371" "-1.7837494" "-4.3" "-0.18088338" "66143" "TCTCGCTGGTTTTGTCACATTCAACATTACCCAGACATCAGGCAACATCTGTCCAGTATT" "19321" "1" "0.112386" "-1.7836644" "-4.3" "-0.23553181" "" "TTCACACGGCTTGGCCTGTGCTCTCCAGAGAATCCCATGTGTGAACATTATGAATGAAAA" "7975" "1" "0.1124" "1.7835818" "-4.3" "0.17127992" "677296" "CCCAAGAATCCAACTTTACAGCTCTTTTACACTTTCTACAAGAACAACCATGTCATTCAA" "56226" "1" "0.112449" "1.7832936" "-4.3" "0.60536722" "19188" "CCCGAAGGGTGAAGAAAAGCCATCGATGTACTGAGCTAAGGATTAGAAGGAAAATAAATG" "25213" "1" "0.112457" "-1.7832486" "-4.3" "-0.70255872" "14455" "ATAGAAGATGGTGTCAGATATATTGTGTTAAAATTTTACCATTAAAGTGTATTATAACAT" "51063" "1" "0.112467" "-1.7831885" "-4.3" "-0.30650922" "19933" "CCTTAGACTGTAGTGTGGGGTTTGCTCATTGGCTTTCTTGTTCAGATTTTACTAACTGTT" "51545" "1" "0.112521" "1.7828778" "-4.3" "0.3076865" "629203" "AATGGGATAACTTCTTGGTACTGTACTATGAAGACCATGAAAAAGGACACAAAGGGAACC" "52102" "1" "0.112527" "-1.7828423" "-4.3" "-0.26739372" "16601" "GAGCAAACAATTTTAACTTCATGAATTTGTTTGAATTCCCCCATGCTTTCTGATAACGCC" "5934" "1" "0.112555" "-1.7826763" "-4.3" "-0.19775094" "11840" "GACGACCTCTACTTTTTTCTTTTGTATTTTGATAAACACTGAAGAAGCTGGAGCTGTTAA" "37884" "1" "0.112557" "1.7826676" "-4.3" "0.53635279" "12798" "ATTGGAGTACACTAGGCTTTAAAATACTGCAGGCATTCTGAGGGACTAAGTTTGCTTTCC" "10002" "1" "0.112578" "-1.7825429" "-4.3" "-0.16254564" "" "TTTAAATTCCCCTAAGGGCCGTAACACGAGCCACCCCGATGCTCCCACCGCTTCCAGTCA" "16328" "1" "0.112587" "1.7824887" "-4.3" "0.49130182" "" "TGGTCTTAACCTCTTTATACATTCCCCAATGTAGTGGCTTAAGAAAGCTGTAATGCACTA" "10876" "1" "0.1126" "1.7824164" "-4.3" "0.2088933" "207474" "CACAAATACATACGACCAATACTAAATGGACAGCAGAGTGTATTTCTTTAAACACATGTG" "312" "1" "0.112608" "-1.7823689" "-4.3" "-0.15370656" "" "TTTAAGACCAACCTAGAAGAATTTGCCAGCAAGCACAAGCAAGAGACCCGGAAGAATCCT" "1334" "1" "0.112611" "1.7823488" "-4.3" "0.23469414" "" "TTGTACCTATGCACTTCTGTAACTATTACTAATATTGATCTGTTTGGGTGACAAGAGAAG" "28775" "1" "0.112628" "1.7822539" "-4.3" "0.41723024" "381287" "AAATACTAATGTGGAAAAGGCGTGGTGTGCTGTGACGGGATTTGAAAGACTCAGTGAGGA" "2226" "1" "0.112645" "1.7821545" "-4.3" "0.43074239" "" "AGTAGGAATTCACTTAAGTTATCTCTGCAGAGGAGAATGTCTTCATGTTCAACCTGCATG" "28842" "1" "0.112681" "-1.7819434" "-4.3" "-0.21183288" "71750" "GTTTGTTTGTTTGTTTGGGGAGTTACTTGGGGGGAGGTTGGTTTTGTTTATAAATATAAA" "39576" "1" "0.112727" "-1.7816733" "-4.3" "-0.17240162" "22589" "TTAATCATGACTCCTTCTAACTACCAGCAGATTGATATGAGAGGAATGTATCAGTCAGTG" "46691" "1" "0.112731" "1.7816521" "-4.3" "0.68935639" "320435" "AACGAACGGATGGGAACAAGAGAGACGGGAGATGCTGGGCTACTCCAGGAAAGCTTCTCC" "54953" "1" "0.112746" "-1.7815661" "-4.3" "-0.21749922" "276952" "GTGGAGGCCTTCAGGATCTGACTGACCCCTTATCCCAACACTAGGTTGACCCTATGCCCT" "54636" "1" "0.112772" "-1.7814127" "-4.3" "-0.16434695" "11428" "GCTGGGGGAGGGGTTGCTTTGTCTCTCTTAACGTTTTATCTTTTCTTTCCTTCTTTTCTT" "20801" "1" "0.112782" "-1.7813575" "-4.3" "-0.21380581" "70925" "GTGTGGAAAACACTAACATAAGTGAGTTGTAAAAAACACTGTCAAGTTTCTTCTGTTGTG" "19586" "1" "0.112837" "-1.7810349" "-4.3" "-0.28510544" "225583" "CTAAAATGCCTTCTAAGTACTTGCAAGAGAATCTGTCTGTGCATTGTGAACGTCCGCATT" "22670" "1" "0.112889" "-1.7807337" "-4.3" "-0.17019517" "16545" "GCAGTTATTATAACATAGCATGCAAACTATCCAGCTCTTATTTTGATTATGATTTGGGGG" "45196" "1" "0.112894" "1.7807041" "-4.3" "0.26807148" "217143" "CCCCGTATTACTGTTATAAATAGCCACCTAGGAAAATAATAAAGAATGCTTGTTCTCGGC" "46519" "1" "0.112914" "1.7805873" "-4.3" "0.16819436" "436240" "GGCTTATTACAGCAGATACAAAACTGTTTATGTTTAATTGCAAAGGCTGCATAATTCAGC" "39748" "1" "0.112948" "1.7803923" "-4.3" "0.32089109" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "61333" "1" "0.112951" "-1.7803735" "-4.3" "-0.17357044" "212281" "CATTATTAGTTTCTAAACACAAGAGAGTTCATACAGGAGAGAATCCCTATAACAGTCAAG" "52943" "1" "0.112957" "-1.7803402" "-4.3" "-0.18941138" "11980" "GTAGGAGAGCAGCTGTTTGAGTTTTTTGGTGTGTGTGTGTTTGTTTTTGTTTTTTGTATT" "2095" "1" "0.112987" "-1.7801645" "-4.3" "-0.23924415" "" "GAAACAGGAATCTATTGTTCTTTGACCCCTGCTTTCCAGTTTTCTCTCCCCTAGTCAACT" "32447" "1" "0.113048" "-1.7798133" "-4.3" "-0.23210406" "" "TGTCAAATGTCATTGAGGGCAGCGGCCACCTATACAGCCCAAGATAACTTTTAGTACAGT" "16122" "1" "0.113053" "1.7797844" "-4.3" "0.30496315" "12310" "TATTGTGCATCGTGTTGTATGTGACTCTGTATCCAATAAACATGACAGCATGGTTCTGGC" "53075" "1" "0.113069" "-1.7796907" "-4.3" "-0.29659834" "" "GGGACAGAGTGCCTAGGTATGAGCCTTCATCAAGTGGTATGAAGGCCCTACCCCAACAGA" "50326" "1" "0.113086" "-1.7795923" "-4.3" "-0.1553565" "75669" "TTGTGAAGGTGTGGAAATAAGTCCTGCCGACTTGTATAAAATGCTGTAAAATTCGAAATG" "34581" "1" "0.113093" "-1.779548" "-4.3" "-0.30685733" "" "TGAGCGTGTACATATGTGCCTGTGTGTTCTTCTGCCTGTCATGTCTCTGAACAAAGTACA" "21466" "1" "0.113107" "1.7794714" "-4.3" "0.3518282" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "29124" "1" "0.113108" "1.7794649" "-4.3" "0.28315936" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "9044" "1" "0.113115" "-1.7794207" "-4.3" "-0.17999113" "" "GTAATGCCTTCAGTAAGCTTTTGTTTATTAAGCATAGGAACACAAGCAGCGGCTTCGGTT" "33537" "1" "0.113169" "-1.7791124" "-4.3" "-0.1849823" "68441" "TTCCCTAGTCTTAGTATTGGACGCTATTTACTCAGCTATCAAGTAGAGATCTTCAAGACG" "27149" "1" "0.113196" "1.7789548" "-4.3" "0.73974681" "52673" "GTTTCTTGTAGCCATCTGGTGTTTGTTTGCAGCTTTCTTAATAAAAGTGTTAAAAAGACG" "26499" "1" "0.1132" "-1.7789318" "-4.3" "-0.15071378" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "28300" "1" "0.1132" "-1.7789278" "-4.3" "-0.24124402" "" "GACCTTAATGTCTAATGCCTAACTGGACTTTGATAGCAGGTTTGTATTGTATTTCATCAA" "8390" "1" "0.113216" "-1.7788353" "-4.3" "-0.16649062" "" "" "8357" "1" "0.113227" "-1.778773" "-4.3" "-0.18589994" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "28923" "1" "0.11326" "-1.77858" "-4.3" "-0.21247156" "68092" "TCTGGTTTTCCTCTGAAATATTAAAAGACAGAATCCAAAGAACGCCTTTAACTCTAGTCT" "3485" "1" "0.113271" "1.7785176" "-4.3" "0.47678187" "" "CTTAGATGCTGAGCCCAAATGTTAAAGCTCTATGTCTTACCTATAGAATACTGTGTCTGG" "15000" "1" "0.1133" "1.778352" "-4.3" "0.60419838" "" "CTGGTACTGGGGACATGCCAGTGTGGTACAGAGATCAAAGGCCCATGAGTTGGAATTCAA" "44234" "1" "0.113321" "-1.7782285" "-4.3" "-0.53028107" "234290" "CCATGTACTAAGGGAGAGTTGTTTTGGAATAAATTAACTGTCACGAAAAACTGTTAGGAG" "56684" "1" "0.11336" "-1.7780054" "-4.3" "-0.19399755" "67889" "TTAAACAATGTCTATGATTTGTACCAATTCTTACCCCTCTATGTGAATAAACGCAAGACG" "33078" "1" "0.11338" "-1.7778899" "-4.3" "-0.29403056" "18115" "GGAGGGACCAACATTGTTCTGATGTGGAGGATTTTCATATTTGGTGATGATATTAAATAA" "27304" "1" "0.113424" "1.777633" "-4.3" "1.05105958" "" "TCTTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGT" "26438" "1" "0.113427" "1.777618" "-4.3" "1.01584103" "" "TATCAACAAAAACCAGGGCAATCTCCTAAACTACTGATTTACTGGGCATCCACCCGGCAC" "30956" "1" "0.113435" "1.7775711" "-4.3" "0.30467022" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "34512" "1" "0.113445" "1.7775141" "-4.3" "0.2152594" "" "AGATGAGTTCTCAATGAGCTTTAATTGGCGCACTGGAAAGTGCAGTGCCTGTAATGTCTG" "32640" "1" "0.113454" "-1.7774594" "-4.3" "-0.20882315" "14761" "AGACGGAGAAGAGGCTGTGCAAGATGTTCTACGCCATCACGCTGCTCTTCCTGCTCCTCT" "54727" "1" "0.113484" "-1.7772842" "-4.3" "-0.23670795" "14860" "GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA" "22069" "1" "0.113485" "-1.7772809" "-4.3" "-0.33897487" "" "TGCTTGCTTGCCTATCTGTCAGTACATATCCACAAATAGTTCTTGTACAATGAAAGAACC" "21855" "1" "0.113496" "-1.7772189" "-4.3" "-0.29312287" "666938" "CTAGAAGGCCACATGTTCTGTTGGGGGTAAAATTGCACAATAAATGTCAAGTTACCTGTT" "25544" "1" "0.113519" "-1.7770817" "-4.3" "-0.2381325" "257939" "CTGGCATTGTCTGGACTATCAGCCTGACTAACACCAGCGTGCACACAGGCCTGATGTTGC" "50035" "1" "0.113546" "-1.7769269" "-4.3" "-0.14836892" "211484" "TGAAAAGCTGTAAGTCTCCTAAGTCAACCACAGCACATGCTATTCTTCGTCGGGTAGAGA" "28277" "1" "0.113584" "-1.7767073" "-4.3" "-0.20278661" "66421" "TACTATGACAGACATCTCCATGAACGTATTTATGTTAACGAACTAATGAGTGTCGCCTCA" "6702" "1" "0.113593" "1.7766554" "-4.3" "0.31183409" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "47414" "1" "0.11362" "1.7764983" "-4.3" "0.1750122" "" "TGAGGGGGTCTCCAAAGCCACCAATTACCACCTTGTTGCCACCATCCAGCAGGCTCTCTT" "47935" "1" "0.113647" "-1.7763476" "-4.3" "-0.25820112" "210044" "ATCCTGCAGACGCTTGGCTACACGTGTACATGTCGAGGTATCATCAACGTGAAGGGGAAA" "37113" "1" "0.113677" "-1.7761731" "-4.3" "-0.16248255" "" "GAACGGCTAGCCAGTTATAAAATGTATCCTTATACACATTGTATCATCTAAGCATACATC" "16899" "1" "0.113703" "-1.7760213" "-4.3" "-0.18771208" "14077" "TTTATTTTTTAAAACTGTATCCAAAGGGTGCTCCAAGGTCAATAAAGCAGAACCAAGGCC" "61266" "1" "0.11371" "-1.7759786" "-4.3" "-0.17629774" "" "ACCTGACTCAACCAACTGCTCTTTATAAAGTTGATCTTTGAGATCTGTAAACTGCTTCTC" "44831" "1" "0.113719" "-1.7759292" "-4.3" "-0.20604569" "" "TTTTCTCTGAGCTCATAAAATGGCTACTGTTTTACAAGCTCTTATCAAGTGGGGTTTTTT" "13226" "1" "0.113797" "-1.7754818" "-4.3" "-0.20136583" "110876" "ACACACGGAAAGGGTATACTTCTCATTTCAGGATGTTTTTAGATTTTTTGAGGTGCTTAA" "14261" "1" "0.113797" "-1.7754802" "-4.3" "-0.24522913" "381286" "ATTTTAATCTAGGTTCTTCTAATCTAGCATGTATCTGTGCCCTGTGTCAAGTGAGCTAGA" "47945" "1" "0.1138" "-1.7754647" "-4.3" "-0.17611287" "68276" "GTGCTACATAATGGCCTTATAGACTTGGTGTTCCTGTACCAGAATTTCTACGCGCACCTG" "18757" "1" "0.113805" "-1.7754361" "-4.3" "-0.20709603" "13557" "CCTGTTCCAGCTGTGATCTTACCACTTCAAATGGATGTAATTTGAATAAATTTTGTATGG" "46742" "1" "0.113808" "-1.7754166" "-4.3" "-0.15686916" "" "CCTAACAAAGCCCAACTGTTTGCCCTTCCCAGACTGAACAAGGCCTGAATACTTTTATTT" "27445" "1" "0.113832" "-1.7752754" "-4.3" "-0.30064471" "" "TACTGTGAAGTGCAAAATTTTATCAGAATGACTACATTTGTAGGGCTTCCCTGCAGCATG" "28509" "1" "0.113849" "-1.7751822" "-4.3" "-0.14362681" "232236" "GCTGTGACTCATTTGGGGTTCCAGGTGTGTAAATTATAAATGCTAATCTGAGAAATACTG" "47730" "1" "0.113907" "-1.7748459" "-4.3" "-0.22802137" "" "GAATGAGTTGGGAGAGAAAATGAAGCAAATACAGTACTCGTCCATGAAATCTTCAAAAAT" "60274" "1" "0.113916" "-1.7747938" "-4.3" "-0.20387208" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "19258" "1" "0.113918" "1.774781" "-4.3" "0.20154266" "" "ACATAAAGCAGGAGAGTGGTCTCCACGCTCAGTGTAGGGCAGGTAGCTTACACCCACCGT" "6900" "1" "0.113949" "-1.7746015" "-4.3" "-0.18795266" "69944" "CCCTGTGTGCAGGGGCATGCAGGAAATAAACTTTGTGTAAAATATTTTATGATTTACATT" "45635" "1" "0.113961" "-1.774536" "-4.3" "-0.17012051" "20844" "GCCCAGCATATTTATAGCTCTTTCACTCTTCAGTTTACTTGAGTTTAAAGTATGTCACTA" "50425" "1" "0.113961" "1.7745322" "-4.3" "1.04889447" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "27931" "1" "0.113974" "-1.7744591" "-4.3" "-0.2212746" "29877" "ACTGTGTCTAATGTTTTGTGTGGCACCTATCACGTTGTTAGAGTTCAATAAACATTCAAC" "59248" "1" "0.113976" "-1.7744479" "-4.3" "-0.22891658" "" "ACAACGGTCATCTGCCATCTTCTTACGCATGACCCAGCGCGCTCTTGTCTTGGCTTCTGG" "12786" "1" "0.113997" "-1.7743282" "-4.3" "-0.14470423" "" "AGATAATCTGCTATAGCTCGATGTAGTTCATGTCGTTGTCTCTGGGACAGCACCATTTCG" "48876" "1" "0.114003" "1.7742925" "-4.3" "0.26060795" "72472" "GCCAACCTAAACCTTGAGTCTGTTAAATGACTTAAGCTATGAAATTAGGAGGTTCTTACA" "39910" "1" "0.114005" "1.7742822" "-4.3" "0.25393109" "231842" "TCTTTTGTCTTTGATGACATTTTTCCTGTCTCTGGCTATATCAATTCCTGACATAGGATG" "8803" "1" "0.114029" "-1.7741409" "-4.3" "-0.17500124" "69136" "AACCCACCTTTTAAGTGTGTTTTGTAAATTGCTGACTTGGATAGCCCATGAAGTACTACC" "35816" "1" "0.114056" "-1.7739885" "-4.3" "-0.17228751" "27377" "GCATACACATATGGAAAAACATCGGTGTTTTATCTAACCTGACTTCAGACATTTTTACAG" "26826" "1" "0.114059" "1.7739734" "-4.3" "0.62425727" "" "CAAATTGACTTGGCTAAGACCCATGCTCAGGAGCCTTCATCTCCCCAAGGAGAAAGTGAG" "34681" "1" "0.11411" "-1.7736801" "-4.3" "-0.23657643" "243725" "AAAGGGGCCTGAGTATACGCTGTTGCAAGCTGTATACTTCATTTCCTTCGGCTGGTTTAT" "43950" "1" "0.114114" "-1.7736549" "-4.3" "-0.19972661" "238690" "AAAGTGGAGCTGTTAGACTCTGTGTTTGTCCTTGAAGACTTGGAGCTGATAGTCCTTGCT" "37050" "1" "0.114126" "1.7735862" "-4.3" "0.25294224" "21942" "CGCGCACCTCATCCAAGTCTCTTCTAACGCTAACATATTTGTCTTTACCTTTTTTAAATC" "41085" "1" "0.114129" "1.7735701" "-4.3" "0.2970589" "78512" "ATAATCAGGAAGGGGTTTGAGATAGCTGCCTTGTGTTTCCAGGCCAGTCCATCTCAAAAT" "29537" "1" "0.114196" "-1.7731849" "-4.3" "-0.26184099" "66112" "GGTAGTGAATGGTAGGTCGGCCCACCTTGAGAAAAATTTAAAAAGGGGAAAAACAAAACA" "9464" "1" "0.11421" "1.7731046" "-4.3" "0.5945788" "217154" "ATGACGGGTCTGCGGGGGCGTTGCTGAGCCCCCAGGCCCATAATTAAATGTTTCTTGTCT" "26711" "1" "0.114213" "-1.7730847" "-4.3" "-0.13275054" "237782" "TAGAGCACTGCGGATGTGATCATGTCCCACAGGCATTGTGCGCAAAAGCTTAGAATAAAT" "46986" "1" "0.11422" "1.7730466" "-4.3" "0.25648713" "16443" "AAGCCAGAAACGGACAACTGGGATACATGGGCGGCTCAGCCTTCTCTGACCGTACCTAGT" "6396" "1" "0.114277" "1.77272" "-4.3" "0.72920362" "" "ATTCCGTGGATGCGGAAGATGCGGTCACAGTCTCCCATAGCTAGGCCAGCTCATACAGGT" "44659" "1" "0.114277" "1.7727194" "-4.3" "0.76591808" "16408" "ACTTGAGAGCCCTGGCTCTGACCAGCTTCAGTCACATGCCACCGTGTATCCTGTCCTTCA" "21681" "1" "0.11429" "-1.7726407" "-4.3" "-0.16743492" "" "CAAGCCAGTGTATCATTTTTGTGGGGATGCTAGAGAGAATCATCAAATTAAAGAGTTAAA" "38560" "1" "0.114301" "-1.7725822" "-4.3" "-0.30656281" "" "ATGGTGTCTAGGAGCACAGGTGACTGTTCAGTTGTAAAATGCTTGCTTGCTTGTGCTTAG" "9549" "1" "0.114304" "1.7725645" "-4.3" "0.50735322" "" "AAGCTCATTTGAATCTTCGAATCAAGTCTGTAGAGCCGGAGGACTCTGCTGTGTATCTCT" "19956" "1" "0.114314" "-1.7725073" "-4.3" "-0.63980762" "" "ATTAGATGATGGAACATCCGAACACAGAACATTCTGGCCTGTGAGAACAGGTGTCAATGC" "6501" "1" "0.114333" "1.7723962" "-4.3" "0.19500785" "" "TTCTGATGATTTAGGAAGCACCAGACTTTGTGAGTGTCAGGCTCTGTTTAAGAGCTGCAT" "13300" "1" "0.114335" "-1.7723824" "-4.3" "-0.15302341" "67222" "CTTTTCACAGATCTCTAAATTTATTTCATAAGAATGCTTGCCCCAAATTATTTCTTACAT" "20259" "1" "0.11434" "1.7723544" "-4.3" "1.23289067" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "45823" "1" "0.114349" "-1.7723048" "-4.3" "-0.15356872" "" "GAACAACTTCCATATTTAATGTTTCAGAATCTTATCACATAAGTGTAAATGGGGAAAGAC" "9616" "1" "0.11436" "-1.7722391" "-4.3" "-0.21501873" "626870" "GAAATCACCATAGCAAACTCAGGGTAAGTGTGGGCTTTTGTTTCTTACATTCCTCTGCAA" "29393" "1" "0.11437" "-1.7721816" "-4.3" "-0.66882101" "21743" "CGAATCGCCTTCCCTGGGAAAGTTATAGCAATCATTTGTAAAGCCTTGCTCCACAGCTTT" "57047" "1" "0.114434" "-1.7718185" "-4.3" "-0.14189253" "71834" "TGAGCAGAATACAACTGAGGCTAACTAAAAATAGGGTCTGGCCCTTGAGTGGCATGCATA" "10538" "1" "0.11444" "-1.77178" "-4.3" "-0.17681858" "72865" "AAGTGACAAGCTGCGTGCTCAGCTGACGCAGCAAAGAGAAGCAGACCCTTAGAAGAGCGC" "47839" "1" "0.114496" "1.7714613" "-4.3" "0.24083576" "" "AGTCTAACTTCAAAGTAGGGCAAGATACATACACATCTGTACTCCTGCCTTCCAAGAGCG" "1978" "1" "0.1145" "-1.7714402" "-4.3" "-0.35888699" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "3229" "1" "0.114522" "1.7713111" "-4.3" "0.3055617" "" "AAGGACTGAGGCAATTCTAAACTCCTATCGTGGAAGCAATAGCAAGCCAGAATCCTAAGG" "15129" "1" "0.114547" "-1.7711709" "-4.3" "-0.1809918" "56086" "GGTTTTCACTGGAAGGAAAAAGATGCTCATTTTAAATGTTGAAGTGTACAAGTTGCTTTG" "42558" "1" "0.114554" "-1.7711271" "-4.3" "-0.218365" "675812" "CTCGTTACAAAGCAAAGGACACATTCAGGAATCTTTTTATGTATGGAATGTGGTAGAATT" "5178" "1" "0.114564" "1.7710733" "-4.3" "0.1960351" "" "" "5390" "1" "0.114574" "1.7710132" "-4.3" "1.0911005" "12363" "CTAAGCAACACAGTGGGATTCTGTTCCATAGACAAGCAAACAAGCAAAAATAAAACAAAA" "43082" "1" "0.114575" "-1.7710086" "-4.3" "-0.43614535" "20349" "CCTCCACCCAATACTGCACAAAGTCTGTATTATTGAATGGAATTTCTATTTCATTTGACT" "53303" "1" "0.114577" "-1.7709949" "-4.3" "-0.17961352" "28071" "CATGAGCAAGATGAAGAAAGGGTAAATGTGGTTCTTGCTAGTTGAAAATCTCTAGTTAAC" "55518" "1" "0.114617" "-1.7707699" "-4.3" "-0.18005669" "171171" "TGCAGCGAGAGAACCTCTACAAGTACTTCTATGCCATCTCCAATATCGAAGTCATTGGCA" "19382" "1" "0.114631" "1.7706867" "-4.3" "0.81145567" "" "GAGAAAAGAGGAGGAGAAGCAGAAGAGGAAAATAGAAGAAGCAAACACACCCAAGAGTAG" "48227" "1" "0.114638" "1.7706488" "-4.3" "0.19314138" "56448" "TCTGTGTCTACCATGCACCACTTTGGCCTGGGCAAGAAGTCACTGGAGCAGTGGGTGACT" "6459" "1" "0.114639" "1.7706413" "-4.3" "0.15557095" "" "TCACAGTCCACCTTCTAGGTACCCCATTGTAATGGTTTGTATATGCATGGCCCAGAGAAT" "14961" "1" "0.114713" "-1.7702164" "-4.3" "-0.34563052" "545156" "ACTGTCTTTGTACTTGAACTTAAATCCAATGGAGAACCTTAACACGGGCATTTGCATGAC" "2826" "1" "0.114767" "1.7699089" "-4.3" "0.50270525" "13095" "GAGTTTCCCAACCCAGAGATGTTTGACCCTGGGCACTTTCTAAATGCGAATGGAAACTTT" "39586" "1" "0.114793" "1.769762" "-4.3" "0.17771199" "" "AGAGTGAAGTAGTGAGTAGTGAACGAAGAAGGAATTATCGCTCAGTTGCTACCCAGTGCT" "52571" "1" "0.114847" "-1.769452" "-4.3" "-0.20751154" "71678" "TTTGGTGGACACTGTGTTTTTAACATGGTTTTCTTCAGTATCCTATCGGAATGGCTTGGC" "45141" "1" "0.114868" "1.7693325" "-4.3" "0.20625296" "69397" "CTGGAACGTTTTGGACTCTCATGATTCACTTCTGCATCTTCTCTCCGGGTTTGCTATGTA" "4397" "1" "0.11487" "1.7693223" "-4.3" "0.4911263" "22637" "AACATCACCAGTGGGCTGAGAGGATGTGTGCTCCCAAAGTCTACTTCCGCTGTTTCTGAG" "767" "1" "0.114885" "1.7692331" "-4.3" "0.25554836" "" "TTGAAGGGAGAATTTCTTATGAGTATATCCAAAAACCAAGGTAGGAAAAGCAGTTTGCAC" "37784" "1" "0.114915" "-1.7690624" "-4.3" "-0.22007019" "" "TATTTTGTGATTGGTGATCTGGGGCTTGGCACTGATGGTCACTTTGGACTTCTTGATGGT" "31876" "1" "0.114929" "1.7689858" "-4.3" "0.68439292" "209776" "CCTCTACGGAGCACCCATCCAGAACCCTTGGCTGGTCCACATCATGTTGGATGTTGCCAA" "42192" "1" "0.114935" "1.76895" "-4.3" "0.16973548" "" "GACAACAATATTTACAGAAAAAACTCAGTGATTGAAAGCCATTGTGATGTGGAACTCTAG" "18778" "1" "0.11495" "-1.7688611" "-4.3" "-0.14661919" "69573" "GTCCTAAAGGACTCTTTTGGACCTAAGTATCTTCTGTTGGTTTACCATTGAGTCTCTTCC" "60416" "1" "0.114953" "-1.7688446" "-4.3" "-0.17700929" "12995" "GTGAGGATAGCCAAGGTTCTGGGAACAGAAGATTTATATGACTATATTGACAAGTACAAC" "338" "1" "0.114966" "1.7687706" "-4.3" "0.1535247" "70829" "AGGAAAATTCATTTCAGTTCTCTAGACGGATGTTGTCTTTCTCCTACTTGTTTCATTTCG" "24954" "1" "0.114999" "1.7685849" "-4.3" "0.28888827" "235041" "CACGGTACATCCATGAAGACAGTGTTACACGTAAATGAAGTATTCTTTTCTTGTAATCAT" "47017" "1" "0.115022" "-1.768451" "-4.3" "-0.17643546" "" "GTGTACCTGCCATGAGACCCTTGATTTAGAAAGGTATCATCAAAGACCATTTGTCCAAAC" "37891" "1" "0.115024" "-1.7684402" "-4.3" "-0.30030448" "215890" "GTCTAAATGATTGTCTTAACAATGTTCCTTTACTTAAGTTGCCATTGTAACCCCTATCTG" "47757" "1" "0.115082" "-1.7681092" "-4.3" "-0.22652651" "" "AAAGGGAATTTAGGAATACTATACATCAGTGCCCACCGATGATATGCATACAGGGCGAGG" "7201" "1" "0.115089" "-1.7680733" "-4.3" "-0.15518584" "22592" "CCGGATTGATTCCTTTTTTAGACTAGCTCAGCAGGAAAAACAAGATGCCAAACTCATAAA" "27585" "1" "0.11515" "-1.7677237" "-4.3" "-0.16201307" "18616" "TTGTTACCATCGTTCTTTCTCATGGAGTCTCCTTAGTATTTCTGAGCTTTCCATTTAGTG" "55042" "1" "0.115156" "-1.7676887" "-4.3" "-0.40588066" "56534" "ATCCTCTGTCATGATGGAATCTTGGTGGTGGAAGTCAAAGATTCACTAGGGACCAAGTGA" "51045" "1" "0.115164" "-1.7676441" "-4.3" "-0.18066562" "212772" "GTGGTCAGAAAGGTACCTGTTAAATGTTACTAACGAAACAAATGCTCTTCAGACTACTTT" "45388" "1" "0.115167" "-1.7676238" "-4.3" "-0.14544957" "67920" "CACAAAGGCAAAGCACCCTTGAAAGGACCTTTACGGAAAAAACGGGCCTATGTGGAAATA" "62843" "1" "0.115213" "1.767363" "-4.3" "0.33861145" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "28593" "1" "0.115216" "1.7673477" "-4.3" "0.38823816" "" "" "47330" "1" "0.115232" "-1.7672536" "-4.3" "-0.15679388" "" "ACACCTGTATGGTGAACCCACTTCAGTTACTATAATAAAAATGTCAACACACGAAACCTA" "26070" "1" "0.115245" "-1.7671801" "-4.3" "-0.2388446" "" "CCATAGCTACAGTACATCATTTGTGATATAAGAGTCTTCATTTCTCAGGTTTCAAACAAG" "57343" "1" "0.115255" "-1.767124" "-4.3" "-0.16351279" "" "GAGGAATGGTCTTTACCCAAATCTCAGACCTAAGAAAATACCTGCTAATTTATATTCAGA" "27006" "1" "0.115307" "-1.7668267" "-4.3" "-0.32668647" "68404" "ACGTGGGAATCAGCCGGTGAATAATCATGCTCACGTCTTTCTTCCACAGTACCTTGTTTT" "35079" "1" "0.11532" "1.7667551" "-4.3" "0.25807893" "71740" "GACTTATGGACCCCAAGGATCTGGGGTCTTAGTATGTATATTTCATGTAAATATATGTAT" "11936" "1" "0.115335" "-1.7666701" "-4.3" "-0.17311438" "93673" "GGCATAAGAGACTTCCAGAATTGTTAAGGAAAGGCCCAGAGGGACATCAAATCACAGATG" "26749" "1" "0.115344" "-1.766618" "-4.3" "-0.17236153" "" "ACATACATACATGCAGGAAAAACTCCAATATTGTTTAAAACAAAAATTGGTTTAAAATGC" "62496" "1" "0.115384" "-1.7663879" "-4.3" "-0.33464316" "12945" "CTTTCTCCATCTGTAGTGTCGATGTCAGCTTTTTCTTACAATACTGCAATACTGAATATA" "8829" "1" "0.115388" "-1.7663681" "-4.3" "-0.16382529" "51801" "AGACGCTATGGTGTGACTGGGGAAAGACCATACAGAGCTATGGGGAGCTCACTTACTGCA" "15916" "1" "0.115396" "-1.7663218" "-4.3" "-0.21346797" "100043074" "ACAGGTTGCATTAATATGGCAATGGCTGGAGTTGAACAATAAACTATTCACTGTATGACT" "28668" "1" "0.115405" "-1.7662718" "-4.3" "-0.18909662" "" "AGAAGTGTTTACAGATACCAGACAATAGTGAGTGGTCAGTAGACCTTCACAGGGCTTTGC" "27629" "1" "0.115453" "-1.7659991" "-4.3" "-0.15647848" "66870" "GGACAATGGAAAAAGGGATTTGTTCTGCATAAATCAAAAAGTGAAGAGGCTCATGCTGAA" "1803" "1" "0.115474" "1.7658769" "-4.3" "0.20876338" "" "CACTAAACTGGGATTGGATTTTGACTGACATTCTCGCTGAAGAAGAGAAGACAGTAGAGA" "30365" "1" "0.115475" "1.7658718" "-4.3" "0.25656874" "245026" "GCTAAAAAAGGTGAAGAAAAGGATCGTTCGGAACATCTGTACCTCAGGTGGTGAGAGCAA" "22505" "1" "0.115476" "-1.7658691" "-4.3" "-0.34421278" "383787" "TACCCATAAAGCGTGTTCCTCTTGTAAAATATTAAATCCGGATACTTGAAGTCACTTCAC" "238" "1" "0.115476" "-1.7658647" "-4.3" "-0.39619034" "17888" "GCACGACGAGGAATAACCTCTCCAGCAGACCCTCGCTGTGGCCAATACACAATAAACATA" "251" "1" "0.115498" "1.76574" "-4.3" "0.58570233" "" "AGACCCTCATATTTGCGTACACTTCTAGATAGTACACCCTCACTGGACATTTCCTTGTCA" "32799" "1" "0.115505" "1.7657032" "-4.3" "0.18930126" "69982" "AACTTATGACCCAGGCGACTTTTGCATCGCTTTATTTCATTGGAATAAAATGAGCATTGA" "24349" "1" "0.115519" "1.7656196" "-4.3" "0.18272427" "" "TATCATGGAGCCAAGTGGAGGACAGGCAGAGTCAGCCTGTCCTGTGAGTCCCAGTGGATT" "31987" "1" "0.115554" "1.7654208" "-4.3" "0.16240475" "381059" "AGAGGAGGCAGAACTCAGCACCACACTCTTCCCCACCCCAGCCAAAAATCCATGAAAAAA" "7288" "1" "0.115573" "1.7653167" "-4.3" "0.19622824" "100039220" "GAGAAAGTTTAAAAACTCCTAGTTTTTTGATGTACTGCTCTTTTGTGGTCATTTCCCAGA" "22483" "1" "0.115589" "-1.7652248" "-4.3" "-0.18881634" "57028" "CCACTCTCTGGGATCTCTAGTGCTCTGTCCCTAGAGATTGTTGGCCAATCAGAGATCTAG" "16520" "1" "0.115608" "-1.7651139" "-4.3" "-0.17533502" "" "ACTTAAAGTCACCTCCTTGATCCTTACATGAGCTACAGACTAAACAATGACCCAGGCGTG" "38740" "1" "0.115622" "-1.7650366" "-4.3" "-0.14463674" "75516" "AGCTTATTGAGATTTTAACTCAAGATCCTTAAATCTGCATTTGATTGGCTCTAAGATGGG" "465" "1" "0.115627" "1.765008" "-4.3" "0.16732748" "" "" "14042" "1" "0.115628" "-1.765004" "-4.3" "-0.24125679" "228005" "CTGCTTCTCTTATCATTAGTCTAGTAAATGTTGAACTGTTTTCTGCAGATGGCATTTTAC" "53695" "1" "0.115631" "-1.7649847" "-4.3" "-0.15819724" "53975" "CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG" "5943" "1" "0.115643" "1.7649182" "-4.3" "0.15898357" "" "GAAGGTAATGTGTCAATATGTAACAGTTGTGCGTGCTTGGGTTATAGACATTTTTCTTTA" "35882" "1" "0.115654" "-1.7648534" "-4.3" "-0.25467906" "" "TGTATCTAAAAGGGACTTAATCATATGCAAATAATAAAGGAGGTGGTGGTGACCCAGCAA" "16933" "1" "0.115654" "1.7648534" "-4.3" "0.17213099" "100043899" "AACTGCAACAGCAACATGTGCTTCTCTGGGCTCAAATCCAACAGGCTCCCATGGGTCTGA" "8958" "1" "0.115657" "1.7648405" "-4.3" "0.31169593" "16622" "TAAAAATGCCTGAATATCACATTGTCCCATGTTCTCAATAAAGCCCACCATGCAGCAAAT" "41674" "1" "0.11567" "-1.764765" "-4.31" "-0.27163701" "107823" "GTCTTCAGCACTTGGGTTTAACAAAAGTTCATCTCCTTCTGCATCCTTAACTGAGCATGA" "62525" "1" "0.115719" "1.7644881" "-4.31" "1.14288285" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "9294" "1" "0.115722" "1.7644675" "-4.31" "0.63393997" "12843" "ACCAAGAATTCCGTGTGGAGGTTGGCCCCGTCTGTTTCAAATAAGTGAACTCAACCTAAA" "45898" "1" "0.115756" "-1.7642736" "-4.31" "-0.15718177" "" "CATCACCTACAAGATTATTTTGAGCAGTATGGTGGGAAGATTGAAGTGATAGAAATTATG" "35728" "1" "0.115813" "-1.7639535" "-4.31" "-0.22503997" "" "TAAAGTTCAGCCAGACTGTCCAGTTGTCAAATGAAGAGGATGCCAAGTGTGAAGGTTCTG" "43700" "1" "0.115813" "-1.7639518" "-4.31" "-0.28384261" "211556" "ATCCGATAGGGTGAAACCGTGACCTTACTTACCAAATGTTTAAAAACCAACCAGAATGTA" "1107" "1" "0.115816" "1.7639345" "-4.31" "0.25103254" "353165" "AAGACATTCTTATATCTTGCTATGGGGAAACAAGAGGATCAAACAGGCCTTTGTGTTGGC" "54802" "1" "0.115832" "-1.763843" "-4.31" "-0.20576623" "192651" "AGTGTTAGGTGAAGGTTGGCTTTATTGCTGCGTTTCATATTTGATTGTTGAAATAGAGAG" "49926" "1" "0.115851" "1.763739" "-4.31" "1.45546947" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "10894" "1" "0.115872" "1.7636175" "-4.31" "0.60070169" "68713" "TGTGACACTCACAAATCTGTCCATGGTGGACTCAATAAAGTGCACGTGCTGTGACTTTCT" "20714" "1" "0.115935" "-1.7632625" "-4.31" "-0.15082707" "18706" "AGATTTTGGGCACTTTTTGGATCACAAGAAGAAAAAATTTGGCTATAAGCGGGAACGTGT" "24971" "1" "0.11594" "-1.7632349" "-4.31" "-0.16998825" "" "GCTCTGCTATCCTCTTTCTCCAGGTGCCTCCAAAATCTTATTGATATAGCGGTCTTCTCT" "46018" "1" "0.115965" "-1.7630921" "-4.31" "-0.20137337" "" "CAGGAAGTGTGGCGGTGCAGAAATACTTTTAAACAGTATCAGACTACGTCGGATTGCTTA" "9263" "1" "0.115967" "1.7630809" "-4.31" "0.14582176" "" "" "19965" "1" "0.115984" "1.762983" "-4.31" "0.82889955" "70719" "GTAAAGGAGCTTTCCACATGAACTCACAATTTTCTTGAAATAAACTTCTTAACCAACTGC" "51346" "1" "0.116029" "-1.7627269" "-4.31" "-0.18272714" "" "TGAAGACTCCAGTGGAAATGTTGTGAGCAAGGAGACATATGAGGATCTGGAAAGACAAGG" "61690" "1" "0.116042" "-1.7626534" "-4.31" "-0.18614415" "67143" "GTTGAGAAAAGTTGACCATGCACTATTTATAGTACTTTGCCATAACAGGCAATGTTCTAA" "58808" "1" "0.116065" "1.7625273" "-4.31" "0.27794252" "546282" "CTTTCCCATCTTCAGACTAATGAAGCATACATATTTCTCCCTTGCTGGTACATTGTAACC" "40917" "1" "0.116082" "-1.7624275" "-4.31" "-0.39305253" "110862" "AACTGGAGCGGTCTCCAAGTGGCTTCAGCATCTCACAAGACAGAGATGATTATGTATTTG" "2882" "1" "0.116084" "1.7624165" "-4.31" "0.22069345" "" "" "48778" "1" "0.116091" "-1.7623774" "-4.31" "-0.21002595" "77031" "CGGGCTCGCCGAAGGAGCAAGAAAGACGTCAACCTCAGCAAGACTGAGAAGATGGGTAAT" "29039" "1" "0.116115" "-1.7622394" "-4.31" "-0.18217332" "" "TACATTAGAAAGGCTGTCTTAGTGCCTGTCCATGTTAGAAAATTGTCATGAATGTGTCTT" "62460" "1" "0.116138" "1.7621116" "-4.31" "0.72663962" "107321" "CTCTGCATTTTGCTTTTTAAGCGGAAGTGTATTTTTACTGACACATGTGATGAATAAAGC" "33224" "1" "0.116139" "1.7621051" "-4.31" "0.20522233" "" "" "40668" "1" "0.11616" "-1.7619856" "-4.31" "-0.35306414" "" "GGTGTTTAGCAAACACATAAAGGAATGTTTTTCTGAAGCAGACACAGATGAAAGGATATT" "44632" "1" "0.116188" "-1.7618312" "-4.31" "-0.25442746" "" "" "4325" "1" "0.116212" "1.7616913" "-4.31" "0.20032066" "257913" "TAGTGTCTACATTTTATACCATTGGGATTCCCATGCTCAACCCCATCATCTACAGTCTGA" "39241" "1" "0.116236" "1.7615596" "-4.31" "0.24798263" "" "AGTTTAGACATCTGATTAAAACCCCTTGGGTCAGATCCCACTCCTGGAGGGAAGAATGAA" "44790" "1" "0.116257" "-1.761442" "-4.31" "-0.15067269" "" "CATGGGTCAAATTATCCCTGTGTGCTTTGCTTCCTGTATATGAATGCAAATGTTACAAAG" "13397" "1" "0.116263" "-1.7614034" "-4.31" "-0.15552131" "" "GCTAGGAGATGAGGGAAATTGGGGTAAATTAAGGGGAAACATTAGGTATTTTAACTGCCT" "8257" "1" "0.116313" "1.7611216" "-4.31" "0.27195132" "" "TTCTCTGGGTTTTCACTGAGCACTTCTAATATGGGTATAGGCTGGATTCGTCAGCCTTCA" "2255" "1" "0.116316" "-1.7611035" "-4.31" "-0.21738244" "" "TCAGAAACTAAACGTAGTTTCTATCCACAGTCGGTAGACCGCAACTGCATCATGGTGTGT" "31333" "1" "0.116326" "-1.7610484" "-4.31" "-0.13994636" "" "" "12143" "1" "0.116334" "1.7610049" "-4.31" "0.45576942" "" "CTTTGCCTTGGTGGGGTCCCTCCAGTCTCTGTCTAATGATGGGAACTGTTTCAGCTGCAC" "60327" "1" "0.116342" "1.7609587" "-4.31" "0.39646714" "433759" "TATAAAATACATTAACTATAACGTCCCCAGGGACCAGAGTACAGGGCAGTGGTGCTAGGA" "21712" "1" "0.116352" "-1.7609001" "-4.31" "-0.19753819" "74570" "GAACTTTGATTTGACCAGCCTCTGAAGAGTCCAGATGTTTAGTAGATGTTCAATAAATAA" "17642" "1" "0.116362" "1.7608486" "-4.31" "0.28319796" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "53543" "1" "0.116365" "1.7608317" "-4.31" "0.35631871" "110962" "CCACTGCTTTTCTATGGGAGACACTCTTAATTTAACAGATGAGAATATTTTGAAACTCTG" "46947" "1" "0.116369" "-1.7608055" "-4.31" "-0.15083944" "53975" "CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG" "30907" "1" "0.116395" "-1.7606584" "-4.31" "-0.1600454" "20454" "CTTCCAAATCATCTAAGTGTTATTTAAGGCACTCTGCTGTTTGTATGAGATGGCTCATAG" "49005" "1" "0.116414" "-1.7605535" "-4.31" "-0.15073128" "" "ATAGGTAAACAGGTACCAAAAAGAGAAGCCCTCGCCATTTGGTTGGGCAATTTACCTGTC" "27915" "1" "0.116421" "1.7605131" "-4.31" "0.52645101" "231147" "ATTTTGCTGAGGGTTGGGGGGAACTGAAGGACCAAACAGTAGTAAATATTTTTCAGCAAC" "19413" "1" "0.116429" "-1.7604683" "-4.31" "-0.30720874" "22160" "ATGGTAACAATCAGAGGAATTTTAACACCTTTAGAAATAAAAACGCTGGGATCAAACTGG" "9120" "1" "0.11644" "-1.7604042" "-4.31" "-0.22426103" "" "GCTTCTTCACAATCATTGTGGGGATATTTTTGTTGCATGCCTTTAAAGATGTCAGTGTTA" "4597" "1" "0.116453" "-1.7603338" "-4.31" "-0.19470131" "" "" "3304" "1" "0.116498" "1.760076" "-4.31" "0.69049278" "" "" "42869" "1" "0.116511" "-1.7600041" "-4.31" "-0.23784812" "100505024" "AGCCAGTGCCACCTTTGCTACACACTCCTATGCCTCTCGTCTCAGAAAACGCCAAGTAGG" "41645" "1" "0.116545" "1.7598118" "-4.31" "0.26323187" "13614" "CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC" "11694" "1" "0.116563" "-1.7597125" "-4.31" "-0.21692248" "13120" "CTGTCTTGAGAAACTTCATTTATTTCTCATAACTGCATTTATTTAGCCATCTCAGTGTGC" "49617" "1" "0.116565" "1.759703" "-4.31" "0.17107051" "229488" "TCTCTCTCTGCTGAGAACAGCATGGTGGCCAATCACATTGTGGAAAATACCTACTTCTGT" "33977" "1" "0.116606" "1.7594675" "-4.31" "0.17565628" "" "GAGAGACCACATCTTCTTATGTGTAGGACTGTGGGTCTAGTATGTAGCAATGCAAGCATG" "49741" "1" "0.116615" "1.7594166" "-4.31" "1.9358044" "15001" "GTGTTGACCTCGAGTGGCATCAACCTCTGTTCACCAAATCCCAGGAGAACATTGTGGGCG" "48611" "1" "0.116648" "-1.7592346" "-4.31" "-0.2451467" "" "TCTGTGTGTGCTCTGTGCACTCTGTGTGTGCTCTGAGAGTGTCTGCCGTGGTTCTGGATG" "22569" "1" "0.116765" "-1.7585725" "-4.31" "-0.17008305" "80289" "AAATGAGTAAGCAAGACTTTTACACTAGCAGTAGACGGGTTGCTTTATTCGGCACTCTGT" "29941" "1" "0.116767" "-1.7585632" "-4.31" "-0.28111508" "229801" "GCCTCTAAATCCTGTCAGAATAGTTAACAGACCAACATCGTATTTAGTTTAGATTGTTAC" "23869" "1" "0.116787" "-1.7584506" "-4.31" "-0.18715712" "" "ACATTTCACTTATTCTATCGGTTTGTTCCCCTTTGGTTTTTTCCTCCCAAACCAAAGGGT" "24828" "1" "0.116795" "1.7584033" "-4.31" "0.22977303" "67580" "GTAGCTTATGGCAAAATACATGAAGACCAATCAGCTAACAGAAATAAACGACTCTGAAGA" "42122" "1" "0.116804" "-1.7583539" "-4.31" "-0.18952683" "" "AACTTTATTTGGTGTGACTTTCCAAAGTTCAGGACTCTCTGAGGCCATGCAGAGCCAGAA" "27336" "1" "0.116819" "-1.7582685" "-4.31" "-0.13372351" "" "CCTTCTTTTGTCTCCACATGAGTCTGCTTGCATATGAGTACTTTAAATTATATGAAAGTG" "29590" "1" "0.116848" "-1.758108" "-4.31" "-0.15699667" "240038" "AGTGATGTAGGATTAGGAGAGTTGGCACCAGTGTTCTAAAGAGAATGCATTTGTGTTAAA" "15394" "1" "0.116863" "1.7580215" "-4.31" "0.22903735" "232174" "GTTCGTGTGTCTCGTTGTGGTAGCATTAATGGGTGATGTAGTCTCACATTCCTAACTATT" "36380" "1" "0.116887" "-1.7578861" "-4.31" "-0.29592104" "" "CTAGGCTATATAACAGGATTCTGCCTCAAACAAGACAAAATGAAAATGAAAGGAGGAGGA" "30542" "1" "0.116939" "1.7575982" "-4.31" "0.38078653" "" "ATGTTGATCTACATTGCAGTCCATGTCATTAGGTAGATTTACCTGTTGAGGAAGTTGTAA" "26161" "1" "0.116957" "-1.7574959" "-4.31" "-0.22218378" "16477" "AGGGCTTTGCGGACGGTTTTGTCAAAGCCCTGGACGACCTGCACAAGATGAACCACGTGA" "45776" "1" "0.116966" "-1.7574449" "-4.31" "-0.18086711" "" "ATTTTAGTTTGATTTTATAGCTAGAGAGAAAGCTTTTGCCCGTTGCATTCTGTAACCTTC" "3093" "1" "0.117019" "1.7571459" "-4.31" "0.32448512" "26904" "ATGGAGTTAGAGCTGAATGTTTATGAGAACACTGATGAGGAGTATGTGGACGTCTTGCCT" "42389" "1" "0.11702" "-1.7571398" "-4.31" "-0.20350579" "70726" "CGTGGTGGGGCGTACTCTCTGAAGAAAGCTGTTATGTTGACCCGGCTTGTGCGCTTGTGA" "45932" "1" "0.117036" "1.757053" "-4.31" "0.26726001" "75778" "ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT" "3944" "1" "0.117042" "-1.7570178" "-4.31" "-0.18955884" "" "TGAGAGTGGCGGTACAGAGTTTTCACTCATTTTGTTCAGCTTTTCCAAGGAATGTTTGAC" "35490" "1" "0.117048" "-1.756983" "-4.31" "-0.33356344" "" "GAAGTAACAGCAGCGGGGATGTCTCAAGTCTTGCAGTTAAAATTTAATTCTTTAAACTTT" "48958" "1" "0.117048" "-1.7569821" "-4.31" "-0.19666417" "" "TGCATGCCTTCACTTACTTCATTTGCTTGTAAATAACAGGATGCAGCTTTCACCTGTGCT" "37364" "1" "0.11707" "-1.7568609" "-4.31" "-0.1784368" "78634" "AGAGCTCCATGCCACCCATCTTAGGGAATGCACACACTCACTGTTACTGGTTCTTAAAAA" "39065" "1" "0.117079" "1.7568091" "-4.31" "0.39231468" "271424" "TTAGGGAAATAAATTTGTTAATAAAATTGCTGAGGTCACCAGTGATTACTGGTGCGCCTT" "5597" "1" "0.117108" "1.7566445" "-4.31" "0.34092179" "70028" "GGGCTGCAGGCTCTTATCTGTCGGGAACTTGTTCTGTAGGTTGGCCTTGAACTCAGAGAT" "53790" "1" "0.117117" "1.7565973" "-4.31" "0.1696732" "" "CACAGCGGACTGAAAGGCATCTGTGTTCCCTGTGTTAAATGTCTATTGTTTCCATTGTAG" "53748" "1" "0.117151" "-1.7564067" "-4.31" "-0.1979372" "76293" "ATATGTGGGGCTGGAAGTGGGTGGGTAGCAGAGGTCTCAATAAACTTCAGGATCTGATGG" "58812" "1" "0.117161" "1.7563479" "-4.31" "0.8276152" "78416" "TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC" "11237" "1" "0.11718" "-1.7562456" "-4.31" "-0.16402932" "21374" "GCCAAGAGTGAAGAACAATCCAGACTAGCAGCAAGAAAATATGCTAGAGTTGTGCAGAAG" "34735" "1" "0.11718" "-1.7562416" "-4.31" "-0.16817827" "53975" "CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG" "38055" "1" "0.117208" "-1.7560836" "-4.31" "-0.20595769" "240058" "TCACCCTGCTTTCCTTTGCGGTAGAGTCAGAGAGTACCTTCCTGGATTACATCAAAGGAG" "38329" "1" "0.11721" "1.7560768" "-4.31" "0.22568124" "235606" "GGTGGAATCAGACAGCTTCATGAACACTGTGCTTTGGCTACACACACACTTGGGCAGCTG" "18512" "1" "0.117227" "-1.75598" "-4.31" "-0.1841236" "" "AAGCGATGCTATTGTTTGGCTATCTTTGTAAAACTTGGTGCCTTCTCTGCTCTGAGATGA" "35403" "1" "0.117227" "-1.7559773" "-4.31" "-0.21191942" "75125" "GGCGTCAAGATGAAACACACAAGGATGTTAACAACACTGATTTGGTTTACATTTCATCAC" "17678" "1" "0.117246" "1.7558712" "-4.31" "0.54672572" "67849" "TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA" "20014" "1" "0.117271" "-1.7557333" "-4.31" "-0.1621229" "" "AAATACACTAAGGAGCCCAGCCCAGTGAAAGCTACTGGGACTGGGAGTCAGAGCGAAGCC" "25996" "1" "0.117282" "-1.7556712" "-4.31" "-0.18368795" "" "CTGAACCAAGCCACAAATATGATCTAAATGACCCCAAGATCATCAGGCCTGTCTGACACA" "62725" "1" "0.117349" "-1.7552953" "-4.31" "-0.27330546" "15182" "TCCCATGAGAGATGGTATAGATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTC" "24233" "1" "0.117371" "-1.7551708" "-4.31" "-0.14329595" "" "TATTTTTTCTGTGAATCCCCAGGAATACTACAAGGAGCCAGTGGCCACTCATGTCCAATG" "50384" "1" "0.117377" "-1.7551363" "-4.31" "-0.24659816" "" "AAGCCTCGCTTTTCCTGTACCTATCCCCATTTATTTTCTCTAGAAATAACCACTTTTAGC" "11393" "1" "0.117387" "-1.7550825" "-4.31" "-0.19417968" "" "AAAGAAGAGAGGCTTATGCTGTTGGAATCCTGGAGAAGTTTTGAAGGGGAGTTTGGAACC" "44722" "1" "0.117395" "1.7550408" "-4.31" "0.19044452" "320209" "CTAGGACATACATAATATTGAAAGAGCTGACATGAATTTTGACTTTTGTGAAGGACCATC" "3815" "1" "0.117488" "-1.754515" "-4.31" "-0.17196848" "268706" "GGAAGAGGCTGTTTTAAAGGGAAATGCTTCGTCTACATTAAATGTGTCTCAGAAGTGCAG" "10953" "1" "0.117494" "-1.7544834" "-4.31" "-0.12947027" "102115" "GGTCAAGCAGGGAGTACAAGCCAGCCCCAGCGTGCTGCATGAATAAAATAAGTTATTTTT" "51816" "1" "0.117511" "-1.7543888" "-4.31" "-0.17067769" "" "GGCAAAGTGAGTCTCAGCCTGTAAAGAGAACAAGGCAGATGTGCCTCCAGAGAGAAAAAA" "35069" "1" "0.117519" "-1.754346" "-4.31" "-0.18085364" "75710" "CTGGACATACTTGCTTTGTTATAGGGTCAAAGCTTTGTCTGAAACCTTCATTTTCTTTTA" "44870" "1" "0.117541" "-1.7542183" "-4.31" "-0.17305797" "68275" "CTTCATTATCCACATAGTGGGGTCAGTTACTTGAGACGCAATCCCTGTTTGAAGATAGCA" "37806" "1" "0.11755" "1.7541716" "-4.31" "0.34972137" "54215" "GCAATTGTGAACTTCCAACATGGTGGATGTATTCATGTCACCAGCTCAGCATCCCAGAAA" "34069" "1" "0.117551" "-1.7541641" "-4.31" "-0.46666178" "" "CAAATGCCATACTTAAGATAGAACCCTAAAAGGAAGAAAGCTTGGATCAGAAACTGAATC" "2319" "1" "0.117554" "1.7541509" "-4.31" "0.19583878" "" "AAACAGTGCTCTGTCCTAGAGGGTTAAGGCACATGTGGTAATTAAAAAACTCAAAGGCTC" "17408" "1" "0.117558" "-1.7541282" "-4.31" "-0.24079594" "77634" "ACAAGGGGTTGTTAATGGCGTTTTACTTAAGTTGTTTATGTTACTGAGATGTAGAAATGC" "26699" "1" "0.117582" "1.7539898" "-4.31" "0.27815307" "" "TAAGATCCAGGGGAGCTATCTGTGTTTTCCCACAGAATGAAGACAACCCATTTTAAATAC" "29415" "1" "0.117594" "-1.7539227" "-4.31" "-0.17072824" "626410" "TTTGTGTCCCTGGGAAGATGTATTATTAATGACTTCTATGAGAGACAAGGTTCATGGTTT" "37256" "1" "0.117601" "-1.7538841" "-4.31" "-0.17660148" "227721" "CACTGAAGTCTTGTTTAGCTCAGCATCTCCGAAATTTACCTGACCATAGGAGCCTTCTCT" "5893" "1" "0.117612" "-1.7538223" "-4.31" "-0.23760548" "83431" "CTAGGATATCAGCACTAAACATCGTGGGAGATCTCTTGCGGAAAGTAGGGGCTTTAGAAT" "9695" "1" "0.117628" "-1.7537335" "-4.31" "-0.14681132" "" "ACTATTAGTCAGTGTAGGTCGCTAACCAAATAGGAACTGTGGAAGCAAAAGCGTTGGTTT" "61563" "1" "0.117656" "1.7535773" "-4.31" "0.17234453" "211577" "GACAGAAAGGACCTTCTGTCACCATGGGTAGCTGACTGCTTTTCTGACCCCACCCACCCA" "49871" "1" "0.117688" "-1.7534021" "-4.31" "-0.19627186" "" "GCAAGGCGAGGAGGACAGAGTTCATCTTGCTTACACTTCCACATCATGGTCCATCGCTGA" "24917" "1" "0.117697" "-1.7533519" "-4.31" "-0.14950074" "" "ATGATTATCTCTATCTACTTACGTGCCAAGTCCTGAGTTCAGAATGTTGAGCTGAATATA" "26877" "1" "0.117713" "-1.7532596" "-4.31" "-0.17430089" "" "GGTGTCAAAGTTCATCTCTAACTTTCTGCAGCCAGTTCTGTCCCTCTCTCCCAATTTTTT" "21166" "1" "0.117715" "-1.7532504" "-4.31" "-0.14608179" "" "GTCCCCTAAAGGACATTGCCACTTAGTCTAAATTTATAATTTGTTTTTTAGTTGGACCAG" "52671" "1" "0.117732" "1.7531518" "-4.31" "0.38870942" "234199" "ATCAAACCTCTTCAGAGCCTGGCAGAATTCTCTGTTTATTGTGACATGTCTGATGGAGGG" "1759" "1" "0.117775" "1.7529159" "-4.31" "0.30591173" "" "TGAAGTTTGGATCTAGGAAGACTTTGTGGTCCATGTGCCTGCAAACTGCTTCCTTTCACT" "25160" "1" "0.117776" "-1.7529089" "-4.31" "-0.2302257" "" "TAAAAATGGAGTAGCATTGCTTTGGGGCACATCAAGAGGAGCCAAGAAATCCCAGAAGCA" "6018" "1" "0.117781" "1.7528827" "-4.31" "0.15046306" "" "" "50441" "1" "0.117787" "-1.7528469" "-4.31" "-0.21104174" "239719" "AGAGATTTCCTTCCCAATAAAAGAAGAGCCTTCTCCAATTTCCAAGATGAAACCAGTGAC" "35112" "1" "0.117788" "-1.7528421" "-4.31" "-0.2631482" "19716" "AAGGATAGGCCCAGGAGTAATGGAGTCCAAAGATCAAGGCGTGAAAAATCTCAACATGGA" "40134" "1" "0.117796" "-1.7527986" "-4.31" "-0.16162724" "" "TTTGGTGAGTCACTCCCTTGGACATCTTCCGTTGATCTCACGTCGGTCGGAGCATGCTTA" "30843" "1" "0.117816" "-1.7526861" "-4.31" "-0.13793196" "" "GAAAACTTGACAGTAAATGACACCTGTTTTGAAGGACGATCAGGCCTTCCTGTGGAAAGG" "57712" "1" "0.11785" "-1.752497" "-4.31" "-0.16739056" "258988" "GGGGCATGGCAGAAATTATTAGGGAAATTCTCTGGGTTTGCATCAAAATTGGCCACTTGA" "20707" "1" "0.117874" "-1.7523585" "-4.31" "-0.18493774" "" "CTCTCCTCACAGCTCCTAGCAGCTGGTCTCAGCACGGAACCCGGAACCACCAAAGCCTCC" "592" "1" "0.117879" "-1.7523331" "-4.31" "-0.46163646" "67095" "AGCGACGTCAGCAACGTGGTCCTCGATAACAAAACCAACAGCATCCTCCTGGAGACCGAG" "7338" "1" "0.117892" "1.7522623" "-4.31" "0.15345503" "" "" "19767" "1" "0.117982" "1.7517592" "-4.31" "0.67761331" "14159" "TTCTTCCTGCCCAAATTCCTCTCTTAGGCAGAAAAATAAAACAAGTTGTGTTCATCGGGA" "12059" "1" "0.118002" "-1.7516478" "-4.31" "-0.14812982" "" "AGCAAATGTCAGCGAGGTGGTAACGGACCATTCTACATAATGCTTGACCTCGTACATGTC" "46592" "1" "0.118053" "-1.751363" "-4.31" "-0.18362984" "69297" "CTGGGAAGGAGTCAGCCCCTAAAGCTACCTCCTCAACTCAGACTGCCTCTACTACCAAGA" "7343" "1" "0.118083" "1.7511972" "-4.31" "0.36088492" "" "AAGTGCCTGAGTGCTCACTGTGTAAGATAACACTGCTGCAAAGTTCTCTTATTCTTCGCG" "44542" "1" "0.118091" "1.7511493" "-4.31" "0.49559586" "77619" "TTGGAAACTTTTGCTAGTACGTTCTTAAGACAAGGAGCCCAGAAGGGAATTAGAATAATG" "31520" "1" "0.118095" "-1.7511268" "-4.31" "-0.1471853" "319615" "CTTTACCAAGATAACTTCAGGGATACACATGTTAAGTCATCAGATGTAAACAGACATGAA" "15150" "1" "0.118103" "-1.7510828" "-4.31" "-0.1495636" "53951" "CTACTTGCGAGAAGAGCACCTGTATTGCATTTGGTGTGGGACAGCCTATGAAGATAAAGA" "32036" "1" "0.118126" "-1.7509549" "-4.31" "-0.18261833" "" "TTCGAGGAGATGCTGAGCCGTGATGACAGCGAGGCGGAGGACTGCATCTTGCACTTCCTC" "56809" "1" "0.118129" "1.7509381" "-4.31" "0.99605654" "108723" "AAGAAGCACGAAACATGCGTCCCAGGCTGGGGAGACAGGACTCCTCCTATGCCGTTCTTT" "30" "1" "0.118136" "1.7509019" "-4.31" "0.52710022" "21926" "TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG" "29630" "1" "0.118182" "-1.7506425" "-4.31" "-0.27426766" "20320" "CTAACTGTAGATGCATGTACTTGTGTTCTGTGTAATTATTGAAGTGCAATGGTGTACAAA" "38605" "1" "0.11819" "-1.7505992" "-4.31" "-0.16548217" "" "" "33747" "1" "0.118192" "1.7505911" "-4.31" "0.49242595" "17874" "GGTTTGCATCTTCTTATTCCTTTCACGTTCTCTACCATAGAGGCAATGTCATGGTCCCTC" "50710" "1" "0.118199" "-1.7505519" "-4.31" "-0.14024181" "20028" "GTCAATGTTTAGATCATTGTAAAAATCCCTTTCAAGTTCCGTGTTAGATTTTTGCTCCTC" "38623" "1" "0.118213" "-1.7504741" "-4.31" "-0.24849153" "258468" "CAGTTGTCACTCCTATGTTGAATCCCTTAATATACACCTTGAGAAATTCAGAGATAAAAC" "9437" "1" "0.118237" "-1.750341" "-4.31" "-0.21284448" "21408" "AGGACCCTTAAAAATACATTTGCAGGTGTAAAAGCCTTAAACCAAAGCTCTTCAGAGAAT" "60048" "1" "0.118239" "-1.7503267" "-4.31" "-0.21600167" "54006" "ATGCCACGTGTACATACCTGTCTTATCTGTTAATAAACATGTAAATAAAACTCCCACCCC" "14689" "1" "0.118241" "1.7503193" "-4.31" "1.70311684" "" "GAATCAGCAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGTGCTCAACTGCTAGAAC" "34840" "1" "0.118251" "-1.7502632" "-4.31" "-0.24061493" "" "TTTTAAGATGCTCAAAATTCAAAGCCTCCACCCTCATCTGTGACTGTTGCTACAGTCTTC" "49332" "1" "0.11827" "-1.7501558" "-4.31" "-0.21857539" "27053" "AGCCATCAGTCACCCAGGCTTACTTAGGCATGAAAAGAAATAAAAGTTTCACATCTGAAA" "32908" "1" "0.118275" "-1.7501276" "-4.31" "-0.21923537" "" "ATATGGACTACTGAGTGTGAAAACAGATGCAGTCACACACATAGGGGGAGGGTATACAAG" "6891" "1" "0.118298" "1.7500013" "-4.31" "0.49970462" "" "TAAAAATATCATCCTTGTTTGGCAGAGTGAGACAGTTTGCAAGTTGGCATTTTCCTGATT" "34938" "1" "0.118302" "1.7499801" "-4.31" "0.38185272" "333467" "TTCAAAGAGCTTTTGGCCAGAAGAAGAAGAAGAAGTGAGAAAGGCACCCAGAACTCTGGA" "25647" "1" "0.118311" "1.7499299" "-4.31" "0.23020478" "14918" "TGGACATCCTTAGCTATGCAGGCAACTTTCGGATGAGGCATGCACCCGATGTACCCATCC" "20555" "1" "0.118328" "-1.7498319" "-4.31" "-0.17761132" "107305" "ACTAAAGGATGCTCTACCTTATTTACCACGGTCGGGTCGTAGGAAGGAACAGTTACGAAA" "18179" "1" "0.11835" "1.7497132" "-4.31" "0.37339718" "14132" "GCTGGAGGTTAAACGTGGAGATGAGCACCATTATCAATGTCAAGTGGAGCATGAGGGGCT" "48338" "1" "0.11836" "1.7496547" "-4.31" "0.32153368" "27007" "AAGCAAGGCACTATATTTGAAAGTATATAGCTTGTTTCACTTTACAAGTCAGAAAGGTGG" "27192" "1" "0.118373" "-1.749585" "-4.31" "-0.14574832" "70456" "CGGATTTGGAGATATAACCAAGAACTCAAATCTAAAGGGATCCAGTAAGAGAGTTCCTGA" "25350" "1" "0.118374" "1.7495764" "-4.31" "0.31650916" "" "" "25259" "1" "0.118389" "-1.7494939" "-4.31" "-0.22065527" "432450" "GGGCAAACACTGTGTGCAAAAGGACTGTATGTTGATGTGGAATGTGTGTGGGCATTTTTT" "8971" "1" "0.11839" "-1.7494888" "-4.31" "-0.24772337" "111970" "TCCTGATAGTCTCACAAAGATGAGAGTCTGGTCCGGGCCAGCGGGTTATCTCGTGGCACT" "45273" "1" "0.118404" "-1.7494128" "-4.31" "-0.30269251" "72795" "CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA" "41774" "1" "0.118432" "-1.7492567" "-4.31" "-0.22227105" "" "GATTATTCGTTATTCAACATTAAATGCATGTGTGTGTTCAAAACGGTGCCACACATCTTT" "35215" "1" "0.11844" "-1.7492128" "-4.31" "-0.23171983" "100929" "TATATGTAAGACCCTGTCTCAAACAAAGCTCCCATGTAGACTTCCTGAAGGACAGGGTAG" "46830" "1" "0.118465" "-1.7490698" "-4.31" "-0.15925301" "110616" "AGTCCTAACAAGTGTAGAGCTATGATATGTGACCTTAATTAAGAAAAACCAGATTGGATC" "360" "1" "0.118479" "1.7489929" "-4.31" "0.73247491" "212032" "AAGATCTGGGGCTGACTCTGACATCTGATGACGCCTTGATGGTCCTGGAAGTGTGCCAGG" "26090" "1" "0.118486" "-1.7489543" "-4.31" "-0.21753379" "" "CCATTCCCTAAATAGACTGTATCTCTATATAAATCTTCTATCTGGAGCTATGGGACAAAT" "45042" "1" "0.118546" "-1.7486215" "-4.31" "-0.1600184" "432450" "CTCAGGGTGTTTTCTGGACTACCAATACATAGAAGTGGCTCATAGTTCCCTCCAGATTGT" "47901" "1" "0.118574" "-1.7484684" "-4.31" "-0.16195295" "19744" "ATATCAGTGTTTATTTCATTGTGTTAAATGTATACTTGTAAATAAAATAGCTGCAAACCT" "9761" "1" "0.118575" "1.748463" "-4.31" "0.21451748" "" "GCTTGTCTATTTATTTGTTTGTGTATGTTGTGGTCAGAGGACAACTTTTGGTAGGCTGTT" "51451" "1" "0.11858" "-1.7484348" "-4.31" "-0.19160122" "" "GCCCGGGCTTGCGTGACCCGCCGGCTCCCAGCAGCACGCACTTCGTGCTGGGGGCACAGG" "15247" "1" "0.118634" "-1.7481361" "-4.31" "-0.16332835" "67923" "CTGAAATTGCACTGGAACTGCTGATGGCTGCAAACTTCCTAGATTGTTAAATAAAATAAA" "4778" "1" "0.118653" "-1.7480318" "-4.31" "-0.23538617" "319583" "ACAGTGTTTACAGAACTTGTCTCCTATCGATGATCCATTGCGTAGCTGTCCATACAGTGA" "55152" "1" "0.118656" "-1.7480127" "-4.31" "-0.20602194" "" "TATAGTATGGAAGGAAGGTTTGCCACAGTGGCGGGAAAACAAAAATGATTAGGGCAGCAG" "4453" "1" "0.118667" "-1.747954" "-4.31" "-0.14819493" "" "CAAGAGACAAAATCAAAGCAATTCTCTTTCCTAATTAGAAACAGCACAGAGAATGCAATC" "42918" "1" "0.118678" "1.7478916" "-4.31" "0.25660116" "98733" "CTGCTGGTAGATGGTGACTAGAGGACTGAAACACACCAAGCAGGTGCCCTTGGACAATTT" "58571" "1" "0.118689" "-1.7478298" "-4.31" "-0.2118991" "" "CAGTCAACAGGCAGCAGTCAGTGGGGAGAAGTCACCCTGGACTGTTCATATGAGACAAGT" "19865" "1" "0.118696" "-1.7477904" "-4.31" "-0.15470969" "" "AGAAGCAATGATACCTCTTCTGGGCAAAGACACGGGGAAGCTCCGGAGAGATTCCACAGC" "51772" "1" "0.118765" "-1.7474095" "-4.31" "-0.2932673" "244608" "AGCAGCCGGCAGCTTATAGACCAAGAAGTGACCCATTAAAGTTCTCTATTATTTTCCGTT" "37472" "1" "0.118782" "1.7473134" "-4.31" "0.14142702" "116871" "CTGCGGCAGGCAGCGAGACGGCCGTTTGTTGCTATTAATTATGCTGCCATTAGGGCAGAA" "28465" "1" "0.118784" "1.7473025" "-4.31" "0.24668504" "69469" "CGGTCAATTCAGAAAATAGTGATGTTTGTGATCACACTCTACCAACTTTACAAGAAGGGC" "24619" "1" "0.118796" "1.7472378" "-4.31" "1.30554691" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "53885" "1" "0.118824" "-1.7470816" "-4.31" "-0.16369934" "100040220" "GGGGGTAAGGAGGTACTTTTTAAAATCGTTCATAGACTTCTGTAAAATGCAAGATTAAAG" "36354" "1" "0.118878" "1.7467804" "-4.31" "1.20762161" "54123" "GCATAAGGTGTACGAACTTAGCCGGGAGCTTGGATCTACTGTGGGCCCAGCCACGGAAAA" "52098" "1" "0.118901" "1.7466563" "-4.31" "0.1601528" "" "CTCTTCCTGTGTTGGAAATAAGCATTCATATTGTTGTTAACCAGTTGGGAGTTCATTTAT" "54045" "1" "0.118904" "1.7466407" "-4.31" "0.20477495" "22268" "CTATATAAGACAGAAAGTTTGGAGAATGGAGACGACTCTCATTCCTGTCTATGTTTAATG" "34305" "1" "0.118915" "1.7465794" "-4.31" "0.35761505" "630322" "ACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATAT" "30103" "1" "0.118918" "1.746559" "-4.31" "0.74634407" "" "CAACCTGGAACCTGAAGATATTGCCACTTACTATTGTCAGCAGTATAGTAAGCTTCCTCC" "22955" "1" "0.11893" "-1.7464951" "-4.31" "-0.24222575" "380928" "CAAAGGAGCCGCCATGATCATCGAGACCCTGGGTCTTTCTTATCATTTACATTGTTTTAA" "9672" "1" "0.118932" "-1.7464859" "-4.31" "-0.13540626" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "56392" "1" "0.118983" "-1.7462038" "-4.31" "-0.20460384" "117150" "GTGGGTGGGACCTGCTGAGTCTCCCATCCCTCAAGCAACCTTTCCCCTGTTGAATGCAAT" "11206" "1" "0.118986" "-1.7461867" "-4.31" "-0.1743314" "" "CAAATTTATCTTCATTCTGAAGGTCTCGGAACTCCTGAGATGTTTAGATGTATTTTAGCT" "49171" "1" "0.11901" "-1.746051" "-4.31" "-0.23672607" "403180" "GCTTGTCAATGTGCCTTATCATCTACTTTTAACATTGTTGGCGAATATATATACTTTGCC" "39693" "1" "0.119022" "-1.745988" "-4.31" "-0.19524755" "" "CTCAAAGCACAGTTTCAGCATCCTATTAAAACTACTGTGCTGCTAATAAAGAATTGTAAG" "25323" "1" "0.119043" "-1.7458728" "-4.31" "-0.19033494" "108645" "ATCAGAACCTGTATAGCCTGATGCCTACTTCATAGCACTGTGTGGCAAACACTTGAGAGA" "34768" "1" "0.119048" "-1.7458426" "-4.31" "-0.15527267" "233726" "CTATGCGCCCTTATTGATATGGAACAAATACCACAGGTTTTAAATCAGGTTTCAGGACAG" "31565" "1" "0.119057" "1.7457948" "-4.31" "0.22315188" "67861" "CATGTTCAACTAGAAGCAGACTGTCACAGGAAGATGCATCTCAGCAAAGGGCAATGTTTG" "50733" "1" "0.119092" "-1.7455991" "-4.31" "-0.21327688" "241846" "GTTTTGGTATTTTGCAAAAAGGTTTCTATAGGCAAAGGCTCAATCCTCACTTTGTAACTT" "1037" "1" "0.1191" "-1.7455558" "-4.31" "-0.52720276" "" "CTGGATCATCTCCCTGCTAAAGGCAGCTAAACCCTGTCCATCTCTGATCCCAGGACCATG" "33842" "1" "0.119113" "1.7454851" "-4.31" "0.26613649" "21935" "TAGATAATGAGCTTCCTAACTGGTGTGAAGCTGCTTTGAGAACCTTCTGTCAGGAGAGCT" "42930" "1" "0.119126" "-1.7454141" "-4.31" "-0.14182876" "67467" "ATGGTGTGTACAAGGTTGAAAGGTTGTATACTCCTTGTAGCCGTTTCATTTAGGAAAGGC" "44476" "1" "0.119145" "1.7453087" "-4.31" "0.2128229" "" "TGAAGTCCAGCAAGTATGTTATGAGGCTTTTCCAGTAGCAGAAAGTTTTCACTGTGCTCC" "30428" "1" "0.119162" "-1.7452143" "-4.31" "-0.22207093" "" "TTAGTATTACAGTGTTGACATTTCTTGCTTACCAGTTGTTAGAACTGTTAAAATTTGCAA" "14993" "1" "0.119176" "-1.7451367" "-4.31" "-0.1412825" "" "" "1393" "1" "0.119206" "1.7449681" "-4.31" "0.39437786" "14049" "GGCAAGGGTACTCGGCCATGATGGATAAAGGCATTCAATAAAAACCACGTTTACATTTTA" "53117" "1" "0.119207" "-1.7449658" "-4.31" "-0.13634465" "17524" "CTCAGGCTCCTAAAGGGGTGAAGCTTTCCTACTATCTACATTTCAAAATGATCTCTGGAA" "18943" "1" "0.11922" "-1.7448936" "-4.31" "-0.15903355" "" "TTCCACATTTCTCTGAAAGGCTTGAAGTTACTATTTTATTGCCCTTGTTTCCAAGTTCAG" "17910" "1" "0.119231" "1.744833" "-4.31" "0.53763187" "16952" "GCCCCATAAGCAAGTCACTTTGGTACCATTCCTGAGAAAGAAGTTTACATATAATAAAAT" "50858" "1" "0.119231" "1.7448298" "-4.31" "0.79061899" "" "ACATATGCTGACGACTTCAAGGGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACT" "12390" "1" "0.119241" "-1.744778" "-4.31" "-0.16926772" "" "AATCGTAGCATTGTCTTCCTATCCGACAAGGGTTTACTAATAAAGTCTTCACTCAATTGT" "3403" "1" "0.119256" "1.7446951" "-4.31" "0.48531768" "12501" "TCTCCATGAATACACCAGCCCCCTCTCTGCTAATGCAAAAGGCAATAAAGTGTATTGGCT" "18373" "1" "0.119257" "-1.7446893" "-4.31" "-0.1461902" "192174" "CCATCAAGTAAGAAAAAAGAGAAGAAAGAACAACTTTCCAAAGCTCAGAAACGCAAGCTG" "39527" "1" "0.119277" "-1.7445782" "-4.31" "-0.21271573" "19821" "TTGATAGAAGGAAGAGACTTCCGGTACCATTGTAACTAAAGTGTCAGTCATTTTAACTAT" "60927" "1" "0.11928" "-1.744562" "-4.31" "-0.23364639" "" "TTCAGATACTGAGGAAATGGATCATACCCAGAAATCTACTCTGAGAGACTTTTTACAACC" "38552" "1" "0.119323" "-1.7443236" "-4.31" "-0.18640589" "" "CTTCCCTTAAACATCATAAAGGATAAACTGTACCATGCATCTATCTATATGGTTTTTCCC" "36118" "1" "0.119331" "-1.7442807" "-4.31" "-0.23933575" "" "" "60309" "1" "0.119336" "1.7442519" "-4.32" "0.14538591" "118449" "CACAAATGCGCAGGCTTCTTCTGTGTACTCGGTACCAGCTTATACCTCTCAGCCCAACTT" "42588" "1" "0.119364" "1.7440974" "-4.32" "0.46293953" "16453" "ACGTGTGGAGCTTCGGAGTGGTGTTGTACGAGCTCTTCACCTACTGCGACAAGAGCTGCA" "61944" "1" "0.119379" "1.7440147" "-4.32" "0.17289271" "18127" "GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA" "33641" "1" "0.11938" "-1.7440087" "-4.32" "-0.2542755" "234915" "CACAGTGCAAAGAAAATACTGATGAGCTGTGATAGTCACTACTTAGTGGAATCATTATTT" "24894" "1" "0.11939" "-1.7439568" "-4.32" "-0.21567136" "" "" "59731" "1" "0.119396" "1.7439243" "-4.32" "0.90110693" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "50750" "1" "0.119398" "1.7439092" "-4.32" "0.22687965" "56088" "CCTGTTCCAGGGGGCAGTCACTGATGTTTTGTATTTTATTCTGGCTTGGGATGTTTTGAG" "45008" "1" "0.119408" "-1.7438564" "-4.32" "-0.14056243" "" "CCTACGGAGCCTTTGGCAGGACGTGCTTTCCATCCTTGTTCTGGACCCTTCCTTTCGTTA" "60963" "1" "0.119416" "-1.7438113" "-4.32" "-0.17503775" "28000" "GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT" "49270" "1" "0.119423" "1.743773" "-4.32" "0.32584678" "237256" "TACTCGGTTCATTTAGGCCACGGTTCCATGCTTCGAATCAATGCATTGCAAATTGATAGT" "12282" "1" "0.119425" "1.7437601" "-4.32" "0.34602086" "233274" "ACAACAGTTAAATTCCCTTGCAGAGACATCCTCCAAAGTTGAAGAGGCTTTGACTTAGTT" "40343" "1" "0.119431" "-1.7437272" "-4.32" "-0.19090309" "" "TAGTCCAGAAGGCTTCATGGAGGTGGTGGGCAGCCAGGTCTTAGGATGAGAAGGTAAGGC" "41742" "1" "0.119434" "-1.7437122" "-4.32" "-0.20576024" "353169" "GGTAAATCCTCACGGTTTTAAAGCCGTCTACTTCTACCTCTGGTTTTTTAAAAATAATCT" "24960" "1" "0.119467" "-1.7435284" "-4.32" "-0.1477271" "243983" "CCTGTTACTGAGCAATTTGGCAAGCAGCTTTTAAAAACATATGAAAATATTTTCCCCAAG" "53130" "1" "0.119502" "-1.7433382" "-4.32" "-0.19224339" "" "AGGCTGAGGACACTTTCATCACTGACCTGGTGGAGCGCCTGACCAAATACAGTCAGATTA" "7721" "1" "0.119573" "1.7429466" "-4.32" "0.23881366" "" "CCACCCAGCCACCCCACTCCCTTAGTCTTCCTAGGTTACAGACTCTACCCCTCCCCTCAG" "42309" "1" "0.119598" "1.7428117" "-4.32" "0.14648548" "" "CAAGTAGTTCAGAAAGGTTGTTTACCAATTTCTAGCCAATCCTTCTGTGTACTTTATCAA" "3634" "1" "0.119616" "-1.7427083" "-4.32" "-0.21003714" "109349" "ATGGGACTTGCCAGGGACCCACACAGCACCCTGAAAAAGCAAAAGCCAATAAATTTGTTT" "18747" "1" "0.119633" "-1.7426161" "-4.32" "-0.1750298" "" "TTATGAGCCAACCACTAATTTCATCCTGTCTCTCCCCTAAATGGAGTTGGAAACCTTCTA" "26525" "1" "0.11966" "-1.7424698" "-4.32" "-0.18793773" "" "" "62580" "1" "0.119661" "1.7424632" "-4.32" "0.61775261" "24047" "TTCTTGCGCACACAGTCTCTCAGGCTCACTCACTCTCTGTGGCCTGCCTCAGATTATCTG" "1875" "1" "0.119699" "-1.7422565" "-4.32" "-0.18215034" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "2352" "1" "0.119713" "1.74218" "-4.32" "0.19929945" "" "TCATACTAAGGGCTGCATTGGTTTGCGTACAGAGAAGATTCAGGATGGAGCCTAATGTGT" "57702" "1" "0.11975" "-1.7419753" "-4.32" "-0.14299149" "" "" "6035" "1" "0.119753" "-1.7419566" "-4.32" "-0.15950889" "21780" "CTCTGAGCATTAAGATGGAAGACGGAGTTGTCATTGGGATTAGGCCCAAGAAACCAGTTA" "7446" "1" "0.119768" "1.7418732" "-4.32" "0.49534869" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "15021" "1" "0.119783" "-1.7417923" "-4.32" "-0.16417139" "" "GACAGTTTTGTTCAAAACTTTATCATGGTTTGGGGATCAAAATTGTGATCAAAGGGATCA" "20377" "1" "0.119792" "1.7417455" "-4.32" "0.9017987" "12257" "GAAAGAGCTGGGAGGTTTCACAGAGGACGCTATGGTTCCCTTGGGTCTCTACACTGGTCA" "12837" "1" "0.119797" "-1.7417142" "-4.32" "-0.26486726" "109050" "CAGGCACTGTCTCATGAGTCCAAGTAGGCGTGCCCAACCAGCATGGTATTTCATAAAGCA" "45773" "1" "0.119799" "-1.7417074" "-4.32" "-0.21458519" "" "AATCCATGACAGTCTTCAGTCTAGGATCAAGGCCTCCTCACAAAAGCCATCTCCTTGTAG" "47550" "1" "0.119819" "1.7415962" "-4.32" "0.51422686" "12826" "TTTTCGTCTCTGGAGAAACTGTACTATCCTTTCACAGGGTTACCAACATCAGGCCACTGA" "25038" "1" "0.119841" "1.7414731" "-4.32" "0.17209046" "" "" "9254" "1" "0.119846" "1.7414463" "-4.32" "0.2433167" "17385" "GCACAGGTACCCTCTAAGCCATGTACATGTGTATACAGTGTATAAAGACTTTTTTAAAAA" "60642" "1" "0.119865" "-1.7413426" "-4.32" "-0.16714439" "216965" "GGCTGCCGGGGTTTTTGTGGTTGGCTTTTTGTTTTTGTTTAACTTTTGGAAAATTTTTAA" "61634" "1" "0.119866" "-1.7413373" "-4.32" "-0.18757729" "100039042" "AATCCAGATGAAGCAAGAAGTCTGAAGGCCTATGGAGAACTTCCAGAACATGCCAAAATC" "13464" "1" "0.119867" "-1.7413333" "-4.32" "-0.16403539" "" "TGTCCACACTGAGTGTGTATCTCAGGCACATGGATAGGGCACGGTCTACCTGGAGGCTGT" "6865" "1" "0.119887" "1.7412232" "-4.32" "0.17951954" "" "GGGTTAAGAACAAATTCAGAGGCTTTGGAGCACTCTTCGATGATATACGTTATATTTTAA" "46161" "1" "0.119916" "-1.7410596" "-4.32" "-0.14012435" "" "" "49761" "1" "0.119949" "1.7408816" "-4.32" "0.18575518" "69306" "ACAGGAGTATCCTGTGACACACGAGTGAGCATGGATAATTAAAATGAACATGGCCACAAT" "45638" "1" "0.11997" "-1.7407657" "-4.32" "-0.15073927" "66352" "ATAAGCACCAACTCATATTGGTGTGGAGAACAACAGGAGACACTAGCTTGCTAATATGAT" "54890" "1" "0.119973" "-1.7407471" "-4.32" "-0.15260636" "" "TGTGTAGAGGAGTGACAGCGCACTTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGGGA" "20101" "1" "0.119983" "1.740693" "-4.32" "0.34825102" "12774" "AAAGTTTCTGCCTAACAAGAGGTGTTACTGGTTTTTCTCAAGCTCCGATTGTGAAACCAG" "53699" "1" "0.120005" "-1.7405733" "-4.32" "-0.19123566" "107071" "AGCCTGTATTCAGGGCCAAAAATGTGCGGAATGATTGGCTTGATCTCCGAGTTCCTATTT" "13415" "1" "0.120032" "1.7404267" "-4.32" "0.63245694" "27384" "TGTGTGGACAGTGATGCTGGCAATATGACCAAGATGGACTGTTGGATGGACTTGTCATTT" "17695" "1" "0.12007" "-1.7402167" "-4.32" "-0.14364735" "" "AAAGCAATACGGATGTGGTGTGCATTCTTGGAAATAACTTTCTGTCTTCTGACTCGGGGG" "3812" "1" "0.120095" "1.7400812" "-4.32" "0.73066771" "" "TAAAAAGTGACACGGTCAGTGGAAACTCAAGACCAGGAATGTACAGGGTAGGGTTAGTTC" "35240" "1" "0.120105" "-1.7400233" "-4.32" "-0.15418603" "" "AGACTTCCTCCAGAATTTCCTTTTCTTTTAAGGTTTACATTTCTTACTAATAGAGGTGTT" "35535" "1" "0.120121" "-1.739937" "-4.32" "-0.24486333" "260305" "CATAATATATTTTAATTTGCCATGTATTTTATTATACTGGGATTCTTTTGTATCTTTTTT" "22049" "1" "0.120126" "1.7399104" "-4.32" "0.64671266" "" "CTCTCTTGCTTTCTTTATTCCAGGACTTGGATCAGTTCCTTGTACACAGAAGGCAGTGAA" "6360" "1" "0.120127" "1.7399047" "-4.32" "0.19811523" "279185" "GGAAGTCCTGCAGCCTGATATTTTCATTTATCACCACCATTAGCATTATAATTTGTCATA" "4315" "1" "0.120128" "-1.7398978" "-4.32" "-0.28567537" "11298" "AGAGGGGGTTTGTCTCCGCATTTCCTCCTCTGCCTGCTCTGTTTACTGTGCTCCAGTGCA" "17656" "1" "0.12015" "1.7397811" "-4.32" "1.41774959" "" "TACAGCAAGCTCACTGTGGATACAGACAGTTGGTTGCAAGGAGAAATTTTTACCTGCTCC" "22346" "1" "0.120158" "-1.739733" "-4.32" "-0.14490034" "234967" "AACTCTACATGCATAACAAGTGGTTTGTAATCATGGGAGAAGAGCGGTGAACCCTCTCCT" "43309" "1" "0.120167" "-1.7396884" "-4.32" "-0.16026849" "225215" "TAATTTCTGACAGTTGCATAATGGCAGCACACAACACAGCACAGCTTAGTTTTGTTGGGC" "61370" "1" "0.120184" "-1.739592" "-4.32" "-0.19205847" "" "AGGTGTCTGAAGCAAAGCTGAGTGACAGAACACATTCAGTCAGGCAAGTGTCTACACAAA" "17059" "1" "0.120205" "1.7394781" "-4.32" "0.53333187" "14824" "TCCACTGTTCAGCCAGGGGAACCAAGTGTTTGCGAAAGAAGATTCCTCGCTGGGACATGT" "15888" "1" "0.120209" "-1.7394542" "-4.32" "-0.16722115" "" "GGGTGTTTCGAGACTACCTAATCCTATGTTTGCTTTTATTTGATTAAAAACCCAAATCGT" "60096" "1" "0.12027" "1.7391196" "-4.32" "0.59849876" "" "CTAAGCCTCTGGATCACATTAACATAATATTGAGACAAATGCAAGTTATAATGCCTAGCT" "62370" "1" "0.120282" "1.7390582" "-4.32" "0.5420935" "20111" "CTCAGCTGGTAACTCAGGGTTCATCTGTCCAAGGCCTTTCTAATAAACTTACAATCCAGT" "12158" "1" "0.120313" "-1.738884" "-4.32" "-0.16900404" "74718" "AGGAACTATAGTCACTGCTGCTTTCAATGTCTTTTATCCAGCATTGTATTTACTACATTG" "44339" "1" "0.120318" "1.7388607" "-4.32" "0.94878844" "12182" "AACCAGACGGTAATCCAGTTGTATTTACACTCATGATTCAAGAAACAAGGCATTCATCTA" "13052" "1" "0.120358" "-1.7386429" "-4.32" "-0.14365364" "" "TTTGCTTCTGAAGGCAAATACGGGGCTCTGAAGATGGACTTTTCCTCGTTCTACTTACGT" "21201" "1" "0.12036" "-1.7386314" "-4.32" "-0.15519308" "69694" "CAGAAGCATCAAGATGACTTACAAGATGTCATAGAGAGAGCTATCCAGATTGGTGTTAAA" "59041" "1" "0.120371" "1.7385671" "-4.32" "0.73166009" "211666" "AGATTCCTGAACGAATACCTGGACTTTCATGTTGCCAAGAAACTGAGGAAGCCCTTCTAA" "14294" "1" "0.120378" "-1.7385332" "-4.32" "-0.196959" "75973" "TCCTAAAAGATGTGGAGCAAAAAGAGCAAAAACTACAGCTCCTGACAGAAGAGGCTGAGC" "5353" "1" "0.120386" "1.7384863" "-4.32" "0.23033832" "" "GGCGTACGCAGTGCTTCTAAGTCCAATCATCTTTCTTATCTTTAGTCTCTTTTTGTTTTG" "21304" "1" "0.120411" "1.7383525" "-4.32" "0.8630617" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "8129" "1" "0.12043" "1.7382439" "-4.32" "0.27700485" "93871" "AAGTTAACTCGGTATTACAGTCCCTATAAGCAATGATTTACATGGATCTCTTTAAAGGTC" "5241" "1" "0.12046" "1.7380801" "-4.32" "0.17462677" "" "AATAACCCACCCAACTCAACTAAAGAGGAGCTTAGATACCAGGCCTTCTCAGAACAATGC" "61313" "1" "0.120531" "1.737692" "-4.32" "0.32700559" "" "AAGAAGAAGAGGAAGAAGACTGCTCCAAATGGTGCTCAGGCCTATTATCTCCATTTGAGA" "12175" "1" "0.120557" "-1.7375522" "-4.32" "-0.14867625" "" "ATCAGAGAATTCACATTGTTGAAGAATCTTAACTGATGTGGGAAGACCTTAAATTGAATA" "18893" "1" "0.120558" "1.7375468" "-4.32" "0.20970502" "52009" "TTAGTGTCAGCTTCTTATAAATACCTGTGCATTGCTTCAACGCTTAGAAAAGTGCTACTC" "22053" "1" "0.120563" "1.7375177" "-4.32" "0.22314176" "244178" "GAATCCAGAATGAGATACATCAACAGCTACCACTACTGTTGCATCTTCAGACAGCCATGG" "19095" "1" "0.120567" "-1.7374959" "-4.32" "-0.1526666" "71885" "TCTGCACCCTGATGGGAAATACCGTCACCCAAGAACTCAGGCCATGGAGACACAGGGTTT" "27598" "1" "0.120575" "-1.7374524" "-4.32" "-0.18288404" "56220" "GCTTGAGTCCCAACAACCATCAATGTAATCTTCCAAAGAAGCTTTTCAATTGTGATAATT" "53420" "1" "0.120602" "1.7373091" "-4.32" "0.32384855" "11637" "GGAGGGGCTCCTCGAGAGAAGATTGGAACAGTGGCAGTGTTATAATTAGTAAGGTTTTTT" "42447" "1" "0.120603" "-1.7373" "-4.32" "-0.16827191" "71986" "CTGGATGACCACAAGATTCAACATCTAAGGCTGCAAGGGCAAATGCCGGCCTCAATGAGG" "23942" "1" "0.120611" "1.7372566" "-4.32" "1.41737436" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "42769" "1" "0.120619" "-1.7372121" "-4.32" "-0.19979578" "67511" "GGAAGGGCGCTGTATTTCCACATCGGAGAAACAGAAAAGAAGTGCTTCATTGAGGAGATT" "61965" "1" "0.120658" "-1.737001" "-4.32" "-0.15132435" "67011" "AGACAGTTCTTTGGTGTGCATACAGACTGACCACTTATTAAAGACTAAAGCAGACGTGCA" "21438" "1" "0.120687" "-1.7368426" "-4.32" "-0.17779896" "230157" "GGCGTTTAACATGTAGTTTAGCCAGTCAAAAGTATGCATGTAGAGTTTAAAGACTATGTT" "60232" "1" "0.120688" "-1.7368383" "-4.32" "-0.23503409" "" "CGCACCATTCCAGAAATGAGATGAACTCTAGTAAGCATCACATCACATAAATATAATTGT" "48149" "1" "0.120691" "-1.7368206" "-4.32" "-0.21476418" "66498" "AGAGTACCCGTCAGAACAGATCATTGTGACAGAAAAGACGAACATACTTCTGCGGTACCT" "23366" "1" "0.120704" "1.7367481" "-4.32" "0.59397561" "236312" "ATGTGGAGGCTGAAATGCAGGCTGAATGCAGTTGTGGAGACTAATGTCTTCAGAAGTGAT" "26113" "1" "0.12072" "-1.7366638" "-4.32" "-0.18709516" "72508" "ATAGTACTTTTCTCATGTGACTCAACACTATAGCACAAGTATTATTTCCCTGGATTCTCT" "44358" "1" "0.120727" "1.7366247" "-4.32" "0.4129036" "68591" "AACTTTGGTGTGTACCTGATGCATTCGTACTTGGATTTATCGTCTCCATGTTTCCTGTCA" "55292" "1" "0.120727" "-1.7366221" "-4.32" "-0.29384304" "271887" "TAGCACCCCTGAGCCTCTGGAGCTCACATCCCACACATAAAGAAATAACATCTTCCACAG" "12980" "1" "0.12074" "-1.7365555" "-4.32" "-0.13980946" "" "TAATGACAGAAAACAGACTGGGTCAGTATGGAACACGACCACGTGCCACATTCTTCTGAA" "22309" "1" "0.120756" "-1.7364656" "-4.32" "-0.16064057" "" "TATCCCATCTATGTGAATCATACAGAACAGGCAATCTACAGGTACAGGTGCTCCTAGGGA" "506" "1" "0.120775" "-1.7363619" "-4.32" "-0.25189608" "" "TGGTGAGAAACCTCACGTGGAAAGGGCTTTATTCAGCACTCAAACCTTCTAATGCACTGA" "7598" "1" "0.120815" "1.7361434" "-4.32" "0.21981789" "" "TTCTGAACTGCAGTTATGAGAACAGTGCTTTTGACTACTTCCCATGGTACCAGCAGTTCC" "12348" "1" "0.120831" "-1.7360579" "-4.32" "-0.14021332" "67872" "TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG" "51876" "1" "0.120833" "-1.7360486" "-4.32" "-0.18287184" "110074" "TTTGTTGTTGTTGTATTATTTAAATTATAGCCTTCCAAAAACTGTTTTTGATCATAATTG" "35231" "1" "0.120854" "-1.735932" "-4.32" "-0.27334336" "" "CACAGGATTTGCCTCCATGATGAGTAGCACTTCTGGAACAAGCGCACACATGCCATCCAC" "26091" "1" "0.120854" "-1.7359317" "-4.32" "-0.17381204" "69259" "TTTGCACAATTTGCATGGGCTCTGTTCATCTGATACGACATTGGAGCTGCTAAGGTTCCT" "60081" "1" "0.120892" "1.7357247" "-4.32" "0.19065691" "" "" "43406" "1" "0.1209" "-1.7356832" "-4.32" "-0.13877443" "" "GGGGACAGAATCAGGTATTGGCAGTTTCTCCATGTTTACTTGTGTGTATTTTTAATATAA" "57466" "1" "0.120912" "1.7356141" "-4.32" "0.14694858" "382097" "TTAAGTTCTGCTGATTCCTTGCTCCTGTATCTTCAGTGAAATGTGCCTTGTGCTCCCACA" "47796" "1" "0.120926" "-1.7355414" "-4.32" "-0.13036605" "245381" "CTGAGCAGTCTCATAGAGTCTAATATATCATGAATGAGTTCTTAAGTACATTAAAGGGGA" "58374" "1" "0.12093" "-1.7355186" "-4.32" "-0.24176224" "233335" "GTTACTACGGCTGTGGCTCGTCATCTCTTATACTGTCAGAGATGTGCGGACTTATTTTTT" "17161" "1" "0.120943" "1.735448" "-4.32" "0.32153661" "" "" "35573" "1" "0.12095" "-1.7354116" "-4.32" "-0.2511774" "22209" "GATTCACGGAAGGGAGTGTATCTTGCAAACTTTTCCCATTCAAATCCTGAGTTAATGCTG" "5507" "1" "0.120969" "-1.7353045" "-4.32" "-0.18078159" "217449" "GGGTTCCCTTGGTTTGTTCATGGAAGCTAACTTGTTCTTTGGTCACTTCTGAATACTCGT" "28495" "1" "0.120984" "-1.7352264" "-4.32" "-0.1454541" "69656" "GCCATTCTTGATTTCAGAAATGCAAAAAATGGTTTTGAGGGGGCCAGAACCTGGAAGTCA" "50600" "1" "0.120992" "-1.7351812" "-4.32" "-0.17919493" "217473" "GACATACAAAGCCGTAATGAGGAACAATCTTTGGTCTTAAAGCTTTGCCATAGTTGAGCC" "29749" "1" "0.120993" "1.7351767" "-4.32" "0.15250001" "16974" "CAAAGGAAACAGGAAAAGAAAGGCATCACTGACCAGGAGTGTCTGGGTTTTAACGATACC" "57392" "1" "0.121002" "-1.7351279" "-4.32" "-0.16328751" "" "" "55106" "1" "0.121005" "-1.7351094" "-4.32" "-0.23101614" "" "AAATGATTTAAAAGCGAACAATCGGTTTGCCATCGTAGACTCCACTAGGCAGGCAGGAGT" "27208" "1" "0.121017" "-1.7350435" "-4.32" "-0.14145176" "66874" "ATACTTTGGAAGAAGGCAAAGAAAGGAGTGTCATTATTTTGAATGGTACCAATTGTATGG" "57422" "1" "0.121028" "-1.7349822" "-4.32" "-0.15728563" "72096" "TTAGTAAGTACCCAGGCTACACAGACTGAATAGGAATAATGGGTTGATGGGAAGCCACAC" "47194" "1" "0.121031" "1.7349683" "-4.32" "0.29024485" "26410" "CAGAACTGTGTAAACCACATAATTTCTGTACATCCCAAAGGATGAGAAGTGTGACCTTCA" "25641" "1" "0.121074" "-1.7347324" "-4.32" "-0.14694263" "56692" "TAAAAATAATTAAGTACAATCACTAACGCCCCTCTCTCTGTGTTCTCGGTGAGGATGAGT" "23998" "1" "0.121147" "1.7343362" "-4.32" "0.57984785" "234779" "GTGCCTTTTGAACTTCCCTGTTCTCAGCCTCATTGAATAAAGACAACAGTTTCATGCCAA" "55181" "1" "0.121189" "1.7341109" "-4.32" "0.25848175" "235386" "TCTTAAGAAAGTCTACATGATGAACCCTTGCCTAGTATGCAAAGCCCGGGTTCAACCTCA" "13400" "1" "0.121198" "-1.7340605" "-4.32" "-0.22011742" "" "" "44936" "1" "0.121212" "-1.7339841" "-4.32" "-0.18611957" "194388" "CCCTGAAAGGTGGACCTGGGTTCCAAGACAAGTTGTGGAATCCTGTGAAGGTGGAGGAGG" "38050" "1" "0.12124" "-1.7338303" "-4.32" "-0.17470336" "" "TCAGATACCTCCTGAAGGCCTAGTCCAAATGAGGGTCCAGCCTCAGGAACCTCCTGAAGG" "60629" "1" "0.121257" "1.733742" "-4.32" "0.23022351" "327959" "TCTGTATTTCTGGACCACAGTCACTCATTTGGCTCCAAAATAAACTTATCTCTGCATCCT" "12637" "1" "0.121271" "1.733662" "-4.32" "1.10913311" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "18036" "1" "0.121278" "-1.733623" "-4.32" "-0.17513767" "74603" "AACTGGCTGTAACTGTTCTCATCGTAGGATTTGCTTTTTTCCAGAAGAGAAATTATTTCA" "55016" "1" "0.121321" "-1.7333936" "-4.32" "-0.20085476" "50794" "GGCTGCGAGAAAGTTTACGGGAAATCTTCGCACCTCAAGGCGCACCTGAGAACTCACACA" "59250" "1" "0.121323" "-1.733383" "-4.32" "-0.16364017" "" "AGATGCAGGCACAAAATGACTCCTATGTCCTCAGCTCTGTTATCTACGAGCTGAACATCA" "53055" "1" "0.121327" "-1.7333589" "-4.32" "-0.17907675" "" "AGTAACTTAGAGAAGCACGAGGCTCCACATCCTCCTCTTCTTCTGCACCCCGTGAGGCCT" "37536" "1" "0.121349" "-1.7332386" "-4.32" "-0.25902474" "243880" "AGAACAAGGATGGAAATTCTGGTGCAAGAACCATGGGTGTATTGGACCTCAAACAACCTC" "46392" "1" "0.12135" "-1.7332337" "-4.32" "-0.31462671" "" "AAGTGCTGATGTGATGAAATGGTGCTTTGGACAAGACTTTTCCTCCAAGTTGGTCCTATC" "47456" "1" "0.121356" "1.7331993" "-4.32" "0.35417757" "70484" "GAAAACTTTTTGTTGTTGAAACATCTCTTTGTCTTTGTAAGAGTCAATCAGTTTTGAATG" "29624" "1" "0.121415" "-1.7328837" "-4.32" "-0.20349067" "76022" "AGACCAAACAGCTGCCAGTTCTGGTGAGGTGCTGTGAAGAGATCCAGCCACATCAGTGGA" "40963" "1" "0.12142" "1.7328556" "-4.32" "0.64074579" "238393" "CCTTCATCACCCAAATTGAAAGGGCAGGAGCTAATGATCAATAAACATATAACTGCATTG" "45372" "1" "0.121445" "-1.7327179" "-4.32" "-0.43662098" "12116" "GACTGCTATTCTGTCTGCTTCTATTCCATTTCATTAATAAAAATGTGCTGGTTGAAAACC" "62420" "1" "0.1215" "1.7324181" "-4.32" "0.2332656" "67574" "TCATGGAGCAGTCTACTATCCAGTAATGACAGATCCCTATGGGTCTCCTTTGTTGGGATT" "19174" "1" "0.121504" "-1.7323985" "-4.32" "-0.29701407" "72795" "CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA" "38522" "1" "0.121521" "-1.7323042" "-4.32" "-0.25426861" "" "AAGATGGTGGTCTTCTTGTACCGGATCATAAGAAATACATCCATCCCCTTGGCTGCTTGT" "51751" "1" "0.121532" "1.7322474" "-4.32" "0.21231903" "212555" "ATCTACCTACCTCAATCTGACTGTACTCTTGGTTACATCATAGTCAGGGGACCTAGGGTT" "31881" "1" "0.121544" "-1.7321802" "-4.32" "-0.15962877" "58244" "ACCTCAGATGTGCTCATGAATGTGGGATTTCTTATAATGTCCCAAATGCATAGCCTGGTA" "12073" "1" "0.121545" "1.7321781" "-4.32" "0.17562714" "" "TTCTAAAATGTATTCCCATCTCTGGACATCTCTCTGTGGCCTGGTATCAACAGACTCAGG" "16766" "1" "0.121587" "1.7319507" "-4.32" "0.22766704" "109246" "TAAAACCCCTCTGACCACCTTGAATAACAGTGATGACCAGGATGTGGAACTTTCAGTACG" "45856" "1" "0.121628" "1.7317255" "-4.32" "1.52179378" "" "AACTTTAATGTGAATACCTCCTGTTGCAAGGAAGACCTCTGCAATGCAGCAGTTCCCACT" "13244" "1" "0.121654" "-1.7315859" "-4.32" "-0.28799959" "26556" "TGATAGCCGGGCAAACACTGTTTATGGACTGGGATTCTCCTCTGAGCATCATCTTTCAAA" "4327" "1" "0.121659" "1.7315588" "-4.32" "0.24437753" "14255" "CGTGGATCTTCTCTCAAGCCTCATTTCCTTGTGAACAGAGAGGCCTGGAGGATGGGTACA" "25546" "1" "0.121682" "-1.7314354" "-4.32" "-0.22379891" "" "ATATAAAACTGGATTACCTCAAAGGCCTGAAATGCAGCAGCTATGACCCCTTTGCAGCTG" "26343" "1" "0.121687" "-1.7314078" "-4.32" "-0.1480297" "229504" "AATTAATTCTAGGTCAGTGAGACCCTGTCCTAACATAAAAAGAGGGCCAGGGGTAAAGCC" "29224" "1" "0.121704" "1.7313142" "-4.32" "0.368147" "219144" "ATCAACTGTTCTTCAAGTAACAATAGTCAGAGGGAATATAAAAATTCTCACAATACCCCG" "30625" "1" "0.121717" "-1.7312463" "-4.32" "-0.21279139" "" "AATGAATAAGCCAGAACTGTATGGAAGAGTGGACAAATCTCAGAAACATTGCTAAACTGG" "19823" "1" "0.121743" "-1.7311055" "-4.32" "-0.18961114" "" "GTTGGGTCAGTAGCCTAAACAAGGTCCTCTAATTTAAGAGTTTGGGGAGTAAGCTTTTTT" "47603" "1" "0.121751" "-1.7310613" "-4.32" "-0.15052082" "74205" "ATTGTCTTGTATGCATTTGAGAGAAATAAATATACTCAGACTTATGTTTTAAGAAATTTC" "18790" "1" "0.121772" "-1.7309452" "-4.32" "-0.18607221" "30956" "TATTGTGCTTCCTTTTCCCCGAGAACATATTATCAGCAAGTGCAGTTGTACTACTTCCTT" "40865" "1" "0.121818" "1.7307" "-4.32" "0.13685225" "67705" "TTCATAGTGAACCCCCTAAGAGAAGTGTGGTGCAAATGTGTGGTAAAGTGAGTCTCTCTG" "18874" "1" "0.121838" "-1.7305885" "-4.32" "-0.16023279" "" "GGTTAATCGCCCCCTGGGAAAAAATAAATTACCCACCTTTTTAAAAAATCTCAAAAGGAA" "5330" "1" "0.121843" "1.730564" "-4.32" "0.47745994" "" "AGTGTCTAGATTCAGATGGAACAAGCTTTGGATGTCAGGGTAAATGGCTCACACTTCATC" "26360" "1" "0.121864" "-1.7304479" "-4.32" "-0.13334761" "209357" "CCTGGGACTCTCTGTTCAGATGATCCTCTGTCAGCGCTTATGGCGGATGCTGGGTCTTCT" "25729" "1" "0.12189" "-1.7303069" "-4.32" "-0.20744464" "" "CATTGCCATATTCATGTCTGAATTCCCAAGTCTTGTTGACTATACAATGTGTTTTGTGAT" "19885" "1" "0.121893" "-1.7302933" "-4.32" "-0.15293371" "73835" "CACCACGAGATCACATGCTCTGGTCTGTCTTCAGCACGATGTACCTGAATCTGTGCTGCC" "61121" "1" "0.121895" "-1.7302798" "-4.32" "-0.16383452" "" "GAGTGGGGCGTCGGCGCTGCGCCTTACGCCTCGGGAGCCGGCGAACTTTCCGCGCGACCC" "33880" "1" "0.121928" "1.7301033" "-4.32" "0.15882755" "229776" "CACCAGGAAGGGGATGTATATATTATAGAGATTATATAGCACAGAGATTCTCCACTTATA" "6095" "1" "0.121929" "-1.7300963" "-4.32" "-0.20224153" "70408" "AAGGGGTCCGATAACCAGGAAAAACTGGTCTATCAAATCATAGAGGATGCAGGGAATAAA" "27711" "1" "0.121935" "-1.7300663" "-4.32" "-0.13833098" "" "GGAAGGGATAGTTTGTCTTCTAATGACAAGTAGTGTTTTGAAAGACACATAGAAATGCAT" "11386" "1" "0.121952" "1.7299746" "-4.32" "0.49463998" "" "TACACATTTCCGAAGCATTGGTTTTAGGAAGAAAGGCCACACAGCAATCACTGGCAGTGT" "45295" "1" "0.121955" "1.7299565" "-4.32" "0.70265795" "" "CGTCTCCTACTCTTGATCATGTCTTGCACTGGCTGCTAGTGTTTTAAACTTAAAGTAAGT" "55032" "1" "0.122005" "-1.7296856" "-4.32" "-0.33989953" "" "ATGAGTGTGAAATCAGAACTCCTGGAAGCTATTGAATCTGGGGGCTTTGAGACACTTTGA" "47878" "1" "0.122021" "-1.7296017" "-4.32" "-0.15578067" "384281" "TGAACTCCTATTATGGAGAGTTCAGTTTACAATGCCAGATCTGAATTGTAAGAACTCCGA" "47230" "1" "0.122047" "-1.7294605" "-4.32" "-0.16623992" "12121" "AAGTTTTGAGGGTATCTTTAATTTTTTAAAATTGCAGTTGAGTAGATAGATATATTGGTG" "48600" "1" "0.12205" "-1.7294437" "-4.32" "-0.25488627" "73412" "CAGTGTGCAAGATCCATGAAAACGAAGAGTATTTTGATAATCTTATAGGGCACATGACCA" "25032" "1" "0.122065" "-1.7293641" "-4.32" "-0.17086274" "" "ATTCAAATGAAGCTGATGTTGTGGGCACCAGAACTCCAATGTTTTGCTTTAAGGCTCCGG" "44665" "1" "0.12211" "1.7291187" "-4.32" "0.32637606" "226041" "AAACCCATCCTGGTATTAGAGATATGGCCTTACAGGTATTAATCACATTCTGAATTTGGC" "34628" "1" "0.122174" "1.7287742" "-4.32" "0.54403048" "217125" "CAGGGCCCTATGTTTGTGCTCAGTCACCTTCACTGGAAGAGGGGGCCTCATAGGGAAAAC" "10162" "1" "0.122183" "-1.7287268" "-4.32" "-0.20265988" "74666" "TATCCTTCCCCCATGCTCTCTGTTACATTTGGGAAGGTGGGGAATAAATGATGCAGTCAT" "19245" "1" "0.122194" "-1.728667" "-4.32" "-0.16177375" "66488" "GCCAAATGCCATTTTTGCCTGGGTGGTTTTTATTTTTTATTTTCTTTGCAGTGCAGTGTT" "12120" "1" "0.122207" "-1.7286001" "-4.32" "-0.19649929" "110380" "CCACTTATCAACAGATCCTCTTGCTTGACTTTAACAAAATAAATAGTGTCTCTTCAGATG" "27154" "1" "0.122224" "1.7285041" "-4.32" "0.17986377" "" "TTGTTGAACGTCACCGGAATTTGACTCTGCTGTGTAACCCTAGACAAGTCCATTCTCCAG" "40254" "1" "0.122228" "-1.728482" "-4.32" "-0.20184818" "624784" "TTACTACATTAAGCTGAAGGACTTGAGAGACCAGCTGAAAGGCATTGAACGCAACACCGA" "60430" "1" "0.122237" "1.7284375" "-4.32" "0.38087709" "24044" "GCCGAGCCTTCTTTCTGAGGGTTCTTCCCACAATGGAGTCTAGGTCCCTTTCTACTTGTC" "15069" "1" "0.122283" "-1.728188" "-4.32" "-0.15361294" "69962" "AATGGAGATGACTTTTAAGCACCCCAGTTAATATGCACCGAATGGCGTAATGAAATAAAA" "58975" "1" "0.122295" "-1.7281208" "-4.32" "-0.22407122" "" "CAAACAAAGGTCAGGTTTGTGGTGTGAGCCAGTGAAAAGGCCTTGGAATTGGAAGTTTTC" "36075" "1" "0.122315" "-1.7280163" "-4.32" "-0.18746441" "" "TGTTCCACGTTGCCAGCAGAGTTTAAAGCCCAAACCACGACCTTAGCTGAATCCAAAAAA" "29669" "1" "0.122358" "-1.7277832" "-4.32" "-0.25240629" "99681" "GGGAAATGTATGAACAGAGGACAAATTTCTAGAGGTCTCTTTATTATACTTAGATGCTCA" "43467" "1" "0.122372" "-1.7277079" "-4.32" "-0.14319777" "223732" "AAACAATTACCAGGGGTTTCTGGCTGAGCTCCGCAGAACCTACAAGTCCCCGCTGAGGCA" "37069" "1" "0.122376" "-1.7276843" "-4.32" "-0.26537134" "18549" "GACACAAGCAATCCCAGCCTGGTCTCAAGCTTTGCTCGCTGTCAATGATTATTTTCACTA" "46628" "1" "0.12238" "1.7276662" "-4.32" "0.21113151" "14255" "AGATGCTGTCTGCCATTACTCCAAAGTGACTTCTATAAAATCAAACCTCTCCTCGCACAG" "26337" "1" "0.122396" "-1.7275785" "-4.32" "-0.15236618" "" "TATAAATAAAAATAGAAGCTTCCCTCCCAAGCGTTCAGTCTGCCCAGTTCTGCTGGCCAA" "44374" "1" "0.122411" "-1.7275008" "-4.32" "-0.20636195" "319748" "GGCGCCTGCGGCAAGACCTTCCGCTACCGCTCCAACCTGCTGGAGCATCAGCGGCTGCAC" "57726" "1" "0.122423" "-1.7274319" "-4.32" "-0.21696197" "16918" "GCTTTTTTGCAAAGTGGTGTTAACTGTTTTTGTATAAGAAAAACAAAAAACAAAAACCCT" "7511" "1" "0.122439" "1.7273453" "-4.32" "0.14300064" "258914" "TTGAGAAACAAGGAAGTCAAAGCAGCTCTCAGGAAATTTTTTCCTTTCCTCAGAAATTAA" "5421" "1" "0.122446" "1.7273112" "-4.32" "0.53148111" "56175" "GACTGTATCTTGATTACTCTTGATTTCCAAGCTTTCAGATCTTTTCTACTTCAGAGAGAA" "11116" "1" "0.122446" "1.7273084" "-4.32" "0.65129206" "78416" "TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC" "36866" "1" "0.122458" "-1.7272433" "-4.32" "-0.22400627" "268859" "AGGCCTGAGTGTTGCATCACATGCAGTAGGACATCATGTTAGCAACTCAAAGAAACAACT" "27079" "1" "0.122505" "-1.7269923" "-4.32" "-0.13535993" "224111" "GCAGGTAGTGATTTGGTGGGAAAACCAAAACTTGATAAACTGCTTATAAAACCATTTCTA" "36610" "1" "0.122517" "-1.7269257" "-4.32" "-0.25812289" "219249" "CGATAGAGCAAAATATCTTTACAAGTGGAAAACTTCTTCTGCCATCAATAAAAGCATTGC" "37871" "1" "0.122534" "-1.7268371" "-4.32" "-0.14699871" "216739" "ATCGTCGATAAACCCCACAAGGCAACACTTCTGCTGGAACACGTGGAGAGGAAGGAGACT" "8972" "1" "0.122552" "-1.726738" "-4.32" "-0.16920675" "232947" "GAGTGGCTTCCTGGACTTGAGAGCATATTTATGTGTCTGCCACTCCCCAGGGTGGGGCTT" "31406" "1" "0.122563" "-1.7266825" "-4.32" "-0.16482134" "320946" "GTTAGCTAAACATTGATATTTCTGATGATAATAAAGACCCAGAACCTGAATTTGGGAACC" "21359" "1" "0.122567" "-1.7266562" "-4.32" "-0.17792931" "" "TTGGCTCAATAAAGATGCGCTTTGTGCATTTGCTTGCTTCAGAACAACAAGTAATCAGGC" "53315" "1" "0.122568" "1.7266521" "-4.32" "0.17623218" "17172" "CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA" "39601" "1" "0.122571" "-1.7266371" "-4.32" "-0.18003329" "56445" "AGAATTCATAGCCTGTATCTATCATTTAGATGCATAGAAAAATGGGCTTTGCACACAATG" "14507" "1" "0.122579" "-1.7265946" "-4.32" "-0.20119369" "71952" "TGGTTGTGCTTACCTTTAGGATTTTTTCAGTGTCGCAGACTTCAGGCTGGAGAAGAACCT" "8351" "1" "0.122594" "-1.7265129" "-4.32" "-0.16476683" "" "" "28894" "1" "0.122597" "-1.7264999" "-4.32" "-0.14542935" "360220" "ACGAACAGGAGGAGAACAGCAATCTTGAGACTCCAGAATATCAGGTCTCAGAAACTGCAA" "19156" "1" "0.12261" "-1.7264267" "-4.32" "-0.27531771" "329217" "TTTCAGGAAGACCTGCCTTTGCTTTTTCCTCTGCTGCTAATTTGAAGCAAGAGTCCTCTG" "13994" "1" "0.122643" "-1.7262516" "-4.32" "-0.18385294" "" "CCCGGTCTTCATCGTTTCCACTCGTGATTACCATCTTGGTTGCAAATGTCTTTATCTTCC" "20630" "1" "0.122647" "1.7262278" "-4.32" "0.71929282" "" "AATCTGTCCTATGCTGCAGGCTTTGCAGTTCTGCTTATAGTCCTGTGATCAGAGACACTT" "44435" "1" "0.122703" "-1.7259291" "-4.32" "-0.15654015" "" "GCCTATGAAAAGCTTCCAGAGCATGCTAAAATCAATGAAACTGATACATTTGGTTCTGGA" "52147" "1" "0.122712" "1.7258795" "-4.32" "0.2478186" "64293" "GAGACATTTTAATGTATGGTAAGGTTTTACACTTTTCAAATAACTGCATTGTACCACCCC" "23382" "1" "0.122751" "-1.7256697" "-4.32" "-0.18185615" "14167" "TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT" "62658" "1" "0.122838" "1.7252002" "-4.32" "0.27123911" "" "ACGTCGAAGAATATGTCTGGGCCTTTGGATATATGGGATTTGACCGTTCTGCGCATAGTA" "59162" "1" "0.122843" "-1.7251781" "-4.32" "-0.14453684" "23825" "GTGCTAAAGAAAGATGAAGACCTCTTCCGAGAATGGCTGAAGGATACATGTGGTGCCAAT" "39596" "1" "0.122872" "-1.7250194" "-4.32" "-0.29393532" "" "TTACAGATTTCCACTACCGATCTCACTTGATGTTCACTGGGTCCTGGTGACCTGAAACTT" "8491" "1" "0.122905" "-1.7248433" "-4.32" "-0.255772" "319586" "AAGTTTGCCGACACGGATAAAGAGCGGACATTGCGGCGTATGCAGCAGATGGTTGGCCAG" "55844" "1" "0.122923" "-1.7247467" "-4.32" "-0.18144587" "244334" "TTGGCCTTAGGCATAAGATTGGAACTTGTGGATCTCCTTTCAAATGCTGCAAGTGATAAT" "22660" "1" "0.122982" "-1.724428" "-4.32" "-0.33267006" "67972" "CAGATCCACGGATGCATTACGGAAAATACAGGAGAGCTATGGAGATGTCTATGGCATTTG" "30609" "1" "0.122993" "-1.7243719" "-4.32" "-0.22376661" "52626" "TGATGGGATTGAAGTGGAAGACCTGCCACAGTTTACAACCAGAAGCGAACTAATGAGAAA" "43417" "1" "0.122998" "1.7243445" "-4.32" "0.62578162" "56620" "GTCTTGCCCTGGTTTCTTTCTATGAACTGCTGTTACTTGAAAGTATAAGATGAATAAACA" "4869" "1" "0.122998" "1.7243423" "-4.32" "0.15478781" "497114" "ATCGTTGAGAGATCTGATATGCTATTGTAGAACAAGAGGCTGCAAAAGAAGAGAACGCCT" "53626" "1" "0.123013" "1.7242653" "-4.32" "0.19224201" "278676" "CAAGATGAGAAGACAATGTCGGATATGGAAAAAATGACCCAGTCAATAAGTGATACCATT" "19658" "1" "0.123014" "-1.7242591" "-4.32" "-0.22573288" "" "" "51069" "1" "0.123015" "-1.7242518" "-4.32" "-0.17305811" "" "" "5485" "1" "0.123043" "1.7241016" "-4.32" "0.14471657" "" "AAATAAATAAATTCAGAACCTGTCCCAGCGTTCTGGGTACCTCTTCTCTGCCAGTCTTCC" "41693" "1" "0.123073" "1.7239415" "-4.32" "0.22945319" "71709" "CTGTGTGGAATGGATATGTGGAACTCTTTCAGGGACCATAGAGTGGGATAGGATTTTCCA" "49246" "1" "0.123096" "-1.7238212" "-4.32" "-0.24500793" "" "" "1872" "1" "0.123121" "1.7236863" "-4.33" "0.67708373" "" "" "9274" "1" "0.123135" "1.7236099" "-4.33" "0.36149042" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "51719" "1" "0.123138" "1.723593" "-4.33" "0.38565214" "234582" "TTTCACCTATCACACCCCTGTGAAGGGGGAGCCTGTTGGATATGTATATTGTATATATGC" "23390" "1" "0.123207" "1.7232231" "-4.33" "0.15133154" "77296" "GAAGAAGCTGCATTGGCTGCACAGTCCAAGTCTAAATGATGCTTTAGGCTAAACTGTGTC" "12078" "1" "0.123227" "-1.7231196" "-4.33" "-0.20023033" "12447" "ATAAAAACACTTTTACAGCTTATTGGGATTTCAGCCTTATTTATTGCTTCAAAACTTGAG" "50829" "1" "0.123235" "1.7230765" "-4.33" "1.37223384" "20293" "CCTGAAGTTCCCCACGGGCAGTGTGATATTTATTATGATATCTAAAAAGAGATGTTTTTA" "8601" "1" "0.123257" "-1.7229592" "-4.33" "-0.16546648" "216134" "GTCTCCATCCCTGTGAAAAGCTGTAACGTCTGCCTTAGAGCCATGACTGAAACTCGACAT" "19569" "1" "0.12329" "-1.7227792" "-4.33" "-0.21604184" "" "GGAACAGACTCACGGCCAGCAGAGCAAGTTTTAACCATTTATATTTTTTAACATGAAACA" "60552" "1" "0.123293" "-1.7227639" "-4.33" "-0.2079234" "" "AGGAATGGTTTCTGCTATGCATCTCATGAAGAGGGAAGGCTCAGCTCCCTGCATAGCTAT" "54568" "1" "0.123356" "-1.7224274" "-4.33" "-0.16283502" "75339" "GAAAACGTTCAATGTTCTGCTTAGTTTATTTCCACAATGTGGAACAGTACGTGTAAGAAA" "2431" "1" "0.123357" "-1.7224229" "-4.33" "-0.18860118" "378937" "AGGAGCTCCGTGATGACCATGGACACGAGATGTTCGTCATTGACCGATCCAAGCCCCTGT" "53467" "1" "0.123357" "1.7224226" "-4.33" "0.17139117" "269630" "AAGTAGGGGATAGGCTCCCCACCCCCGCCCTTTAAATTCAGACCTTAGAATTAAAACATT" "56365" "1" "0.12337" "-1.7223522" "-4.33" "-0.13923522" "227210" "ATAAAAGATTTGCATCCTACAACTATGTGCATTCTATTTCTTCTCACATCTAACCTTGGG" "20861" "1" "0.123372" "-1.7223423" "-4.33" "-0.13836397" "277333" "TTTGTAAAGCTCATTTCCTGGCATGACAATGAATATGGCTACAGCAACAGCGTGGTGGAC" "36301" "1" "0.123376" "1.7223215" "-4.33" "0.65948326" "" "TCCTGACGTACAGTGTGAATAGTGTGTAGTGGTCCTGAAGGATGGTGTGAATAGTGTGTA" "41798" "1" "0.123391" "-1.7222391" "-4.33" "-0.24394865" "68870" "CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT" "5996" "1" "0.123403" "1.7221778" "-4.33" "0.37627422" "104086" "TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA" "25331" "1" "0.123408" "1.7221483" "-4.33" "0.15920127" "" "ATATGTCCACGTCTTAGTTTGTTTTCAGTTGCCATAACAATACACAGGCCATCAGGGAAC" "47290" "1" "0.123444" "1.7219602" "-4.33" "0.13574733" "" "TTCAACTTTCTTGCTAATTTCCCCACTGTGTTTTTTCTAGCAGTACGGGCAGTACGGGCA" "1361" "1" "0.123473" "-1.7218015" "-4.33" "-0.2092251" "245578" "TTCTCCAATCATAGAGGAACACCCCTTGTAAAGCCTATATGGATACTTCACATTTTAAAA" "60888" "1" "0.123487" "-1.7217291" "-4.33" "-0.21734416" "213012" "GCCATCTAGATACAACAAGGAAGGCTATTTCAGAATCCCGTACAGTTTCATTAAAGAAGC" "31697" "1" "0.123511" "-1.7216016" "-4.33" "-0.18340789" "70382" "GTCATAGCTAAAAGTGGTGGTGTGTTTGTGGTTGTCTCTTGAACATGCGCTGATAGGTGA" "40078" "1" "0.123524" "1.7215299" "-4.33" "0.19847921" "259081" "TTATTTATTCCATCAAAACTAAGGAGATTCGTCGAAGGCTTCACAAAATCCTGCTGGGGA" "31405" "1" "0.123545" "1.7214175" "-4.33" "0.37403557" "434017" "CTGGGTGGACTTCATCATCTCAACCATATCAGTTCTGTTGTGGAGGTATGACACAGTCAT" "49407" "1" "0.123553" "-1.7213784" "-4.33" "-0.2207516" "100038914" "CCTAGCACTCATACACGAGAAAAACATTATCAGGATGAATATGTTTCTGAAATGGATTGA" "45605" "1" "0.123597" "1.7211428" "-4.33" "0.17626087" "" "CCCTTAGCTTTGATTAAAATTAAGAGGTTTGTTCAGTGAACAACATGGAACAGCTGTTTT" "23754" "1" "0.123605" "-1.7211002" "-4.33" "-0.15791458" "" "GTACATCACGTTCTTACGAATCATTCTAACCAATGCACATTTATCAACATGAATGAGTGC" "58239" "1" "0.123629" "-1.7209706" "-4.33" "-0.34134124" "94281" "GAGGGGTATAGGAACACGTTTATCTCCTGTTTGGAAATCTTTGGCCCCTTAAAGAGCACT" "62945" "1" "0.123631" "-1.7209571" "-4.33" "-0.26409658" "75202" "ACTAAGGACGTTACGTACTTCCGTGATATGCCGGGGGCTCACGGGTACCTGGCACGAATA" "52576" "1" "0.123645" "1.7208853" "-4.33" "0.33291919" "640793" "ATATGAAAAAGGAAATTCCAAAGTACATCTCCGCATTTGCAAACACCCAGGGAGGCTATC" "43090" "1" "0.123741" "-1.7203721" "-4.33" "-0.15832996" "76123" "CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT" "12861" "1" "0.12376" "1.7202723" "-4.33" "0.60539782" "11890" "CATGGCTCTATGGTCTCATACCTTAGGAAGACTGAGAATCCCCCCTTCTGCACAATTTAT" "26185" "1" "0.123773" "1.7202017" "-4.33" "0.18679872" "" "CCTTGTAACTTACCTCTTGTGTAAGCTGAAGTATGAAAACAATCAGAAATGAGTGCTTTT" "33550" "1" "0.123799" "-1.7200631" "-4.33" "-0.18806612" "109910" "AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC" "41131" "1" "0.12381" "-1.7200067" "-4.33" "-0.22351028" "" "" "16115" "1" "0.123867" "-1.7197036" "-4.33" "-0.16019211" "28000" "GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT" "46557" "1" "0.123897" "-1.7195405" "-4.33" "-0.19507717" "" "GCCTCGGCCATGATGTCTGTATACAGCAGTAAAACCCTAAGACAATTATTATTATTATTA" "23636" "1" "0.123917" "-1.7194357" "-4.33" "-0.18377023" "17152" "ACATGCATCTGTTTCCTTAAAATCTGATCCAAACTTGTCAACTGCTTCAACGGCTAAGCA" "25580" "1" "0.123918" "1.7194312" "-4.33" "0.17980556" "22670" "AGTGGCTCCCTCACCACTCTTTGTTCTAGAGTTAATCATCTTCATTTCCTGTGTCTTTAT" "7176" "1" "0.123935" "1.7193415" "-4.33" "0.60034312" "" "AGGGGCCTTCTATGCTGAGCTTAATCATACCATCAGCAGCAACCTAGAGAAAATCGTCAA" "27774" "1" "0.12395" "1.7192605" "-4.33" "0.18525166" "100033459" "GCTGATGTGCCACCTAACTTCTCTGTTTTCTTCTGTAATATAAATCTGATATTCAGTTTG" "33354" "1" "0.123976" "1.7191193" "-4.33" "0.60161352" "" "TGCCTGATCTCGTCATGTCCCACGAGGAAAACCCTACTCAACTGCAGACTTCCGTGTGGC" "13223" "1" "0.123982" "1.7190917" "-4.33" "0.25725999" "" "TCAGGCCCACCCCCCCACGCGGGCGCAGGTCAAGTAAGCGGAGGCGCTGCAGGTGGTGCG" "34992" "1" "0.123997" "1.7190099" "-4.33" "0.16997587" "319513" "GGGCCGGGGTGTTCTTGTCCATTGCTGATATCAATAAAAGCATGGAAGGACAGAGTGACA" "31045" "1" "0.12401" "-1.7189398" "-4.33" "-0.20954851" "" "" "60533" "1" "0.124027" "-1.7188474" "-4.33" "-0.45216405" "100039954" "CATGATTTCTGGCATGGATGCTTCATCTAGTTTGAGTTGTTATTATGTATGTGTCCATAT" "29787" "1" "0.12403" "1.7188321" "-4.33" "0.48924553" "80879" "GTGGTCTGTTCACCCTGAGTCCCACCCTTTGTTAAATAACAAACTGCTGATTCTTAAAAA" "11633" "1" "0.124055" "-1.7187028" "-4.33" "-0.20334632" "" "GATTAAAAACCCTCTTTCTTCCTCAGGCCGGGACAAGTGCAATACTTTATATCTAACACA" "30795" "1" "0.124058" "-1.7186865" "-4.33" "-0.16152586" "" "GGAGAAAGATGTTCTGAATTGGATTGCCCTTCAATACAGAATGGAATCCCCTAGTTTTTT" "1072" "1" "0.12406" "1.7186725" "-4.33" "0.56410203" "" "ATTGTATGGGAGGAGAGCTGCTACTTAGACATAGGAGACTCTCTTCCTCTTTCTGTTCCT" "46035" "1" "0.124082" "-1.7185559" "-4.33" "-0.18194816" "20845" "TTGAAGTCTTAAGCCTTCACTGATATTTATTGCTCACCTCGGTGCTTTAAGGTGAGCGAG" "17819" "1" "0.124087" "-1.7185326" "-4.33" "-0.18686156" "229279" "CCCCAAATATCTGAACTCAAATTCGGAATGTCTTAAATAACCAAAGAAGAACACATGGTT" "3971" "1" "0.124105" "1.7184328" "-4.33" "0.53697297" "" "TTCTGGTCATTCTTCATCTCCTCACAACCAGGCACCTGAAGGGCTGCAATCCTTCACCAG" "27767" "1" "0.124119" "-1.7183618" "-4.33" "-0.25500224" "" "GGGAACTCACATGTTCAGAAAGAAGCAATATTAACACCCCTTCCCTTTTACTTCCCATAG" "3294" "1" "0.124132" "-1.7182913" "-4.33" "-0.15715936" "22764" "GACATTTTGCTGCATTTTACAACTTTTTAGGAGGTCAAAGTTAAGTTTGCCCTATGGATT" "36422" "1" "0.124157" "-1.7181605" "-4.33" "-0.19307057" "215090" "GCCATAATGCACACATATATCTTGACTGAGAAATCCTACTCTAAGGAAATAACTCAAAAG" "44971" "1" "0.124161" "-1.7181383" "-4.33" "-0.17799704" "74018" "CGAAATCAAATCACAGATACTTAGGCCTCTTCTCAGTTTAGAAAATTTGGGCACAGTGAC" "28121" "1" "0.12418" "1.7180361" "-4.33" "0.66316305" "" "TCCAAGCGTTCAATGCATCCACGTGGCGATTTAGATCTGCATACTGAAAATAAAGACCCG" "14527" "1" "0.124204" "1.7179114" "-4.33" "0.32453002" "224833" "CCTGGATGGTCCAGGGTTATATCAGTGAACTGGAATATATGTGTATATATTCTAATATGC" "8144" "1" "0.124218" "1.7178346" "-4.33" "0.42825097" "226527" "TGTACTGGGGTCGCTACCAACACCAGGACTTTGCAGTGTTTTCCAAGAGCATGTCCACAG" "51488" "1" "0.12423" "-1.7177711" "-4.33" "-0.30658903" "26414" "TCTACAAGGAGGTAATGAACTCAGAAGAGAAGACTAAGAATGGCGTAGTCAAAGGCCAGC" "18156" "1" "0.124242" "-1.7177068" "-4.33" "-0.14018657" "" "AAATCCTCTCTTAAGGCAGTTGAACACATGTTGGAGACATTGCAGATCACTCAGTCTTAA" "37839" "1" "0.12426" "-1.7176125" "-4.33" "-0.16802386" "" "GACAAACAGTTCAGTTTCTTCCTGTCTATAGAAGAGCAACTTTGGCTTTGTTTACAGGAA" "50563" "1" "0.124267" "1.717575" "-4.33" "0.13709225" "433078" "CTTCCTGAACAACCAAATACAGTAAAGAGAAAACCTAGGGAAAATTGTGATGATGTTCAT" "31994" "1" "0.124294" "1.7174327" "-4.33" "0.24699313" "12769" "CAGGCAAGAGGCACTTGCTGCAGGTTCTCCCATCTCTTTGCCAGTGACATGGCCTTTCCT" "1938" "1" "0.124296" "-1.7174225" "-4.33" "-0.19093589" "14000" "GAATGAAGTGTGCCCATTGAAATAAAACTCAAACCACACTGCGGTTGTTGTCTTAATGAT" "46229" "1" "0.124337" "-1.7172021" "-4.33" "-0.15139203" "" "GAAGACTACTTAAAATTGGGACTTATCCTGAAAACTTGTTATGATAAAGTGGATCAGGAG" "1215" "1" "0.12434" "1.7171855" "-4.33" "0.70942924" "16535" "AATTTCGTAGTATGATCTTGATTGAGAGACTTTTCCAAATAAAGTTGGGACGTCCCAGGT" "4184" "1" "0.124343" "-1.7171709" "-4.33" "-0.15631165" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "19725" "1" "0.124371" "1.7170239" "-4.33" "0.4292068" "209200" "GAAAGGGTTGGGCAAGGAGAGAGCTCGCTTACACAATACCAAGTTTGCCGACAACTTTAA" "39698" "1" "0.124372" "-1.7170192" "-4.33" "-0.14593167" "66146" "TGCATGTTGTCGCCATTTGCATTTTGAGTCATCTTGTGTAAATGTCACCATGAAAGTGTT" "54704" "1" "0.124383" "1.7169567" "-4.33" "0.7401801" "226652" "TGGGGCTACAGGCCACCATTTAGCAATGGTGGGTATTTGATAATAAAAGCTGAATTTTTT" "13807" "1" "0.124392" "-1.7169087" "-4.33" "-0.17514002" "75934" "TCTTTGCTGAACCATTGTATTGAACTTCTGAATTTATCGTTACGTCTGAGCAAAGCTTTG" "40886" "1" "0.124397" "1.7168837" "-4.33" "0.84528994" "" "GGACTCCCTGGTGGTGTGTGAAGTGGACCCGGAGCTAAAGGAAACATTGAGGAAATTCCG" "36358" "1" "0.124425" "-1.7167388" "-4.33" "-0.24643031" "76850" "AAAGCGGAAGTTAAGGTCATCATACTAATACTGCATCAACTCCAGGAATTAAAGGAAAGA" "58951" "1" "0.124463" "1.7165373" "-4.33" "1.09886429" "109032" "ATGGCAAAGTGCATGAATACTAGACAGTAAAAATAAAGCTGTTGGTGTCTCTGTGCGTTT" "30450" "1" "0.124487" "-1.7164049" "-4.33" "-0.28663731" "" "GTACTTTTGTGAGCACTAAATTTTTGTCTCTGTGGAACGTGTGGGAAACGGAGTGGTATG" "9177" "1" "0.12449" "1.7163906" "-4.33" "0.40375157" "229534" "CTTGAATGACCTTCACAGAAGAGAGCAACGCACTTGGCCCTGCACTGGTACCACTTTTGC" "39097" "1" "0.124511" "-1.7162819" "-4.33" "-0.28501873" "668727" "CAACATCTCTCCACTAACTTAGTTTTTCTACCCCTCCTGAATAAAAGCATTAATCAGAAA" "59" "1" "0.124541" "-1.7161237" "-4.33" "-0.19412226" "108946" "GTGTTTGTTTCTGTTTGGAATGAAAGCTTTCATATGCTTTCCAGAATGATGTGAGTTACA" "205" "1" "0.124545" "1.7160976" "-4.33" "0.8294462" "14130" "ACTTCTGTGAGTCCTGAAACCAACAGACACTACGAGATTGGTTCCCAATGGTTGACTGTA" "60800" "1" "0.124577" "-1.7159313" "-4.33" "-0.29422562" "63954" "TTGTCATTGGAAAGATGTCACACAGCCTGTATGAGAAACTGTTTGATTTCAGGACAGTTT" "50294" "1" "0.124586" "-1.7158843" "-4.33" "-0.27913027" "192164" "TGTGTTAGGCTCTGCAGAGGACACATGTCAGAGAGAAAGGCAGGTAGAACATTTGAAAGA" "34975" "1" "0.124603" "-1.7157903" "-4.33" "-0.27399524" "" "GGATTCCAAGCAGAATCTGAAGTCTACAGGTAAGAAAGGTTTTACTTTAGGTAACTGACC" "41943" "1" "0.124639" "1.7156036" "-4.33" "0.23300578" "106583" "GGAGACAGACAAAGCTATGACATTTTATGCAAGGACTGGCTGTAGATTCTTGAGGAGCAT" "9943" "1" "0.124641" "-1.7155903" "-4.33" "-0.24715123" "14687" "CGCGGTCTACATCCAACGTCAGTTCGAGGACCTCAACCGCAACAAGGAGACCAAGGAGAT" "22762" "1" "0.124671" "-1.7154316" "-4.33" "-0.33806811" "26361" "GACTTCTTGCAGTGATGGCGCATGACCTGTGAATTATAAGATGAAATAAATACTTTCCTC" "33608" "1" "0.124693" "-1.7153177" "-4.33" "-0.24743661" "238252" "GAAGAAGGGTACAGGACTAGAAACATGGATGCTTTTTTGCCTAGCCAAGGCCTAGGTTTT" "3264" "1" "0.124726" "1.7151413" "-4.33" "0.32520545" "" "AAACTCAAAACACACTTCTCATTATTCCAGTTTTTCATCTTGAACTTCATGTCATTTATG" "48939" "1" "0.124763" "-1.7149462" "-4.33" "-0.15742761" "" "ATCTCTCTGAGATGAGAAACCGAGAAAACAGAACCAAGCACCCAACAGTGCTTTTGTAGG" "51175" "1" "0.124773" "-1.714893" "-4.33" "-0.16089981" "378700" "TTCAGAAAGCACATAGCACCTTGGTTCAATCCCAGCTTTAATAAACTGATCCTTGGTCTT" "15906" "1" "0.124802" "1.7147398" "-4.33" "0.65178543" "272382" "CCATGTGGTCAAGGCTAAACTGTACTAAATAAAATTATTTCTCATCACCACTATACATGC" "32755" "1" "0.124827" "-1.7146078" "-4.33" "-0.17786987" "69684" "TGCTGAGGAGTGAGGGGCCAGGACGTCGTCCCTGTGACCAACAGTAAAATATTGTGACTC" "46642" "1" "0.124829" "-1.7145992" "-4.33" "-0.27949682" "" "TCATCCTCCTTTGCCACAGAACTGGAAATAAGAGATGTGAACAGTCAGTCCCCTTCTTCA" "23061" "1" "0.124879" "1.7143346" "-4.33" "0.20994107" "71664" "ACCCCAATACAGTACTTCTAAGGAGGGGTCAGGTAAAGCATGAGAGAGACTCTCAGCGCC" "5406" "1" "0.124893" "1.7142607" "-4.33" "0.85761025" "15163" "CCTAGAGGGGAGGCTCTCACAGGGCTGCCTGATTCGCCCTGTTGTGCTTTTGCTCATTTT" "791" "1" "0.124898" "1.7142339" "-4.33" "0.66550697" "" "TCCAAAATGCTGGATGAAGAAAGAAAAACACGAAGCATAGAAACCGTTTGTGGCGACGTT" "53414" "1" "0.124908" "1.7141793" "-4.33" "0.1977855" "" "GCTTTGCTGATAGGGTACTAAACCTTGGAAACAGTAAGCAAACCTAAATTAAATACTTTC" "23954" "1" "0.124918" "-1.7141275" "-4.33" "-0.14495162" "" "CCAAGTGAGAAGCCCTGTCTTGAAAGGAGAGAGCAGTACCCAAGGAATGACATCTCAGGT" "20313" "1" "0.124935" "-1.7140369" "-4.33" "-0.4349567" "" "TGTCAAGAAGCCTGACTCTCGCTAGACCACGCACAGCGCGATCAAGATTATGGGGTCCTC" "45431" "1" "0.124956" "-1.7139282" "-4.33" "-0.14091968" "" "ACTAGAGGGCACTGTTCAGTAGGGCTGTCCCAGACATTTGCTTCTGTGCAAGGAGAGATG" "43594" "1" "0.125002" "1.7136811" "-4.33" "0.19976441" "13808" "CTTTCACAGGAAAGACACAGGCCTTCAAGCCCTTCTCCCAGAAATAAACACTGCCAAACC" "31054" "1" "0.12504" "1.7134833" "-4.33" "0.29291574" "" "GGCAGGGTTTACACTGGACCTGGAAAGAAAACTCCAAACCCCAGAACTTTATAGTATGTG" "27186" "1" "0.125062" "-1.713366" "-4.33" "-0.22447905" "" "ACACACATACCACACATGCATTTTCTGTTTTATTGGCTATTCTCTGAAGGTCCTCCCCTT" "6968" "1" "0.125068" "-1.7133365" "-4.33" "-0.15076189" "269252" "CTTTGGAACACAGGTATTCTTCTGTGGGCTTAAAGAGGAGATGTGCACTGTCAATTGACT" "17682" "1" "0.125085" "-1.7132456" "-4.33" "-0.16127023" "245474" "TAAAATGGTATAGAACCTTCTGTGAGAGAAAAAATGTAATTGAACTATGTTCACTGGGGG" "56020" "1" "0.125105" "-1.71314" "-4.33" "-0.31747468" "14738" "GAAGCAATGACATCTTTTAGACACGTATTGACAGTGGAAATCATCTTACCAGTGTTTTTT" "19217" "1" "0.125111" "1.7131087" "-4.33" "0.26497525" "" "CATGGTCCCGCTTCACTTTGGGAACCTCCTTGTTCTTAGCCTTCTCATTGTTTCGAGGTC" "44362" "1" "0.125129" "1.7130129" "-4.33" "0.230586" "67861" "TCTTCACTGATATGCAACCCGCTCCTACTGACTCCTATTTTTGCCAAGCCTATTGGATAT" "24376" "1" "0.125142" "1.7129434" "-4.33" "0.22718068" "" "" "38837" "1" "0.125145" "-1.712928" "-4.33" "-0.20472101" "" "TTCTGTGTCTCCCTGACTAGAAGTCATGGGCGGAGTCACCTTTCCTTACTCTGTGGTGAT" "3880" "1" "0.125158" "1.7128593" "-4.33" "1.06780402" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "20185" "1" "0.125163" "-1.7128325" "-4.33" "-0.14186123" "11614" "GAGTGTGGTACTAGGCTAACAAGCTAATTTCATAAAAATAACATCTCTTTCCATTAACCC" "20797" "1" "0.125209" "-1.7125901" "-4.33" "-0.17444156" "" "ATGAAATTTCCATGAAGAATTTAGAGTACTCTGTTCCATGAGGAACAGTGGGGCTTCGTG" "31930" "1" "0.125211" "-1.7125817" "-4.33" "-0.36380677" "74782" "CACTGTTCTTTAAGAGCAACTCTTCTGATATATATGACCTATGGTGTAAGAGACAAATAC" "61984" "1" "0.125222" "-1.7125226" "-4.33" "-0.14892531" "70357" "TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA" "502" "1" "0.125223" "1.712516" "-4.33" "0.27183314" "" "TCTGGTATGACGCTGGGCGCCTGTGGGAGAAAGACAAAAAATAGAAGTTGTTCGAGTTAA" "10752" "1" "0.125239" "-1.7124344" "-4.33" "-0.14524926" "70357" "TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA" "54330" "1" "0.125258" "-1.712331" "-4.33" "-0.49520566" "109264" "TTTTGTAAAATCTCTGATCTACACTCCAGACTATGACTCCTTCTCACTAGACACCTACAG" "33731" "1" "0.125265" "-1.7122977" "-4.33" "-0.20139469" "53323" "GCTCATAGGTTTGGAATGTTTTGTCCGAGTTCTTCACTTTGTAAGTAGTAATGTAAAAAG" "29692" "1" "0.125266" "1.7122906" "-4.33" "0.42080244" "74760" "CTATTTCCTTCCAATGGAATGTAACGCGATCTCTATTTAATAAAGGAAGGCTTTGTTGGT" "62220" "1" "0.125272" "-1.7122588" "-4.33" "-0.26179401" "" "TTGTGCTCTGAGAAAGCCACCTTCTAACCTTTATAGCTATGTTGGGTCACACAGACACTT" "9817" "1" "0.125275" "-1.7122436" "-4.33" "-0.21285295" "" "TGCTGAGGCTTGCAGATCTGCATTGAAGAATAAAAACTCCAATGCATGGCTTGGCATTTC" "53519" "1" "0.125287" "-1.7121818" "-4.33" "-0.15690852" "14265" "TGAGCGTCTACGATCTGTTAATCCCAACAAACCTGCTACAAAAGATACTTTCCATAAGAT" "27783" "1" "0.125292" "-1.7121534" "-4.33" "-0.20398299" "" "GATATTCAGAGGGTGTTGAGTGCTCCATCTAGTCTTTAACTTACCATTGTGCCATTAGTC" "2967" "1" "0.125296" "-1.7121309" "-4.33" "-0.24989061" "230779" "AGAGACCCGGAAGATGATCAGCACTTGGACCTCAGTGTGGGTGAAGATCTGTGCCAGCTG" "29769" "1" "0.12537" "1.7117429" "-4.33" "0.2324024" "20908" "ATCGCCATGCTGGTGGAAAATCAGGGGGAGATGTTAGATAACATAGAGTTGAATGTCATG" "2054" "1" "0.125387" "-1.7116542" "-4.33" "-0.2697704" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "23683" "1" "0.12545" "1.7113229" "-4.33" "0.15160601" "15353" "CTGCGCCTTTCATCACTCAATCTGGACTTTTAAATAAGTGTTGAATAAAAACAAATGGGT" "24943" "1" "0.125458" "-1.7112774" "-4.33" "-0.16403426" "" "AGTTCTTCCATCATCAAGTTCACTACTACCTCCTCAAGAAGAAAGAGCTCCAATCACTGA" "19660" "1" "0.125471" "-1.7112081" "-4.33" "-0.15465084" "" "AGGCCAAGCACTGTGAACACGCTGGCTTCACTGTTTGGTTTTGTATTCAATTCTTGGAAT" "29237" "1" "0.125486" "1.7111338" "-4.33" "0.23694468" "" "CATGAGTGGCAAATGGTCTTTATGTGGTCCCAATTCATTTAAAAAATAAAGCTGGCTTTC" "10964" "1" "0.12552" "-1.7109526" "-4.33" "-0.43699005" "" "AGACTGGGTAGTAATACAAGGTTGTTTCAAGAGCACTGATGCCTGTCTAACTTTAAACCT" "20031" "1" "0.125531" "-1.7108941" "-4.33" "-0.186161" "16504" "TGAGGACTCCTAATATTGCCAAAGGATTCAACTTATTTAACAACCCCTATTATCCCCGCC" "18697" "1" "0.125533" "1.7108845" "-4.33" "0.34145078" "68612" "ACCTGCAAGAAACCTATTCAAAGCAGGTCTCCAGCCAAGATCCCTGATGCAAGCTGGCCG" "61735" "1" "0.125545" "1.7108223" "-4.33" "0.26718463" "73341" "CCTTTCAGTTTCCCCTCTGTTATGTCCCTTCTTATAGGAGCTCAGATTTTCTAAACTTGT" "119" "1" "0.125549" "1.7107991" "-4.33" "0.44122105" "101883" "ACTTGGCTGAGTCAGAGTTTGCTGGGGCTTACTACTCCATCAATAAAGTTTCCCTTGAAG" "45096" "1" "0.125559" "-1.7107455" "-4.33" "-0.19226171" "" "GTTCTCAACAATAACGTTGTAAAGCCTATTTCCTGGTATGACAATGAATGCAGCTACAGC" "38967" "1" "0.125567" "1.7107029" "-4.33" "0.25015328" "" "AAGTGGCCAGTGCCTGCTGCCTACTGATTCTGCCATAATTGTCTACCTTGGTCATAAATT" "34401" "1" "0.125618" "-1.7104399" "-4.33" "-0.20055051" "" "GTTCCTTTCCCTGGCCACCATGTAGCAATAAACAAGGCTATATGTTTAATAATAAACAAT" "29972" "1" "0.125646" "-1.7102913" "-4.33" "-0.18572161" "" "CCCTGTCTCGAAAAAACCAAAAACCAAAACAAACAAACTTTTAAGTAGCTGCAGTGAATA" "3538" "1" "0.125649" "-1.7102758" "-4.33" "-0.48485042" "18983" "GTGCATTGTGCAAATTGTTCAACAGGAATAACAGAAAAAGACAAGGAACTACTGAAGAGC" "46959" "1" "0.12566" "1.7102156" "-4.33" "0.16359435" "" "AATATGCATGACTACAGAAAAGACTGCACTTAGGAGCAGTAACATGGCTCTGCCTTCCTG" "16637" "1" "0.125736" "-1.7098178" "-4.33" "-0.14272999" "259098" "TACTTAATGGTGCCACCAGTGCTCAACCCAATCATCTATAGTGTGAAGACCAAGCAGATC" "62492" "1" "0.125737" "1.7098109" "-4.33" "0.26148836" "140709" "TCTCCACCAGGAGGTGATCAGAGACCTGTGATGTTATTTCAAATAAAGGTGCTCTCTCCA" "23055" "1" "0.125744" "1.7097754" "-4.33" "0.37509769" "" "TTCCCAAGTGTGCTATGAAGAAAATGGCCAAGGACCTCCCTCCAAGAGAAAAGATAAACC" "260" "1" "0.125773" "-1.7096214" "-4.33" "-0.19029988" "" "TGATCTGACAGCTATTTGTGATGCATCGGAAGCCTGCATAAATGCCCTTCTAGGAAATGA" "1783" "1" "0.125809" "-1.7094319" "-4.33" "-0.26389342" "50781" "GCCTGTAAATCGCATCTGAAGATACCACAGTAAAGAGATGTAAACATTTAGGAAAACAAT" "57284" "1" "0.12582" "1.7093768" "-4.33" "0.4222578" "240754" "TATGGGGATGTTGGGGATAAAAAGGCACATAGCACTTAGAGTGGAAGCATGACGTGATAG" "61259" "1" "0.125822" "-1.7093668" "-4.33" "-0.15372182" "75291" "AATTTGCACTTGGTCCTAAAAATTAACATCTGGGGAGCATGAACTGATGCCAGGCCTGCT" "24779" "1" "0.125828" "-1.7093324" "-4.33" "-0.1585972" "" "ACATGGAGGCAGTATGAGGCCCAAGAATGGCTACCAGGCCTTCACTGCCTTCTTGGTGGT" "1269" "1" "0.125841" "1.7092653" "-4.33" "0.53642889" "77647" "TGGATGCCAACGTTTCTCAGATCAATATGGTAGAAAGTTTCCCACCAGATAACCAGGTAG" "30622" "1" "0.125852" "1.709208" "-4.33" "0.17029088" "" "ACTACTTGCGCCACGAAGCAAGCTACACGATGACTACTCGCGTCGTACTAGCAGCAGCGT" "53889" "1" "0.125864" "-1.7091464" "-4.33" "-0.2194866" "207785" "CTCCAACTTTCTTAGCCCTTAGATTTGGATTTTCATTAAGAAACGTAAAGACTAGCCAAC" "52517" "1" "0.125871" "-1.7091072" "-4.33" "-0.22859404" "68910" "ATCCACACAGAACAAGCTGAAGCTCCTTGTATGGGCAGCCAGGCCAGTACCCCACAGAAG" "50798" "1" "0.125886" "1.7090315" "-4.33" "0.87427485" "11513" "ACACTTCCTGACAAAGTGATTGTTACTGTGTACTTCATAGATGACAGGTCAATGCTCCGA" "40064" "1" "0.125904" "1.7089348" "-4.33" "0.18705865" "12505" "ACAGATTTCTTCGACCCAATCTCACATCCAATGGGACAAGGTCATCAAACAGAAAGCAAG" "43757" "1" "0.125951" "-1.7086879" "-4.33" "-0.16806957" "" "TCAACAAGAAATAGCACAAAGGGGTAGAAGAGACAGAGGTGGAGAAAGTGCAGGTTCTGA" "13845" "1" "0.125951" "-1.7086871" "-4.33" "-0.19306453" "13728" "GTTTGTTTTTGATTTATGACAATTCCACTCTTGGCCCCAGTTGTCGTCCTGTCACTCCCT" "37211" "1" "0.125962" "-1.7086324" "-4.33" "-0.17940013" "218952" "GTGGTTGGGTGTGAATAGGAAAACTTGTAATAAAACTCCACAGCCATAACAATATTTAAC" "48465" "1" "0.12598" "-1.7085384" "-4.33" "-0.19851323" "277562" "CTGAATCCAGCCATCTACACACTGAGAAATAAAGATATTAAAAATGCCATAAAGAAGCTG" "50709" "1" "0.125981" "-1.7085342" "-4.33" "-0.24807687" "" "GGAAAGCAAAGCTCATCAGGGTCTACTTGCCTTTCTGTTTTGGTCTAGATAAAAATAAAG" "25787" "1" "0.125998" "1.7084419" "-4.33" "0.35149831" "73673" "CGCATGGACTGTCTTCTGTTTGGAACAACAATAAAGAACAAGAGCCGAATGTTTCGTGTC" "25410" "1" "0.126064" "-1.7080974" "-4.33" "-0.23471597" "" "TTTCTCTGTGTGTTGCCTACACCCAGGGACATCGTGCACAACCACAGCACAGCCTCTCAG" "1478" "1" "0.126065" "1.7080943" "-4.33" "0.48316216" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "53738" "1" "0.126077" "1.7080269" "-4.33" "0.21434354" "14762" "CTCACTAAGAGTCAGCCATTACCTTTACACTTGACACTGGGACTTGCAGTGGTGACTATT" "52954" "1" "0.126079" "1.7080171" "-4.33" "0.20493177" "" "TGATCTACCAGGCTTTCTGTGGTAACAATGCAGCAGTGATATTAAATGGCACTCGTGGTT" "34071" "1" "0.126082" "-1.7080015" "-4.33" "-0.21414842" "66780" "CTGGGACAATTACCTTCATTGCTTGTATTATACAGACATCAGCCAGCTATGACTAGACAT" "24432" "1" "0.126098" "-1.707917" "-4.33" "-0.13868667" "227522" "AGTTTAGAGACTGAACCCTCGGAAAGCCAGGACAACGAGATTTTGGACACGTCATTTGAT" "1048" "1" "0.126112" "1.7078442" "-4.33" "0.48441085" "56523" "AAGTTATGCTTTGCTGAGTTTTGTCTACCTCCTGAAGTAGAGTTGTAAGACCCCACTCCC" "34758" "1" "0.126152" "-1.7076361" "-4.33" "-0.17253378" "57776" "CTCTAAATATGCTGCCCAGAGACTGTGAATCACCAGCTATGTGAAAATAATAATAAACAA" "61040" "1" "0.126159" "-1.7076" "-4.33" "-0.17248932" "" "CTTCCAGCCAGAGCCTTTACATGAGTCTTTCAAAATATTTCCAGAATCCTATTTTCATGT" "56828" "1" "0.126162" "-1.7075853" "-4.33" "-0.21472785" "72899" "TCTCCACCCCACAAGAAGAGCAAAGCAAAGAAACCAGAAAGTTCTAAAGACTCCAGTGAA" "19053" "1" "0.126167" "1.7075568" "-4.33" "0.42850768" "" "GGGTTTAGGGGCCAGGCACCGGCGGATTAGGGCACAGCAATCTGGGGAGACATGAGCAGG" "6246" "1" "0.126172" "1.7075331" "-4.33" "0.69410626" "74735" "AATTTACCTCAAAGGTTACACAATTGATTTTCCCGGTGCTTGGTCTAGAACCAGTGGCCT" "20106" "1" "0.126189" "1.7074399" "-4.33" "0.18157605" "57014" "GAAGGCAAAAATCAAGCCAAATGGCTCAACGGTATCTTGAAAAGTACAAAATAGATGATG" "31749" "1" "0.126217" "1.7072961" "-4.33" "0.42295825" "18439" "TTCACTTCTCTCTTTAAAGGGAACCATCTTCTAAACTCTTCCTAATTTCGTGTAAGGGTT" "36544" "1" "0.126226" "-1.7072478" "-4.33" "-0.1675809" "74069" "CTGGTCTCAGACCTGCATAGGAACACATCCATGGCACTAGTGAATTTCCTCAACTTTCAA" "35120" "1" "0.126235" "-1.7072006" "-4.33" "-0.1779657" "" "AAATACGAAAGCCAACAACTGTATCTTCGTATCTTCGTCTTTGTTGGCTTTCGTATTTAA" "46801" "1" "0.126246" "-1.7071459" "-4.33" "-0.19144358" "14419" "TGTTGATGTGCCCCTGCCTGAGAGCAACATTGTCCGCACTATAATGGAGTTTCTCAGTTT" "22185" "1" "0.126263" "-1.7070551" "-4.33" "-0.14432609" "" "GAAAAGTGGACATAACTGTGAACTTTAGGATCACTGGACAGTTGAATAGTGAGACATTGC" "30635" "1" "0.126274" "-1.7069972" "-4.33" "-0.23539558" "432450" "CCTCTAGGCTTTAATGCTCTCATATTGTAACAATAAAGAACCCTCAATTTAGCAGGAGAC" "59728" "1" "0.126282" "1.7069566" "-4.33" "0.14182393" "" "GTACGCCTACACTCCCATTCATGTGCACACATATATACACACATACATATAATTTAAACA" "59542" "1" "0.126288" "-1.7069259" "-4.33" "-0.16234819" "" "AGTATCTTAAACCTGCACCCTGCAGGCTTAAATCCCAGATAAACTCAAGGAAGTCCTGCT" "4801" "1" "0.126305" "-1.7068351" "-4.33" "-0.14859743" "" "CCCTGAAAGGGACCTATGTCCGCAAGAGTCCCAAGGTCCATCAGGAAAATCAAGACCTAT" "20271" "1" "0.126346" "1.7066193" "-4.33" "0.33598633" "328795" "GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC" "13952" "1" "0.126352" "-1.706589" "-4.33" "-0.13297283" "30947" "AGGATACAGCCGTTTGCGTCCTGGATCAGAAACCCACCCGACTACCACCAATTTAAATGA" "33940" "1" "0.126355" "-1.7065746" "-4.33" "-0.14115473" "258466" "GAAGTCAAAAGGGTTATGAAGAAGCTCTGGGGTCGAATGAGGAAAGCTGGTGACATGTAA" "3555" "1" "0.126358" "-1.7065565" "-4.33" "-0.18542519" "22718" "ACTACTGTTAATTGCATAAGCTTAATTCACCAAACACAATTCAGCTCACTTAGGAAGAAC" "53516" "1" "0.126362" "1.7065385" "-4.33" "0.41890693" "" "ATTGCATAAAGCATGTGACTTCTTGCCTAATGGGTGTGTAGAAGTTAAGAAAAATGTCAC" "59696" "1" "0.126371" "1.7064929" "-4.33" "0.42402725" "50930" "TTAGAACAGATTGTGCCAGGCCTGTTGGATTCCTGGAGTTGATGGGATCGTGGGAAGGCA" "37851" "1" "0.126378" "-1.7064563" "-4.33" "-0.24501134" "64661" "GCTACAATAATTACCCTACCGCAACAGAGGGCCTTAACAATGAGTTCCTGAACTTTAAGA" "13523" "1" "0.126409" "-1.7062901" "-4.33" "-0.1421954" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "2847" "1" "0.126468" "1.705983" "-4.33" "0.16933153" "" "CTTGCAGAATATATGACTCTGAGTTAACCACAGCCAGCATCAGAATTCTTTCAGCAGCAC" "12251" "1" "0.12649" "-1.7058712" "-4.33" "-0.15374518" "235047" "CAGTATCTGACTGGACTGGCAATTTGAGTGAGAATGGTCCTCATAGACCAACATGGACTT" "15373" "1" "0.126527" "1.7056745" "-4.33" "0.33194261" "12182" "GAATAAAAGAAAATAACCCCAAGGAGAGTGCAGTTCTCTCTGAATAGGGACTTCACAGCT" "3289" "1" "0.126535" "-1.7056329" "-4.33" "-0.19626788" "258498" "CTTGACCTCTTTAACCTTTCAATTAGTCTACTGTGCATCCAACCAAGTGGACTATTTCTT" "48068" "1" "0.126545" "1.7055797" "-4.33" "0.15914463" "12663" "TAATATGAGAGATTCCTCAGGAGTGAGCCGAAGCTCATACTGTGGCTTACCTTCCAATGT" "62558" "1" "0.126562" "-1.7054925" "-4.33" "-0.3052064" "329514" "CATCTTGGGGATAAATGAGAAAAGAAAGGTTCTAATTAAAAAGTGATAAGTTGGGCCTTG" "1956" "1" "0.126575" "1.7054224" "-4.33" "0.1769158" "70461" "CGGCCTTTTGTTAAGCAATATTGAAAGATCGGACTTTGTATAAAGTAGCTTCCAAGTTTT" "16442" "1" "0.126576" "-1.7054176" "-4.33" "-0.18427401" "68597" "TGTGGACAACAGCAGCCCAGCACAGAGCCACATGAGCAGTAAAAATATGTTTAATGATCC" "57729" "1" "0.126637" "1.7050998" "-4.33" "0.34758461" "" "CATCTCTTGCAGATCTAGTCAGAGCCTTGTACACAGTAATGGAAACACCTATTTACATTG" "61684" "1" "0.126716" "-1.7046905" "-4.33" "-0.22818139" "432591" "TTGTTTGTCATCTGTGGCACAATAAGGCACTTCTATTTCAAACGGACATATCTACTGCAT" "44582" "1" "0.126725" "-1.7046398" "-4.33" "-0.27418797" "68870" "CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT" "52580" "1" "0.126732" "-1.7046047" "-4.33" "-0.19861542" "" "GTAAACACACACAGAGCGCATGCATAGATGTATGCATCATATAGATAACATACACATAAA" "30730" "1" "0.126742" "-1.7045543" "-4.33" "-0.22085988" "14687" "TCATCTGCCCGTCACACCAGCCCACGTTTGAGCATCCCTCGTTGTGACCATTCTGTTTGG" "12339" "1" "0.126784" "1.704334" "-4.33" "0.1627902" "228796" "AAGACGCTGCCAACTGCCTTCATCCGCCGTTGTTCTGAACCAGCAGAGGAGTCCAGATGT" "4470" "1" "0.126813" "-1.7041816" "-4.33" "-0.23803847" "207686" "TGTCCTTCTTTTCAGTACGTTAGACAGCATTTGGTGCTGCATTTTGGGATGTTATGATTC" "46457" "1" "0.12684" "-1.7040428" "-4.33" "-0.16532851" "" "CCCATTACACTGTGTGGCAGGAGGGGTAACAATAAAGCAATAGGCGATTTGCAAAAATCA" "61707" "1" "0.12684" "1.7040411" "-4.33" "0.63238834" "100041107" "ACCTCCACATTTGTCCTTTATCCTCAGTTGCAACCACTGCTTACTGGAGACTTTTCATGA" "57646" "1" "0.126862" "-1.7039267" "-4.33" "-0.18107559" "" "GCACCTAAGATATTTCAGTGCACTCTGATGGTGCAAAGGTTTTAAAAATAAAGCCTATAT" "8898" "1" "0.126865" "1.7039152" "-4.33" "0.43727135" "22323" "TGCCATGGTCACACCCACGCTGGCTGCTGATTGGATAAGGAGGTCCCACCCCTTTGTTTT" "41073" "1" "0.126866" "-1.7039061" "-4.33" "-0.18299082" "20926" "TATGGATGAGAACCAGGGGAAGGGCATCCGAGTCCTAGGCATTGCTTTCTCCTCTGCCAG" "7700" "1" "0.126873" "1.7038704" "-4.33" "0.21703908" "19114" "CCATGTTTTGTGGTTCAATTTGTAAGACTTTCCCCTAATATACAAGTCACATGTATTCAC" "3348" "1" "0.126911" "-1.7036745" "-4.33" "-0.16043283" "65106" "CTATCACTTGGGCACCTGTTTGATGTGCAGTGGAAACTGGGTCAGCCAGTTGTTTATATT" "32405" "1" "0.12693" "-1.7035752" "-4.33" "-0.15977424" "16562" "TTGTTTTTGAGACAGAGCCTCTCTGTATAGCCCTAGCTGACCTGGAATCTGCTATGTAGA" "38872" "1" "0.12695" "-1.7034699" "-4.33" "-0.20792329" "" "CTCCTTGGAAGTGCCAAAATCTGAGATCTTCACCACATCGTCGTATGTGATTAGCATGCT" "55055" "1" "0.126983" "1.7032987" "-4.33" "0.30394156" "228413" "AAAGATTTGCTTGTTCAGCTTCTTATGACACATTGCAAGGAATAAAGGAATGATGCATAC" "3327" "1" "0.126986" "-1.7032845" "-4.33" "-0.36070259" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "61795" "1" "0.126994" "-1.7032395" "-4.33" "-0.20246425" "17156" "CCTGCACTGGTTATTTTTGTTGTTGATACTGCTCTATATTTTGGCAGAAAAAAGGGTAAA" "2320" "1" "0.127031" "1.7030485" "-4.34" "0.7881372" "381175" "GAAAAAATTGCGTTTAGAAAGCAAACTGTTCCAGCTTAAATCCAACGCTGCAAATCCAAA" "32205" "1" "0.127041" "1.7029967" "-4.34" "0.66637948" "" "" "55085" "1" "0.127041" "-1.7029942" "-4.34" "-0.13747173" "22630" "TAGATTGAATGAGAAAGCGCTTAATGCATCTGGGCTTGGGGTCACAGATCGAAATGTCTC" "16815" "1" "0.12705" "-1.7029498" "-4.34" "-0.14319049" "" "ATTTACTGCCTATTGTTACATTCTGGATATCCTGGTACAGGGGAACAGGGACAACAGGCA" "14559" "1" "0.127066" "-1.7028667" "-4.34" "-0.19879478" "" "TGAGTCAGGAGCAGGCAGTTTTGGCTTTGTCTGTTTTCTGTTCTGTTCTCAGAAGGACAA" "45054" "1" "0.127068" "1.7028588" "-4.34" "0.24304381" "17387" "GGACAGCGAGTACCCTAAAAACATCAAAGTCTGGGAAGGAATCCCTGAATCTCCCAGGGG" "22449" "1" "0.12708" "-1.7027914" "-4.34" "-0.32943098" "" "" "49544" "1" "0.127102" "-1.7026809" "-4.34" "-0.18414495" "12928" "GAATGATGAAGAAGATCTTCCCTTTAAGAAAGGAGACATCCTGAGAATCCGGGATAAGCC" "1873" "1" "0.12714" "-1.7024827" "-4.34" "-0.15122147" "320632" "GGAGTGGAGAGTGTTTTTGACATCATGGAGATGGAGGATGAAGAACGGAATCCATTGCTT" "44487" "1" "0.127151" "-1.7024249" "-4.34" "-0.16528134" "" "ATTTTGTAAAACTTTCTCAGACTCTTCAGGTGAGGTGTTTGGGGAACCACCATGGCCCTT" "44092" "1" "0.127158" "1.7023908" "-4.34" "1.39439571" "270152" "AAAGCATCCAGTTTGGTCCGCTCTTCAGTCAGATCCAAGTAATGTGGTTGAAAAGAAAAA" "22950" "1" "0.12716" "-1.7023759" "-4.34" "-0.1670439" "" "" "1177" "1" "0.127172" "-1.7023166" "-4.34" "-0.20657319" "216227" "TTGGATTTTCCCATACCAAAGGAGTGGCTATCTCCTTCCTGGTGCTTGCTGTAGGATTTA" "21607" "1" "0.127237" "-1.701979" "-4.34" "-0.17205739" "70122" "GCAGCCAGTGTGGTACTCATTTCTTCTTAAAAACAAAACAAAAACAGGACTCAGAATTTT" "62390" "1" "0.127249" "-1.7019145" "-4.34" "-0.2227006" "71770" "TGTAGTTCCCAAAAGAAGATGTGTCAGGGCAAGCAGAAAGGGAAGTTTAGGCCAGAATGT" "61174" "1" "0.127268" "-1.7018164" "-4.34" "-0.16025665" "224585" "TGGCACTGCCCAAAGTGGTCTATGTCCTCATATATCAGTAATTAATAAAGAAAATACTTG" "233" "1" "0.12729" "1.7017022" "-4.34" "0.40517329" "16952" "TGACATGAATGAAATCAAAGTATTTTACCAGAAGAAGTATGGAATCTCTCTTTGCCAAGC" "5511" "1" "0.127355" "-1.7013629" "-4.34" "-0.30306667" "16528" "GGTTGCCAAATGCCACCGCTCTTCCCTGGCTGGTTCTTCACATCCAATCATTTCCAAAGC" "19256" "1" "0.127356" "-1.7013575" "-4.34" "-0.2422157" "100038538" "TCCTCTTACAGCTATAGTAAGGCTGTCACTTGCTTCAGAACAATCATTCTTGAAATATTT" "1986" "1" "0.127387" "-1.7011968" "-4.34" "-0.27112009" "" "GTTGCATAGCTAACTATGAACTACCTGCAGTACAATTATTTCAAGCCAGTAGGTTTTAAT" "57298" "1" "0.12739" "1.7011854" "-4.34" "0.17011333" "" "CCAGTCCCAATGTCCATAAAGAGTCATGTTACATAGAAGTCTATCTAGAATTGATTTTGT" "8623" "1" "0.127393" "-1.7011676" "-4.34" "-0.22687584" "" "TCACAGCAACAAAGAAGGAAGCAATGCTATTAAAAGGAGTAAGGACTGTTTTGGATTAGA" "48790" "1" "0.127412" "1.7010713" "-4.34" "0.68182097" "101602" "ATGGCCTATCGAGAACTGAGTTTGTTCCAATATGGGAATGAAGATTTTTTCCCAGAGAAA" "19841" "1" "0.127431" "-1.70097" "-4.34" "-0.15415136" "217057" "GTTGGGGTGCTAGGCTCATATAGTACACTGTATACTTGTATGAAAATTTCAGCAAATAAA" "8606" "1" "0.127437" "1.7009377" "-4.34" "0.22320369" "" "GAGACAGGATCCCTTTAAATTCCCAGACAGTTTCTGACTAAAAGAAAAATATCTGACAAT" "34916" "1" "0.127448" "-1.7008845" "-4.34" "-0.20233309" "" "GAGATGATGTCTTCTGTAGGGACAGAAGTTATTTAGTTATGGTGCAACCATATGAAAATT" "39950" "1" "0.127489" "-1.7006707" "-4.34" "-0.18468867" "224630" "AGTCCTTTATATTGTGAAAAAGCGCCTCTTTCCATTTTTGTAAGCGAGAGCTGCCAGCTT" "33137" "1" "0.127496" "-1.7006315" "-4.34" "-0.21576866" "" "TTCTCCAAAGAGCAGTAGTCTATCTGAGTGGCTTGGACTTCTTAGTGGGCATGGTAAAGT" "47784" "1" "0.127508" "-1.7005728" "-4.34" "-0.17932005" "" "GCCGACCTCCACTTAGCAACGAATCAACACACACGTGAAGAAGCAGGCAAATGGCCATAA" "12779" "1" "0.12752" "-1.7005078" "-4.34" "-0.30824748" "17122" "AGCCACCCACAATCTGTTCTCAGATTCCTAATCATTCCAGAAGTATTAAATATCATTTCT" "17937" "1" "0.127544" "-1.700384" "-4.34" "-0.2288447" "76602" "GCAAGAGTCGGGCTTAATGTATATAAAGCTTGCCTATTTATTATTATTACTGTGTCCTAG" "62342" "1" "0.127568" "1.7002582" "-4.34" "0.27418304" "18784" "AGATACACAAATGGCCTAGTCATCTGCGAACACGACTCCTTCTGTCCAATGAGGCTCTGT" "57090" "1" "0.12757" "1.7002522" "-4.34" "0.17781376" "69770" "CTGTAAGGGACAAGAGCATCCTCTGATAAGGTGTGATGGAGCAGGGGGCCTGAGGATCTC" "55414" "1" "0.127581" "-1.7001915" "-4.34" "-0.18533919" "232855" "CTCATCAAAGAAGAACATGGATCAAGATGAGGATTAGTGCCATCTTATTCCTAAGAAGTT" "40068" "1" "0.127585" "-1.7001739" "-4.34" "-0.20755345" "100040320" "AGGATATTGCTGCCTACAGAGCTAAAGGAAAACCTGATGCAGAGAAAAAGGGGTGGTCAT" "61260" "1" "0.127611" "-1.7000389" "-4.34" "-0.16542507" "" "ATGTCAACTTCATGCTCAATGACTTTCATCCATGTGCTGTAGGATGAGCTGCTGGTCTCA" "8965" "1" "0.127627" "-1.6999537" "-4.34" "-0.1992791" "53324" "CATCTGGTGCCAAAAGTTCATTTGCAGCTTCTACAACAATCCCCACAAAAGATGAACAGC" "52679" "1" "0.127629" "-1.6999461" "-4.34" "-0.18504197" "" "" "11211" "1" "0.127631" "1.6999357" "-4.34" "0.39917891" "83453" "CACAGGACATGTACCCAAATATGGTACTTATTTATGTAGTCACTGTGTTTCTGGAATTTT" "1903" "1" "0.12764" "-1.6998896" "-4.34" "-0.1477112" "74252" "TCTTCATGAACGATATTTGACATGTGCTTTGGTACCCTTCTCTGAAAGTTGAAAACCTAC" "19845" "1" "0.127659" "-1.6997914" "-4.34" "-0.85197465" "68695" "GACACAGATACTACCCTGGATGAGGTAGAGCTGCACTTTGGAGCACAGGTTCGACGCTTG" "11593" "1" "0.12766" "1.6997862" "-4.34" "0.29319648" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "37713" "1" "0.127691" "-1.699625" "-4.34" "-0.17311315" "" "TTGTTGTTAACGAACGTAACTGTGTATAGCATACCCATGTACATCCCAGTATTCCTCACA" "22983" "1" "0.127691" "1.6996241" "-4.34" "0.30113175" "" "ACCAGGAGGTGATCAGAGACCTGTGATGTTATTTCAAATAAAGGTGCTCTCTCCACTGTG" "31257" "1" "0.127702" "-1.6995669" "-4.34" "-0.22142252" "270163" "TACCTGTATACAATCAAGATGGAGGGGCTACAGGCAAAGGAAGAAGTACAAAGAACAAAG" "31672" "1" "0.12772" "-1.6994757" "-4.34" "-0.13002891" "71834" "TGAGCAGAATACAACTGAGGCTAACTAAAAATAGGGTCTGGCCCTTGAGTGGCATGCATA" "2446" "1" "0.127729" "-1.6994246" "-4.34" "-0.24451775" "329165" "TATTTAAGTAGCCTTTTGTTGAACAAGCTTAGTTGACTAATAAGACGTTTGGAAACCCAG" "44170" "1" "0.127754" "-1.699296" "-4.34" "-0.15282533" "216821" "GGAAGTCTGACTGAGCAGTGGAGTATGGATAGGAGCCAATGCTACTTTCTGAGGGGTGTG" "46298" "1" "0.127756" "-1.6992884" "-4.34" "-0.29930134" "" "TCCTAGCTGCATCCACTTCCATTTTATGACTCAATTTACTGTGTTTAAAATTACACCACA" "48121" "1" "0.127768" "1.6992268" "-4.34" "0.22471495" "" "" "34016" "1" "0.127798" "-1.699069" "-4.34" "-0.23897913" "213208" "TCCCTCACCCCAGGGACTTCATTCCTCTGTTACCTAAGCTCAGAATAAAGAATTACCCCG" "36082" "1" "0.127802" "-1.6990509" "-4.34" "-0.21107673" "" "TAGAAAACAAATGTGGTAGCTCGGCTTACAATACCTGGTCTGCAGTCAGTAGTGGAGAGT" "26878" "1" "0.127808" "1.69902" "-4.34" "0.29867356" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "13573" "1" "0.127811" "-1.6990006" "-4.34" "-0.37814959" "27220" "AAACGCATTCCGATCTACGAGAAGAAGTACGGCCAAGTCCCCATGTGTGACGCTGGAGAG" "24172" "1" "0.127831" "1.6988973" "-4.34" "0.20699883" "" "" "20181" "1" "0.127857" "-1.6987623" "-4.34" "-0.18059735" "" "AACATGACAGATGCCGCTGTGTCCTTTGACAAGATGGCAGTAGCACCCATCGAGTGGGTC" "37485" "1" "0.12786" "-1.6987496" "-4.34" "-0.20845967" "" "TCAGCAATGGTAGAGATGGAACCTGCTGGGAGGTGGACCACACCCCACCCCTATCCACCC" "4447" "1" "0.127886" "-1.6986159" "-4.34" "-0.15644693" "268395" "CATGGGTCAGTGTGGTAGACAGAGTGGCTGAACAGATGGATCAGCCTCAGCAAACAGCCT" "60584" "1" "0.127943" "-1.6983215" "-4.34" "-0.17016577" "" "ATATCTGCCCCAGGGTAAAAAAGACAGTAAGTTGGAAAAGACTAGATGGTTGAAAGCAAG" "11834" "1" "0.127982" "1.6981206" "-4.34" "0.20035624" "14792" "TGCCTCTTCACATGGGACAAATGGCTTAAGGTGTACAGATCCATCTATTTCCTTGGACAT" "13339" "1" "0.12799" "1.6980768" "-4.34" "0.31093976" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "49916" "1" "0.127992" "-1.698065" "-4.34" "-0.15232411" "629557" "AAAGCTCATATCCTGGTATGACAATGAATACAGCTACAGCAGCAGGGTGGTGGACTTCAT" "24411" "1" "0.128015" "-1.6979472" "-4.34" "-0.24296634" "67750" "CTAGTAAGGCCAATAAAGGAAAGAAAGCCAAAGCTAAGAAGTAGGAGGCTGGTGACTACC" "30778" "1" "0.128015" "-1.6979471" "-4.34" "-0.21889397" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "3147" "1" "0.128022" "-1.6979142" "-4.34" "-0.2563948" "12570" "GGCTACTTAAGGACAAATGATAAAGAGACAGAAGTCTCCCTTTCTGTGAGGTGACCCTTG" "59147" "1" "0.128068" "-1.6976746" "-4.34" "-0.16366977" "105377" "TTAAGAGTGAGAAATATAAAAACTGTACACATCTTATAGCTGAACGACTGTGCAAGAGTG" "20604" "1" "0.128084" "-1.6975904" "-4.34" "-0.1696957" "" "TCTTGTTTGCTCTCTATTTTGAACAGTTCCTTGTTATGAAAGCAAGACAGGACTGGAAGA" "45681" "1" "0.128131" "-1.697347" "-4.34" "-0.1998599" "" "GAGTGAGTAGTGTCAGCCTGCTGTGAAGTTAACAGAAATACTTCAATTTTATTTTCAGTA" "49063" "1" "0.128154" "-1.6972328" "-4.34" "-0.19100715" "21408" "GTAATTATAGGCATCTAAGTGCACAGAGGAGTGCGCTGGACTTCTCAGTAGCAAAACACT" "58322" "1" "0.128157" "-1.6972132" "-4.34" "-0.16459894" "79263" "TGCCCACTTAGCTGCTGAGGTGGAGGGCAAGTGCTTACAGTCAGGCTTCGAGATGCTTAA" "20901" "1" "0.128164" "1.6971781" "-4.34" "0.16622709" "" "TGAAAAAAGAGCAGAGCACTGTGATAGCAAAGTGGAGCACTGTGACTGCAAAGTGGAACA" "7952" "1" "0.128188" "1.6970576" "-4.34" "0.31987764" "101100" "GCTGCGAGGCTAGAGAAACCACTGCTCTGATCTTCACTGGCCTATTCTGGATCCAGCATC" "57565" "1" "0.128195" "-1.6970204" "-4.34" "-0.25317343" "" "AGTTGTATGCGTTAACTGTGGATTTAGTTCAACCAAACTCGGGTCCACCAAATGGGGAGT" "53009" "1" "0.128201" "-1.6969873" "-4.34" "-0.23627293" "16531" "TGGGTGGGCAGTCAATGTATACATGTAAATTCAAAAGTCCTGTGAGTGGAAGTATTTTTT" "56259" "1" "0.128215" "1.6969136" "-4.34" "0.57896163" "15950" "CACAATTGCTTTCTGATCTGTACTGACAGTTTGCATCTAATAAAGTTTCACTGGTTCTAT" "28467" "1" "0.128228" "-1.69685" "-4.34" "-0.20189673" "" "ATAGTTTAAGGAGTGAGCCACGGAAGCACATGATAAAACCAAGACACAACCGCTTCAGAA" "55975" "1" "0.12823" "-1.6968367" "-4.34" "-0.38184361" "67972" "ACTAGCTGCATTGTAAAGAAACAAATCGAAACTGAGTCTTTTCACATATTGTGACGGACA" "1698" "1" "0.128235" "-1.6968152" "-4.34" "-0.15476241" "30795" "CGGACATCAGCAAACATAAAAATGAGCTGTGGCTAATTAGAGCTTGTAAGGGAAGAGTCA" "62797" "1" "0.128245" "1.6967617" "-4.34" "0.71522272" "107607" "CTCAAAGCAAAGCATGGCACATACCCACCACCATACCATGGTGCGCATGGGATGGGACAG" "23035" "1" "0.12827" "-1.6966301" "-4.34" "-0.14712244" "26912" "TCAGCCCAGATCAGAGGCTGTGACTCAACCCAGACTTCTAGAGCCTGGTTGAAAATGGGC" "62068" "1" "0.128289" "1.6965352" "-4.34" "0.33271524" "" "AGTCAGGTATTGCTTCAACCTGATTTACTGTCTGTCTACCACTTCCACATAATAGAGCTT" "51358" "1" "0.128301" "-1.6964746" "-4.34" "-0.1739352" "" "CAGAAGTCCCATTCAGTTTCTCTTAAGGCATTTGATATGTCATAGTTTTTGATCATGGAA" "11155" "1" "0.128309" "-1.696433" "-4.34" "-0.17663319" "20918" "GTGCCATGTGAAGGAACAAGCTGGTCTTTTGGTTTTCTTTCCCCCTCCAGTTTCAATGTT" "436" "1" "0.12832" "-1.6963768" "-4.34" "-0.27149384" "" "ATGAATAAGCCCTTTGTCCTCAAGAATTTCATTCAGAGAAAATCGTAAAAATCACCCCTA" "45299" "1" "0.128327" "-1.6963406" "-4.34" "-0.22651989" "" "TTTATGATCCTTTTCTGGGTGAGGACTCGCTGAGTGCAACTCTTATCTCAAAGCACTGCT" "29362" "1" "0.128341" "-1.6962687" "-4.34" "-0.17479154" "333050" "CTGACCCCCTCCTACTAAGCATCTTAAAGTTTCTCTTTTCTCTTTAATTGCATCAGGACC" "33482" "1" "0.128352" "-1.6962109" "-4.34" "-0.15635421" "" "AAGATTAAAGTGGGCACTATTTCACCCCGTTTTATGAAAAACTGGGGGACCAAAGCCCCA" "10267" "1" "0.128354" "-1.6961976" "-4.34" "-0.20384498" "" "TAGGTTGGAGAAAGTATTACCATTCAGGAAGGCTATGGGGAGGAGATTTAAGTAGAGAGA" "30781" "1" "0.128375" "-1.6960922" "-4.34" "-0.19731756" "664883" "ACCCAGCCCACTCCCAAAACAGTAAATGTATCTATTTCTGTGGAAATCATTTCTCATTGA" "46476" "1" "0.128396" "1.6959851" "-4.34" "1.00164818" "63986" "CCTTTGAGCCAGGGATTTGGAATCCTTACTTCTGAAGGCTCAGATTGATAGGATATGAAC" "39852" "1" "0.128396" "-1.6959818" "-4.34" "-0.13744602" "" "TCCTGTGAGGTATTAGCAATCAAGCTGTATTTCCTCAGTGGTCTGTCTTCAGGCACAAAG" "55293" "1" "0.128399" "-1.6959687" "-4.34" "-0.1413606" "18717" "ATTCCAGCAGTGAATGGGCGCGGGGAGCGACTGCTCCTCCACATCGGGATCATTGATATT" "28644" "1" "0.128429" "-1.6958113" "-4.34" "-0.12936925" "" "AGGTTACAAATTTCTAGCAGGCGACCAAAAGCTTCTGAGTCTCACCCTCTCCATTTGTGA" "7893" "1" "0.128432" "-1.6957955" "-4.34" "-0.25105071" "70369" "GTTTTAATGGGGTGGGGTTTTTGTTTGGATGGTCTGTTTTATCATAAACATTTTTGCTTG" "29046" "1" "0.128472" "-1.6955911" "-4.34" "-0.33899812" "209448" "GGAAAGAAAGGGGGATAATCAAACAGAGAGGGTCTGTAACCTTGTAGAGCACAGTTAGCA" "31903" "1" "0.128474" "-1.6955813" "-4.34" "-0.16175427" "75602" "CCACGAATAGTGACGGTGTTTACAGCATGTATATTTTCAATATCTCATGAATACTAACAG" "23678" "1" "0.128494" "-1.6954796" "-4.34" "-0.20105453" "28077" "ACATAACTGTTTTCATGGGTTTCAACTAGACATAATAAAGTCCAAAGTTTTACATTGCTC" "39848" "1" "0.128507" "-1.6954129" "-4.34" "-0.31459418" "14810" "TTTGCAAAACCAAAAAGACACAGTGCTGCCGCGACGCGCTATTGAGAGGGAGGAGGGCCA" "27223" "1" "0.128564" "-1.6951197" "-4.34" "-0.14770472" "" "AGGGAACAGAGGTTCAAAACAAAATGCTCTCTTGAGAATGAAGTGCTTGGCTTGCTGCTA" "49190" "1" "0.128589" "-1.6949885" "-4.34" "-0.26405753" "20621" "CCTTTTTAAGTGTATACCAGAGCCGTACACTCCAATGGTTAGTAAGTCATAACTTCTCTT" "16879" "1" "0.128591" "-1.6949792" "-4.34" "-0.18674992" "" "CCCTACTGATGAGGAGCAGGCTACTGGGCTGGAGAGGGAGATCATGATAGCAGCACAGAA" "23899" "1" "0.128659" "1.6946315" "-4.34" "1.18100051" "654818" "GTATGTAACAATGTTGAGATAGTCCTGGTTATAGTCGTTTGGTTTTTAACGCAAAGACAA" "25" "1" "0.128675" "-1.6945496" "-4.34" "-0.14550564" "NA" "GGTGGGAAATATTTGCTGGGAAGTATCTCTTCAGAGCCAAGCCACTTGTCTTGGTTTTTT" "21773" "1" "0.128678" "-1.6945338" "-4.34" "-0.17593111" "13489" "ATCCTGAATATACACTGTGACTGCAACATCCCACCAGTCCTCTACAGCGCCTTCACATGG" "37861" "1" "0.128688" "-1.6944814" "-4.34" "-0.2175875" "20641" "GGGTTTGATTTCTTTGAGTCCATTATTTGGGCCTCTTTTGAGATGAAATAAATTCTTGGC" "59644" "1" "0.128709" "1.6943718" "-4.34" "0.23176765" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "11678" "1" "0.128725" "1.6942919" "-4.34" "0.47682698" "" "GGCCTGGTTAGGAAATATTAGGTGTCATGTGCTACTTTGTTAACACAGGAAAATAAATTT" "28584" "1" "0.128725" "-1.6942918" "-4.34" "-0.28280585" "73728" "CCTTCTTTGGTGGGCCCTACCCTTTGTACAGCCTCCACCCTCATTAAAACTGCTCTGAAT" "3030" "1" "0.128728" "-1.6942777" "-4.34" "-0.30562113" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "6087" "1" "0.128732" "-1.6942558" "-4.34" "-0.21478349" "269152" "ATGACCCAGAATGATGGATTAAGTGCCTTGCAAATCTTTATGATTATCCAAACATTGTGT" "1992" "1" "0.128747" "1.6941774" "-4.34" "0.24088376" "319579" "GTAGAAGGCTACTGTAGGAAGAAATGCAGATTAGTGGAGATATCTGAGATGGGATGCCTG" "23092" "1" "0.128769" "-1.6940654" "-4.34" "-0.15268933" "226090" "GCCTCCTACCTTTAAAGGTTATCTGATCACTTGTGTAATTCACTTCTCAAAAGATAGTTT" "8925" "1" "0.128819" "1.6938078" "-4.34" "0.25977257" "56516" "GAAGAGCTTTACTTTTGCTCACGTGAACCTTTCTTTTTTAAATAAAACACAAAAGCCTCC" "45182" "1" "0.128882" "-1.6934854" "-4.34" "-0.19088678" "" "TTTCAGAGAGGGAGCCTGGCAACAGACGCGCATCCTGTTAACCAGTGGCTTTCCTTTGGG" "5327" "1" "0.128889" "1.6934477" "-4.34" "0.77646215" "" "CAAGAACATCATCATGGAATGTTTTCTTTAAGCTGACCAGTTTGCTGGAATAATCTACTT" "28075" "1" "0.128889" "1.6934467" "-4.34" "0.95280591" "21928" "AGCTCTTCTCGGCACTGGCCCAGCCTTGACTTGTCATGATTCGAGGCTGGGATTTGAAGC" "59679" "1" "0.128902" "-1.6933804" "-4.34" "-0.17516565" "74487" "ACTTGGCGTTTTCTGAGACGAAAGGCAGCGGAGTGTGTAGCAAAGGTGGCGCTGGCTCTT" "61841" "1" "0.128905" "-1.6933644" "-4.34" "-0.22608186" "239102" "TTTGGTCCTCAGTTACAGGGGGCATACTTCCAACAGCTTTACGGCATGAAGAAGGGGCTA" "52213" "1" "0.128909" "-1.6933441" "-4.34" "-0.16768454" "209003" "AACAAACAAACATGATCCGTTGTATCTGGGAAAATATTTAGTATTGACCAGAGTATGTGC" "27849" "1" "0.128934" "-1.6932195" "-4.34" "-0.13452343" "" "CATGGAGAGGGGACTGTGACTTGCTCTGAGAGTTTGACTTTGGGCTACCCAGGGACCTAG" "37344" "1" "0.128953" "-1.6931186" "-4.34" "-0.17980016" "228139" "ATTTGCTTCCCTGGGTCCCAAGCATCCATCCATTTCCAAAGGATAGAGAAAATGGTAGCT" "2345" "1" "0.128968" "-1.6930439" "-4.34" "-0.19812563" "56224" "TTGGAGCTGATGATTGGAACCTAAATATTTACTTCAATTGCACAGATTCCAATGCAAGCC" "29784" "1" "0.128969" "1.6930373" "-4.34" "0.17837898" "110829" "TTGGAGCTGAAGAAAAGACTTAAGAAACTATCTGAGACCTTAGGAAGGAAATAACTTTTG" "3271" "1" "0.128982" "-1.692971" "-4.34" "-0.19854531" "100502936" "GGTTCACTCCTCCACAGAAAGATGGGTAAATAGTAGAGCATCATGTATTTGGTATTTGTA" "5960" "1" "0.128991" "1.6929259" "-4.34" "0.20117605" "" "TGTAGGGTGAATGGAAATGGCCACCACAGGGGCTGGTTGAAGGCTTGTGGCACTATGGAG" "56875" "1" "0.128998" "1.6928879" "-4.34" "0.28528519" "" "CATTTCATCTTTCTCATCATAAAATGTGTTTTCACTTGATGTGATCACTTCTCAGAGTGA" "47286" "1" "0.129006" "-1.6928469" "-4.34" "-0.22756512" "" "TGCCTACAGAGCTATAGAAAACATGATGCAGCGAAAAAGGAGGTGGTCAAGGCTGAAAAG" "20728" "1" "0.129012" "1.6928198" "-4.34" "0.20818143" "" "CTCAGTAAATAACCCTTACTGACAGTTTACTTCTCCTTGGGTGGAGAAGGCAAAGAAGGT" "44926" "1" "0.12902" "1.6927779" "-4.34" "0.399535" "219103" "TGGCCGAGTTAGAGTGAAGGACAAAGACGGTAATGTGCTAATGGACACAGAAATGTGAAG" "19340" "1" "0.129057" "-1.6925857" "-4.34" "-0.22560831" "" "TGTGCCTCTGAAAAGTTCTCTTCAACTTCGGATCCTGCCATCAACAGCTCTGTTTATCTG" "61532" "1" "0.129058" "1.6925794" "-4.34" "0.51466973" "" "ATCTTCTGGAATCACAAGATCACGTTCAAGGACCCTAAGTTCGGCGAAATGGGACTTAGA" "1788" "1" "0.129067" "1.692535" "-4.34" "0.74031247" "" "CAAAGAATCCCATAAGCAATTTTCTACACATTGGTCCAACCCTGGGATAGGAACAGCAGA" "22459" "1" "0.129099" "1.69237" "-4.34" "0.29745503" "72690" "CCTCTCTAGATTCTAAATATGAGCAGCGATGGACTTGGGGTGAGAGATGAACGAACTACT" "26339" "1" "0.129109" "1.6923188" "-4.34" "0.29657777" "" "TTAAAAGCATAAGGAAAAAGTAGGAGAAAACGTGAGGCTGTCTGTGGATGGTCGAGGCTG" "48096" "1" "0.12913" "1.6922151" "-4.34" "0.42037368" "" "CTGGCCTTCCGGGTCTGAAATCACATGCTCTTTAGTTGGGAAGGAGACAGACAGTGTCTC" "26613" "1" "0.129159" "1.692062" "-4.34" "0.35924922" "16773" "CCCGACTACCTAATAAAGATAGTTCAATCCTGAGGAGAATTCATCAAAACAAGTATATCA" "43390" "1" "0.129165" "1.6920336" "-4.34" "0.34714599" "18111" "TGGATATATTCAACCAGTAATTGAATCCCACCTTTACCAAAACACGTTCTCTAACCCCCG" "2341" "1" "0.129174" "1.6919896" "-4.34" "0.16900564" "75015" "AAGATGAAGACCTTTTCTCAGGAGACTGTTTGTTCTCAGGTCCCATTACTGGGTCCAGAA" "21047" "1" "0.129195" "-1.6918791" "-4.34" "-0.19001061" "72123" "GAGTTTCAAGCTTATGACTGTTAATGTAAGGATTTGTATGGCTTTGAATTTCATGAGCTC" "11445" "1" "0.129205" "-1.6918303" "-4.34" "-0.15310781" "" "GGATCCTGCAGCTATAACGACTTCAGCGAGTCAAGGAACAATCAGTCTGCTTTCTTATAG" "20819" "1" "0.129205" "-1.6918267" "-4.34" "-0.19875552" "" "GGAAATAATAAAATTTGTTTTTCAGGTGGGGATAATATATGGGCGTTAAACAACATCGCC" "54292" "1" "0.129219" "-1.6917582" "-4.34" "-0.19729944" "" "CAGTGTTCCTGATTTGGTGAGACAGAATAGACTCTTATCATGACCTATAATTATACCTAT" "3094" "1" "0.129244" "1.69163" "-4.34" "1.25437455" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "15927" "1" "0.129263" "-1.6915322" "-4.34" "-0.15175425" "71268" "CTCAAGGATGTCATTGAAGAGCAGGAGGAGCAGATGGCAGAGTTTTATAGAGAGAACGAA" "5767" "1" "0.129263" "-1.691532" "-4.34" "-0.22655131" "" "GTGCAGCCTTTTCTGATTTTGTTGTATACCACTTTTACATAAACTGGAATCTCTCCCTCC" "33808" "1" "0.12927" "-1.691498" "-4.34" "-0.29385507" "" "" "13912" "1" "0.129271" "-1.6914912" "-4.34" "-0.19214616" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "40292" "1" "0.129275" "-1.6914712" "-4.34" "-0.16838395" "17758" "GCCATTACCCATGTCTGTAATTGTTGTACTGATTTAAACAATAAAGCTGCCTGACATCCC" "7766" "1" "0.129275" "1.6914709" "-4.34" "0.8855848" "12481" "TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG" "17949" "1" "0.12928" "1.6914451" "-4.34" "0.22397967" "18127" "GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA" "46780" "1" "0.129296" "-1.6913613" "-4.34" "-0.23890585" "14860" "GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA" "2486" "1" "0.1293" "1.6913406" "-4.34" "1.07363705" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "48109" "1" "0.129304" "1.691321" "-4.34" "0.63649591" "21926" "TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG" "51353" "1" "0.129308" "-1.6912987" "-4.34" "-0.1763699" "74252" "GGTGTTCAAGGACTCTCAGAGATCTCAAGGCAACTATAATGGCAGTTTTTGAAATATATT" "31235" "1" "0.129322" "-1.6912301" "-4.34" "-0.1383289" "20656" "GGCTGGTTTATAGTAGTGTAGAGCATTGCAGCACTATGACTGGGGTGCTGTAGTCTTTAT" "4615" "1" "0.129342" "-1.6911294" "-4.34" "-0.19365264" "" "AGTACCCCCCATAGAACGGGTATTTAATTTACAGAACAAATGATCTTATGGGAGATGACA" "59918" "1" "0.129356" "-1.6910573" "-4.34" "-0.17853405" "98985" "TTCCAAGGACTTCCGGCGGGAATGTAGAGATGAACGAATCCGTGAGTATTTCTATGGATT" "22115" "1" "0.129404" "-1.6908122" "-4.34" "-0.17571268" "54364" "TGTGGATTTAGTCTGTATAACTGTAACAGAGAAATTACCATTTTACTTCAAAAGACCCCC" "44769" "1" "0.129417" "-1.6907449" "-4.34" "-0.20571086" "" "AGACGGAAATCCGGGGACAGCATCCAACAGCACGTGAAGATCACCCCAGTGATTGGCCAA" "3199" "1" "0.129421" "-1.6907209" "-4.34" "-0.22096332" "380664" "CATGTAAGAGGGTGCACATGTACTTACATTGGCTTTTGTATATATGTATAAATGCTGATG" "37218" "1" "0.129433" "-1.6906619" "-4.34" "-0.18194985" "67542" "TCGTGGGTTTATTGATGCTCTTACAAGAGAAGGGCCAGGAGGTACACCTAGGCCCATTGA" "52352" "1" "0.129438" "-1.6906381" "-4.34" "-0.21447297" "" "ACAGAATTCCAACTCTTCCCTTGGAAAAGGAAGGTTCAGAACAGGACATCCTCATTAAAG" "23592" "1" "0.129443" "-1.6906098" "-4.34" "-0.13269332" "69638" "TCCTCCCACTGTTTGTTGGGTAATAAATGGAACTATGGCTTGCCCCGAGATTTCTTTTTT" "42679" "1" "0.129443" "1.6906091" "-4.34" "0.63468379" "434794" "GTCTAGTGCAGGGAGACTATAGTCATGGCTTCCAAAATCAAGGGCAGACCTCCCAAGCAA" "48249" "1" "0.129473" "1.690459" "-4.34" "1.68645713" "" "GGTGCTTTCACCTCAGGTACCTGCAGTTCGCCTATGATGGCCTTGATTACATTGCCCTGA" "62659" "1" "0.129478" "1.6904305" "-4.34" "0.37548908" "" "CAAGTACTCATGAACATGGTACTAAACCTGACACCCACGTAAATGATGCAGTATAATATC" "37933" "1" "0.129503" "-1.6903059" "-4.34" "-0.18070437" "" "TTCATCGGTTCCATCCGTGAAGTTCCCAGTGACGTCAATGGGCTTCCAGATGGGGACCAC" "52944" "1" "0.129512" "-1.6902572" "-4.34" "-0.14946473" "54170" "CACTGGTTTGCATTCTTAGGGAAGAGAGCTTTGAACGAAAAGGGTTGATAGACTACAACT" "16949" "1" "0.129519" "-1.6902218" "-4.34" "-1.37284721" "66898" "GCTTATCAGATTCTCAGATCTCACCGAGAAATTATCCCCAAATTGGTCCGGGTCTATGTA" "36948" "1" "0.129546" "1.6900863" "-4.34" "0.18041802" "" "AAACAAGTACCCAAAACTCATCTGATATCGGAAGAGGAGTGGAGGAGACTTGGTGTCTGA" "11971" "1" "0.129584" "-1.6898883" "-4.34" "-0.13519799" "670940" "TCTATCACAGCACCAAAGGCAAGACTATGGTTGCCGTGGAAGTTTTCTCTATTTTGGCGT" "23231" "1" "0.129611" "-1.6897508" "-4.34" "-0.27756004" "21885" "CAGAAACAACATCAAGAAACCTGAAGAAACCTGTTTCCAAATCTTGACACAGAACTGCTT" "5812" "1" "0.129634" "1.6896338" "-4.34" "0.18167118" "" "" "37421" "1" "0.129674" "-1.6894329" "-4.34" "-0.17112563" "" "TTGAGACACCCATGGATGCCACACAATAACCATTAGTATCCCAGCCAGGAAAAGAAAGAG" "55793" "1" "0.129684" "1.6893792" "-4.34" "0.33632293" "69748" "AAGTGCTTGGAACGTTTCTCTCAGATTTCCCATGGCTTCTAATAAACTGAGTGACTTTAA" "52363" "1" "0.129689" "1.6893549" "-4.34" "0.50482395" "76633" "GGAAGACTATAAGAGATACAGGTGCTTTGTTCTGCACAAGCTGCCCAAGTTGAAGTTTCT" "29823" "1" "0.129695" "-1.6893228" "-4.34" "-0.18797178" "258533" "TATACACTGAGAAACAAGGATGTAAAGGGCGCACTGAAGAGGCTTGTGACTACGAAATAA" "27182" "1" "0.129726" "1.6891635" "-4.34" "0.28717366" "" "GGCAGTTTGTTCAAGATAAAACAGTTGAACCATGGTGAACCCAACTCTTCCCTTTCACCC" "56347" "1" "0.129734" "-1.6891264" "-4.34" "-0.19752073" "78255" "GCACTAATTTCAGGGAATGAAGTGAGATGTTCCCAGAGAAAAACGATGGAGTTGCAAAGC" "50203" "1" "0.129784" "-1.6888688" "-4.34" "-0.15406975" "" "ACTTCATCAAGCCATTTTTCTTTAATGATGGGCAGCGAGGTCGCTACAATTTCATTTTTT" "41328" "1" "0.129787" "-1.6888552" "-4.34" "-0.26431994" "" "AAAGAAAGTTCCCAGGCTAACTCATGCACAGGAGGTACACTGTCATCTTATAGGTAGGGT" "28283" "1" "0.129814" "-1.6887174" "-4.34" "-0.16414544" "223648" "CAGTTGGAGGAGGCAGAAAACGCTGAAGACGACACAGAAACTGTCTTGGAGCAAGCCTGA" "42884" "1" "0.129819" "-1.688689" "-4.34" "-0.1662044" "75504" "GAAAAATGATGGTGGCTTCTTCTCCACCTAGTGGTGACAACCAGGCTAATTTCAACATGG" "3578" "1" "0.129829" "-1.6886404" "-4.34" "-0.16595586" "212772" "GTGGTCAGAAAGGTACCTGTTAAATGTTACTAACGAAACAAATGCTCTTCAGACTACTTT" "23299" "1" "0.129848" "-1.6885454" "-4.34" "-0.23030184" "" "" "550" "1" "0.129865" "-1.6884549" "-4.34" "-0.2077388" "" "ATTCAAATAATTCCACATTCCCAAGAATATCTGGACTGGAGCATGTCCAACTGCCCGCAG" "58689" "1" "0.129878" "-1.688392" "-4.34" "-0.14096864" "72167" "GACAGAGAACAGCTGGTTAAGATTTTGAAAAGACTTGATGTAAAAAACTACTTCTTCCCA" "61286" "1" "0.129882" "-1.688372" "-4.34" "-0.24768641" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "19870" "1" "0.129882" "1.6883718" "-4.34" "0.40956994" "" "ATAATGACAAGGTACACCCTGTATCCCAGCAGTGGTTGTTTAACACCATGAGCTTGGTGT" "35952" "1" "0.129904" "-1.6882603" "-4.34" "-0.17027475" "" "TTTCATCTCTAAAGAACAATCTCAGGGTGTGGCACATGGTCCCCTGAGCTACATTGTCTA" "22731" "1" "0.12995" "1.688024" "-4.34" "0.88101529" "11629" "GAGCTTCTGATGACAGCAGCATGGAAAAAAGAAACAGTCGTGAGCCAGAGTCAGACTAAA" "55364" "1" "0.129954" "1.6880031" "-4.34" "0.18442951" "" "" "3737" "1" "0.129967" "-1.6879366" "-4.34" "-0.24497939" "20646" "CAAGATGGGAGAATCTTCATTGGCACCTTCAAGGCTTTTGACAAGCATATGAATTTGATC" "29809" "1" "0.12997" "-1.6879194" "-4.34" "-0.20671634" "16392" "CCCCCAAAGATGTGTATAGTTATTGGTTAAAATGACTGTTTTCGCTCTTTCTGGAAATAA" "27438" "1" "0.129987" "-1.6878338" "-4.34" "-0.16784221" "232314" "GTGTTATGTTTCCTGGAAACTCACCAAACTATACTGACAGGTCTAATATAAACGGGCCTG" "2664" "1" "0.129987" "1.6878327" "-4.34" "0.23614292" "" "GAGTTTAATCAATATCCCAAAGAAAGTGGGATCATGAAAGTATTAAGGGCAACAATGATG" "39654" "1" "0.129992" "-1.6878108" "-4.34" "-0.15523448" "" "GCGTCCTGTCCTCGCGATCAGAAAGTTTCCCGGGTTTCCCGGGGCCCAGCCGGCTCCCCG" "46732" "1" "0.130003" "-1.6877522" "-4.34" "-0.22974899" "11928" "AAAGGAAAACCTGGAAAGACTGAAAGATTACGTTTTATATCTGGATTTTTACAAATAAAG" "25629" "1" "0.130017" "-1.6876802" "-4.34" "-0.20243081" "69399" "GTTGAATCCATCTGTCCAATGAAAACACATGTGTTGAAAGAGGAAACATCATTAGAGTAT" "45143" "1" "0.130022" "1.6876561" "-4.34" "0.59961175" "12306" "GTCTGTGACATGAGACACTTCCTCTTATGTACTGTGTCGTGAATAAACCGTTTTTACTTT" "209" "1" "0.130028" "1.687624" "-4.34" "0.888713" "" "" "55383" "1" "0.13008" "1.6873625" "-4.34" "0.21714812" "29818" "GGCCTAGGTAGACTGCCTCAGGGAAGCCAGAGAGATAGCCATGACTGTTACCTTCCTTGT" "1466" "1" "0.130094" "-1.6872914" "-4.34" "-0.18081381" "19291" "TTCTGTCGGTATGCAGATGAAATGAAAGAGATCCAGGAGCGACAGAGGGATAAGCTTTAC" "42582" "1" "0.130099" "1.6872651" "-4.34" "1.64005019" "14964" "CAGTTCTCTTTACACAACATTGTCTGATGTTCCCTGTGAGCTTGGGTTCAGTGTGAAGAA" "1711" "1" "0.130126" "1.6871257" "-4.34" "0.37790003" "545366" "AAATGGTCAAGACATAATGACATGTACAGAGAATGGCTGGTCCCCTCCTCCCAAATGCAT" "2166" "1" "0.13022" "1.6866514" "-4.34" "1.04870721" "64697" "CTGGAGAAGTAGCCCGTCATCTAAAAAGATGTTTTCAAAAATGATTCTTTCTCACGCCAC" "48561" "1" "0.130221" "-1.6866436" "-4.34" "-0.13875366" "17714" "GTGGAGGTGGCAGACATTTTGGAGAAGACTGCCAAGTGCTGTTCAGAAGGGGCAGAACCT" "26903" "1" "0.130236" "1.6865701" "-4.34" "0.25013201" "100340" "CACTGACTTGGTTCATCTTTCTCCTGGTAAAATTGGGCAACGTTACCCAATGGAGAGAGA" "47615" "1" "0.130269" "1.6863986" "-4.34" "0.93922039" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "57829" "1" "0.130285" "1.6863171" "-4.34" "0.17371272" "" "AACATACTGGCCAGGAACAGCCACAGCCTCTCATCAGTGGAATCCTGGCTCTCTGATGGG" "58391" "1" "0.130307" "-1.6862083" "-4.34" "-0.13974285" "" "CTAGTTGCATTTTGCCTGACGGTAACAGAAACTGTGATGAGATGATAAATAGGTTTGGTT" "22455" "1" "0.130342" "1.6860302" "-4.34" "1.39705814" "" "TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC" "39083" "1" "0.130346" "1.686009" "-4.34" "0.23480236" "74775" "GAGGAGGCGGCTGCACCCACGAGCAATAAAATTGATCCCAGGGTTTTCTTGGTTCTTTTG" "4142" "1" "0.130353" "1.6859749" "-4.34" "0.23316132" "" "ATTCATCAAGATTGGGGATATGAGTTCTTCACTCAAGGTCACCTTTGCAGTGGGCACTCA" "50476" "1" "0.13039" "-1.6857874" "-4.34" "-0.22152812" "54393" "AAGAGAAGTCCCGACTGTTGGAGAAGGAAAACCGTGAATTGGAAAAGATCATCGCCGAGG" "27352" "1" "0.130392" "-1.6857783" "-4.34" "-0.17965113" "109910" "AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC" "50285" "1" "0.130393" "1.6857712" "-4.34" "0.16259306" "194604" "CCTTCTCTTCATGGGGAGAGTGCTGAATCCCACTAGAGTCATCACGGATGCTGTACATCG" "23438" "1" "0.130403" "-1.6857176" "-4.34" "-0.18393101" "22110" "ACTGAGACTGAATATTCGTAACAGTTTTCGATATTACTCCAAATTCTTAGAAACGGCTTG" "45961" "1" "0.130445" "1.6855057" "-4.34" "0.31548906" "" "AGACGGCTATTATGTCATGTGGTGAGAACTGTGTACGGTGATTTTACAGTGAGGAAACAA" "40055" "1" "0.130455" "1.6854552" "-4.34" "0.29200403" "13614" "CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC" "45254" "1" "0.130476" "-1.6853502" "-4.34" "-0.18570806" "277939" "GGACAGGCTATTTTTGCCATAAATATTGGAAGAAACATGGAATAAGTATGTACATAGCTG" "29558" "1" "0.13049" "1.6852775" "-4.34" "0.20669291" "330004" "GTCTCTGATGGGAAAGGTGACCCTGAGGTGTCCCTGTCACCAAGTCTTTCTCCAAGCTGA" "52054" "1" "0.130491" "-1.6852733" "-4.34" "-0.16160056" "" "TAGGCAGATGAAAATGTTAGCCATTTACCTAGATGATCTCTCAAAGCTAATTTGAGATTC" "35057" "1" "0.130507" "1.6851919" "-4.34" "0.33144665" "" "GTCCTGCAGATGCCTTTAATAAATGTTTTTATTTCCTCATACCGCTTCCTCTTTGCATAA" "52785" "1" "0.130542" "-1.6850142" "-4.34" "-0.15555986" "230233" "ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT" "34965" "1" "0.130583" "-1.6848068" "-4.34" "-0.1912973" "" "CAGCCAGTTCAACCTCAACGACGTGGTCAAGTTCATTTGCAACCCAGGATACATAGCTGA" "43088" "1" "0.130588" "-1.6847817" "-4.34" "-0.15528147" "75533" "AAGTTACCTTACTGTAAGAAGCCGCTCCCCATGTTCTTTACATTAAAAGCATATATGTGT" "47689" "1" "0.130606" "-1.6846887" "-4.34" "-0.13661584" "52637" "AGACTGGCGACAACGTAGGACCTCTGATCATCAAGAAAAAGGAAACCTAATGGACAGTTG" "34020" "1" "0.130614" "1.6846515" "-4.34" "0.17734565" "" "GAGCTCTGGTCTATGTGCTTTCTTGCTGTTACTTTATTAAATCTTGCCCGCTGCAATTTG" "61714" "1" "0.130631" "1.6845643" "-4.34" "0.21038609" "18073" "TGGAACTGATCGGAGAACTGAGCTTCTATGATCGTACGGACATCACGTCGGTCTATGTGA" "24039" "1" "0.130631" "-1.6845631" "-4.34" "-0.21206429" "" "TAGTTAGTCCCAGTATTCAGGAGATGGTAGCGGGAAAGGACTAACTTTGCAGCCACGTTG" "37302" "1" "0.130646" "-1.6844857" "-4.34" "-0.16391917" "212880" "TAAATATCTGGAAGACATTGGAATTTTGTACTGAATGCTGTAATAAAGTCTGTCAGGCAC" "26939" "1" "0.130667" "1.6843815" "-4.34" "0.35251221" "230752" "TGGGAAAAGAATGCCAGCTCCCACCTTCTCCCGATAATAATGACCAATGAAAGGTAGTCT" "42439" "1" "0.130683" "-1.6842984" "-4.34" "-0.18269276" "" "CAGGTTCTTGTTGGTACACAGCACAAATTAGTTATATATGGGGACAGTAGTTTTTTGTTT" "38545" "1" "0.130695" "-1.6842373" "-4.34" "-0.14849094" "74352" "GTCTTGGTGTTAATGCTTGTAAATCATTTTCCCCCATTCCAATATATTTTCCAAAATCCC" "37175" "1" "0.130709" "-1.6841671" "-4.34" "-0.15507441" "74203" "CTTATACATACAGCTGTACATAAAGTAACTATCAGTTAGGCTTGTGTCAACTGTTTGGAT" "43631" "1" "0.130725" "-1.6840845" "-4.34" "-0.20459093" "258722" "TACTGTCAACAGTATCTTTGGACTCTTTGTGGTGCTCTCTACCTTGGGACTTGACTTCCT" "45353" "1" "0.130741" "-1.684007" "-4.34" "-0.2273201" "240690" "AGATGTGCCTCTATGTAAAAGTACACATGAACTTTAGTGTGGGCTTAATTTTCTGTGCTA" "45038" "1" "0.130756" "-1.6839299" "-4.34" "-0.13965616" "" "ATCTTGATGTCTACATGTCCCCAAGGACTGGTATGATATTAGTGAGGAGAGGCCAATCAC" "43203" "1" "0.130777" "-1.6838252" "-4.34" "-0.14335332" "74385" "AACTGTGTTTAGGATGCCAGTAGACTTAAGACTGTAGTAACTTCAGAAGATGAGCATAAT" "57837" "1" "0.130782" "1.6837972" "-4.34" "0.28843778" "239611" "GCATGGTTATCATTGTTTTGTTATTGATGCTGGCTGGAAAATAAACGCCATGGTGCAAGG" "60401" "1" "0.130801" "-1.6837006" "-4.34" "-0.25036419" "" "AAAGCCAAGGAATAAGAAGTAGTGACCTGAAGCTGGGACTGTTGGAGTGTCATCTTCACT" "7453" "1" "0.130819" "-1.6836113" "-4.34" "-0.24365899" "260305" "CCCCTCGACTCTCAGGCTGTGACTGTCCAGAACAAACTGTTTTATAAATGGTTTCCAATG" "29004" "1" "0.130848" "-1.6834651" "-4.34" "-0.53819665" "" "AGGTTATCCAGGACTTCATCCCTGTTCTGCTGGAAGCAGTTCTGGAGGATAGTCCTCTTC" "34810" "1" "0.13085" "-1.6834517" "-4.34" "-0.17523868" "" "TGCCTTAGTTTCTCTGAGGCATCCTGTTGTCTTGCAAACTACCTGTTTGTGCTTGACACT" "52682" "1" "0.130868" "1.6833636" "-4.34" "1.10136707" "434484" "TGTAGGAACCTGCTCCCAGTGGATAGAGTCGTGTACGACATCCTCAGCAATGTACAGAAG" "46380" "1" "0.130894" "-1.6832309" "-4.34" "-0.15188361" "432989" "ACCCTTCTCCTGCGAGATCTCAAACTTTCAGAGATGAGAGACTTTTATCATGGACCCAAG" "29560" "1" "0.130923" "1.6830825" "-4.34" "0.206758" "70062" "ACTGTTGTTATCAGTCAGTGTTACTGGAGGAGTGAATATTGAAAATCAGATACTGAAAAC" "14376" "1" "0.130949" "1.6829536" "-4.34" "0.18995957" "72333" "AAAGGAAGACGCTGGGTGGTACACTGTGTCCGCCAAGAACGAAGCAGGCATTGTGTCCTG" "4753" "1" "0.13097" "-1.6828487" "-4.34" "-0.20336592" "" "GTACGTCAAACGGGTGACAGGAAACGCCTCCTGCCATCATCAATTATGGCTGCCTGGGCT" "16331" "1" "0.130986" "-1.6827656" "-4.34" "-0.12991095" "" "" "29592" "1" "0.131025" "1.6825702" "-4.34" "0.56254769" "" "" "47064" "1" "0.131031" "1.68254" "-4.34" "0.18794166" "" "" "48248" "1" "0.131045" "1.6824698" "-4.35" "0.3138017" "50913" "AAGAACAACATCAAAAAGTTGCTGTGAATATAGTTTGAGCTTTTTGGGAGGGGGTATTCT" "43552" "1" "0.131079" "-1.6822984" "-4.35" "-0.18156326" "" "" "18099" "1" "0.1311" "1.6821898" "-4.35" "0.54735831" "" "CCATCCTGGAAATACATTTGGAAGTACTGGAAAACGTAATATTACTCCAAGTTCAAGTAT" "15823" "1" "0.1311" "1.6821895" "-4.35" "0.22018292" "" "TATCTAGCTGCTTATCTGGGACCTTGTGGACTGCCCTTGGAAACAGAACCAAATCTGCCT" "19228" "1" "0.131103" "1.6821764" "-4.35" "0.31360769" "" "TTTCTGATCAGTTGTCACCAGCCCTGGAGCCTCCTCAGCCACCTACCAAGCAAAAGTCTT" "10149" "1" "0.131135" "1.6820127" "-4.35" "0.76030734" "74131" "AACTCCACAGGATCAGGAGATTATCACAACTATTACTGGGGTACCCTTGACTCCAATAGC" "29498" "1" "0.131157" "-1.6819028" "-4.35" "-0.21821798" "" "" "25500" "1" "0.131209" "1.6816377" "-4.35" "0.1584571" "" "ATAAAAATCTTAGTCACCCCCAAGCAGGGACAATTTACCCTTAGGGCTAGAGAGCGCATA" "31154" "1" "0.13125" "1.6814338" "-4.35" "0.33838339" "240754" "TATGGGGATGTTGGGGATAAAAAGGCACATAGCACTTAGAGTGGAAGCATGACGTGATAG" "3965" "1" "0.131279" "1.6812861" "-4.35" "0.18316361" "192185" "CGTATCCCCCTGAGATTCCCAGGTCAGGAATTCCCATAAATCAGTCTGTTGAAATTCTGA" "1957" "1" "0.131282" "1.6812706" "-4.35" "1.21083208" "" "TTTTTTGAAGTGCTTGAACATGAGCTGATAGTCATCTGACTCCTCTTCATTCTGGTCCTC" "55692" "1" "0.131289" "-1.681237" "-4.35" "-0.15999704" "14566" "ACAGATTTGTTAGCATAAGTCTCGAGTAGAATGTAGCTGTGAACATGTCAGAGTGCTGTG" "37207" "1" "0.131324" "-1.6810601" "-4.35" "-0.14607265" "" "AAGAATCAGTGCTCTGTCCTCACTTGCTACTGACCGTTCAGAGAACACTAAACCCTTACT" "49298" "1" "0.131332" "-1.6810187" "-4.35" "-0.1911131" "353170" "ACCTCTTTCAGACTGTAGATGGAAATAACTGTGAAAAAATGATGCAGATATAGTTTGTGC" "16289" "1" "0.131395" "1.680699" "-4.35" "1.40181772" "" "TTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTGCCAGAAA" "15534" "1" "0.131427" "1.6805381" "-4.35" "0.15822121" "" "" "55981" "1" "0.131428" "-1.6805339" "-4.35" "-0.14127468" "18108" "CTATTTAGTGATGCCTGGAAATGTCATTCCAAAGAAGAATAAAAGCACAAGTTGAGTGAA" "27025" "1" "0.131432" "-1.680515" "-4.35" "-0.15795161" "76894" "AAAGGAAGCATGTAGAACTGCTCTAACAACCCTCATAGAAAATCTGAGGTCCAGAACTTC" "11261" "1" "0.13144" "-1.6804758" "-4.35" "-0.23334829" "13929" "TGCCCTTCAGATAGGATTAGGTGAAGCTAGACGGCAAACAAATAAATACTTTGAAAATCA" "40811" "1" "0.131447" "-1.6804389" "-4.35" "-0.13640483" "69821" "AAACCAACCTGTAATGATCCACTGGAGATACAGGTAGATAAACCAAACCAAATGAGGGGT" "48834" "1" "0.131472" "1.6803146" "-4.35" "0.17766544" "" "CCAAGAAGCATACAAGCAGTATAATGCAACGTTAAACCGCTTCTCTGTGAACTTCCAGAA" "49861" "1" "0.131476" "-1.6802906" "-4.35" "-0.25917264" "67897" "CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT" "52832" "1" "0.131479" "1.6802777" "-4.35" "0.22313342" "12140" "TGAAGCACTGGTCACTAATTATAAGTTTGTCTTCGGTGTGGAGGTAGAAAATTATAATTC" "27776" "1" "0.13155" "-1.6799191" "-4.35" "-0.20310596" "70533" "AGAGAGTATATCTAGAACTGAGAAAATGTGTGTCCTGGTCCAGATTCAGGCTCTCTGTTG" "33824" "1" "0.131569" "-1.6798266" "-4.35" "-0.18944385" "100087" "ATACCCTGAGTGTGTAGTTAGCATAAGCTGAGGCATTGAGTGGTAGCTCCAAAAACACCA" "52603" "1" "0.131621" "1.6795617" "-4.35" "0.24352363" "" "GTATTCAATATGTTTCCAAACCCAACATCTTAATACTAAGACATCAGGTTCCCAGATATC" "4583" "1" "0.131627" "1.6795324" "-4.35" "0.33052889" "17925" "ACGGAGCCAGGGACTTGGAACCTTTAGGAACAATCAGTGCATCCGGTGACAGCCTGGGTT" "36530" "1" "0.131638" "-1.6794768" "-4.35" "-0.22181803" "" "" "44461" "1" "0.13164" "-1.6794649" "-4.35" "-0.21242825" "18099" "GGTCACTTTGTACAATGTAGATTTGAAGTACAGTGGTGAGAACATTAAACGTGACATTTG" "47768" "1" "0.131648" "-1.6794243" "-4.35" "-0.22783175" "" "ATTGTGACTACTGTGACACATATCTTACCCATGATTCTCCGTCTGTGAGGAAGGCACACT" "8684" "1" "0.131652" "-1.6794053" "-4.35" "-0.1933894" "" "AAGTGTATTTAGAGAAAAACTCCGAGAACAAATTGAGGAATGGCTGTCTTTCTATGAGAC" "44787" "1" "0.131665" "-1.679339" "-4.35" "-0.15992374" "" "GTTGACAAGATTATATGCCACTTGAACAATGAGAACATGTATTCACCTTCTTTAATCTGG" "37153" "1" "0.131678" "1.6792733" "-4.35" "0.17328516" "213438" "ATCCAATTCCTGTTGGTGCCTTCCTTCTAAATTCTCTCTTTTGCACTCTTGATACAAATG" "25212" "1" "0.131704" "-1.679143" "-4.35" "-0.18611724" "" "" "51404" "1" "0.131706" "1.6791351" "-4.35" "0.16963647" "17172" "CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA" "52020" "1" "0.131719" "-1.6790718" "-4.35" "-0.17097664" "" "ATCATGGAGTTCTTAGTACCGCATCGGTCCTCCTCCACGGCATCTGCCTCTGTGCTGCTT" "58742" "1" "0.131775" "-1.6787877" "-4.35" "-0.1824717" "" "GCCATCGATCTACTCAGTGCTTGTATTTTCCTACCAATTTTGTATTTTTCAAAAAGGACA" "33585" "1" "0.131798" "-1.6786723" "-4.35" "-0.13802849" "" "AGCACCACTTTGAATAGGTAATCGTACTCGTCGTCCCGGGTCCCCATTGTCCTGGCGCTT" "36235" "1" "0.131812" "-1.6786042" "-4.35" "-0.22710325" "13204" "CTCGTCGAAGTACTGATTTCACAAGCAGGGACTATTATATTAATATAAGAAAAGCTTTGG" "40715" "1" "0.131816" "1.6785815" "-4.35" "0.39036931" "231805" "ACAACAGAAGGCATACAGTTTTGGCAGTCAATTCCTGGGACCCAACTCAATGTGACCAAT" "33900" "1" "0.13187" "-1.6783084" "-4.35" "-0.21766282" "" "TTGCTTTTTGTTTGGGTTTTTGATTGTTGAGTCTGGTCTTGAACTTGTGATCTTCCTGCC" "18337" "1" "0.131871" "-1.6783067" "-4.35" "-0.37090972" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "29078" "1" "0.131875" "1.6782838" "-4.35" "1.12605536" "11433" "CTTTCTTGGGAACGGGCTTTCCTTTCAGTCAAGTCTTACTGTCACTGCTATTCAATAAAA" "43601" "1" "0.131924" "-1.6780382" "-4.35" "-0.16963" "74365" "AGAGATACTAATGTTACTGCATTCTTTCACTGACTTGAGGTCTCATTTCAAATGGTTCAG" "557" "1" "0.13193" "1.6780104" "-4.35" "0.98956045" "" "GGCACTTGTCATGCAATCTTCAAAAATGAAGTTTCTTTCGAGCACTGTGCTCAATTTTTT" "25930" "1" "0.131932" "-1.6779996" "-4.35" "-0.17174914" "" "TCCTGGGCTGGCTGTATTCTTTGACTTGTGGTCCAGGGAGCCCCATCCCCACTGACTTTT" "40542" "1" "0.131954" "-1.6778902" "-4.35" "-0.23400996" "238161" "TAACCTGCAAAGAGAAGCTCGTAAGCTTTCATGAAGATCGACATAGTAACATGCATAGGT" "50119" "1" "0.131955" "1.6778855" "-4.35" "0.21681503" "" "TGCTCTCTGGAGATTTTCAGCGCATCCTGTCCCAGATTCTCATTTGGTTATTTGTCAACG" "3062" "1" "0.131965" "-1.6778335" "-4.35" "-0.2425796" "329795" "CTGTGAATACAGAACTTAAGGACTCAGTATAATATGGCCAAGACTTGATGTTGCTATATT" "16743" "1" "0.131988" "1.6777177" "-4.35" "0.41450765" "" "TTGGGAAGAAGAAGAAGCTTAAAGCTCAGGAAAGGGAAAATTACAGATTGAGCTGGTAGC" "21584" "1" "0.132034" "-1.6774851" "-4.35" "-0.15557078" "66409" "CTGTGGGTGCCTCTGAATTTAATATTTCTATTGTACAAACTAGGGGTTTGAGACAATAAA" "15105" "1" "0.132089" "-1.6772089" "-4.35" "-0.24046037" "18168" "TTATAATGTGGTTAATTCCGTCACTTGTGCAGAGTCCATGTCGATCTAAGGAAATTTCTG" "20892" "1" "0.132099" "1.677159" "-4.35" "0.34093666" "" "ATACATTAGTAGTGGCAGTAGTACCATCTACTATGCAGACACAGTGAAGGGCCGATTCAC" "20120" "1" "0.132109" "1.6771107" "-4.35" "0.39590108" "11988" "TTTTTTACTGTGGACAAAAAAGACACAGATGGAGGGGTATAGGAAAATGCCCTTAGTCCA" "18018" "1" "0.132131" "-1.6769992" "-4.35" "-0.20506094" "20604" "AAGACATTCACATCCTGTTAGCTTTAATATTGTTGTCCTAGCCAGACCTCTGATCCCTCT" "30429" "1" "0.132135" "-1.6769812" "-4.35" "-0.21288273" "26372" "ACTAAAATTCCAGCTAACAGCCTTTGAAGCATTAAATCCCACCACAGGGGGACAGCTTCT" "10727" "1" "0.132141" "-1.6769508" "-4.35" "-0.27931055" "269881" "ACTCACTCTATTTATTGGGGAAGGGGGGAGGGGAGGACACTTAATTTATTCCTTTGTACC" "21260" "1" "0.132153" "1.6768884" "-4.35" "0.7661993" "230787" "GTGACTGAATGTAGGGATCTGCCTCCAAGAATAAAATCCTAGGTAGGACACTAGTACTCC" "50295" "1" "0.132166" "1.6768262" "-4.35" "0.23125289" "93692" "TGTTGCTGGTTTTCTGCTACTGTTCGTCAGCTGAAGTCATTTTGCAGAAGTCCACTTTCT" "11831" "1" "0.132198" "-1.6766624" "-4.35" "-0.18306029" "16538" "CTGAGCCGTCAGACATAGGGGCCACAGATCTTTCTTGAAAAGCTCAGGCAGGATAGCACA" "62687" "1" "0.132217" "-1.6765668" "-4.35" "-0.16606519" "78255" "GCACTAATTTCAGGGAATGAAGTGAGATGTTCCCAGAGAAAAACGATGGAGTTGCAAAGC" "43742" "1" "0.132231" "-1.6764983" "-4.35" "-0.21926704" "68468" "GGCTTACCAGACCCTCTGCTTGTCCCCTTCTATCTTGAGAAATAAACATCAGTGTCTAAT" "27139" "1" "0.132233" "1.6764867" "-4.35" "0.19254876" "" "GGTCTCTGTCCCCATCTTGTGTGCCATGTGTCCCTGAGGGTGAATCACACCTGTGTCTGA" "7245" "1" "0.13228" "-1.6762511" "-4.35" "-0.20341335" "" "TCTGAGTGCTCACCACCTGCAGGGACTACAGCGAGATTTGTCAGGCCCCCACTTCACTAA" "923" "1" "0.132285" "-1.676227" "-4.35" "-0.17467427" "83925" "TTGTTTTCATAGTGCATGTTCATTTCGACTCACAACATGTTCTTGGTGTATTTCTTATGC" "60396" "1" "0.132339" "-1.675956" "-4.35" "-1.20732222" "16573" "CCTGTTATACTAAATCATACACTATAATTTGTTTAGTTAGAAATAGTAAACTGTTTGCAA" "50664" "1" "0.13235" "-1.6759037" "-4.35" "-0.17604254" "15191" "GGATTGATGAGATGCCTGAGGCTGCAGTGAAGTCAACAGCCAACAAATACCAAGTCTTTT" "50299" "1" "0.132379" "1.6757548" "-4.35" "0.34807019" "18810" "ATAAACCTGTACTTGAAACCAGTTAGAAGGACCGGCTGGAACTCAGAATCCGACCTGTTT" "52156" "1" "0.132391" "1.6756964" "-4.35" "0.60322705" "" "CCTCTGAATCTCTTTTCATCAATAAAGAATCAAACAAGAGTGTACCGTCTTCAAAGAAGA" "46596" "1" "0.132398" "-1.6756601" "-4.35" "-0.22409958" "13982" "TTTTTTGTAGACGTTTCAAACTACCGTGTCATGTATGCAGTTATTAATGCCTAAAGCCTT" "45382" "1" "0.132441" "1.6754446" "-4.35" "0.34338479" "170756" "TTGTTTGTTTTTTGTTTTTGTTTTTTGTTGTTTCCAAAAATAAAAGATGAGTTATTTCAC" "22933" "1" "0.132483" "-1.6752376" "-4.35" "-0.17293011" "" "TGGGCCCAATTTCTGAAGTTTAGATGGCATCTTTCTTCTCAAGAGACCTCAAGAGACTGA" "58200" "1" "0.132513" "-1.6750882" "-4.35" "-0.2429154" "235106" "ATGAAATTCCGAGAATCACAGCCAATGAGACAGAAATTCGAGGGAGGAGGACAAAGCATA" "6418" "1" "0.132519" "-1.6750559" "-4.35" "-0.16597022" "" "CCCAGGCTGGTCTTTGTATTATTATCATTAGAGAACTTAGATTTACAGCCAGTTCTATTT" "9858" "1" "0.132535" "-1.6749786" "-4.35" "-0.14708517" "268782" "TAAAAGACATGACCGACTATCTATCTACTGACCGTATTTGTCAACGGAGCCCCCATTCTC" "45553" "1" "0.132546" "-1.6749214" "-4.35" "-0.15338962" "66922" "CTAAGCTGAAGTCATAGGTTGGAAAGTAATTTTTAACTTCTGGAATCATGTTGCCTACTG" "42980" "1" "0.132549" "-1.6749058" "-4.35" "-0.17912058" "" "ACATCTCTGTAGCCCCATACATCTCTGTCCTTCTATCTCTATACCCCATTGTCTCTATGG" "2349" "1" "0.132562" "1.6748403" "-4.35" "0.18375733" "" "ATGAGAAAATTATGTGGAGCACATCTCAACCAGGAGTTGAGGAATCCAGAGGACGAATGC" "54851" "1" "0.132606" "-1.6746236" "-4.35" "-0.34824418" "" "TGGAACATGAAAATCAAGAACATTGTAAATGCAACAATAAGGGGGAAATGCAATTAAAAA" "3706" "1" "0.132619" "-1.6745552" "-4.35" "-0.22736649" "99035" "GGAAAGGCCAGCGGGAAGTGGGTATGATCAAAATGCACAGTTTACACTTAGGAAAATTTC" "32109" "1" "0.132641" "-1.6744483" "-4.35" "-0.36994628" "" "AGCCAGATCCCAGATGCTTTTCACCTGAGCTTGAAAATAAAATACATGTTACACTTGAAT" "12834" "1" "0.132645" "-1.6744263" "-4.35" "-0.13606703" "67770" "GGTTGGATACCCTGGATATTTCTTTTAGTTAATGTCTGTAAACTTGGTATCTTAAAAGCC" "6071" "1" "0.132664" "-1.6743319" "-4.35" "-0.21716636" "320560" "CAGACAAACTGACATGGGTTTTCAGGTTTTGGAGTACATTTAAATATGACTTTTCATGCT" "11953" "1" "0.132677" "1.6742648" "-4.35" "0.45483648" "16638" "TCCTCATTGACTCTCCAATGAGTGTAAAAGTGCAAAGAGAGAGACAATCTGGAAGATTTT" "27514" "1" "0.1327" "-1.6741528" "-4.35" "-0.1533832" "270627" "CATCAAGTTGGGGCAGTGAGACTGGAATTCAAACAATGTTAATTAATCAGAGAACTCTAA" "14655" "1" "0.132705" "1.674128" "-4.35" "0.1971793" "107022" "GGTCCTCTGCCAAGAACTTACAGCTAACATAGTGAAATTGGAAAAGATACAAAACAACTT" "32846" "1" "0.132746" "-1.6739211" "-4.35" "-0.26190386" "" "TCTCTAATGAGAAGCACTGGGCCACCTCTGCATGGTTTTTCTTGCCAATTTCTCTTGTAG" "58010" "1" "0.132756" "1.6738706" "-4.35" "0.16853084" "100048702" "CCAGAGAGAAATTCTACCCAAAAGATCAAAGAGAGAAATTCTACCCAAAAGATCAGGGAA" "863" "1" "0.132783" "-1.6737392" "-4.35" "-0.36798704" "16835" "CTGCTTTGAAACCCTTGTTCAGATGTTTTTATAGGCTGAAAATATCATACTGTGATGGAT" "43475" "1" "0.13282" "1.6735543" "-4.35" "0.34641555" "18111" "CGCACAAGATCCTACCATGAAGATCGAACAGCCCATCAACCAGCAGAATGGACATTCTGA" "6826" "1" "0.132839" "1.673458" "-4.35" "0.17045578" "" "TATGTATTGGAAGACTCACTATAAGATAATGTCCCAGAGGCAAAGCCTTCGGGTGGGGTT" "9082" "1" "0.132842" "1.6734438" "-4.35" "0.32507326" "11799" "TGATTTGGCCCAGTGTTTTTTCTGCTTTAAGGAATTGGAAGGCTGGGAACCCGATGACAA" "7140" "1" "0.132854" "-1.6733837" "-4.35" "-0.28216338" "22042" "TCCTGCTAGATGGAACATAGATTCTTCATGTAAGCTGGAACTTTCACAGAATCAAAATGT" "21532" "1" "0.132872" "-1.673291" "-4.35" "-0.22520133" "72014" "TCATCCGGACTCCCAGTTAACCTCTGGATTGAGAAATAAGGCTAGGCCTGGATGGCGCAG" "60701" "1" "0.13289" "1.6732042" "-4.35" "0.2140228" "74091" "TTATCAACTATGTGATCAAGCTAGGTTTTGGAGTGTCGCAAACCAAAGCCATCATGACGC" "11462" "1" "0.132897" "-1.6731705" "-4.35" "-0.18672828" "56637" "GATCCTGATACAGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTGGTCCGA" "50578" "1" "0.132916" "-1.673076" "-4.35" "-0.18395059" "" "CAGTTTGGCAGTTTTGGTGGCACCTTTATCTGCTGGGCTATCTCAATGGCCATTAAAAAA" "29448" "1" "0.132921" "-1.6730491" "-4.35" "-0.18349913" "213539" "TGAATTTTTAGGTGTGCGTGGAAGCATGACAAATGTGAGGAGCCCACCTTCATTTTACCA" "28765" "1" "0.13294" "1.6729526" "-4.35" "0.28278008" "" "CCTGTGTGCTTTGCAATAGGAATAATAGGGACTTTGTTCTCTTAGAAAAGATAATAACAC" "54397" "1" "0.132971" "-1.672798" "-4.35" "-0.23364488" "211446" "GCTAGTTTACCCGTTATATTTGCTTTAAGATGACTCTAAACTTAACAGTTGAGATTCCTC" "62848" "1" "0.132981" "-1.6727485" "-4.35" "-0.24765135" "72555" "TAAGAAGCGGCGACTGAACCAGAGCACCTGTACCAACTACGACACGCCACTCTGGCTTAA" "42677" "1" "0.13299" "-1.6727025" "-4.35" "-0.13898752" "269470" "AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG" "7403" "1" "0.133003" "-1.6726419" "-4.35" "-0.22600854" "" "TTTTTGGTGGTAAGATTACGTTGTATACCATGCCCGTGTCTGCTCCTATGTCTCTTTTTA" "14569" "1" "0.13301" "-1.6726039" "-4.35" "-0.2316371" "" "CCCAGCATCCTGAAGCATATGAGGCACCTTAGAGAAAAGGTCTAAATGGGCCTTATAAGA" "19290" "1" "0.133017" "-1.6725706" "-4.35" "-0.21310599" "" "ACTGACAGACACACTCAAAGAGCCTCTGGCACTTTTTGGACTGCCCTTCCTATTCTATTA" "44047" "1" "0.133031" "-1.6725007" "-4.35" "-0.15744498" "" "CCTTCTTAGAGTAGGTTGTAGATGACTGGTGAGCCAAAAAGCAGAATTCCAGAGGTGGTA" "10194" "1" "0.133046" "-1.6724241" "-4.35" "-0.16332974" "258397" "CCCAGTTATCTACACATTCAGAAATAAAGAGATGAAGGTAGCAATAAGGAGAGTTTTCAA" "42718" "1" "0.13306" "-1.6723553" "-4.35" "-0.15801402" "382236" "TGCCTTTCAAGTGCTGGGATTAAAGTTGTGTGCCATATGACCAGCTATATTACTTTTTAG" "59484" "1" "0.133092" "-1.6721953" "-4.35" "-0.16047965" "58520" "TATCTACAGGTGGATGAAGGTTGGAAGAGTCTGGGCTGTTTTTAGACCTTTTGGTCAATT" "11320" "1" "0.133099" "1.6721619" "-4.35" "1.15374634" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "61901" "1" "0.133107" "1.6721235" "-4.35" "0.20826623" "" "" "48679" "1" "0.13311" "-1.6721044" "-4.35" "-0.25679447" "215654" "ATTCCCCCCTTTGACTGAAAACTTCCTATGGATCAAATTACTTGGCCTTCATTCTTTTAT" "57345" "1" "0.133114" "1.6720846" "-4.35" "0.29921736" "" "" "52084" "1" "0.133147" "1.6719237" "-4.35" "0.18848352" "22601" "GGCTGTAGTAGGTAGCATACAGGTAAGAACTTAACTGGTTATTCTTGAATTTCTTTTACA" "51164" "1" "0.133164" "-1.6718363" "-4.35" "-0.20926705" "" "TTTTAAATAATATTCGCCAAGAGGCAGTCCTCCTCTAGTGAAGAGTTTACATAATGTGTC" "20742" "1" "0.133171" "1.6718022" "-4.35" "0.41036501" "68119" "AATACAAAAACAATGTAACAAATGGTCTTTTCTGTAACCTAAGAGGCCCCATGAATAAGG" "36536" "1" "0.133172" "1.671799" "-4.35" "0.60324277" "78416" "TAAGAAAAGTATAAAGAAGGACCAAGCCGCTGAACAATTTATCCTGCAATTTTTTGGGTC" "23829" "1" "0.13318" "1.6717575" "-4.35" "0.27603658" "" "TGGTTCTCTGACCGTCCACCATGTTTTATTTCCAACTGATCTCTCTCTGAATTTCCTACT" "24371" "1" "0.133192" "-1.6716987" "-4.35" "-0.23828489" "13196" "GGACATAGGAAAACTAGGTAGACATTCCTTTGGCAATCTTGTTAAGTTTAAATCTGACCT" "53644" "1" "0.133195" "1.6716844" "-4.35" "0.26156925" "68750" "CAGTGGCACTAATGTGACTGTTCATGGAATACAGCAAAAGCATGTGAAAATTAAAAAGTA" "8063" "1" "0.133224" "-1.6715393" "-4.35" "-0.13317778" "67222" "ACTTGCTGCCTCTTTGCAAGCGTTCTGTCAAAATTTTTGGTTTTGTTTTTAACTAACTTG" "21031" "1" "0.133237" "1.6714758" "-4.35" "1.22491272" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "52085" "1" "0.133244" "-1.671437" "-4.35" "-0.20931134" "208618" "AACAAGTTTGCACAGTTAGGGTGGTTTTGTAGATAACTGTATTTGTATAACACAGCCATG" "24906" "1" "0.133248" "-1.6714213" "-4.35" "-0.44414995" "" "ATTTGTGTTTTCACACACGGCGGGAGGAAAAGAAGCCAATCAGCGACGAGACGTCGGCCG" "42901" "1" "0.13325" "-1.6714109" "-4.35" "-0.24073757" "241514" "GAATAGTTTGAGAATCAATATAATATATGCTGTATATTAAAATGATGTCTTAAGAGTATG" "9732" "1" "0.133255" "-1.6713868" "-4.35" "-0.2558725" "" "CCTGAGACCAATTTCGATCAAATACTTTTGTCAATAAAAAGATACTAATGTCCGAGTGTG" "58071" "1" "0.13329" "1.6712125" "-4.35" "0.66343677" "21926" "TGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAG" "21061" "1" "0.133305" "1.6711358" "-4.35" "0.20810674" "" "GGTTCTAAAATATTCGGAAAGGTTGTTTACAAAGTTCTAGCCAATCCTACTGTGTACTTT" "39714" "1" "0.133305" "1.6711351" "-4.35" "0.21247713" "50875" "TCTTTTAAGAATTATAATGGAGAACAGTGTTTACCTTGATCTTTACAAGTCTGGCACCTC" "32102" "1" "0.133305" "-1.6711349" "-4.35" "-0.43781274" "" "GGGGCGTTTCATAAATTCATAAATGTGTGTGTTTTTCTGAGTGAGAAATTCTCTGTTGAA" "24829" "1" "0.133312" "-1.6710994" "-4.35" "-0.18412358" "12283" "GTACAGCAGAGGAATGTTATTGTAGTAGTATGTAACTATTACCTGAGTTTTGCAACAAAC" "39186" "1" "0.133317" "1.6710765" "-4.35" "0.29072123" "620078" "GACTCTGAATCCTTATCTCTGGTACTGTTGTTCTCTGCTAAAATAAACTGTTATGCCAGC" "60235" "1" "0.133332" "-1.6710029" "-4.35" "-0.49614038" "259110" "GAGGAACAAAGAGGTGAAGAAAGCACTGTTTAAACTCAAAGATAAAGTAGCATTTTCTCA" "62365" "1" "0.133341" "-1.6709562" "-4.35" "-0.37402463" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "19126" "1" "0.133349" "-1.6709163" "-4.35" "-0.19677494" "223838" "ATCTTCTTTTTTCCCAGACACTATCTGGAAAGGCAGTTCCATTTGCTACAGCTGGGGACT" "2463" "1" "0.133358" "1.670873" "-4.35" "1.16190037" "" "CCTTTACTTACCTGTACTTATACATATAATTAAGCCCAGCTTATTGCATTTGCCTTATGG" "43201" "1" "0.133365" "-1.6708381" "-4.35" "-0.20570404" "269295" "CCTGCCTGGCAACATTTTCCGAGGCTTGGTCAGCCTACAGTACCTCTACCTCCAGGAGAA" "38525" "1" "0.133377" "1.6707794" "-4.35" "0.22634289" "104681" "ACTATATTATAAAGTGACATCCAGCCCAAGTCACAGAAATTAATTGGCCATTCCAAAACG" "20022" "1" "0.133386" "-1.6707321" "-4.35" "-0.16768843" "623503" "GATGTCACCGGACCTGGCCTGCGGTGCCGGCTAAGCTGCTTCCCACTGGATGGAAGTGCC" "52931" "1" "0.133389" "1.670716" "-4.35" "0.24679515" "80908" "TGATACAGTCTCTAGTAGTTCAAGCTGGTTTCAGCCTTACTATGATGGTCTTATGCTCCT" "54188" "1" "0.133393" "-1.6707005" "-4.35" "-0.26686741" "" "AGAAAGAACCAGGTCCCAGGAGATGCGCTGCCTCTTGGTGAATGCCTACTGCATCCTGGA" "45926" "1" "0.133407" "1.670629" "-4.35" "0.55638746" "227612" "TGCACTTCTAAAATAATTTCATGGAGGCTAATTTCAGGTCTAAAGAGGCCTGTACACTCA" "24874" "1" "0.133416" "1.6705829" "-4.35" "0.20152043" "" "" "47968" "1" "0.133427" "-1.6705268" "-4.35" "-0.225363" "74117" "TTAGTGCCAGTCCCTGACATATCATGAAAAGTTGGTTTTCTTTGCATTTTCAAATATCTG" "591" "1" "0.13345" "-1.6704166" "-4.35" "-0.45865382" "" "GTACTTCTGAACTACTAATGCCATCTATCATGTCTTGGCACATGCTTACTGACTGCTCTG" "60871" "1" "0.133476" "-1.670287" "-4.35" "-0.13874787" "" "TCACCAGGCAAAAGGCAGACTGGATGAAAATGCCATTGTGCTATAGGATCTTAAGGAGTG" "29893" "1" "0.133477" "1.6702794" "-4.35" "0.28278789" "268973" "ACTATGATATTAGCGCTATTAAAGGCACCTTTAAACTAGTGACTGCTTAATGCACCCGTG" "9575" "1" "0.133479" "-1.6702729" "-4.35" "-0.15882107" "76007" "CATCTTCAAAAAATGAAGAACTACAAGGAAACGATCCCAAAATTCTTCCTTCATCGAAAG" "28312" "1" "0.133514" "-1.6700973" "-4.35" "-0.37621759" "" "CGGGCCCTGGACAAGCAGGTGGGTTCTCCGAGTTGGCCGCCATCCTATCAGACCTTGTAG" "58994" "1" "0.133589" "1.6697239" "-4.35" "0.24379131" "218442" "TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT" "49165" "1" "0.133611" "1.6696172" "-4.35" "0.17540416" "" "" "13926" "1" "0.133615" "-1.6695945" "-4.35" "-0.33239048" "" "GTTCTGGGTCCTTTACTCATTCCATGCCTTGATGGTCAAGATTAAATGAAACCTATGAAC" "36636" "1" "0.133632" "1.6695085" "-4.35" "0.16148706" "270160" "ACAATGAAGACAGATTTTCTTGAGTTCTTTCTTGTTATTTCTGTGTGGAGATACCAGAAG" "18712" "1" "0.133668" "1.6693319" "-4.35" "0.24438904" "244058" "AAGGGCGCGTGGGACAGCTCTCCCCTCTTGATTTGTGCACGCAACAAGGTTGTGGTGATT" "60498" "1" "0.133681" "1.6692679" "-4.35" "0.63846592" "20400" "GGATTGGAAAACTGAATCCCTTAGGGTATTTTTAGTTGCCGTATTTACAAATGAGAAACA" "59421" "1" "0.133732" "-1.6690131" "-4.35" "-0.19833608" "" "ATGGAGGCTTCTGACATCCAATGCAGGCATGTGTCAAGTGGTAGAGTTTCTTAGAAACCT" "53152" "1" "0.133824" "-1.6685589" "-4.35" "-0.15857562" "17380" "AACACTGTAGCTTTCTGCCATCATCATATAACTGCTAGGCATACATTATCCAGATCTCCA" "52878" "1" "0.133824" "-1.6685562" "-4.35" "-0.20189289" "13831" "TTGGCACTGTAAGAATTTCTATTCTCTGTAATGTTTTTCAAAATAAAACTCTTCAAACTG" "13537" "1" "0.133826" "1.6685492" "-4.35" "0.19403976" "27998" "ATAACCCTCCCTTCATCAGGATACCATTAAAAAGGGCTCCCCCGTGTTGGGTGAGTGAGT" "24854" "1" "0.133841" "1.6684764" "-4.35" "0.40319337" "" "CTGAGCAATCTGCCAAAGATAACTGTATGAGCAGAAAGCAGCTAAACTAAAAGAGAAGTA" "54029" "1" "0.133842" "-1.6684688" "-4.35" "-0.13084458" "" "ATTCTACAGGAAAAAACTGAGGTAGAAGGTGGTTCACTATCTTGGCTTGCAGCTGATAAG" "28492" "1" "0.133849" "-1.6684328" "-4.35" "-0.22641345" "217473" "CTACAGGGTGATGGATTTGATCTGTGAGAAATGCATGAAACAGAGAGACATGAATGAAGT" "29741" "1" "0.133856" "-1.6683987" "-4.35" "-0.18645964" "14167" "TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT" "60520" "1" "0.133861" "-1.6683774" "-4.35" "-0.19803423" "" "TGCTACAGAGCAAGCTCTGAGTGCTCACCACCTGCAGGGACTACAGCGAGATTTGTCAGG" "39462" "1" "0.133871" "-1.6683233" "-4.35" "-0.464332" "11440" "TCCCACGAGCCCTTCTCTAGCTCACTGCATGGAGATGAAATAAAATCGATATGAAATTTT" "44426" "1" "0.133898" "-1.6681911" "-4.35" "-0.61660826" "13653" "ACTGAAAATGTAAATTTATACATCTATTCAGGAGTTGGAGTGTTGTGGTTACCTACTGAG" "3713" "1" "0.133906" "1.6681515" "-4.35" "0.215845" "76642" "AGAGAATTCAGATTCTCCTTGGGAATCTCAGACCTTCTGCCCCATTACATCCCACCCCTT" "932" "1" "0.133907" "1.6681492" "-4.35" "0.72349659" "" "GAATAATAAACTGGTGGAACCAATAATCCTATTGTCCCCGACAAGTTCCACCCACTCTAC" "14371" "1" "0.133946" "1.667956" "-4.35" "0.50626431" "232970" "GGTGGAAGGAACTATTTATTGGTGCTCCTCTGATATCGAATTAAACATGGTGAAAAAACA" "43448" "1" "0.133949" "1.667938" "-4.35" "1.10208734" "" "ATGGGTTGCAGCTGAAGTCTGTAAGGCACAGTTACATGCAGGTACAACCCTTAAGAAACA" "25016" "1" "0.13395" "1.6679333" "-4.35" "0.31707199" "100042198" "ATCGTTAGTTTGGCTTCAAAGGATCCAGCACCCTTTACAAGGTCAGACTAGCTCCAAAGA" "544" "1" "0.133971" "-1.6678277" "-4.35" "-0.21045268" "" "TGCTCACGTTGAATGGATACTACCGAAACATAAGAGGACTTGAAGTCCTTGTGGAGAAAG" "35746" "1" "0.133977" "1.6678017" "-4.35" "1.20084231" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "52510" "1" "0.133998" "-1.6676955" "-4.35" "-0.20908254" "76500" "GAGCATCAGTTCTACGAGACCCTCCCAGCTGAGATGCGCAGATTCACTCCCCAGTACAAA" "37293" "1" "0.134024" "1.6675656" "-4.35" "0.15474178" "77252" "TTCTCCAGCTGAAGTTATCAGGGACAGAACCCCATTTATATTAAAATGGAAATTGTGGAC" "7612" "1" "0.134025" "-1.667564" "-4.35" "-0.16499032" "16648" "CAAGGAGGTACTTACAATTTTGACCCAACAGCCAACCTTCAAACAAAAGAATTTAATTTC" "9591" "1" "0.134025" "1.6675631" "-4.35" "0.26711748" "" "AGTTTCCTGAGTCCAGTCATCTCAGAAACTCCTTGGAATACCTTGCTGACAGGCTCAAAA" "31368" "1" "0.134074" "1.6673221" "-4.35" "0.74520819" "16154" "GTCATGACCCTAATCTGGTACGAGAGCTCCTTCTGGAACTGGGCAAGCTCTTTGAGACCC" "28052" "1" "0.134134" "-1.667025" "-4.35" "-0.13163315" "30951" "AATTATCTCTAGAGTTCTATTTTCTATTAGATGTAAATATGTTATTTAAGAGAAAAATAT" "37000" "1" "0.134137" "-1.6670065" "-4.35" "-0.17899371" "" "AATGAAGCATATCTGTACATTTGTCTGAAAACTAAAGACCTGCTGTGCAACCAACTATAA" "60732" "1" "0.134156" "1.6669145" "-4.35" "0.14745721" "" "TAATGGGTGCAAAGTAAATGGCAGACCTGAAGCTATATATTTCACACCTGATGTCTCTGA" "20719" "1" "0.134165" "1.666871" "-4.35" "0.20937168" "546943" "TCTAGACTGTATTTGTACAGTCTGTAACATTTCTTTTGTGGACTCTCGGGTCTGGTTGAG" "52460" "1" "0.134199" "-1.6667009" "-4.35" "-0.13663981" "67988" "GAGCTGAAGCGATCATTTATGTTGTTTCTGTTTATTCAGTTTTATTGCCCATGATGTTTC" "26617" "1" "0.134243" "-1.6664835" "-4.35" "-0.15667983" "13205" "GTCTCCTTTGTTGTTGTCAATTGTGGTTTACTTTTAGAGGTGAAAATAAAGTTGTGCTCT" "25627" "1" "0.134256" "1.6664202" "-4.35" "0.57095483" "" "" "47907" "1" "0.134259" "-1.666405" "-4.35" "-0.36946236" "" "TAAAGTCTCTCAGGATTTTCAGCCCTTTTACAAAACCCTTACTACAAATGTGGATCCCAG" "29359" "1" "0.134268" "1.6663614" "-4.35" "0.47796207" "71929" "AGGAAATGGACCATGGAATTAGACTAGTTTCAAATGAGGGCTGCTGAGAAAGCCACACTT" "52081" "1" "0.134274" "-1.6663298" "-4.35" "-0.13785828" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "51332" "1" "0.13431" "1.6661546" "-4.35" "0.15235966" "" "CTTACAAAAGGTTTTTCATTTTGAGTTTTACCATTTTATTTGACCACACCGGCTCGTCTG" "8262" "1" "0.134318" "1.6661124" "-4.35" "0.19688089" "" "TATGCTAGTTTCTACATCAACCTACAGCCCTGAGGATAACCCATGCCAGGGATGAGAAAA" "32770" "1" "0.134353" "-1.6659399" "-4.35" "-0.29738217" "" "TTTCTCTTTGCATTCCCCTCATGCTCTTTTTTCTCTTAGGATTGATGGAGCCACAAACAG" "33948" "1" "0.134363" "1.6658894" "-4.35" "0.27967808" "230145" "TTGAAAACTTTAAAAATGTCTCCTGGCATCCTGCTTTCTGAGGGCAATCCTAAGATGTTG" "51122" "1" "0.134365" "-1.6658842" "-4.35" "-0.13745207" "68194" "ACTAAGTTCGGCAAGGATGACTATTCTTGCATAAATAAATCTCCTATTAATTAATCACCG" "721" "1" "0.134367" "1.6658722" "-4.35" "0.71777158" "" "" "26495" "1" "0.134405" "1.6656864" "-4.35" "0.20425384" "623131" "TAGGGCTGGGGGGCAGGTATCCCGCACTCCCAGTCACCTCAATAAAACATCTTCTTTGTA" "452" "1" "0.134426" "1.6655792" "-4.35" "0.72383851" "" "AAACAGAAAGAAAAAGAGATCTACGTGACATTGTATTTGCCTGGGAAGACAGAGCACTAG" "7196" "1" "0.134442" "-1.6655033" "-4.35" "-0.30040617" "18751" "TATCTAAGAGCCAAGTCTATGGCATTAGCTGTGAGAAGTAGTTACCACTGTAATTCACCT" "52122" "1" "0.134453" "-1.6654485" "-4.35" "-0.1606694" "381406" "GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC" "23944" "1" "0.134469" "-1.6653682" "-4.35" "-0.14604902" "66631" "GTTTTTCCGAATCCCATAGGAATGCGCACATCAAATTCCTTTCTAAAATATGAGGGTTAG" "48727" "1" "0.134488" "1.6652747" "-4.35" "0.18161736" "" "GAGATAACCATCAAGTTCCTTGGCAAAATCTTGGCACATGGTTCTCAATAAATATTCTTT" "37881" "1" "0.134492" "1.6652539" "-4.35" "1.02647069" "545030" "TGCATGGGAAATTTCTACGTGGCTCACTTCACCAAGGCTTATTGCACTGGGAAAAGAAGA" "54252" "1" "0.134508" "-1.6651749" "-4.35" "-0.22375016" "" "CATGTTACAACAAGAATATGAAGGAGATAGGTATATTGAACAATATGGCTGCAGATGTAC" "3717" "1" "0.134511" "1.6651604" "-4.35" "0.479087" "" "CAGAGAGCCACCATCTCCTGCAGAGCCAGTGAAAGTGTTGAATATTATGGCACAAGTTTA" "49287" "1" "0.134514" "-1.6651452" "-4.35" "-0.18353551" "" "TTTTTTCTCCTGTGTGATAGGGTCTTATGTAGTCCAGAATGGCTCTTGCTGCCATCACCT" "33839" "1" "0.134527" "1.6650819" "-4.35" "0.31344187" "" "AATTCAAAGCCATGCGCGGTTTGTTTCTGGAGTCTTCCACTTTCTATTTCCAGGTGTCAG" "12816" "1" "0.134558" "-1.6649303" "-4.35" "-0.21159113" "243547" "GAGGACAGACAGGGCCCTAAGAAGCCATTCCTTTCCCTAGTTTCCTTCTTGGCTGAGTAA" "27148" "1" "0.134586" "-1.6647914" "-4.35" "-0.33792321" "" "GCTTTCTCATCTGACTTGGAGTAAGGTATGCATGAGGGAGAAAATTTTCTGTATCTGGTA" "15608" "1" "0.134593" "-1.6647565" "-4.35" "-0.14719844" "244183" "CTAAATACAAACCACTATAGACTCATTTCCTTGATCCAATTCTTTCTCTGTTTACAGTGC" "11828" "1" "0.134598" "-1.6647339" "-4.35" "-0.17151873" "" "CGTACATATTCACTTAATGACCAACATATCTACTAGAAAAGTTGAGCAGAAAACATCTGG" "13358" "1" "0.134614" "-1.664655" "-4.35" "-0.2169656" "74438" "GAACACTGGATTGTATTGCCTTTGTCAGTAAGTTCCTCTGTTTAATAAATACTGAAGAAC" "61977" "1" "0.13462" "-1.6646255" "-4.35" "-0.18921963" "" "TTCACCAGAAGAACCGTATCTAAATGTGAAATAAAACCTGCCAAGCATAAAGAGAAACGG" "25246" "1" "0.134638" "-1.6645347" "-4.35" "-0.17626251" "12212" "TAGAAATGGTTTTACTCTGCTCTTAAAGAAAATGCAATTAATAGCACTGGTTTCCTCCTG" "55544" "1" "0.134665" "-1.6643999" "-4.35" "-0.12911506" "" "CAAACTTGCAGTTTATGTATTGGAATTTCACAAAAGACATAGGACTTAAGTGGAAAAGGG" "9239" "1" "0.134667" "1.6643906" "-4.35" "1.05731133" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "24663" "1" "0.134697" "1.6642427" "-4.35" "0.25102282" "224648" "ACCCCGAGTGTACTGGTTCTGTGAACCACCTGAAAAGCAAATTAAATACTATTAAACAGC" "56838" "1" "0.134741" "1.6640249" "-4.35" "0.13404051" "76927" "GTTCTCTCCCTGGCTTATGTTGCAAACTGTTACTAAATCACCTGCCCCAATTCCATAAAT" "46240" "1" "0.134744" "-1.6640125" "-4.35" "-0.13813974" "70456" "CGGATTTGGAGATATAACCAAGAACTCAAATCTAAAGGGATCCAGTAAGAGAGTTCCTGA" "40590" "1" "0.134798" "1.6637474" "-4.35" "0.22504978" "16189" "GTCCAAGTCCACATCACTGAAAGACTTCCTGGAAAGCCTAAAGAGCATCATGCAAATGGA" "7073" "1" "0.134821" "1.6636347" "-4.35" "0.29645751" "14939" "CCCCGAGAATGTTATCTAATGCTAGTCATCATTAATAGCTCCCTACAGAACTTTCATACA" "39504" "1" "0.134834" "-1.6635715" "-4.35" "-0.24412766" "" "" "60111" "1" "0.134842" "-1.6635301" "-4.35" "-0.14830001" "" "AAGTCATTAGCATCTGCTTCCTGACCAGGCGACTTCTGCTTCCCTTCCACTGGACCTGGG" "39807" "1" "0.134844" "-1.6635196" "-4.35" "-0.17409951" "" "GGAATTATTAATACCTTTCCTCAGTTAAAAATGGAATCACTGTGTGCCCCACAAAACCAA" "25276" "1" "0.134854" "1.663472" "-4.35" "0.17390234" "239405" "CCTTAGGTCAGTTTGTCCTTAGATTATGAATTGGCAGGTTCTAATTGCATTATTTCCCTG" "55324" "1" "0.134876" "1.6633604" "-4.35" "0.1791947" "" "CACGCATTAGTGTGGAGCTGTTACAGACAGAAGAGTCTGGGGTCTCAGAGCAGATGAGCA" "33451" "1" "0.134882" "-1.6633325" "-4.35" "-0.17624586" "" "CTTGAGTACTTACTGAGTGTCTACTAAGCACAGTACTTAGCTCTGGTGCTTTCCTTGAGT" "3582" "1" "0.134917" "1.6631616" "-4.35" "0.1844549" "" "TTAAGAATAACTGTGAGAAAACGTCGATTACAGCGCCCAGGATTGTCTAGCCCAGGTCTA" "53021" "1" "0.134926" "-1.6631168" "-4.35" "-0.17836912" "54375" "ACAGGCATTAACGCTTCCTTAGATCTGAAGTCGCAGGTTAAGCTTGTCTGGTCTACATTC" "39297" "1" "0.134956" "-1.6629701" "-4.35" "-0.19423643" "" "GTCATGTGGAAAGATGGATCCATGTGTTTGTACAATGTCAGTTGTTGAATAAGCAATAAA" "43903" "1" "0.134974" "1.6628783" "-4.35" "0.24709319" "" "ATCTAGGTTTTTAAGGTATTCAGCCTCTGGTTGCTGGCCTTCAAGGTAGTGTCAGACATG" "20982" "1" "0.135011" "-1.6626988" "-4.35" "-0.24939698" "" "" "46745" "1" "0.13503" "-1.6626044" "-4.35" "-0.1471355" "" "" "49057" "1" "0.135085" "-1.6623337" "-4.35" "-0.20520873" "" "GGGATCTCTGGCAAACGCTGGGAAGATGGGTGCCATGGAATCTAAAACAAAAATTTGTTC" "27068" "1" "0.135104" "1.6622425" "-4.35" "0.17130002" "68347" "AGAACCTGTTCTGAAGGGGCCTTAAAATAAATCCTTTCCAGCCCACTGTGGGCTATCTAT" "34897" "1" "0.135109" "-1.6622151" "-4.35" "-0.15393887" "" "AAGAAACTGCGTACTCTGTCCTGCCTCCATTTCCGGATCTGATCGGGACGGATCGACGCA" "60020" "1" "0.135139" "1.6620708" "-4.35" "0.16525092" "66326" "TTGGTTCAGCCATGTCTCTGGGTGGTCATCGGGGAAGTGCAAACATGAAATGCTGTGAAC" "58106" "1" "0.135162" "-1.6619571" "-4.35" "-0.57277483" "" "" "7271" "1" "0.135174" "1.6618962" "-4.36" "0.44152206" "67168" "CTCCGTGTTCAACTGTGAAAACTGTGTTCTTGGGAACTATCTCTCCGGCTCCAACAAAAA" "864" "1" "0.135187" "-1.6618338" "-4.36" "-0.36666514" "93874" "ATGTAATTTTAGGCTGCATTGTTTTGAGTTCATTGAGTTCTTGGCCTTTTTAGGTTAAGC" "21254" "1" "0.135188" "-1.6618278" "-4.36" "-0.19936514" "225215" "ATGCCATGAAGAGAGTTGAAGAGATCAAACAGAAGCGCCAGGCCAAATTTATAATGAACA" "41427" "1" "0.135193" "1.6618062" "-4.36" "0.17526069" "" "ACTCATTCTAAAAATTTTCCTCTGCGAGGGTTGATGCCAGAGGCCTCTACTCTGTGACTT" "32915" "1" "0.135197" "-1.6617857" "-4.36" "-0.13790697" "75841" "GAGGTATTTGTTTAAAATTCAGTTCATCCAAAATGGAGTAATATGCTTCACGTCAGTGTG" "22943" "1" "0.135207" "1.6617376" "-4.36" "0.37326751" "20409" "CCTTGCCAATAAGTGAAGAGATACTTTGTTGTATAAAATACATATATGCTCACCAGGGTA" "47256" "1" "0.13522" "1.6616707" "-4.36" "0.16419032" "" "GTTAAGGACTAAAGGATGGTTTTTGTGCTTTCCTGAATGCTTTGTTTAAACAAGGAAATG" "33353" "1" "0.135223" "-1.6616566" "-4.36" "-0.27460952" "" "AGGCTACATACGAGGGACATGTTCCTTATCCTTTCGCCTAGGGGAAAGTCCCCGGACCAC" "18702" "1" "0.135228" "-1.6616343" "-4.36" "-0.14271631" "" "TTTGTGCTTGCTACTCAACACATTGAATGCGTGCTTGCCAGTCAACACATTGTCCCTGTT" "26442" "1" "0.135237" "1.6615889" "-4.36" "0.23721289" "" "AGCCCCAGGGCCATCTAAGGGCCTCCACCAAGGGCTTCTGGTGCCTAGAAGAGAAATGCC" "28992" "1" "0.13526" "1.6614765" "-4.36" "0.29154139" "22370" "GAGCCCATTCAGAGCGTCTATTTCTTCTCTGGAGACAAATACTACCGAGTCAACCTTAGA" "17772" "1" "0.135265" "1.6614512" "-4.36" "0.68892075" "114584" "GATAGTGGACAAGGGTAAGATTTTTATTTTGGGATGGGGTGGGTAGGACAACGCATTTCA" "33513" "1" "0.135285" "1.6613506" "-4.36" "0.17608139" "72000" "TGAGGGCCTCACGAACTCTTCACCCCACAGAGACCCGGGATATCTTGCCACTCCTAAGTT" "44183" "1" "0.135298" "1.6612873" "-4.36" "0.14096664" "" "AACTTAGAAGCAGTGCTTGGTGGGGGAGGACCTCCAGCAAAGAATAACTCCAATCTTTTA" "443" "1" "0.13532" "1.6611818" "-4.36" "0.17237184" "227707" "GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGGAGAAGAAGAAGAAAGAAGGAAAGAA" "16872" "1" "0.135327" "1.6611464" "-4.36" "0.44084252" "" "AGTTATTACTGTCAACATTTTTGGGGTACTCCTCCCACAGTGATTCAAGCCATGACATAA" "51030" "1" "0.135333" "1.6611192" "-4.36" "0.2038761" "" "GGTACCAATAGTGGGAAGAGAGCTGCTTACTTCAAAAGGAGTAAGGGAGCAAGAAATCCA" "61894" "1" "0.135339" "1.6610867" "-4.36" "0.2366678" "319229" "CTGGCCATCTCCTTCTTCTCAGAAAGGAAGTGCCTGCAGGCATTTGTGCTCTTCGGATGG" "12002" "1" "0.135379" "1.6608935" "-4.36" "0.19681188" "56176" "TATCGAGGTCTTCATTTGCGGCTCTCAAAACAACAAGGTTCGGGCTAAATGGATGCTTCA" "37230" "1" "0.13538" "-1.6608882" "-4.36" "-0.20631504" "" "GACCTGAGTTTGAGTTGTGTTGGATCTCAGTAAACCCAATAACACAAAGGCTTTACCACA" "15569" "1" "0.135389" "-1.6608435" "-4.36" "-0.21608018" "" "CTATGCACTTATATATCATTTAGCAAATGCTGATCAAGGGTTTACTTCACACGTTCTTCT" "18677" "1" "0.135408" "-1.6607476" "-4.36" "-0.1656969" "54201" "AACTGCGGCCGGCGCTTCTCGCAGAGCTCGCACCTCCTCACGCACATGAAGACGCACCGC" "1408" "1" "0.135416" "-1.6607091" "-4.36" "-0.44475366" "320226" "TACAAAAAACTCTACAGGAGATCCTGGAGAAGCACGAACAAGAGAAGACAGAGCTGGAGT" "32202" "1" "0.135423" "1.660674" "-4.36" "0.45922211" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "17704" "1" "0.135451" "-1.6605361" "-4.36" "-0.23854839" "" "AGTCATCACTGGTAGCAAAGACTTGCAGAACGTCAATATCACACAGCGCATCTTCTTCTG" "60481" "1" "0.135463" "-1.6604794" "-4.36" "-0.18265557" "15500" "GTATTGCAGTATGGGAGGAATATGATGCTTCTGACCTTAATGTGTTTTAATGTTCTTTGT" "6698" "1" "0.13548" "-1.6603961" "-4.36" "-0.16785558" "69726" "TATTCATTTTATGATCTGGAGTCCAATATTAGCAAACTCACTGAAGATAAGAAAGAGGGC" "29022" "1" "0.135483" "-1.6603815" "-4.36" "-0.21390323" "" "CAGGAAAGGTGTCTCCTTTTATTTAGGACTAATTATTTTAAAACGTAGGTCCTGGGATTT" "9164" "1" "0.13549" "-1.6603461" "-4.36" "-0.16823002" "" "TCAGTATCTTGAGATGAGCATCCTGGAAAAGTTAAAGGTTTTTGTTTTTACCCCTCCCCC" "15554" "1" "0.135495" "1.6603236" "-4.36" "0.254361" "27393" "GACAGAGAACACCGAATCCACCCAGTAGTGTTCTAAAATTTAAACTTGTAGAGTAAATTA" "28683" "1" "0.135495" "-1.6603224" "-4.36" "-0.20470416" "14526" "GTCACAACACCTGGATTATACTAACAGAAGACATGACCACCTGGTAACCGTAGTGGTAAA" "50240" "1" "0.135512" "-1.6602372" "-4.36" "-0.19848852" "13798" "CTGCTTACGACCGTGTATATATTTAATTTCAGGTAAGGAAAACAAATATGTGTAGCGATC" "39602" "1" "0.135531" "1.660146" "-4.36" "1.20629076" "" "GTTACATGTACAGGTACCAGCAGAAGCCAGGATCCTCACCCAAACCCTGGATTTATGGCA" "45262" "1" "0.135547" "-1.6600656" "-4.36" "-0.1516674" "72607" "CCGAGTTTGAAGAGGACAGTGACTTTGTGATCGAGATGGAGAACAATGCAAATGCCAACA" "37205" "1" "0.135593" "-1.6598411" "-4.36" "-0.16822221" "" "CATCCTTCATACTGTGTGTGTGTTTGTTTCCCACTGGAATTAAATTGCACTGTGGTAGAA" "44886" "1" "0.135601" "-1.6598044" "-4.36" "-0.17862474" "18108" "ATAGAGCTCTCACTGCAAAGAGAAAAGTGGGACTGTCTCTGTGATCCAAACAGAAATGGC" "61665" "1" "0.135608" "-1.6597697" "-4.36" "-0.18717862" "" "" "57070" "1" "0.135617" "1.6597227" "-4.36" "0.94564501" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "40660" "1" "0.135622" "-1.6596985" "-4.36" "-0.2120399" "" "GAAAGGTCACCCTCAAGACTTACAGACGAAAAGAAGTGAAGGCTGTGGTTTTGGTTTTTT" "50917" "1" "0.135651" "-1.6595599" "-4.36" "-0.20758961" "20608" "TTGTTGGGCTTCCTACCCCCGGTTCTGGCCATCGGATTATGCTACCTGCTTATTGTGGGC" "57629" "1" "0.13566" "-1.6595144" "-4.36" "-0.14753722" "210973" "GCTGGCATGTTCAACTGCATAATGCTCTGGCACTGTATTTTGAATGACATTAATTTATTA" "19000" "1" "0.135713" "1.6592556" "-4.36" "0.32825976" "18802" "AAAGGTTGAGGAAGAATGCCTGACTCAAAACTGTGACTCTAGAGAACAATGCACAGCCCT" "41837" "1" "0.135714" "-1.6592511" "-4.36" "-0.15495417" "" "" "48179" "1" "0.135718" "1.6592308" "-4.36" "0.25606808" "17939" "ACTGAAGTCAACTTCACTGTGATCATCAATCCTTCGGGGGTTGTGATGTGGTACCTCTAT" "12839" "1" "0.135721" "1.659216" "-4.36" "0.17285902" "18707" "AGCTGGAAAACCAAAGTCAACTGGCTGGCGCACAATGTGTCCAAGGATAACCGACAGTAG" "11238" "1" "0.135733" "1.659158" "-4.36" "0.45734363" "15945" "TTCCTAGTGTCTAGAAGTGGAGCAGTTATTATACCTGTCACGGGTAAAGCTGCCAAATGC" "30684" "1" "0.135741" "-1.6591189" "-4.36" "-0.17709904" "27224" "TTTTTCCTATTGCAGGTTCGATTGTGTATGATTTAATTCCCTTTAGGAATTTGTAGGCCT" "511" "1" "0.135762" "1.6590152" "-4.36" "0.51429241" "26362" "TTGAGTGTCTGAGATTCTAAAGGTCCACAGTCTAGAGTATTAGGTACGACTCCAAGGGTG" "59923" "1" "0.135764" "-1.6590036" "-4.36" "-0.32020324" "68861" "CAGCAGTGATCTTTACATTTTCTTTGCTGAAAAAGCACTGACAAAACTAAACCACCAAAA" "21366" "1" "0.135767" "-1.6589899" "-4.36" "-0.14807068" "69890" "TGTGTGCGGAAAGCGCTTCCGATTCAATTCCATCTTGGCTTTGCACCTGAGAGCCCACCC" "58976" "1" "0.135797" "1.6588429" "-4.36" "0.35613494" "" "GTTATATATGGTCTTTTCAGTGTTTTCGGTTTGTCAGTCCTACCCCATCTACTTTCATGT" "31459" "1" "0.135823" "-1.6587183" "-4.36" "-0.24346479" "" "TCTTGTTTATTGAATCTGGCATTCTCTGATATTTTTGGTCTGGCAAACCTCACCGCTAGA" "2914" "1" "0.135853" "-1.6585699" "-4.36" "-0.16970271" "209018" "AACCAAGATCTCCATTGGTCACTGTGTAACCTGAGAGCATCAGTATCCAGAGGACTCAAT" "1338" "1" "0.135876" "-1.6584557" "-4.36" "-0.19570369" "106585" "GCAGGGTAGACTTTGAAGCACTGGTTTTTTGTTGTTTGTTTTTGTTTTTGTGAAGTTATG" "17623" "1" "0.135963" "1.6580308" "-4.36" "0.16965856" "408189" "CTGTTTGGAAACATACAGGAGGACGTATTTGATATCTTCAGAAATGCTTACAACTTTTTC" "2915" "1" "0.135964" "-1.6580292" "-4.36" "-0.47373807" "" "AGACATGTAAAGAACAGGAGATGTCTTAAGGGCGTGGGGTTAAGTGTACATGGAGCTCAT" "45966" "1" "0.135969" "1.6580039" "-4.36" "0.1941947" "" "AGAGTAGAGGGAGGACACCCCCAACCCCTAGTCAGCAGCTTCCAAAAGGATGTCCATATT" "53000" "1" "0.135986" "-1.6579186" "-4.36" "-0.14250414" "" "TTGAGAGGTGTCTCACTGGAGACTTGTCCCTCACATCTGCTTTTCCATGTCCGCGTCCCC" "26841" "1" "0.136017" "1.6577676" "-4.36" "0.15417986" "" "TCTTTTCCCTTTTCTTTAGTCAGCAGGGTCCCATGGTGACCGGTTTTGAAAGCAATAGTC" "22104" "1" "0.13603" "-1.6577081" "-4.36" "-0.20835939" "" "CAGGTACATCCCACATCGACACAGACATGTAGACCTGCACATCTAGTTCTGAGATTTTTT" "3533" "1" "0.13603" "1.657704" "-4.36" "0.33284074" "20856" "AAGCAGTGAGTGGGAAGATGAACAGTCTGAGTATTCCGACATCCGGAGGTGAAATGAAAA" "46903" "1" "0.136048" "-1.6576181" "-4.36" "-0.15992505" "216169" "TCTCTCCTCATGGAAGCAAAGAGAAGGAAAGAGGGAAACTAATTAAAGGATTAAGATTTT" "36405" "1" "0.136063" "-1.6575454" "-4.36" "-0.41922358" "" "ACATACCATCAAGAGTGGTGTCCAAGCCGCTGTTCCCAGGTAGCTCCATGGTGCCACAGA" "15587" "1" "0.136066" "1.657531" "-4.36" "0.24921319" "27403" "AGACAGAGGATCTCTGTACCATACGCTGGCTCCCAGAAAGCCTTGGGCTCTGGGGGAAAT" "32058" "1" "0.136111" "-1.6573083" "-4.36" "-0.26112979" "93761" "TAAGGCAGTGTGTACGGAATGCTCCCCAGTTTAGATTTGACTGGTTCATCAAGTCGAGAA" "37316" "1" "0.136125" "1.6572411" "-4.36" "0.3108772" "" "TGAGCTGTAAGTCCAGTCAAAGTGTTTTATACAGTTCAAATCAGAAGAACTACTTGGCCT" "22557" "1" "0.136167" "1.6570389" "-4.36" "0.24832637" "381337" "CTGCCTGGTTTCTAAAGTCTCAGAGGAAGAACTAAAAATACAATTCACTAATGAGTTCTT" "42508" "1" "0.136179" "-1.6569764" "-4.36" "-0.12486997" "107569" "CTAGCTTTGAAATTGGGGTGGAGTATGGAGACATCATCTTCTGAAATTGTTTTATTTGTT" "37630" "1" "0.136193" "1.6569092" "-4.36" "0.35844349" "18950" "CTCTACTCTGTTTCCTTGATGAAGTCACTAGTCTCTGTTCTTAGATCCTAGCAGAAAGGA" "27929" "1" "0.136202" "-1.6568684" "-4.36" "-0.16305134" "58523" "AAGATGCCTGGATGTACCTCTGTGCGTTCCAAATTAAGAACATTTTTTAAATTTGTGCCC" "8081" "1" "0.136212" "1.6568178" "-4.36" "0.20761107" "" "CACTTCTCTGGGTCTATAGATATATAAAATAGTATACAGCCCATACATTTGCTGGTAGTA" "30534" "1" "0.136226" "-1.6567501" "-4.36" "-0.15293167" "" "AGTAAAATAACCAGATTCTCAGCCTATGAGGTGAAGACAAGGCCTTCTATAAGGCCCATT" "26296" "1" "0.136228" "1.6567407" "-4.36" "0.18137896" "101187" "CGAATTAAAAGGATTCAAAGGATCCAAAACTTAGACTTATGGGAGTTCTTTTGCAGGTAA" "11687" "1" "0.136236" "-1.6567022" "-4.36" "-0.14366262" "217700" "CAAGCCAGTAGCTTTCACTTCTCTTTTCTCTGAGCGGTAGGCTAAGAACTCTTGCATCTT" "15262" "1" "0.136268" "1.6565428" "-4.36" "0.18368662" "" "CAACCAAAGTTCCTTTATCTAATTTGGGTTTATCATTTATTTGCTATTGCCATGCAGGTC" "19916" "1" "0.136302" "1.6563774" "-4.36" "0.38297286" "" "TCATTCTGGAGTTGGCTACCCCCTCTCAGACATCAGTGTACTTCTGTGCCAGCGGTGATG" "12290" "1" "0.136335" "-1.6562173" "-4.36" "-0.28931625" "" "" "39379" "1" "0.136347" "1.65616" "-4.36" "0.18187464" "" "GATGAATATGAAAGCATAGTGAACCACTTCTGCATACCCATAAGAATGGCTGGAATGTAG" "31146" "1" "0.136348" "1.6561559" "-4.36" "0.58523925" "16160" "GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT" "23301" "1" "0.136368" "1.6560575" "-4.36" "0.36912726" "" "GAAACCCGTACGACAACAGTACGAAACCAACCCAGAGGACTGCTTTTCCTGGACCAACCC" "60215" "1" "0.136382" "-1.6559914" "-4.36" "-0.14970845" "408068" "TTCAAACTTCACTCCTCAAATGTATGCAGTTGTCCTCAGCACTACATCTGGATTTCTGAC" "14919" "1" "0.136385" "-1.6559751" "-4.36" "-0.20235883" "14815" "CACATCACACATAAATCTGCTTTCAGTTCCAACCAGCTTGGCTTTCAAAAATAGAGCTCC" "4123" "1" "0.136389" "-1.6559543" "-4.36" "-0.20523137" "100036521" "TGTTTATGAATGAGGTCAGACAAACCACTAGGGAAAATTGAAACCTCTTCGAAACACCAG" "50924" "1" "0.136398" "-1.6559116" "-4.36" "-0.17253371" "17330" "AAATATTTCAACGCTGTCAATAATTGTCTTTAACCTCCAAGTAGGTCTTGCAGAATCGTC" "25111" "1" "0.136412" "-1.655843" "-4.36" "-0.28842383" "217109" "AAACAAGTTTGTATACTAAAGAGATGGATGTATATGTTTATTACATAAAGAATTGTTTGT" "39316" "1" "0.136419" "-1.6558069" "-4.36" "-0.66095236" "" "TGGATGTTTTACAATAAAGTTGTTTGATGATCTTTCCCTAAGGCCTCAAAAAATAAAAAA" "38184" "1" "0.136446" "-1.6556796" "-4.36" "-0.14741786" "70979" "GTTAACCTAACTTTGATGTGCATGTGCGAAAATGATTACCTTATCATAGAAATAAGCCAG" "51398" "1" "0.136452" "1.6556479" "-4.36" "0.72442163" "" "ATACCTTGATTCCCTGAGTACTGGGACTATAGGCACATAGAATTTGAGACCTTGATTCTC" "58466" "1" "0.136527" "1.6552855" "-4.36" "0.29710876" "" "CAGAGGAATCCCTGTCCTTACAGCATCTGTGGTTATTAGAAGTTTCTGTAGTGTCACCTC" "5845" "1" "0.136533" "1.6552523" "-4.36" "0.33377329" "" "" "52932" "1" "0.136561" "1.6551189" "-4.36" "0.18870688" "" "CAATCTCCGTTTGTGTGGTAACTGCCAGTGTCTGTCCCTTTGGAAGTATACCACATCCAC" "57004" "1" "0.136568" "-1.6550821" "-4.36" "-0.19043217" "" "AAGCAAGGGTGTGTCTAAAAACCATGGCACAGAGAGCATTTGGGGATGGTATACATGACT" "8774" "1" "0.136598" "-1.6549396" "-4.36" "-0.27005054" "52589" "CATTGTCTGGAACATGAGATTTTCCTTAATAAACTGCCCCTAGCAGACTGTGTCTTAGGG" "36221" "1" "0.1366" "-1.6549288" "-4.36" "-0.22597131" "" "TCACAGATGGGACCGGACATTACTCCTTGGCTTACAAAGGATGAGGGAGCATGGTCTGCC" "17961" "1" "0.136602" "-1.6549161" "-4.36" "-0.2446051" "26931" "CTCTCCAGGGAAGAAAATATCTTACTAAACAGTGTATTTCTTTTTGGTTGAGAAGTGTGT" "34858" "1" "0.136621" "1.6548255" "-4.36" "0.41080726" "330483" "CTAGTCTTAGCGCCGAGCTGTGGGAGAGCTGCCAAGTCCATAAATGTCCCAATGAACGCA" "37537" "1" "0.136632" "1.6547699" "-4.36" "0.36426016" "80898" "ATGCAGAGTGCATTCAGATCTGTATCAGAAATATCTCGTTTTAAGATATACTTGTGAGTC" "35197" "1" "0.136657" "1.6546502" "-4.36" "0.39974775" "259055" "GAGTTAGAACCAAGCAGATCAGAGACAGAGTTACCCAAGCATTTTGTGGAAAAGGCTCAT" "37468" "1" "0.13669" "-1.6544885" "-4.36" "-0.17445579" "78925" "AGAGGAATCTTGTCTTAACACTATACTCTACTTCATTCCCTGAAACTCGTTATTTACTTG" "34870" "1" "0.136705" "-1.6544164" "-4.36" "-0.46451657" "" "ACTTGGGACTGGATCCACCCTGAGGAGCCTCGGGTCAACATCCTGTTTCCGGCAAGCCCT" "35712" "1" "0.136787" "-1.6540207" "-4.36" "-0.14518249" "330401" "ATCCTGTTCAGTATTGTGAAGTAGCCCTTAATCCTAACTTTTAAGCAAAATCCCTTGGCC" "5838" "1" "0.136798" "-1.6539646" "-4.36" "-0.36842279" "15370" "CTCTTCCGCTCTCCTTCCATGTGTACATAACTGTCACTCAAGAAGGTGATTGACAGATTC" "10125" "1" "0.136802" "-1.6539445" "-4.36" "-0.14793277" "230233" "ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT" "59845" "1" "0.136811" "1.6539004" "-4.36" "1.17631997" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "18635" "1" "0.136827" "1.6538238" "-4.36" "0.45472349" "" "GAAGCAAATTCCACCATGCACTATTTTTATTTCCTGTAATCATTTTTTCCCAGTGACCAT" "3977" "1" "0.136827" "1.6538237" "-4.36" "0.7927336" "" "TCCCAGGCCAGAGTTATTCGTACTTGGGGCTTCAAGTCCGAACATTCCTGGAGCTATGTG" "13917" "1" "0.136836" "1.6537787" "-4.36" "0.19433357" "" "ATAAAAAATACACTGAGGCTACTGGAGTGGACAGGGTCCACATGATCCCTGTTTTCCTGT" "2014" "1" "0.13685" "1.6537127" "-4.36" "0.1762277" "67343" "AAACATGAAATTCAGGAACGTGAATCTACAGCAAGCAGAAGCCTGTGGGATCTATGCTGG" "8043" "1" "0.136856" "-1.6536815" "-4.36" "-0.13921633" "" "AATAAGCTTGAGTAGCCAGCAATGTATGAGAACATCCAGGAATGTATGTTTCATCTAGAA" "11440" "1" "0.136869" "1.6536227" "-4.36" "0.31309613" "228765" "CTGGGTATTGCAGGGATGTGTCCCAGGTGATGTATATTGAGTCTGTCATTGCCGATTTTA" "59314" "1" "0.136883" "-1.6535531" "-4.36" "-0.27373867" "67897" "CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT" "35549" "1" "0.136916" "-1.6533904" "-4.36" "-0.59054921" "" "GGCTCCTGAGAGAAGGAAGCAGGAAACTTGCTTTGTTTTGTTCTTTAAAATGATTTTTAT" "30857" "1" "0.13693" "1.6533234" "-4.36" "0.14611197" "" "TTCAGATATATTTATGTTTGTCAGACATTTTGTTGGTGGCTAGTAAAGTCTACAATAACT" "39840" "1" "0.136959" "-1.653182" "-4.36" "-0.15130508" "66943" "AGTGGTGATTACCTCCAAAATAAATGCCATTGAAGGCAGCCCTGGCTGCTGAATAAACTG" "47683" "1" "0.136963" "-1.6531627" "-4.36" "-0.14624471" "68106" "TTTCCGATTTTGACATGACCCTGAGCAGATTTGCTTACAATGGACAGCGATGCCCTTCTT" "26379" "1" "0.136964" "-1.6531582" "-4.36" "-0.20375718" "" "CCAAGACAGACCCTTGCTTATCTTTTAGATGTGACTTGTCACACTTCAAAGATATATATT" "13627" "1" "0.136971" "-1.6531276" "-4.36" "-0.19238159" "76952" "AGTAGCAATGAGCGCCCGGACATTAGTTCCATCCAGAGACGGATTAAGAAAGTAACTCAT" "5930" "1" "0.137022" "1.65288" "-4.36" "0.27791496" "" "TAAGAAAGTTTTCAGGCACCGCAAATACTAGGCACTAGTCTCCCTCCATGACTTCCTGAT" "23985" "1" "0.137068" "1.6526547" "-4.36" "0.13299482" "" "" "12176" "1" "0.137074" "-1.6526257" "-4.36" "-0.14127076" "231042" "CCCATACTCCTCCCTAACTATGGCTTCTGAGATTGACTTGAATACGTTTATATATATATA" "32061" "1" "0.137122" "-1.6523943" "-4.36" "-0.29973853" "223650" "GTCGGTGTATTACAACTCAGGGTATTACAACTTTTCGTGTCTTCATGTCTTTTGATAATA" "59886" "1" "0.137125" "-1.6523771" "-4.36" "-0.13295894" "68270" "ATGTCCCCAAGGTAGAATGAGTGGGCTTTACACACCAGACACATCTGCTCTGCCCACATA" "54779" "1" "0.137136" "1.6523262" "-4.36" "0.53638462" "13386" "TACACATATTGTCTTGTGTTGCTGGTGCCATGCTACCACGCTATCTAAGAACCCCTTCCT" "51279" "1" "0.13715" "-1.6522572" "-4.36" "-0.12706922" "" "AATATCGTCACAGCAGGTTTCTAGTCCTTGGGTACAAAGCAATGTCCTTCCAATACAACC" "2275" "1" "0.137179" "1.6521153" "-4.36" "0.1551972" "" "GACTAGAAATCAAGTACCGTCGAAGATGAGGTCCAGAAGTCCGGTTCCATTTTTTCTTAA" "61743" "1" "0.137217" "-1.6519338" "-4.36" "-0.31868896" "" "CTCAGGGGGCCAGAGGCTCATCTTGGAATATTTTATAACAATATAAATAAGATTCTGGTT" "41725" "1" "0.137246" "-1.6517913" "-4.36" "-0.14842734" "69702" "GTGGAAGTTCTTCTGAGTGCTTACATAAAGATGAATCAAAGGAAGTGTACTGAAAACAAA" "12395" "1" "0.137261" "-1.6517185" "-4.36" "-0.19936265" "623223" "CCCACTCTGGGACCAACTGTACATTTTTTAACACAGTTCTATTTTTGTAATCTTTCCCAT" "40180" "1" "0.137268" "-1.651684" "-4.36" "-0.14923415" "" "CCGAGACATTGAGAAGAGCATCTGCCGGGAGATGTCTGGGGACCTGGAGCAGGGCATGCT" "22134" "1" "0.137282" "1.651618" "-4.36" "0.37585477" "20195" "ATAGCATGCCATGATTCTTTCATCCAAACTTCCCAGAAGCGAATCTAATCCTCTCAGTTC" "54907" "1" "0.137295" "-1.6515557" "-4.36" "-0.14873699" "50996" "GGACATGATCAGTCATATGACATGTTATGGTTTTTGTTTTGCCTTATTCTGGGTTTTGTT" "6517" "1" "0.137302" "-1.6515228" "-4.36" "-0.16321597" "11907" "TGTTTATAAGAATCACCAAGAAGACCCAAGTGAGGAGGCTGGTGTGCTGGAGTATGCAAA" "23133" "1" "0.137353" "1.6512765" "-4.36" "0.52261356" "58801" "GTAGATATCTTGCCCAATGGGTATTTATGGTCTGTGACTATATTTATATGTATGCTTCTG" "2037" "1" "0.137364" "1.6512208" "-4.36" "0.36340569" "" "AACTATTCCAGCTGGCTTTTGGTTTCTTCTGATGTATATCCCTTGAATAAAGCCGTGCAA" "7549" "1" "0.137364" "-1.6512193" "-4.36" "-0.18313493" "" "ACCACCTTACGGCAGGTACGGCAGGTATTAGAGAGGGCACCTGTGTGTGACACCACCTTA" "8926" "1" "0.137426" "1.6509212" "-4.36" "0.21254897" "241431" "GGAAACCATGAAAACAACAAAAATGTACACCTTTTCTTCTCTAACACTGTGAAAATCACC" "16539" "1" "0.13746" "-1.6507548" "-4.36" "-0.31624005" "114142" "ACTGTGGACGAAGTCGAATACCAGAAGCGAAGGTCACAAAAGATAACAGGAAGTCCAACT" "34397" "1" "0.137516" "-1.6504881" "-4.36" "-0.1692397" "24132" "CACAAACACACTTTTGGTTTGATCCCAGACTATCAATTGGGAAGGCAATTCTAGAGTGTT" "39182" "1" "0.13754" "1.6503723" "-4.36" "0.25861213" "" "TTCCTTATATTAGCAAAATGTACAGACATTACTCCAGGCTCTCAGGTCAGGAGGCTGGAA" "20760" "1" "0.137558" "1.6502852" "-4.36" "0.25077358" "83768" "AGACTAAAGCAACCAGCAATGCCACGGTGGCTTGGGCCTAAGAAGCAGCACCCTTCCAGA" "16458" "1" "0.137589" "1.6501323" "-4.36" "0.21202587" "56708" "GTTCAGCCAAGGACTTCAACCGGCTTAAGAAGAAGATGCAGCCTCCAGCAGCTTCAGTCA" "46304" "1" "0.137595" "-1.650102" "-4.36" "-0.19348498" "" "CAGCTCGGCATCCTTTTCTTTGAAGCTGTCGGCCCTGGTCATGAACTTCTCATAGCATTT" "55466" "1" "0.137597" "1.6500961" "-4.36" "0.33546238" "" "GTTTTTACGTTTCTCTGTATGTATGTGTGAACTGTATGTATGTGCATTTCTGCATGCTTT" "3054" "1" "0.137638" "-1.6498961" "-4.36" "-0.17597068" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "9664" "1" "0.137655" "-1.6498162" "-4.36" "-0.2010861" "53883" "TCCGGAAGGCTATGGGAACCCCGACTTCTGCTGGCTCTCTGTCTATGATACCCTCATCTG" "4618" "1" "0.137671" "-1.6497382" "-4.36" "-0.13443595" "53975" "CTAGTGACTGTCAACGGATAATTGGATATGCATTCTTCACCTAGAACAAGTGGGGTTTGG" "16936" "1" "0.137674" "-1.6497205" "-4.36" "-0.14875601" "75219" "GTATGTTTACCCAGTATGAGTTGAGTTGATGAGTTGATGTGACAACAGCCTTAAGATAGC" "11590" "1" "0.137702" "1.6495853" "-4.36" "0.25960124" "74589" "TTCCACTGCAGCTGGCTTGTCATGCTGTGGTAACAGTGAACAATAAACTGTATGTCATCG" "27803" "1" "0.137706" "1.6495697" "-4.36" "0.30210308" "" "GTGGTGAGAGAAATGGATGTGTTTTCTTTGCATAAAAACATAAAGTGGGGTTGGAAGTGC" "13587" "1" "0.137726" "-1.6494735" "-4.36" "-0.42234775" "214424" "TGCGTAGCTGTGTGTGAGGTCATCGATCATCCAGATGTCAAGTGCCAAATCAAGAAGAAG" "22292" "1" "0.137737" "-1.6494167" "-4.36" "-0.17906378" "" "GAAGTAGTAGTGATGACAATGACAGGCTGGCGTAGCAGAACTGCGCCACAGAAATGAGAA" "37934" "1" "0.137738" "-1.6494153" "-4.36" "-0.17040277" "75565" "TTATTACCGGACAAAGCTTCGAGGCCTCTACACAACCGCCAAGACTGATGCGGAGGCCGA" "28311" "1" "0.137768" "-1.6492683" "-4.36" "-0.19081658" "" "GGGTAAAATAATCTGACTATACATGAAGCATTCCATATCATGTCTGTAAACCAACACCAT" "13678" "1" "0.137778" "-1.6492219" "-4.36" "-0.19829423" "319211" "GCTGTGGTTGAAGATTTCTTTGACATCATCTATTCCATGCATGTGGAGACAGGGCCGAAT" "23921" "1" "0.137794" "-1.6491416" "-4.36" "-0.2466058" "" "AATTAAGAACAGAACACGGGCTAACATTACTCACTCCCACACCTCTGATGCTCTATCAAT" "51042" "1" "0.137808" "-1.6490747" "-4.36" "-0.2119812" "224671" "GTTCATGTGTGTACAAGGTCATGACGGGCTCACCATAGAAATAAAGCAGTGTCTTCGATA" "54647" "1" "0.137819" "-1.6490238" "-4.36" "-0.14968725" "" "TGCCATTTATGCTGGGAGCTGCTCAAAGAGAAAGCATCAGCCTTTGGCTGCCAGGCCTAG" "7689" "1" "0.13785" "-1.6488719" "-4.36" "-0.27780954" "14696" "TCTTAGATGATGGACAAATCATTACAAGTTCGGGAGACACGACTTGTGCTTTGTGGGACA" "6346" "1" "0.137871" "1.6487723" "-4.36" "0.1585655" "280662" "AGAATGGAATAGAAGGTTTTTCCGTAACCCTTTCTTGAATCATGTTCCTACAAAAGGCAA" "2912" "1" "0.137871" "-1.6487704" "-4.36" "-0.24478724" "75040" "GATGGAAAAAATGTGGTCAATGTTTTAGTGGCATTGTAGCTCAAGATAATAAATGGTCCT" "43369" "1" "0.137882" "1.6487178" "-4.36" "0.20525955" "71950" "CCATGATGAACCGATGCCAGCTGGACTAGTTTAAACAAAATAAAACACTAATTTTACCTT" "16075" "1" "0.137883" "1.6487161" "-4.36" "0.7358393" "12394" "TGTGCATCGTGTCACTGTAAATGTAATGGTACTGTTGTTACAGTGGAGGACTTGGTCAAA" "7255" "1" "0.137897" "-1.6486452" "-4.36" "-0.19652746" "11858" "TGAATGTTCCTCCCGATCTTCTGAGCGCAGTGTCCGGGATGTCTTCCATGTGGCCACAGT" "25704" "1" "0.137899" "-1.6486364" "-4.36" "-0.17886689" "" "AGATGGTGATTATTATATAATAGACTCTCTGGACAGAGGCGTGCCAGCGCTGGGAACATT" "16778" "1" "0.137926" "-1.6485058" "-4.36" "-0.16569499" "385658" "GGCTGTCATGAAATATATGCCGAAATCAGACGTGAAACCAGATCAGAAGTTAATAAAATT" "22688" "1" "0.137936" "1.6484602" "-4.36" "0.63595233" "" "TGACTTATTCCCCAAATGCTGTGGTGCCAACATCAAATAAGGCTACTCTCTGGATTCACT" "8580" "1" "0.13794" "1.6484395" "-4.36" "0.25231199" "14262" "GCAGTGGGCATAAGTCCCTTTCTCTTTAAGTTCCACCAACAATTTGTAAGGAGAATGGTA" "61899" "1" "0.137949" "-1.6483946" "-4.36" "-0.20036292" "211347" "GTCCTTAGACTGTTCAAATGGAATATGGTTAGAGTGAGTGACATTCTATGCTCTTTCTCT" "45215" "1" "0.137967" "1.6483092" "-4.36" "0.23409974" "18854" "AGTGTTTGTGACTTATGGGCTTATTTTACAGACAAGATGAGAGTTACCACTCTAAGAAAA" "48774" "1" "0.137975" "-1.6482687" "-4.36" "-0.16351238" "17528" "GAGATGTAAAGTTTCATTCCAACCTTCCTTTCCAAGTCTTGTACTCCTCCTTCGCCTTTA" "44899" "1" "0.137986" "-1.6482182" "-4.36" "-0.17198071" "75552" "TTTGCCTGGGACTAGTCATCAGGAAGTTCCTGAACAGCACCGAATTCTGCAGTAAAAAGT" "18109" "1" "0.138002" "1.6481427" "-4.36" "0.23950394" "230767" "ATAGCGAATAGCGTGTACCCCCTCCTCATAGAATATTAAATAAAGGTTGCATAATAAAAC" "60320" "1" "0.138035" "-1.6479831" "-4.36" "-0.15520262" "22390" "ACCAGAATGACTTCTGACTATTCCAAGTTTTCCACAAAATACATTTTACCTGTGAATAGC" "54410" "1" "0.138079" "1.6477675" "-4.36" "0.57662382" "" "CCACTGAGCACATTAAGCCAAGCTCTATCCATTAAGCATTTTCATCTTTGTATTTATCTA" "18795" "1" "0.138106" "-1.6476378" "-4.36" "-0.15084446" "56469" "AAGAAAGTCGAGGTCATTGACCTAACCATTGACAGCTCGTCAGATGAAGAGGAGGAAGAA" "20682" "1" "0.138139" "-1.6474827" "-4.36" "-0.20831821" "22631" "CTTACTCCTCAACAATTGAAGTGGACTTTTATGGGGTGGGGGGTGATTGGCAAAAGGTAA" "61272" "1" "0.138153" "1.6474151" "-4.36" "0.59044168" "" "AAGAAAGTCCTCGAACGACAACAAGCGCCCGCTTCGCGTCTGAAGCTGATTAAGGCTGGG" "35673" "1" "0.138157" "-1.647392" "-4.36" "-0.16436275" "" "GAGAGGTGCTTCCCTGCCGAGTGTCGCCTGCGCAGGCTGGCGTGCCAGGCGCGGGGGCTG" "19789" "1" "0.138169" "-1.6473372" "-4.36" "-0.39784216" "" "CACGGCAGCCATTTACCTTAACTGACAAAAGCTTTTTCTTTGACTTCTCTTTATAGAAAA" "23975" "1" "0.138184" "1.6472635" "-4.36" "1.12200969" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "14517" "1" "0.138187" "-1.6472511" "-4.36" "-0.1492261" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "1174" "1" "0.138188" "-1.6472458" "-4.36" "-0.20033181" "" "CTTGTCTGAATTCACTCTTGTCTGCAGCTAGAACTCTTTCTTTAAAAACCATTATTCAGA" "3784" "1" "0.13822" "1.647093" "-4.36" "0.48564042" "276891" "ACTTCTTTTCACATTCAAGTTTCTTTAAAGTTGACTATAGTGCCTTCTGAACTCTTGCAG" "15810" "1" "0.138239" "-1.6470004" "-4.36" "-0.20292236" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "22558" "1" "0.138244" "-1.6469766" "-4.36" "-0.15206037" "71989" "GGAAAGATGGCTTGGATGAACATGTATCAAGGAGCCAGGGATTTTGTCAACTAGAGTATG" "24697" "1" "0.138253" "1.646934" "-4.36" "0.4702437" "207818" "CCACTGTTCCCCAATCAGCCTCAAACTTCTACTGTTTTTATCCTAATTAAACTTATGAAA" "61049" "1" "0.138261" "-1.6468952" "-4.36" "-0.13356921" "" "GGAAAATTACCTTGCCTCAAGTTTGGGATCAGTGAGGGGAAATCCTCCCCGGCTTTCTCA" "31780" "1" "0.138277" "-1.6468192" "-4.36" "-0.14118495" "69718" "ATGGCTTCTGTATAAGAAAAGGTGCGATTGCCGCCAGTATTCAGAAGGTAGAGAAGATTC" "40271" "1" "0.138286" "-1.6467755" "-4.36" "-0.30273235" "240058" "TTACCCTCCAGCTCGGGGCTTGTTTACTTCTGATGACTTCATGGTAAATTAGAGCTGACT" "55059" "1" "0.138287" "-1.6467666" "-4.36" "-0.14425236" "18762" "TGATGAGGACGTCATAAAGAGGATCGACCAGTCCGAGTTTGAAGGCTTTGAGTACATCAA" "28831" "1" "0.138331" "-1.6465573" "-4.36" "-0.35574909" "" "CCCCAAAACTAATAAACGGACAAACAAACAAAGCAACATTCTACCACCGTGTATTATTAT" "4499" "1" "0.138341" "1.6465114" "-4.36" "0.23036551" "" "CTATCCAGGAGACCCAGTGGTTCAAGGAGTGAATGGCTTTGAGGCTGAGTTCAGCAAGAG" "30036" "1" "0.13837" "-1.6463719" "-4.36" "-0.23851184" "" "GGAATTGGGGAATGGATATCTCACCTGGTTGTCCTAATGACAGCAGGCCTCCTAGGAGGC" "57569" "1" "0.138378" "-1.6463293" "-4.36" "-0.17307078" "545975" "AAGGGTTCAGTACCATGCGAGGTGACTTTGTAAAGTTCTAAGCCATACTGACTTTCAATA" "53817" "1" "0.13843" "1.646081" "-4.36" "0.27603697" "12830" "GACAGTATTTGCTTAGTCTTCTCCCTTCAATTAGAAAAAGCCAATGGACTTTTAAAACCT" "9755" "1" "0.138452" "-1.6459751" "-4.36" "-0.13337862" "" "AGATTATCACAGCTTTTTAAAACACCAAGCTCCCTTTTCCTCAGCAGCAGTAGTCCTCTT" "9517" "1" "0.138504" "1.6457273" "-4.36" "0.20292287" "73182" "TCAGGGTCACATGCACAGCTCAAGCTGCACTCCGATGTGCTTTCCCCTGTTGCTAGATTA" "20785" "1" "0.138509" "1.6457025" "-4.36" "0.17398404" "210126" "AAGAAAATATTCTCTGTCCACATTAAATCTGTCCTCAATCTAGAAACCCTTTCAAATGCC" "52474" "1" "0.13855" "-1.6455058" "-4.36" "-0.17827092" "" "TTCTCAAATAAAAAGACTGCATTGGAAGGTGTGAGGCCTGCACTCTTTCTGGAGGGAAGT" "18091" "1" "0.138577" "-1.645376" "-4.36" "-0.14136998" "56196" "ACTCCCAGTTACTGTTCTGATTAGTGGTAGTTATTTGCTGGGAACTGACAAAGTTCATCT" "29954" "1" "0.138589" "1.645319" "-4.36" "0.2070741" "" "GGATGCTCAAGAAAGTTTGGGAGGAGCTAAGAGACATCAATTATGTAATGAAGAGACAAT" "30763" "1" "0.138622" "1.6451594" "-4.36" "0.4886117" "" "" "50706" "1" "0.138635" "-1.6450954" "-4.36" "-0.23971207" "13196" "GGATGAAGAAGTGAACTGTACAGTTTTAAACTTGATTGCCATTAAAGCAGAAGTTACAAG" "40473" "1" "0.138649" "-1.6450309" "-4.36" "-0.23073736" "" "CAGGTATGTGTCCAAGAATTGTAGTCAGTGGCTTACCTTATTATGTTTGAGACAAATATA" "30960" "1" "0.138694" "-1.6448162" "-4.36" "-0.16188045" "" "ATCATCAAATTTGTATGGTTATGGCCTGGAAGAATTATGATGTCAGAGGCTCTTCAACTA" "55953" "1" "0.138694" "-1.6448136" "-4.36" "-0.22481346" "67621" "AGGGCTGTAAAGCATCAGAGTAGCCTGTCGGGACCACAATACGAACTGTTATTTTTACCA" "33421" "1" "0.138719" "-1.644694" "-4.36" "-0.19683812" "" "GACTTGGTTGATTTCTTTTATCACTTGTTCATAGGATGGCGGGAGCTGGAGAGTAAAGAA" "41731" "1" "0.138734" "1.644624" "-4.36" "0.15203738" "71723" "ACCCCAACTGAGGTACTAAGACATCGAAGGCAGCATGTCTGAGCCAGCACTGCTCCTGGA" "58991" "1" "0.138745" "-1.6445687" "-4.36" "-0.2140242" "546336" "TTCCTCCAATAGTATGATTTTCAAACCTCCACCTACATTGCTTATATGTGGAATCCTTGA" "37502" "1" "0.138747" "1.6445615" "-4.36" "0.68302007" "" "TGGACCCTTGAACAATGGTAATGATGCTGTGCTGATAAGCTGCAAGTGCAGAAGAAAAAA" "27584" "1" "0.138748" "1.6445565" "-4.36" "0.66729201" "277666" "GTGACTCATTAGAGGCATAGAACATATGTATTCAAGCATTTTTGGATGTACTTTGGAAAG" "34420" "1" "0.138749" "1.6445496" "-4.36" "0.12476486" "73124" "CAATTGTGTATGTATGCATAGGAAATGTTCCGCTCAAATTTAGTTTGGATTTCCAGTAAC" "22035" "1" "0.138773" "-1.6444359" "-4.36" "-0.12793696" "19243" "ATCCATGGTGTATTCCTTCAGTCATTTCAAACACTGCAGGGCTTCTCTCGTTATCTGCCT" "49968" "1" "0.138774" "1.6444288" "-4.36" "0.30805866" "14114" "TTTTTTAACCAACGGGGCTCTTTGTGTTTCAAGTTGATGGCTGCTGTAGAGTGGCACATA" "38330" "1" "0.138808" "-1.6442697" "-4.36" "-0.17436812" "" "TTGAGTTCTTCAAGGTCAACCATGGTTCCAATGTATTATCAGCCCAGTGCCTTTGCCCAT" "1692" "1" "0.138814" "-1.6442387" "-4.36" "-0.2061267" "218397" "GTATTTTTGTGTGAAGTATTCACAAGGGTTAAGTTAAAATAAACTAAGGGATAGCTTGCA" "140" "1" "0.138823" "1.6441956" "-4.36" "0.22941584" "14450" "AAGAATCTGATTGAAACCATACAAACGAATGGGTCATTGGTGGCAAATGGCTTCCTGAAA" "9476" "1" "0.138834" "1.6441427" "-4.36" "0.81150539" "" "TTTAAGGTCCAGGGATTGTGTCCTATATCTCGACAAGGCTGAAGAAGGCACAGTCTCTTT" "34275" "1" "0.138859" "-1.6440247" "-4.36" "-0.15885244" "" "GGTCACATCTTCATGGCCATTTGCGGTTATCTTGATCACAAAGTGTTCATCCTGACTGCA" "44517" "1" "0.13889" "1.6438753" "-4.36" "1.14232045" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "23342" "1" "0.138898" "-1.6438357" "-4.36" "-0.17097893" "22689" "TCCTGTCATTTACACCAGGACATGTCACAGACTTTATAAGCTACCAGTGCTATCTTTGTA" "26532" "1" "0.138903" "-1.6438119" "-4.36" "-0.16467917" "" "" "38135" "1" "0.13891" "1.6437781" "-4.36" "0.54613683" "100504093" "CTTTTAGATCTCTTTCGAAAGCAGTTTTGGGAATATAGACATGATAGAGCAGACTATGAA" "56609" "1" "0.138917" "-1.6437433" "-4.36" "-0.27575075" "18549" "CCCTGAGTCTGATGCAAGAGACAGTCATTTATTTTAAAAACTGAAAAGCAAGTGAATAAC" "48873" "1" "0.138958" "-1.6435473" "-4.36" "-0.14104304" "70527" "TTTAAAAGGTCAGGGTGTTATTTTCTTCTATAATAAAACAGCTCACTTGTGTTGTGCTCC" "54151" "1" "0.13898" "-1.6434427" "-4.36" "-0.16182619" "" "GACCCACTGGTCTCTTCCCCACCAAGAGTTGAGTGCTACAGTTTGCAAAGAGTGTTTCTG" "15422" "1" "0.139012" "-1.6432924" "-4.36" "-0.16597724" "628431" "CTTGTTGGTGCTCAGCACAAATTAGTTATATATGGGGACAGTAGTTTGGTTTTTGTTTTT" "2667" "1" "0.139023" "1.6432361" "-4.36" "0.17206766" "" "AATGCTGAGAAATACTTTGTTTCCCAAATGTTCCCTTTCTCTACCTGTAAAAAGTGACAC" "54654" "1" "0.139066" "-1.6430336" "-4.36" "-0.27560097" "" "CAAAAGATCACTAAGTGTAAATGATATGGCAGACAACCTGGGAGTAACAGAGCCCTGGGA" "33806" "1" "0.139068" "1.6430229" "-4.36" "0.67842561" "21813" "TCTAGCGGGGAATTTACAGAATGCTGGTCCACTAGTGGGATTTCTAGGGTTCAAAAGTGA" "29889" "1" "0.139081" "1.6429587" "-4.36" "0.23400216" "" "CTTTCCTCTTTGATATAAAGTGATGTATATGCTTAATGAGGCCCCAAAGAGGACATTTAA" "54648" "1" "0.139084" "1.642946" "-4.36" "0.42381504" "" "TAACGACACATACATGAAGTTTAGCTGGCTTACAGTGCCTGAAAGGGCAATGGGGAAAGA" "59195" "1" "0.139087" "-1.6429334" "-4.36" "-0.13794126" "56451" "CATCATACTGATTGGTGAAATTGGTGGTCACGCTGAAGAAAATGCTGCCGCGTTTCTGAA" "25958" "1" "0.139089" "-1.6429221" "-4.36" "-0.17465689" "" "" "48125" "1" "0.139151" "1.6426255" "-4.36" "0.18711233" "" "" "3725" "1" "0.139162" "1.6425743" "-4.36" "0.64599184" "27424" "CATCTTCCTTCCCTGTTGAGACTGGACAGATCTTCTCTGATACCCCAAAGCTTGGATAAA" "46576" "1" "0.139163" "-1.6425656" "-4.36" "-0.12346128" "" "TTGTCCTAGATTTCAGGTGTCGATGAATACGGCCCACAGGGAACTGCAAGCCGGCTCGCT" "13074" "1" "0.139182" "1.6424765" "-4.36" "0.33995074" "53859" "GAAACAGCTGCTTAGGACTCATTGTAGCATTAAGTTCACTGTGAATCATTTGTTGGGAGG" "36249" "1" "0.139184" "-1.6424655" "-4.36" "-0.20921949" "627626" "AATAGCCATTCTTGTATGTTGATCTTGAGTGTAAGAGCTATGTCCATTCTGTAATTATCC" "15485" "1" "0.139211" "-1.6423396" "-4.36" "-0.13141044" "77929" "GCAAAGAAACCTGGAAAATGGTTTGTGGATGTTATATGTGCCAATAAATCCATTAGAAAG" "57014" "1" "0.139215" "-1.642317" "-4.36" "-0.17163198" "69228" "TGGTTTAGGGAAGGAAAGGTTTTGAGATCTTACCCTCTGAAAAGATTTGTGCCACACCCA" "56332" "1" "0.13923" "-1.6422483" "-4.36" "-0.26128436" "64011" "AGCCAAGTCCGTGCCCTTTTTAGCTCTTCAGTCTAACGTGGTCTCCTTTTGCCTTTTCTC" "39782" "1" "0.139242" "-1.642188" "-4.36" "-0.15500125" "66072" "CTATGCAACCTATAGTCATGCTTATAATGGTGTTTTACAAAATTATAGTCATAAGTTTTC" "49764" "1" "0.139265" "1.6420781" "-4.36" "0.14234665" "16153" "GGAAAACCTCGTTTGTACCTCTCTCCGAAATATTTATTACCTCTGATACCTCAGTTCCCA" "10060" "1" "0.139272" "1.6420471" "-4.36" "0.57798984" "74044" "TGCCATTGTACCACATTGTGTTATCATTGGTATGGTCTTAATAAACGCCTTCGGCCGTGC" "35054" "1" "0.139278" "-1.6420173" "-4.36" "-0.18116881" "171259" "CTCATCCTCTTTTGGATATTTAATTCCCTGATAAGCTCCAACTTGCTTCACTATATCACA" "1609" "1" "0.139368" "-1.6415868" "-4.36" "-0.17700434" "72754" "TATGATCTGTACATAATGGGTCTCTGGGAGATGCTGGAATAAAAGGCAAGTTATATGTGG" "20788" "1" "0.139374" "-1.6415577" "-4.36" "-0.19494173" "" "TTTACACGGGAGGAAATGCAGCCCGACACATCCGAAAAAAGCTAACTCCCATGAGTACCT" "2873" "1" "0.139392" "1.6414742" "-4.36" "0.22587454" "" "CGCTGTGGATATTTTCAGTTCTATGAGCTTGCGCATTTGCATGATTAAAATGGAAAAAAT" "7699" "1" "0.139422" "-1.6413321" "-4.36" "-0.17088354" "69944" "AAAGAATGTAGCAAAGCATTTAGTGTCAAGTCCTATCTCACTATCCATCAGAAAACTCAC" "52540" "1" "0.139423" "1.641328" "-4.36" "0.21355822" "12235" "AACAAGATTAAGACCTTGCGTAATAGGCTAATTGTGATGCTTTCAGAATATAAGCGTTCA" "8419" "1" "0.139466" "-1.6411182" "-4.37" "-0.30976831" "100040216" "CAGCAGAATCCGGTTATCTAAGAAGCTCTACATCTCCTGACAATTGCAATCTCACTTTCC" "47939" "1" "0.139468" "-1.6411123" "-4.37" "-0.13677664" "218613" "GCATGCCTGATGTGACATTCATAAATTGTACCACTATGACTTTATCCATGTAAAATAGCT" "6616" "1" "0.139473" "-1.6410867" "-4.37" "-0.19657642" "66586" "GGATGTTTGATACTGGAACCAGTGCTCATATGTCATGTAAATAGGATGAAACTTTCTATT" "42625" "1" "0.139486" "-1.6410275" "-4.37" "-0.17619849" "17716" "GCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTCTATATCC" "22392" "1" "0.139523" "1.6408479" "-4.37" "0.77084144" "" "TGGATATGAATTGTACCAGCTTTGAACCTGACACCAGAGAAATATAACCATGTTTGCAAC" "12039" "1" "0.139543" "1.6407532" "-4.37" "0.66376888" "" "CGGTGTTCTGAAACCTTCAGTGAAGAAGATAACCCAAGATCATTGACATGTCACAGGATG" "5851" "1" "0.139553" "-1.640704" "-4.37" "-0.24049403" "" "AAGAAGGATATTCCTGCCTACAGAGCTAAAGGAAAACCTGATGCTGAGAATAAGGGGGTG" "1076" "1" "0.139561" "-1.6406697" "-4.37" "-0.27905527" "208869" "AGATTATATCACCAAGCACCCAGGAGACGCTGAGAAGATCTCCCAGCTCAAAGAACTAAT" "57064" "1" "0.139599" "1.6404848" "-4.37" "0.78679985" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "26019" "1" "0.1396" "-1.640483" "-4.37" "-0.21580943" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "30557" "1" "0.139633" "1.6403225" "-4.37" "0.33860955" "" "TGAGACCACAGAAGAGGAAGCACGGAACCTAGGCAAAGTCCAGAGAGGGCACTGCTATCT" "12386" "1" "0.139682" "1.6400928" "-4.37" "0.23387869" "26373" "AGTTGCAGTGTCTCTGGCACAAGTCTGTTATAAGGTCACACAGGGTCTTTCTTTGGAAAG" "23753" "1" "0.139746" "-1.6397868" "-4.37" "-0.17353816" "" "AGGAGATGACTCTTTATAACTGCTTTACCTAATTAGTGATATTCAGAGGATTTTTCTCCA" "11378" "1" "0.139787" "1.6395919" "-4.37" "0.15718366" "" "CACATTTAAATTTCTGGGTCTACCCCACAAGGAGAATATCTACAAACTCACAGAGCTTCT" "61330" "1" "0.139788" "-1.6395842" "-4.37" "-0.14869529" "" "ATTCCACTGTGCTGATGGCTACAGGGTTTATTTGGTCAAGATACTCACTTATAATTATAC" "45185" "1" "0.139795" "-1.6395516" "-4.37" "-0.26401607" "21987" "TCAATGTATTTCCCAATCATGCAGATACTGATTATTAGCTTTGGTTTTGACTTGGTCTCC" "30524" "1" "0.139806" "-1.6394999" "-4.37" "-0.22724039" "59058" "TTCCAAAAGGGGACCTATTTGCATTCCAAAACAGAAAAACATCACAGCAATAGATTTTAC" "24517" "1" "0.139833" "-1.6393725" "-4.37" "-0.12014107" "" "ACATAACTGTGAACTTTAGGATCACTGGACAGTTGAATAGTGAGACATTGCCATTCTATG" "28679" "1" "0.139871" "1.6391911" "-4.37" "0.13263101" "" "TAGTAAGGAGAGGAAGATTTCCCCAAGATAACCCACAGAATTAAGGCTCCGAAGTGGAAG" "62477" "1" "0.139876" "-1.6391682" "-4.37" "-0.20584109" "27015" "TGTGAGCAGATGCAGTTAGAATCGGCCATGATGTCCATGAAGAACATTAGCTTAACATAA" "18057" "1" "0.139883" "-1.6391356" "-4.37" "-0.14419702" "" "AACCACATCATCCAGTGGTACCATTGTCATACATGCCTACAGCACAGTGTCAGAAGGAAT" "42738" "1" "0.139899" "-1.6390557" "-4.37" "-0.34079776" "22092" "CTCTTAGCTGTTAAGTTGTTTTTTCGGTTAACAAAATAAATCTCCAGGTGTTCAGTGTTG" "42115" "1" "0.139927" "-1.6389255" "-4.37" "-0.14707752" "" "" "47434" "1" "0.139943" "-1.6388474" "-4.37" "-0.19702788" "217198" "GGGCAGCAATGGGTGTGGACAGTTTTCTAGTTTGTTTCTTAATTTATTTGTAGAAGAAAA" "31129" "1" "0.139972" "-1.6387117" "-4.37" "-0.18036313" "" "TCACCTAGCCTTGGACATTTTATTATAACAGGAAGAAATAAAGCTGCTGTTTGTCAACTC" "40823" "1" "0.139991" "1.6386213" "-4.37" "0.33475213" "20530" "TTTTCCTTATGGTGGCCATTGCTCACCTCTTTCCCAGTTCCTGGAGACTTTGAGATGAAA" "61799" "1" "0.140003" "-1.6385631" "-4.37" "-0.14314271" "259054" "TGAGAACCAAACAAATCTATGACCGTGTGAAGAAAATATTATTGCAAGTACGAGGAAAGG" "11353" "1" "0.140004" "-1.6385595" "-4.37" "-0.26700887" "73998" "AGTTACTGAATGTAAAGCCCAGCTTGGAAGATTTGAAGGAACTGTCACCAACTGAAGGAA" "23945" "1" "0.140008" "-1.63854" "-4.37" "-0.14884819" "" "AAGTCCCAGCCAAACCAGGCAGGTATCCAGGCTCCAGGTCTCTGAGTATGGCAGTTGGTT" "17049" "1" "0.140042" "-1.6383785" "-4.37" "-0.15191011" "" "" "18641" "1" "0.140073" "-1.6382313" "-4.37" "-0.18100167" "20913" "ATAGTCAGATTTTACATGCATAAACCTCTTTATAATTAGATCTTTATAACTCAGTATGTT" "56866" "1" "0.140074" "-1.6382231" "-4.37" "-0.24614232" "" "TCAATGCTGCTGACCTACTGAAGAGAGTCCAGGGATAGAAAGTAGCTAAGAACTCAAGCT" "52764" "1" "0.140089" "-1.6381553" "-4.37" "-0.16818039" "14167" "TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT" "3664" "1" "0.140091" "-1.6381455" "-4.37" "-0.19717928" "72170" "GTTGAGACTTCTCAGCAACCAAAAGTTGTTACTCAGGAAAGTTTATCGTGAGAAAGCTGA" "8730" "1" "0.140107" "-1.6380693" "-4.37" "-0.14308803" "228012" "CTGTTTAAGATGCTGCTGGAATTATAGAGAATGTAGCCAAACAGTAATAAACAATGACAG" "62276" "1" "0.140119" "-1.6380129" "-4.37" "-0.12746253" "22025" "TGTTGGCTCCTTTGATACCTTTATCATCTCAAGATAATAAGCCAAGGATTCACCAAAAAA" "7569" "1" "0.140143" "1.6378954" "-4.37" "0.28447638" "432555" "CAAGTAGAAGAGTTTCCCACGGTATAAGAACTATCTTCCATTTAAGTATCATGAATGAGA" "13641" "1" "0.140156" "1.6378366" "-4.37" "0.2860746" "26425" "GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA" "28330" "1" "0.140162" "-1.637808" "-4.37" "-0.328332" "" "" "47153" "1" "0.140215" "-1.6375561" "-4.37" "-0.15405535" "70533" "TTAAGTCAGCTTGGTGCTGACAGCTTAACGAGCCTTAGAAAGTTAGCTGAACAGTTCCCA" "19301" "1" "0.140223" "-1.6375149" "-4.37" "-0.20850435" "110876" "ACACACGGAAAGGGTATACTTCTCATTTCAGGATGTTTTTAGATTTTTTGAGGTGCTTAA" "32004" "1" "0.140228" "-1.6374928" "-4.37" "-0.24421748" "629147" "TGTTGTTGAAGATATTGTAAAACCAAGCGCACCAACAAGCGCACCAACACTTGCGAAGAT" "59720" "1" "0.140235" "-1.6374602" "-4.37" "-0.21266819" "" "TAGTTTAGTCGTTCTGTTTATCAAAGATGCAGTACTGAGAAGCTTTTGCGAGTCTTGAAG" "54689" "1" "0.140274" "-1.637273" "-4.37" "-0.14092026" "236285" "TTTGCCAAAGCTTATCTCATTTCCAAGAAACCGCAGTACCTGGACACATGTATCCGGTGT" "55350" "1" "0.140277" "-1.6372629" "-4.37" "-0.17314464" "436440" "ATTTGAATCACCAGGACAGAGCCTTCCTCCGTTGCACAGTGGCCGTCCTGATGGAGTTGC" "47034" "1" "0.140311" "-1.6370989" "-4.37" "-0.1328192" "67511" "GGTTGGAAACAGAGCCTACAGAGTCTTAGTTACTGAGTTTATTTTCAATGAATGTGGGTT" "13793" "1" "0.140332" "-1.636998" "-4.37" "-0.14290185" "11841" "GCTGGGCTGCGGTAAACATGTGGTGATTGGTTAGACAATAAAGAACTTACTGGGAAGTAG" "24615" "1" "0.140334" "1.6369919" "-4.37" "0.52312166" "20491" "GAGTGAGGGTTATCCAGGTGCTCTTATTCCCATGGATCTACAAGGAATACAAGGCTTGTT" "22420" "1" "0.140364" "-1.6368458" "-4.37" "-0.1276634" "66665" "GGTTAACAACTTTGAGGGCTTAATGTTCACTTAGGTTCCTACATCCTGTTTGTTTTATTA" "47072" "1" "0.140389" "-1.6367303" "-4.37" "-0.16517357" "" "GTGGCAAAGGAATTGCAATTAAGAAGCAATGAACTTTTGGAACCCCAAAAGAAAGTTACA" "50199" "1" "0.140396" "-1.6366946" "-4.37" "-0.23987728" "" "GCAGAGCTATAGCAGTAAGACAGAGAAAGAACAGCCTGAACCTTGGCGATTCTCAGTAAA" "42968" "1" "0.140447" "-1.6364557" "-4.37" "-0.1714321" "" "" "3028" "1" "0.140449" "-1.6364432" "-4.37" "-0.13222386" "" "ATAAACTCCCGTGGATATCACACCGCGGTGCACACTTAGTGAACATTCATTCTGTCTATG" "39532" "1" "0.140572" "-1.6358642" "-4.37" "-0.26056175" "" "ATCAACTTCCAAGTGTTCATCATTGCTGTGAGCATGACCTCTTGGGACAAGCTGGAACAG" "29906" "1" "0.14061" "-1.6356841" "-4.37" "-0.14213347" "67115" "AAAGGCGGCTGGCAAGAAAGCGTGAGGCTACACAGAATAATAAAGGTTCTTTTTGACGGT" "32388" "1" "0.14061" "-1.6356804" "-4.37" "-0.14416155" "" "CCCTCCTCATTTTAGAATACCAGACTTAAAATTGTTTCAAAGTCTCCTTGTTACTGGAAA" "47063" "1" "0.140642" "-1.6355288" "-4.37" "-0.14741283" "69934" "TTCTCCAGGAAAAGGCTACGTTCTTCAGAATTCAGCAGAAGGATGAGCAGCCTAAGATTC" "13796" "1" "0.140663" "-1.6354298" "-4.37" "-0.18649498" "78834" "TACAACACACTCTCAAGTACTTTCAAAGAAGAACTGTATTGTTACTTGAGAAATGGTTCC" "7409" "1" "0.140674" "1.6353786" "-4.37" "0.4337353" "234686" "GGACACTGAAGAGTGGACTTGGAGATGACCTGGTGCAGGCACTGGGACTAAGCAAAGCTC" "13291" "1" "0.140804" "-1.6347644" "-4.37" "-0.16309122" "" "" "29020" "1" "0.140812" "-1.6347241" "-4.37" "-0.17091318" "666555" "ATCAAGCAAAGAAATAAACCCTGACAGGTTGTCATGGCCTCCGCATATGTGAAGTTGCCT" "47340" "1" "0.140833" "-1.6346244" "-4.37" "-0.13822893" "407786" "GCATGATGACGACGATGACAATGACACCATGTAAGGAATAAAGTCTGTTCTGCATACATT" "9070" "1" "0.14085" "1.6345449" "-4.37" "0.19410587" "269587" "AACATCATGACAACAGAGAAGAGTTTAGCGGCTGAAGCTGAGAATTCTCAGCACCAGCAA" "6324" "1" "0.140866" "1.6344726" "-4.37" "0.27311088" "211535" "GGCTGTAATCAAAGAGGATTACCCTATGAGCAAGGAGGAGTTGCTAAGCCAAGTCATGAA" "51760" "1" "0.140879" "-1.634411" "-4.37" "-0.13491501" "78912" "CTTCTGTGGAAAGAGATTCACTCGGAGCGATGAACTCCAGCGACATGCTCGAACCCACAC" "13871" "1" "0.140883" "1.634388" "-4.37" "0.23727464" "232415" "AAAGGAAGTCAGTTCCAGTGGGTACACCATAAGGATGCAAAACTTTCTTCAGATTTGTAA" "13098" "1" "0.140887" "1.63437" "-4.37" "0.76298694" "57248" "TAAAGAGCCGTTCTTGCCATCCTTTCTGCCCTGATGAAATTGAAAAGAAGTTTATCCTGG" "21866" "1" "0.140967" "-1.6339953" "-4.37" "-0.13485125" "23945" "CTTTATGAAGGAGGGAGTATATTTTCTACACAGAGACTGTGTGGAAATATCCTTTGAATT" "54892" "1" "0.140993" "-1.6338703" "-4.37" "-0.30695394" "" "TTTTGCTCTGGTTGCTCTGTGTATCTGCATCCAGCAGGCTTGGGAGATAATACAACCTTT" "51250" "1" "0.140997" "-1.6338515" "-4.37" "-0.13374672" "71834" "TGAGCAGAATACAACTGAGGCTAACTAAAAATAGGGTCTGGCCCTTGAGTGGCATGCATA" "8435" "1" "0.140997" "-1.6338493" "-4.37" "-0.17876498" "" "GACCTCTGTGAACTTGCAGATTTTCTTCTCCACATTCTTTTCTGCCTGTTTCCGTAACCT" "7916" "1" "0.141015" "1.6337659" "-4.37" "0.1573549" "258887" "GATGAAAAATGCTATGAAAAGGTTCATAGGCAACTTTCTGGGTCCCAAAGTAAATTTGTA" "46012" "1" "0.14102" "-1.633742" "-4.37" "-0.21471145" "408067" "ATTCCTAAAGGTAAAATAACTTGACACAGATGTTTGTGGATTTGGGGCTTTAAAATCCCT" "16039" "1" "0.141041" "-1.6336439" "-4.37" "-0.16034151" "331461" "ACCTCCATAGGAAATCAGCATACCTACTGTAACATCCCTATGACACTCATCAATGGGCAG" "38934" "1" "0.14106" "-1.6335537" "-4.37" "-0.26548539" "78408" "GCCAACAGCACAAGTGTTCTATACATGAGTGGCTAATTAGGTGTTTATTCTATTTATTGT" "5127" "1" "0.141084" "-1.633441" "-4.37" "-0.16587334" "53332" "ACTTCTTTCCAAGTTACATCCTTTGTTACGAACAACTCGTTTACTTATAGAACACATCAC" "56372" "1" "0.141087" "1.6334271" "-4.37" "0.16516019" "" "TCTCCTGTTGACCTTTGTGCTCAGTAAACGAAATCTTCCATCTCCGGCAGCAAATCAGTT" "37771" "1" "0.141098" "1.6333746" "-4.37" "0.25310078" "216616" "CATCTTAGCATGAAGATCAAGAAGGAGGGGTTTTTTAACTGCTTTGTAAGAAAATGGAAA" "26746" "1" "0.141099" "1.6333702" "-4.37" "0.53336204" "" "GAAAGAAAGCCATAAACCAGCTTCAGCTCCTATCAACTCACAACCAGCTTTATCTATGTC" "1316" "1" "0.141179" "-1.6329897" "-4.37" "-0.29571962" "320609" "AGTGCTGGATTACCCGTGCTGCACCATCCAGGATTTGCCAGAGCTTACTACCGAGAGTCT" "61898" "1" "0.141199" "1.6328964" "-4.37" "0.24025027" "" "GACTCTTGTCCCGGAGTCTGAGTTTTAGCCGGTAAAGTATTCGGAAGCGTAAACTTTTTT" "44634" "1" "0.141249" "-1.6326637" "-4.37" "-0.14287371" "" "ATCCAAAATGTTCTGACGAAAGTCAGTCTGGTATCTACGGCCGTAGCTGTCAATTGTCTG" "9516" "1" "0.141269" "1.6325691" "-4.37" "0.58158637" "70891" "TAACATATATTAAACTTCACCTCACTATGCTACGAGGTCCAACTATTAAGGCTTGAAGGG" "5198" "1" "0.141272" "1.632554" "-4.37" "0.14894228" "21683" "TGCAGAGCCTCTAATTCTTCAGTGGAACTTCAAGTTTGGACACTTCTTCTCATCATGACC" "491" "1" "0.141274" "-1.6325425" "-4.37" "-0.20542832" "" "" "17322" "1" "0.141295" "1.6324465" "-4.37" "0.15515527" "230398" "AGATACATTTTGTAATGACCTCTACCAGCAGCTCAATGACCTGCAAGCCTGTCTAGTGCA" "28558" "1" "0.141295" "1.6324453" "-4.37" "0.84562385" "" "AAAGTCCTGTTAGTCAACTTGTGAATGGATAAGGCAGAGTGCAGAGGAAGTAGCTCAGGA" "2040" "1" "0.141306" "1.6323931" "-4.37" "0.23188864" "" "AAGCTGTGGGGAGAGATCTATTTCTAGCCATCTACTTCAAAATCTGCTAAACAGCCAAGC" "52066" "1" "0.141315" "1.6323527" "-4.37" "0.17549717" "212439" "TAGATCTCAAAGCCATTGATAGCAGGGGGCCACTCCCTGGTCTGAGAAAACTGAATATAT" "14464" "1" "0.141315" "1.6323496" "-4.37" "0.18354527" "" "GTTGAGACGGGTAATGTGTGCTCTGCAAATGACTTTTATGTGCTTTTTTGTACATTTTAA" "28016" "1" "0.141325" "-1.6323018" "-4.37" "-0.15624543" "" "TGTTGTAGACAGTCTCTGAGGAATTATCCCCTATTGAATGGTCTCATAACAGTTTTGGAA" "930" "1" "0.141392" "1.631988" "-4.37" "0.61584008" "" "AGTGCACTATTGAATGCCTAAGCACAATTCTACATGTGGATGTGCTGCAGAGTAGCTGTG" "49146" "1" "0.141396" "-1.63197" "-4.37" "-0.16830846" "108159" "GTCTTACTTGACTGGATGATGAAAGTTGGGTACCACAAATCCCTATATAGACTTTCCACT" "6664" "1" "0.141397" "1.6319628" "-4.37" "0.17203692" "68401" "TCTCATGCTTTGCAGTCTTAGCTCCCTTTTAAAGAAGGACCTCTGTTTCCAGGAGGCTAA" "51142" "1" "0.141426" "-1.6318274" "-4.37" "-0.15356445" "241612" "GGAGCAGAACTCATCCAAACTGAACAAATATGCCTTTATGTAGGAGCAGAGGGAAATTTG" "36392" "1" "0.141428" "-1.6318188" "-4.37" "-0.2146131" "226169" "GGTTTTTAATAACAGGTGTTGAACAAATTAACTTGAATTTCTATGTAAGGTGGTGGGGGG" "15805" "1" "0.141448" "1.6317261" "-4.37" "0.16657018" "230088" "CAGCCTCAACCCTTAACTCTTGGGGCTTGGCTGAGGGGAACAAGCATTTGCTGAAACTTG" "31743" "1" "0.141462" "-1.6316591" "-4.37" "-0.14087813" "69168" "AGAGAAAGGTCCTGATGAATCGGAAAGGGCCATGATAATAAAAGAGAAGCTGGTGCATGA" "32188" "1" "0.141463" "-1.6316534" "-4.37" "-0.13913167" "231380" "ATAGCTTGGCTCTGTTTACTTAAGTCTACACGTATCTTTGAAAGTAAATGAGAGCCATGC" "35491" "1" "0.141469" "-1.6316254" "-4.37" "-0.16032422" "67381" "AGTCAGAATTACTGTAGTGTTTGGTTGTACATAGCAGCCCTGGCATGAGACTGAAGAGGA" "44826" "1" "0.141504" "-1.6314603" "-4.37" "-0.15652501" "" "CTCATGTACTACTGTTTGCTTCAAATAATCTGTAGGTTTGGGGATTTTGTTTTGGTTTTG" "12274" "1" "0.141542" "1.6312794" "-4.37" "0.61544185" "21938" "AAATCTGGGATTACAGACAATTGTGCCAAATGGGTATTGGGAACCAAAGTTGGGTTTTCT" "38854" "1" "0.141574" "-1.6311285" "-4.37" "-0.20712721" "" "ACTTCGGATACTGAAGCAGGCTACCAAAAACATATCCAGCTCACCCTGGGAGTTTCTGGG" "2550" "1" "0.141617" "-1.6309278" "-4.37" "-0.19706715" "56409" "GGCATTGCCTATGTTGAAACGTAGCCAAGATGTGAATTGAAAATAGTACTTCTCTTTATT" "46068" "1" "0.141619" "1.630921" "-4.37" "0.25423993" "19205" "GTGGAAGAGTGTAAATATTTATGATTTTATACCTGTGGGGCTGAGGCGGGTGCAGCAGTT" "12426" "1" "0.14163" "1.6308677" "-4.37" "0.48742979" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "54837" "1" "0.141654" "-1.6307554" "-4.37" "-0.19734932" "" "CCGCTCGTTCTTCCTGTCTCGTTATTGCTCATATATAGCTTTTAAGGAAATAAAAGTAAT" "34615" "1" "0.141654" "-1.6307525" "-4.37" "-0.19478662" "" "GGACTCTTCAATGATGTTGATCAGGAAAATCTCTCATTGGTGGAATTACTTCTCCAGTCT" "9628" "1" "0.141659" "-1.6307299" "-4.37" "-0.24895109" "212518" "TGGCTAGACTGTGAGCCCCTTCCAGTGATCCTCTTGGCCTGTACAAAGTTGAGCTACAGC" "27716" "1" "0.141667" "-1.6306942" "-4.37" "-0.38757629" "" "GTGAGACAATATTCCATTTTCATACCTTTTCTAGAGATCAGAAGCTACTCATTCTACACT" "41197" "1" "0.141668" "1.6306872" "-4.37" "0.20208911" "627394" "CTTGCAGAAAACCTCAGTGCAAGAGATAGATTCGGCTGTGTACTACTGTGCTATGAGTGA" "13562" "1" "0.141668" "-1.6306865" "-4.37" "-0.14878188" "" "GAAAAAGCAATGCTGTGGAATTCTTAGACCATAAAAGCCGAGTGAGAGGGGGTAAGGACT" "13819" "1" "0.141671" "-1.630676" "-4.37" "-0.16789455" "27373" "GTTCTCAACATACCTCAACTTCTGCCGCTCCCTGCGGTTCGATGATAAGCCTGACTACTC" "15248" "1" "0.141687" "-1.6305977" "-4.37" "-0.13434699" "66350" "GGTGGAGCTCCTCTTTGACAGCGTCATCCATTTAGGCTGCAAGCCATACCTGGACAGCCA" "54787" "1" "0.141705" "-1.6305165" "-4.37" "-0.14812607" "" "GAACTTGCATTGACTATGGAGGAGAATGATAAGTAGTACTTGTAGCCCTGAAACTGACTG" "37632" "1" "0.141726" "-1.6304132" "-4.37" "-0.18473105" "107817" "GCGGTGGTGCCTCTTCCCAACAAACACACCCAGAGAACTCATCAAGGTGACCCGAGAAGA" "35333" "1" "0.141735" "1.6303754" "-4.37" "0.6801378" "" "GAGTAAATTCAATGTCAACCTGGAAAATTAGGTGACACCCTGTCTAAAACTGAAACATTA" "44486" "1" "0.141739" "-1.630354" "-4.37" "-0.1692537" "19070" "TCACTGGTGTGGCACTCATGGTTTTTAAATCAGTTTAGTATTATCTGTTGATAATGCCTG" "20042" "1" "0.141746" "-1.6303216" "-4.37" "-0.17007067" "230757" "GCGGAGGCTGCAGCAGGGGTGGGAGTGGAGATAAAGAAAGATATAAGAAACTGTCCTCTT" "18005" "1" "0.141751" "-1.6302963" "-4.37" "-0.23919423" "55984" "GGCTTTGGTTGTGATTGTAGCACAAGTGAACAAACTCCATAAGAGTGTTTATAAAACTTA" "11427" "1" "0.141761" "-1.6302525" "-4.37" "-0.50990651" "228787" "TATGGATGAAGTCTAGACCCCTCAGGTGAAAGGTCACAAGGTGCCATTTGTTCTAGATGT" "5653" "1" "0.141772" "-1.6301982" "-4.37" "-0.14899222" "216560" "ACATTGGAGATGTTGGTTCTCTCAGAATGGTTCACTTTGGTTTGGTGTAAATCATCCGAA" "4728" "1" "0.141775" "-1.6301857" "-4.37" "-0.1271089" "26940" "GCAAAGTTGAGTCAGATAGAGCTGGCATGAGGAGAAAAGACTGGGCTGGTATGAAATAAT" "19568" "1" "0.141813" "-1.6300075" "-4.37" "-0.14676137" "13223" "TGCCCGAGGTGCCCGAGGTGCAAATGCAATCCAAAATAAGCCTGCAATTGGCACCAAAGA" "35559" "1" "0.141814" "-1.63" "-4.37" "-0.17152566" "" "AAACCTCAGAAACTGGCTGATATTGAAACAGCTTTTAACCATCAAGAAAAACTTTTCACT" "33789" "1" "0.141814" "-1.63" "-4.37" "-0.27855986" "30953" "CATAAGCGAATGTTTGATGAAAAGAAGCTTAAAGCCCACCGACCTGAGAGACATGACTAT" "25633" "1" "0.141815" "1.6299965" "-4.37" "0.25738937" "11670" "CCTCTTGTTCTGCTGTTTGCTGAGCACAGAGACCAATAAAAAAGCCTCTAAAGAAAAGTC" "43604" "1" "0.141828" "-1.629936" "-4.37" "-0.18164517" "" "TGGGGACACATCTCGTAGGGCTAGAGAAAACGACACACCAAATAAAAGTTGAGTGCCTTA" "24056" "1" "0.141859" "-1.6297883" "-4.37" "-0.21706064" "236915" "TGTTCTTTGCCAAGAAACTGGAGGAGAAAATACGTTGGCTTAGAGCTTTCAGAGAAGAGA" "31573" "1" "0.141887" "1.6296569" "-4.37" "1.0069553" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "57677" "1" "0.141935" "1.629433" "-4.37" "0.20044349" "27214" "ACATGGAGAATTTGCCCTGTGGTAAAATCCAGCGGAAAGTGAGAATGCTATTAGGGCAAC" "45345" "1" "0.141948" "-1.6293732" "-4.37" "-0.15212923" "12892" "GTATGTGATTGTGTTTGCCACTTTTAGGGTAAGAAAATCTACAGATTCAACATGTCTTAC" "56731" "1" "0.141952" "-1.6293534" "-4.37" "-0.20391797" "64144" "GTCCCGCATTTTAAACTTTTTTGTTAAATTGTGAAATGATGGAGGAGTTTTATAGAAAAT" "19788" "1" "0.141991" "1.6291717" "-4.37" "0.39142871" "" "TCTTTCCTATTAGCTCTCAGCTGTGCCGTGGAACTCAGTCATTAAAGAGTGTTTTAAGCC" "55151" "1" "0.142011" "-1.6290782" "-4.37" "-0.12695848" "73024" "GTGCAACTGTTGTCTCTGTTAACTTCTTAACACATGTTTTGTACTTGGTACACAAGAAAA" "20940" "1" "0.142017" "-1.6290484" "-4.37" "-0.19020648" "" "TTTCAAACAAGAGCAAGTCCGTGAGCACATGAGAGTCTGTGTGTTCATTCTGGGTGTCTA" "48776" "1" "0.142026" "1.6290084" "-4.37" "0.21328779" "" "AATCTTCTTGCTTTGCCTCAGCACCAAGCCCAAACTCTCATGCTTTGTAGTATCCATGAG" "1005" "1" "0.142038" "1.6289482" "-4.37" "0.25889029" "" "ATTGTTGTTATTCCCAGTGGAGGCCCTGGGACTACACTGTAATAAGCAATAATATTGATC" "54833" "1" "0.142058" "1.6288559" "-4.37" "1.26826524" "15951" "GTAGAAGCCTATTGAAATATCAGTCCTATAAAGACCATCTCTTAATTCTAGGAAATGGTG" "670" "1" "0.142059" "-1.6288525" "-4.37" "-0.54780028" "19657" "TACAGTAGTAATACCAAGATTTGGGGGATCCCATGGAGGTCGTGGAGAAAGCAGATATAA" "1216" "1" "0.142068" "1.6288103" "-4.37" "0.53141215" "268752" "ATGACCCCAGTGGTGTCATGATGACTCGCCCAGGGACTAGGAGACAGTGTCCCTGAAGAA" "40098" "1" "0.142102" "-1.6286483" "-4.37" "-0.22012277" "74254" "TGGTGTTGGGAATGGCGGGATCCGGGAAAACTACCTTTGTACAGAGGCTCACAGGACACC" "22191" "1" "0.142104" "-1.6286387" "-4.37" "-0.13352896" "" "" "57568" "1" "0.142127" "1.6285332" "-4.37" "0.18960186" "71785" "GAAGGGGCAAAGCTAAGAATATGGCTCTTGTTGATATCCAGCTGGATCATCATGAGCGAT" "47169" "1" "0.142142" "1.6284613" "-4.37" "0.24979834" "" "AGTATAGGAAGTGCCAGTGTAGGGACTACAATGTCAGATTAAGAATCTTAGGGCCCAGAG" "31042" "1" "0.14215" "-1.628426" "-4.37" "-0.24256126" "66734" "GGCTCCTAAACTAAGCTATTTCAGTCCCCAGTGGATTAGGCAGAGATGTGACACCCACTC" "6197" "1" "0.14215" "1.6284225" "-4.37" "0.55178453" "" "CAAGTTCCGAAAACTTTGGGGTGTCAGTGATATGACTGCGTTTTCAAAAAACCACTTACT" "16551" "1" "0.142171" "-1.6283258" "-4.37" "-0.20896918" "" "" "16363" "1" "0.142187" "1.6282528" "-4.37" "0.95079085" "320832" "GAACAAGCAGAAGTCATTGAAACCCATACTGTGCTGGTCACTGAACATCAGAGAGTGAAA" "913" "1" "0.142187" "-1.6282527" "-4.37" "-0.35565962" "" "ATATTCTTCAAATCACTGTACACCTTTGGGCATCAGAGTAGCAACATGAGGACCACCCTG" "28719" "1" "0.142201" "-1.6281838" "-4.37" "-0.13141953" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "51569" "1" "0.142239" "1.6280093" "-4.37" "0.479971" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "56913" "1" "0.142259" "-1.6279147" "-4.37" "-0.17935766" "" "GATTTTCCCCCCGTGGTTGTATTGTTCTGATTTCACGTACACCAGAGTAACTGATTTTTT" "15903" "1" "0.142262" "-1.6279016" "-4.37" "-0.15970697" "16578" "ATGCTGAGATTACAGGTTTGGGTTACTGTACTCAGCACTATTTGCTTTTTCTTTTTCTTT" "38640" "1" "0.142267" "1.6278772" "-4.37" "0.47336196" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "61960" "1" "0.142288" "-1.6277789" "-4.37" "-0.20373548" "11777" "GACTTACAGTGGGAGATGGTGGGTCTTTTTCAAAAGTGTTAAAGATATGTTTTGTTTTTC" "44422" "1" "0.142294" "-1.6277483" "-4.37" "-0.23226318" "18951" "ATCCTCCCACTACCCACACCGGATGCGGAGACCGAGAAGCTCATCAGGATGAAGGATGAA" "46348" "1" "0.142345" "-1.627512" "-4.37" "-0.59769275" "69536" "GAGTTGTTGCTGTGGATAAGGAGGAAGCTGCTGTTAGTCTGACCCATGAGAATGCTCGGA" "39222" "1" "0.142347" "-1.6275036" "-4.37" "-0.2149689" "" "AATTCTGGTTTGGCAGTGGTAGGCCAACAGCACACAGCACTGAAGTTGAATTTCTCAGTT" "50950" "1" "0.142354" "-1.6274706" "-4.37" "-0.1375659" "74781" "TTAACTATTTGGTGAAGTCTGTGGAGTCTCCTTGCTTTGCATGTGTGATGTGCCAAGCCA" "28755" "1" "0.142369" "1.6273961" "-4.37" "0.2357225" "16153" "GGAAAACCTCGTTTGTACCTCTCTCCGAAATATTTATTACCTCTGATACCTCAGTTCCCA" "34995" "1" "0.142374" "1.6273762" "-4.37" "0.21821393" "622976" "CTATAATTCGTGTGATGCTTTATTGTGACCTCATACCGGCTTACTTCTGTATTTGAATAA" "43139" "1" "0.142377" "1.6273617" "-4.37" "1.34862162" "69816" "TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA" "15687" "1" "0.142385" "-1.6273239" "-4.37" "-0.12707761" "66128" "TAACTTGCTCTTGATTATGAAATGTTCCCAGCGATGAGCTATTAAAAGCACATAGTATCT" "54340" "1" "0.142418" "1.6271711" "-4.37" "0.14797993" "640374" "TGAGTTCTCTTCTGCACTGCAGTCAATGCATCCTGAGTTCACCAGTGATAGCTTTGTTCT" "11594" "1" "0.142418" "-1.6271678" "-4.37" "-0.17554188" "" "CCACACTACGGAAGTACACGCTGCTGTCCACCAAGCTCTTCACAGCACTGAAACAGAAGG" "29149" "1" "0.14243" "-1.6271109" "-4.37" "-0.17290899" "" "CATACACAGTCTTATGTTGATCTACATTGCAGTCCATGTCATTAGGTAGATTTACCTGTT" "16041" "1" "0.142441" "-1.6270614" "-4.37" "-0.18323393" "" "TCAGTAGCTAAAAACAAAACACGAAATAAGCAAGGCATGGGAGATGGCTCAGCCCTTGCA" "22361" "1" "0.142489" "-1.6268357" "-4.37" "-0.22669874" "54006" "GGAGGCCATGAGTGAGTGTACCGGCTGCCACAAGGTTAACTACTGCTCTACGTTCTGCCA" "15332" "1" "0.142492" "-1.6268224" "-4.37" "-0.16354646" "" "GTCTGAATTTGAGGGTGAGAGAATACATTTGCTAACACGAATCATGGGTCAAATTATCCC" "35243" "1" "0.14252" "-1.6266939" "-4.37" "-0.15574088" "70675" "AGTTTGGATGCATAGTTTACTCCAGTAGACCATTAGCATTTGCTTATATTGCTTTCATGC" "29932" "1" "0.142554" "-1.6265318" "-4.37" "-0.24837295" "" "" "61341" "1" "0.142703" "-1.6258338" "-4.37" "-0.14060583" "" "ACTACCCAGGCCATTCGAATGGGCGCAATTTACTCGTTTTAGCAACAGGAAGCAAATACA" "57249" "1" "0.142715" "-1.6257797" "-4.37" "-0.20495874" "" "CAGTGTGACAGGGAAGCTCCCTCTGCTGCAAGCAAGCCCACCTTGTCCTCACTCCTGTCT" "59591" "1" "0.142733" "1.6256969" "-4.37" "0.16344156" "170707" "TGCTCCATTTGACCAGAATTTGTCAATTGATGGAAAGATTTTAAACGACGACTGTGCCAC" "48869" "1" "0.14274" "-1.6256648" "-4.37" "-0.13151863" "" "GGAGAAGTCCTTTGTTAAGGAAGGCTTTGTAAATGATCATACTCACCCTTTCCCACACTG" "37326" "1" "0.142747" "1.6256325" "-4.37" "0.4421577" "" "GCCAAGAAAATTAACACGGAGCTCTTTGTGTGTTTGTATGGTAAGAATATTTAAAACGCA" "25298" "1" "0.142765" "1.6255477" "-4.37" "0.90422438" "" "AAACACATACCAGGGACAGACTGTCATGATAACGACAGCATAGGAGGAAACAACAACTAG" "4834" "1" "0.142773" "1.625511" "-4.37" "0.27870969" "20975" "TTAGATCCCCAATGCCTAAATCTGAAGAAAGCAGAAGTGTCAATAAAACAAAGGGAAGCC" "30610" "1" "0.142774" "-1.6255023" "-4.37" "-0.41450251" "57740" "ATGCCATCCAGCAAGACTTCGTGATTTTTAACAGAGAAAAGTTGAAGAGGAGCCAGGAAC" "29278" "1" "0.142802" "1.6253752" "-4.37" "0.22185521" "258327" "AATGCTGAACCCTTTGATCTATACTTTGAGGAATAAGGAAGTAAAGATAGCCCTGAAAAA" "39489" "1" "0.142804" "1.6253641" "-4.37" "0.72093511" "18414" "ATTGCAGATGCTCTGTTTACATTTTCTTGTCAATGGACTTCTCACTGGAAACTTGCACCC" "62116" "1" "0.14282" "-1.6252911" "-4.37" "-0.17111975" "20254" "GAATTATTTTGTTACTGTCTGTAGTGTTTTGTGGAGTTCTGGAGCAAAACCAATAAAGCA" "113" "1" "0.142833" "1.625228" "-4.37" "0.21752131" "" "TGGGAAGAGCTTGCATTGCCAATCACACAACAGCTTTGTATCTCAAAGGCTCTAATCCCA" "61897" "1" "0.14284" "1.6251975" "-4.37" "0.42200491" "" "TTGATTCAAGTTTTCTAAACTATGACACCTGCCCAGGGATAGGCAGGGTTAGAAGGCAGT" "38060" "1" "0.142886" "-1.6249792" "-4.37" "-0.12243261" "67665" "CAGGTTACTGTTTTGCCTTATTGCTTAATGTAGTGAATAAAGCAGACAAAGCTCGTGTGT" "46721" "1" "0.142993" "-1.6244828" "-4.37" "-0.33628612" "74337" "CCCTTCTGCAATGAAGCCTTTATACTTGAAAATTAAATGTTAAGGCACTCTGGCTTTAAG" "19933" "1" "0.143002" "1.6244423" "-4.37" "0.13342667" "19657" "AGACACTTTGCAGTTAAAAGAAATCCATCTTCAAAAAGGGATGATCCCCCTTCTAAAAGA" "62833" "1" "0.143003" "1.6244354" "-4.37" "0.20093903" "66467" "GCTCCCTCCCACACAAATACGGAAATATAAGAAAATGAAATCATAAATGTTTTTCCTACC" "23883" "1" "0.143007" "1.6244162" "-4.37" "0.36073894" "" "TTGATGCTGTTCAAAGCGAAGCTGCGCTGGAGGAGTACAGCCAGACACTGCAAGGCTCCA" "38227" "1" "0.143015" "-1.6243798" "-4.37" "-0.21492509" "71059" "GTTGGATCTTTAATGTCATCTAACTTTTTACACAGCAATTAAACAACCTTGTGAGAGCCA" "8616" "1" "0.143059" "-1.6241745" "-4.37" "-0.15846071" "" "ATGGTTCAGCCCAAACAGCTAAGGCCTGCGAGGGAGGAGGAAGAAGACTTCATAAGGGCA" "997" "1" "0.143063" "-1.624157" "-4.37" "-0.2811697" "74186" "TTTCATCACTCATGTTTCCAAACTGGAATTAAGCTCAACCTAACTTTGTGGAGTCTTAAC" "54734" "1" "0.143068" "-1.6241326" "-4.37" "-0.18978172" "" "TCCAGAGGTCAAGGTCAGGCAGGACATTTTCATTTGAAGACCTTCACCTGTGTTTAGATG" "9946" "1" "0.143095" "-1.624009" "-4.37" "-0.20021839" "20604" "AAGACATTCACATCCTGTTAGCTTTAATATTGTTGTCCTAGCCAGACCTCTGATCCCTCT" "55863" "1" "0.143117" "-1.6239024" "-4.37" "-0.18779989" "" "GGCGGCGACGGTGGCGTCACCATCACCATCAGAGAAAAAGAAATATGCCTTTATGTCATG" "36723" "1" "0.143119" "-1.6238947" "-4.37" "-0.15154986" "74108" "AACAGATGCCCAGGCTTTGAGAGCTTGTTATTTCAAGTTTCTTTCCCTCAGATAGGAGTG" "16390" "1" "0.143138" "-1.6238066" "-4.37" "-0.13598492" "78796" "TGTGGGATTCAAACGCTGCCCCTAGAACTCTGAGCCAAATTAAAATGAGCTGAGCGAACC" "49676" "1" "0.143145" "-1.6237748" "-4.37" "-0.16104554" "93687" "CCGTCTTACAACTGAACATGTATGTGTGTTGCTTAGATAAATGTAATCACTGTAAACATC" "44477" "1" "0.14322" "-1.6234233" "-4.37" "-0.3862797" "245269" "GGATGAATTGCTGTTGTGCTCATGTGAGATGACGCTAATGCTCTGATAAACACCCAGTTC" "12178" "1" "0.143227" "-1.6233909" "-4.37" "-0.1517904" "72147" "TGCTCGGTGATGATGGCTCACTTCTGTTCGAGTACCTGCCCAAAGGTGCCCACTCACTGT" "27603" "1" "0.143253" "-1.6232717" "-4.37" "-0.18856203" "66231" "GCTTTCAAGTATTCATGTGTCGTTCATATTTCTTCACAGAACGGAAATGTATCCCATATA" "43114" "1" "0.143271" "1.6231882" "-4.37" "0.76042251" "12362" "CTATGCTGAGAATCGTGCCAATAAGAAGCCAATACTTCCTTAGATGATGCAATAAATATT" "3140" "1" "0.143281" "1.6231423" "-4.37" "0.3945881" "" "GAAACTAGAGCTGCTCTGGATGCCGTGTGTCAGACCTGTATCACTGACCAAGCCATTAGA" "36964" "1" "0.143299" "1.6230548" "-4.37" "0.50128315" "68662" "GTTGAGGGGAACCTGGGAAAATTCTGCCTGACGAGATGCCTGACGAGATATTTTTCTTTA" "6516" "1" "0.143306" "1.6230231" "-4.37" "0.17272281" "16630" "GTTGCTGGATTGGATTGTCATATGATAATAAGAAGAAAGATTGGGCATGGATTAACAATG" "62439" "1" "0.143319" "1.6229619" "-4.37" "0.44104384" "268591" "GTAGCATACTTGAGTAATCAGGGTCAAAGTGTCTCACCACAAACAAAGGTATCAAATCAC" "22286" "1" "0.143375" "-1.6227043" "-4.37" "-0.15305773" "15469" "ACGTGTATGGCTTTGATATGTCCTGCATTAAAGACGTGGCCATCAAGGAGCCCCTGGTGG" "57949" "1" "0.143392" "1.6226247" "-4.37" "0.14073434" "404195" "ATCATTGGATGTTACAATTCCTCGGGACTTTATTGATTATTTCCTAATTAAAGGAGCCCA" "46334" "1" "0.143401" "1.6225804" "-4.37" "0.17043962" "446099" "GTGAAACTGTTGTGTGATGTCTTGAACCAGGCAGAGTGCAACATAGAAAAGCTGATGTAA" "31319" "1" "0.143407" "-1.6225528" "-4.37" "-0.1463899" "226470" "TGGTTGAAGTCTTGGTGAAAGAAAATAGGATTTACAGCAGCGCTTCACAGATTAAGTTTA" "38305" "1" "0.143448" "-1.6223647" "-4.37" "-0.24250684" "72899" "TATCTGATCTTGTTTTCCAGTCCATTTTGAACCAAGAAAGACTCATTGAAGACTCCTTGA" "32796" "1" "0.143456" "-1.6223265" "-4.37" "-0.22132958" "224598" "CCCACAAATGTAGTCTTAGTATTCATCAGGGGATTCATGCAAGAGCAAAACTTAAAAAAT" "60246" "1" "0.143457" "-1.6223237" "-4.37" "-0.16921774" "" "GAACATACATTTGACATTTTCTGCTTTCTGACTGTGGATTGAATATGACCAGCTGCCTTA" "21410" "1" "0.143479" "-1.6222212" "-4.37" "-0.1827051" "71726" "AGCTCCAGAGAGGGAGACTAAACCTTTGAGGATTCCCCAGTGATAGAAGTGTTGTAATTA" "32474" "1" "0.143508" "1.6220849" "-4.37" "0.67401377" "74202" "CTGCATACCAAGATACACGTTTGTGCACACACATCTAATAGAGATAAAATGTAAAGTAGA" "2180" "1" "0.143536" "1.6219559" "-4.37" "0.3948334" "" "TATAATTGGCATAGAGGAACCCTGAGTCAAGCTGTGGAAATCACTCAGTACTCCAGACCA" "10554" "1" "0.143582" "1.6217409" "-4.37" "0.6421977" "117004" "TTGTGCTTCCCATCTGACAGCTATAACCATCTTCCATGGAACAATCCTATTCCTATACTG" "26069" "1" "0.143596" "-1.6216739" "-4.37" "-0.16567187" "" "ATTCAAGGTTTTCAACTAGCAGGCCATTGTGGCCATCCTAAAGTCAGATTGCTGCATTAA" "40522" "1" "0.1436" "-1.6216582" "-4.37" "-0.16138088" "14391" "GCTTAAGCATGGTGCTGACGTCAATGCAAAGGATATGTTAAAGATGACAGCTCTGCATTG" "1169" "1" "0.143656" "1.6213985" "-4.37" "0.28185377" "" "TGGATATGTCAATGAGGCACAGATATCCTAGGGACTGGGGCAGAGGTCACAGCTGGCCCT" "53752" "1" "0.143686" "-1.6212583" "-4.37" "-0.25239876" "77634" "TCTATTTTGAAGGAACATTTTACAATGACAGAAGATACCCAGAATGCAGAGACTTGAGCA" "26772" "1" "0.143708" "1.6211546" "-4.37" "0.2216875" "" "ACAATCTGCCTGATGGCTGTCAAACCTTCCAGGATACTCAACGGCTGGCGCTTGCCTGCT" "30735" "1" "0.143751" "1.620957" "-4.37" "0.51395437" "545384" "TTGCTTTAAAACTGGGTCTGCAGACCAAGGTGCAATAAACATGTTTCATGAAATATTTTC" "5364" "1" "0.143775" "1.6208444" "-4.37" "0.58755052" "19378" "AACCAGCTAGCTCCCTTCAACCCACAGTATAGAATGTGAAAATGAAGATTTATGACTTTT" "6946" "1" "0.143778" "-1.6208287" "-4.37" "-0.19038318" "73242" "CAATATTGCCAAACTCTTACTTTCCAAGTGTTATGTAGATATGTCAGACTAATGTTGCTC" "24384" "1" "0.143792" "1.6207634" "-4.37" "0.52370517" "" "AGTCATCTGAACCAGCCAGTTTTTCTTAAATGCATATCCCCTCTGTTGGGGCTCTGAGAA" "44001" "1" "0.143804" "1.6207114" "-4.37" "0.23581713" "" "GTCTCTAAGTCAGCTGAGGCGTTACAGTTGCAGAAGGTGCTAAATCAACATCTTTATTAA" "6721" "1" "0.143854" "1.6204799" "-4.38" "0.25272668" "101100" "GCTGTTGGACTTGGATGGTTTCCTGGAATTTGATGACCTAGATGGGATACATGCTTTGAT" "8485" "1" "0.143854" "-1.620477" "-4.38" "-0.3932832" "100505195" "TTGAATTTAGCAACTAAGTAAATCCGATCCTTCCACTGGGCACCTGACTCATAAGCTCCC" "9046" "1" "0.143855" "-1.6204748" "-4.38" "-0.17786095" "70901" "GCTGCAAAAGTAACTGGACAGTGTAACTCTGGACACTATGTTGATAAATGAGCTTCCTCT" "43414" "1" "0.14386" "-1.6204517" "-4.38" "-0.22466413" "114255" "GGTTCTGATTTGTGGGAACAGACCTTGTAAATAACCACTGTTCACATGTGTGGCAGAATG" "27699" "1" "0.143887" "1.6203247" "-4.38" "0.30258633" "" "TGTTGGCAATTTCCCCTTCAAAACCACCTGAACTGGAGCCCCATTCATTAGCATGAGAAT" "21323" "1" "0.143891" "-1.6203057" "-4.38" "-0.19221566" "241391" "GCTTGTAACCCAATGGAACTGCAACAAAAGTGGAAATTTGAAAAATACTACGAAGTCTAA" "31638" "1" "0.143923" "-1.6201564" "-4.38" "-0.20415168" "140483" "GAAAGAAAATACTCTGTCTAAACACTGCCTAACTGAAAACATGTGACTTGAGTTTCATTG" "386" "1" "0.143928" "-1.6201354" "-4.38" "-0.24102269" "" "AACCAAAGTCATTCTCACTGATAAAACATTCTCTTATTTTCAAATTTGGGGGCTGGGGGC" "60488" "1" "0.143937" "-1.620092" "-4.38" "-0.14208753" "12068" "TGGGCCATTTGATCATTATTTGTGTCAGAATAATGTGAAGTGAAGTGATTGCTAAGCTCT" "36266" "1" "0.143946" "-1.620049" "-4.38" "-0.17932613" "209361" "GTGAGGAGCGTCGTGACTGAGACGGTCAGCACTTATGTGATCCGTGATGAGTGGGGCAAT" "3296" "1" "0.144007" "-1.6197662" "-4.38" "-0.26862511" "72795" "CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA" "36565" "1" "0.144019" "-1.619713" "-4.38" "-0.14354842" "56433" "GAATCCAGACTTTGTGTGTATGTTTTCTCTTCTCTGGTAATAAATGTGTACCTTCCATTT" "57960" "1" "0.144049" "-1.6195756" "-4.38" "-0.20669592" "73681" "CTTTTGAGCCTTGTTAAGTGTCAGGGACTGGTATATATATATATAGAGAGAGAAAGTGTT" "49297" "1" "0.144117" "-1.6192604" "-4.38" "-0.14587542" "66098" "CGAGAAACAGTATGTGCTACTGATTGAAAACAAATAAAGCAGATGTCTTTGTTTGCAGTC" "30828" "1" "0.144118" "-1.6192557" "-4.38" "-0.17912804" "72899" "GCCAAAACCTAAAACATACAGTCTGTGTGTTTATCACTAGACCTTTGTAATGTATTTCTC" "41953" "1" "0.144124" "-1.6192272" "-4.38" "-0.1875532" "" "TGTACTGGTTTAGGATCCTAGGAAGGTAATCAATCATCCTCAGAGTGTCAGAATCCTCGC" "36985" "1" "0.14413" "-1.6191985" "-4.38" "-0.13218618" "57815" "CACTGGAGTTGAAGAGCCAATGTTTTGACTCATTTGAGTATAATAAACATTTCTCTGGGC" "56979" "1" "0.144135" "1.6191744" "-4.38" "0.37481368" "19698" "GAAGATGGGGAGCACTCCGGTTCTCTTTGAGCCCATTTTACAGAATGCTGAGTCCGAAGA" "5952" "1" "0.144156" "-1.6190787" "-4.38" "-0.14320294" "76123" "CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT" "29665" "1" "0.14416" "-1.6190583" "-4.38" "-0.23898095" "" "TACAAGAGAAATTGGCAAGAAAAACCATGCAGAGGTGGCCCAGTGCTTCTCATTAGAGAA" "18351" "1" "0.144215" "-1.6188047" "-4.38" "-0.22355671" "" "CAGGGGCTAGGTGAATAACAAAAGCTAGTCTTGTATAATATAAAAACTAGTGAGTACTAG" "27436" "1" "0.144242" "-1.6186803" "-4.38" "-0.15552219" "28000" "GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT" "31620" "1" "0.144261" "-1.6185905" "-4.38" "-0.22073038" "" "" "16692" "1" "0.144265" "-1.6185753" "-4.38" "-0.22018293" "56421" "CTTCATGGTCTCAGAATTTCCTTCAGAGTTTTTGCCAGTCAATAAACACCTTTGGTTGGT" "50549" "1" "0.144289" "1.6184611" "-4.38" "0.2322204" "75778" "ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT" "45183" "1" "0.144303" "1.6183979" "-4.38" "0.22736427" "" "CAAGAGCCCTGGCAGGTATTTTATATACAGTATTTTTACCCAACACATAGTAATTTGATC" "47303" "1" "0.144394" "-1.6179794" "-4.38" "-0.14573655" "237558" "ACTGATAGTCTTCCAGTGCAAATACACGCTAGGGAATATATGTTTCCGCAGTCAACGGGA" "22306" "1" "0.14442" "-1.6178557" "-4.38" "-0.17971391" "" "GATTTTTAAAATGTACCCTTTAAGAATTAAGGATCTTTACAGCAATATGTATCATGAACT" "34010" "1" "0.14444" "1.6177671" "-4.38" "0.84594416" "" "GGTTTTTGATTTAATGAATTTTAGTCTGAATTTTAAGTACTAGTTATTGATTTAATTTAG" "28040" "1" "0.144449" "-1.6177212" "-4.38" "-0.16670827" "15505" "ATGAACTACACTGCTTGGTCACACGCTGGGATCAGAATCTTAAGCAGTTATTCTTGCCAA" "55165" "1" "0.144457" "-1.6176854" "-4.38" "-0.16958678" "52846" "TCCAGCGAAACTTCCAGATCTAGTGGAGAACAACCCTTTAGTCGCTATAGAAATGCTGCT" "16024" "1" "0.144462" "-1.6176642" "-4.38" "-0.24184271" "71096" "GATACAGCTGCCATCATGTTTGGTGACAAGGATTGATTGGTGTAAAGTATGTAAATAATA" "36648" "1" "0.144466" "1.6176443" "-4.38" "0.2566678" "" "ATCATTACACTGTCAGATGTTTCTGACATTTTAAGTCAGAGTCAAAGCTAGCTACTTCCT" "31861" "1" "0.144469" "-1.6176305" "-4.38" "-0.23727205" "241950" "CCCAGCTGTATAAGAACAGCAAGCACTTTTGAGTCATTTCTCCAGACTTAATAAATTTTA" "30552" "1" "0.144469" "-1.6176297" "-4.38" "-0.2015064" "" "AGCTACCCAGAGGCTGGCTCAGACGAAGCACATCTAAGTTTGGTTGTGTAATTATTTTTT" "48230" "1" "0.14448" "1.6175812" "-4.38" "0.13208078" "71768" "TGATCCCATCAGCGCATACTCTTGACATTGACGTCATGTGACATCCATCCTAGAAGTGTT" "6972" "1" "0.144544" "-1.6172823" "-4.38" "-0.61708094" "633640" "ACACGTGGAAACGCTTCACTGTCCATTGTATCTGTCGCCGTCACGGGCGCTCTTTCACAC" "6467" "1" "0.144548" "-1.6172673" "-4.38" "-0.14874147" "69071" "TTTCTATCTTGAACAGATAGCCTGCTCTGGGTTATTCTGGTGCTGGTTCTATGAACGGCT" "17737" "1" "0.144563" "-1.6171985" "-4.38" "-0.16642154" "" "AGAACTTTCCATTCTGGCCTGTTATTTCCTTTCAAATATTCTGTCCAGTCACGCCCGCTG" "46739" "1" "0.144572" "1.6171549" "-4.38" "0.53180713" "23943" "CAGAGATAGACCTTTCCCAGGGTGCAGCCCAGTGGTATGACCTGATGGATGACAGAGATA" "54518" "1" "0.144581" "1.6171155" "-4.38" "0.95489449" "" "GGTAAGGAGGAGCCTCCTCCATCCACCCTACACACGTCGAACTTTGCTCTTTCAGTCGTC" "25186" "1" "0.144594" "1.6170513" "-4.38" "0.63957551" "" "AATTGTGAAAGAGCTTGATGATACGAAGCCTGCCAAGTAGAGACGCCAGAAACCTGCAAT" "42707" "1" "0.144597" "-1.6170375" "-4.38" "-0.16497932" "" "AATATGGGCAATTCATGTACTTTTCGCCTTGTACTCTCCCTGGCTCACTGCTTTGTCAGA" "59221" "1" "0.144624" "-1.6169128" "-4.38" "-0.21102728" "26429" "CTTGTGAAAACAAGCCTCAAAGCCATATGGACACTGTGACAATGACTAAGCCAAGCTGTG" "7011" "1" "0.144638" "1.6168519" "-4.38" "0.40212589" "102294" "TGTGGAAGTCAAGACCGTGATTGGATGAGTTAGAACTCAGGATTTATGTCCTTGATGTGG" "3886" "1" "0.144652" "-1.6167865" "-4.38" "-0.1419316" "" "TTCATTGTGGATCTGACATGCCACCTAGAGAAACCTGCCAAGTATGATGACGTCAAGAAG" "52857" "1" "0.144744" "1.616361" "-4.38" "0.17749719" "" "TGTGTGCACGGGGCACGCACCTGTGCCACCATCACCTACAGCAATAAAAACAGGTCCATC" "40302" "1" "0.144748" "-1.6163437" "-4.38" "-0.13775669" "" "TTCTTTAAACTCTGCAGCAGCAGTGGCGGGCTGACAGCCTGCCTCCACAGTGTGAGGTAA" "36396" "1" "0.144762" "-1.6162777" "-4.38" "-0.16352263" "20231" "GACCTCATTCTTCCCTTTGATTTACTTCGAGGGCTCTGTTCTTTACCGTGTCTGGCTAAT" "9398" "1" "0.144791" "1.616144" "-4.38" "0.36323724" "" "AATATATTAATTATAACATCCCCAGGGACCAGAGCACAGGGCAGTGATGCTAGGAGGGTT" "62013" "1" "0.144799" "1.6161087" "-4.38" "0.15130138" "" "TGCGTGTGTGCTGGCTTTTTTCTCTCTTTGGTGGGTTGCTATCTCCTCCGCCAGTGGGTT" "908" "1" "0.144805" "1.6160807" "-4.38" "0.6274099" "" "AACAAAGTCGTGAATAACGTGTAGGTTTAGGAGAGAACGCACAGAAGGTAACTCCAGTGG" "32758" "1" "0.144813" "-1.6160419" "-4.38" "-0.27142057" "" "" "2003" "1" "0.144826" "1.6159838" "-4.38" "1.02432747" "" "" "36417" "1" "0.144839" "-1.6159252" "-4.38" "-0.16137736" "18663" "AAAGCTCTCATGGATGAAGTTGTAAAGGCCACCTCCAATGGCTGTGTCACCATTATAGGA" "43512" "1" "0.144842" "1.6159116" "-4.38" "0.17839957" "" "GTAATAGTGACCTTCTGGGCAAGATGGAAGATTAGAGCTTTAATTATGTAAAGAAGCAAA" "26748" "1" "0.144857" "1.6158424" "-4.38" "0.3053888" "" "CCCAGACAAAACTTATGTTGGGAATGTGCAAAGAAACAAGAAACATAACGCTCTTATACC" "29256" "1" "0.144877" "1.6157505" "-4.38" "0.56880158" "74732" "GTTTATCCTCTCTGGAAAGTTCCTTGGTGCTATATGGTTTTGAATGACATTCACTTCAGT" "28287" "1" "0.144878" "1.6157423" "-4.38" "0.46589231" "12977" "TGTGGGGCTTACTTAGCCTTCTGGTTACAGACTATTTCCATGCTAGAAAATACATATTTT" "22930" "1" "0.144881" "-1.6157297" "-4.38" "-0.23287093" "22173" "TACTCTGCTACCTAGCATGTATATATAAATCTACCCAACAAATGTTCATTACAGCTGACA" "60595" "1" "0.144892" "1.6156803" "-4.38" "0.17153953" "627264" "GAGTAACTTTCAGAAAGACAACAGGTTATAAAATCCTCACCTTTGAATATAACAAGGAGC" "36922" "1" "0.144904" "1.6156224" "-4.38" "0.56425693" "" "GTGGAGCATCCCTTTTGAAAACTACAGAGTAATTCACAGTGATGTGATAAATTTGCAAAA" "62109" "1" "0.144921" "1.6155461" "-4.38" "0.13049273" "" "TTGTTTTGGTTCACATGGATTAAGGAGCCTATGGGCTGCTTCCTCTCACCAAGATTCTCT" "59872" "1" "0.14493" "1.6155056" "-4.38" "0.19232134" "71137" "ATCCCGACTTCCTGGTGATGTCATTCCTACTTCCTGGAGTCCCTGGAAGTTTTTGAAAAT" "23718" "1" "0.144943" "1.6154448" "-4.38" "0.56798528" "71862" "GGTATTAATCCAAATGCAAAGTAAACACATTAACATGTGTCCAGCTTGATGTTTTACTCC" "15321" "1" "0.144944" "1.6154392" "-4.38" "0.45904577" "" "AATCAGAACTGTTAGCATGTACGCATGCATGCATGCATGCATGCATGTGTGTGTGTCTGT" "9701" "1" "0.144957" "-1.6153796" "-4.38" "-0.18605886" "319371" "CATGGAAGAATGAACACTTTCCACTTTTGTGTATATGCAGTAATAGCTGGCAGAATTTTT" "30186" "1" "0.144995" "1.6152048" "-4.38" "0.80381134" "17921" "ATATGGATGGCACAGAGGAATCAAGGACAACTTAGCTCTCTGCATACTTGGAACAACCAA" "9580" "1" "0.145003" "1.6151663" "-4.38" "0.61127213" "17345" "CAGTGAACCTAAGCCAAGGGTAACTCGTGGAACCAAGAAAGATGCAAAAACTCTGAAGGA" "55989" "1" "0.145021" "1.6150837" "-4.38" "0.15411713" "791324" "ATAATTACCGTTGTCAAGAAGCTTGTAGAAGTAGACATTCTTCCTTAGAACCAAAGATTC" "43439" "1" "0.145083" "-1.6148016" "-4.38" "-0.15314436" "" "AAACGTTGTCTGTGCAAGGCCAGAGACAAGTAAAGGAGCCATGGCTACAGTTTGTGGACC" "51997" "1" "0.145111" "-1.6146699" "-4.38" "-0.12186134" "" "CCAGAAAAATAGAGGTTGTTAAGACATTCTCCAGGACAACACACTCTAAATTTCTTACTA" "33410" "1" "0.145111" "-1.6146688" "-4.38" "-0.14563716" "245532" "CCCTTGCTTACCTCAAAGGTTTCTGTCAAAATTAAATGCTACTGCATGTGCCTGAACATG" "22212" "1" "0.145121" "1.6146244" "-4.38" "0.33760962" "" "" "30050" "1" "0.1452" "1.6142592" "-4.38" "0.25085236" "71819" "ATCGGTTCAGTTTACTGATATTGAGACTTTAAAACAAGAATTGCCAACTGGTAGTCGGAA" "58929" "1" "0.145285" "-1.6138689" "-4.38" "-0.6220978" "" "TTTTTGCTTAAGACCTGTTCACTTGGTCATCAGGGTCAGTCCTGTCTTTAGGGAAGCTCT" "53377" "1" "0.145309" "-1.6137597" "-4.38" "-0.15624754" "15361" "CCGGGGCAGGCCACGCAAGCAGCCTCCGGTGAGTCCTGGGACGGCGCTGGTCGGGAGTCA" "42835" "1" "0.145337" "1.6136298" "-4.38" "0.19132146" "" "AAGAGGTACAGCTTTACTACAAGGAATTCTCTTCCACTCGACATGGGTTCTTGGGTGCAA" "26614" "1" "0.145341" "-1.6136145" "-4.38" "-0.28322259" "239857" "CTGTGCTGCAAAGAAGATCCAAATGAAGCATATCGCACAGAAAACAAACACAATTATTAA" "39695" "1" "0.145347" "1.6135849" "-4.38" "0.18430205" "100042484" "GAATCGCCGTGAAGGCATGTTTGGAGGCAGAGAATATTATTCAAGGCAGTAAGAATATAC" "54780" "1" "0.145348" "-1.6135813" "-4.38" "-0.20119939" "225655" "CTTGAACTCTTCCTTCTGCTTCCCCATTCCCAAGTCCTGAGAATACAGACTTGGACTGCT" "40511" "1" "0.145348" "1.61358" "-4.38" "0.27212011" "16998" "CTCCCAAGGGTGATTCCTAGAAACTTCGACATCAGATCTGCCCCTTTAATTTACTCTTGG" "4137" "1" "0.145396" "1.6133612" "-4.38" "0.28041414" "53945" "TTCTAGAGCAACAATAGTCACAAAAGTTCCCCTTTCAATATCCCTGAGAAGAATAAAGAA" "61042" "1" "0.145403" "1.6133263" "-4.38" "0.18861268" "218977" "GACAAAATAGTGTTTGATGCTGGGTTTTTCAGAATCGAGAGCCCAGTGAAGTCATTCTCA" "26094" "1" "0.145412" "1.6132885" "-4.38" "0.28238729" "59012" "CACTCAGTGCTACCCTCTGGGTCGATCTGAGTTCCCATGTCCTATAACAGATTCATTTTT" "41529" "1" "0.145425" "-1.6132264" "-4.38" "-0.25902205" "240514" "ATCTTCATAGTTCTAGCTGTCATGGAATTCACTCTGTAGGCTGGCCTCAAACTTCACCTG" "54090" "1" "0.145433" "-1.6131918" "-4.38" "-0.20072415" "58233" "TTCAGATCCTAAGAAAAGAGACATCTATGACCAAGGTGGAGAACAGGCAATTAAAGAAGG" "36143" "1" "0.145437" "1.6131731" "-4.38" "0.18542705" "" "TATTTAAAGCCTCTGACTGCCATTAAAGCATGGTCCACTGTGTCCTGTGATTCTCCCCAT" "3579" "1" "0.145437" "-1.6131713" "-4.38" "-0.19273791" "" "AAACCACACAGAAGCAGAGCTTAATGGATGATGGTAAGGATGTTGGATCATAGCTGCCCT" "55550" "1" "0.14548" "1.612973" "-4.38" "0.13820793" "" "GCTTCCAGGAAAGTCTTGATAGTAAAAGCAGCAATTTGAGGAAAGTTGACTTCTAAACCG" "33972" "1" "0.145484" "1.6129568" "-4.38" "0.47240124" "56615" "AGAATTCCTATATTTTCAGTGGATTCAAACTCTTTCTGAGGTTTTAATGCGTGAAAGGAG" "47566" "1" "0.145505" "1.6128591" "-4.38" "0.45023077" "" "TACTTACCAAAAGGATTGGAATACTCTGAGCTGAACAGTTAAGGCACACTGGTGTCAGGG" "12180" "1" "0.145512" "1.6128272" "-4.38" "0.17194616" "" "CCAACAAGGTAGAAGAAAAGGATCACTGGGGTATGTTTCTCAGAATTCTATTTTCTTTTT" "39339" "1" "0.145559" "-1.6126119" "-4.38" "-0.16727165" "266620" "TGCTCGTGTCCCAGCTCACTCCAGGTGATGCTCAGAAATGCTGGAATCTCCACGGCAAGT" "9593" "1" "0.14556" "1.6126069" "-4.38" "0.19021887" "" "TCAAAGGGACTAAACATCAACAGCTTTCTCGATTGGCATTTTGCAAGAGAATTAAACCCC" "7376" "1" "0.145585" "-1.6124935" "-4.38" "-0.16432046" "240067" "AGCATTTAGGGTCTCCACATGCCTTCACAAACATGAACGAGCTCATGCTGAAAAGAAACC" "50975" "1" "0.145589" "-1.6124758" "-4.38" "-0.14206561" "74600" "CCAATGCCAAGTCCGGAGCGCTTAGAAAAGGTCGTTGATTCCATGGATAACGTAGATAAA" "54630" "1" "0.1456" "-1.6124239" "-4.38" "-0.14488223" "" "AAACCATGTGCTCAAGAGACTCAGAGTGAGCACCCTCAAGAACTTCGTGCTCAATATACT" "54364" "1" "0.145609" "-1.612385" "-4.38" "-0.18832766" "" "CCATAACCACTGGGATGATGGACTTCATGATCAGCTCTGGCCTCATGACTGACATGGCTG" "42897" "1" "0.14561" "-1.6123773" "-4.38" "-0.15887048" "" "GCATGGGGGAGACTTGAAATACTGCTTTTCTTCCCCACCTGTCCTGGAGCATGGAGAGCA" "22921" "1" "0.145614" "1.6123601" "-4.38" "0.42651682" "103161" "GCCTTTATTAAAGAACTATGGTGTCTTGGCGTACAAGAGATAGTAACAAAACAACCAATA" "30621" "1" "0.145628" "-1.6122973" "-4.38" "-0.19093387" "" "CTGTGTCCACCAGGTCCTCTGTGCCCATTTCTCGATGTTCCTGCGAGACTCGTCGTCTAA" "33636" "1" "0.145638" "-1.6122481" "-4.38" "-0.18056822" "78903" "GGAGGTGGTTACTTCAGCTAAATGTGTACCATTGAAATTGTGTTCATTTGCACCCTGTGC" "55257" "1" "0.145648" "1.6122025" "-4.38" "0.26997603" "" "AAGAAGAAGTTTCACCTGGCCCTTACCCTTGGGCTTCTTTTACTGGTTTCCTTGTGTTTG" "50764" "1" "0.145651" "-1.6121897" "-4.38" "-0.13423087" "208718" "TTCCCTGCCCAGGAAATGGGGGGTTTCAGCAAATCAGTGTCATGGAATAAAATCAAGTGT" "61912" "1" "0.145659" "1.6121543" "-4.38" "0.18201408" "14725" "GCAAGTAGCATTCCCGGTTTCTCTGTGCTAATATTGCACGTGTGTTAACGAATGAATGGA" "58354" "1" "0.145686" "-1.6120289" "-4.38" "-0.18148622" "68152" "AATTATAGTGGAATATGCACAGAACATTTTGGCATGAAAAGAGGCTGAATAAATAGCTAT" "5681" "1" "0.145693" "1.6119983" "-4.38" "0.2965848" "83379" "TTTTCAGCTAAACTGCCATTTCTGTCATAGTTTCAAGATTCACTCCGGCTCCATGTACTG" "6453" "1" "0.145727" "1.6118427" "-4.38" "0.14748724" "" "TATGTCTCCTATGCCAGTCTACGGAGCACTTCTTTTTCTGAGCTACAGCAACATTTGCCA" "42684" "1" "0.145728" "-1.6118376" "-4.38" "-0.16570457" "117197" "CCAGTCCTGTTTCGGACCGAGGACCACTTCCCTGGCTGCGGTGACAGACCGCAGCTCTGA" "40898" "1" "0.145746" "1.6117569" "-4.38" "0.26725433" "16428" "AAGGATATGCACCAAGCAGTTACCTGGTAGAAAAATCTCCAAATAACCTTGAAACCTATG" "21006" "1" "0.145746" "-1.6117531" "-4.38" "-0.17141831" "69587" "CTCACAATGCAGTTACATTAGAACTTAGGTATTTTCCCATGTGGTGAAATTAAGCAGTTA" "31297" "1" "0.145794" "-1.6115352" "-4.38" "-0.18224352" "" "TTTTAGGAAATGTGGGAATTGTTTCAAGATATATTCAAGCCTCAGTAGACATCAGACAGC" "24892" "1" "0.145847" "-1.6112935" "-4.38" "-0.18251817" "" "CATGAAAAAATTCATAGTGGAGAGAAAAGTTATTAATGTAGACAATGTGGTAAAGCCTAG" "27784" "1" "0.145852" "-1.6112676" "-4.38" "-0.20839643" "" "AGAATGGCTCTGTATCCTTCAGCAAGTCCTTTCCTTTCTCCGGACGGGCTGGCTAGGTGC" "9689" "1" "0.145903" "-1.611034" "-4.38" "-0.13829552" "" "ACCGCGGAGCCCGAGGCTGGTCGCTGCGTGCTGTGCGGGTCGGTCAGTCGGAGTCCCACT" "27810" "1" "0.145914" "1.6109849" "-4.38" "0.41506636" "56615" "GGAGTTACTTTGTCAATGGCTTACAGGCTGCTAAGGAGCAGACTGTACTTGTAAAGAGAA" "43993" "1" "0.145929" "1.6109187" "-4.38" "0.23884206" "66894" "CAGAGGCCTTGGGGACCCTTTCTTCTCTCTGATGATGGCAGTCTGGAATAAAGCACTGTC" "53280" "1" "0.145935" "-1.6108883" "-4.38" "-0.15155546" "22428" "CTGTTAGCACCGTGCTGACTTTCCATTGGAGACTTGAGTTGGAGAGAGGTGGGTCCTATT" "61810" "1" "0.145949" "-1.6108227" "-4.38" "-0.15595297" "" "" "12370" "1" "0.145963" "1.6107616" "-4.38" "0.38666565" "623898" "AGATGAGAAATGAGCAGAGAGATCACCTGATCGATTTCAAAGAGAGTTCCAATTACAATA" "6757" "1" "0.145976" "1.6107008" "-4.38" "0.83013899" "64380" "CAACACTTTAACATCCTCCATTAATTGTATGTACAAGGGGCAATGAATTAGCAAAGATGT" "29831" "1" "0.145989" "-1.6106396" "-4.38" "-0.18426861" "66193" "AGCCAGAGCAGACCTTCAGTCTGAACCGAGACATTACAGGAGAATTAGAATATGCTACGA" "22645" "1" "0.146" "1.610591" "-4.38" "0.77448879" "258970" "ACTTTCCAGTGGATAAATATATTGCTGTGTTTTATACAGTTGTTAGTCCCATGCTGAATC" "51315" "1" "0.146027" "1.6104691" "-4.38" "1.15561438" "16365" "AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT" "23724" "1" "0.146038" "-1.6104176" "-4.38" "-0.24138512" "" "TTTCTCTGCTTCTGATACTCACATTGCTGGCCAGAAAGTTAACATGTGCGGTTTTGCTCC" "29106" "1" "0.146044" "1.6103914" "-4.38" "0.31281868" "" "TAACCAAGAAGGAACTCCGCTTTGCATCCTAAACTTTGATTCCCTCACCTTAGGAGAGGT" "37679" "1" "0.146066" "1.6102878" "-4.38" "0.18596462" "381628" "GTGATCTTCCAATGAAGATGAAGGGCAAAATTCTGTTTCTTTGGGGCAGAATTTAATTAT" "11566" "1" "0.146068" "-1.6102786" "-4.38" "-0.1229478" "232337" "TCATAGGGTAAGTGGAAGTTCTTTCAGAAGGACCAGCCTTTGGTAGGGCAAACTGACTTT" "59793" "1" "0.14608" "-1.6102272" "-4.38" "-0.26181709" "226419" "GCAAATGGAAAACGGAATAATTGAAGCCCATTCACTGATGGATATGTTTTTGTTAGACTT" "18078" "1" "0.146101" "-1.6101306" "-4.38" "-0.1654329" "67005" "TAATCTAGGTGGGCAGCTTGTATCATCGATTGACTCTGAAATTATTGTGTGGGTATCTTG" "25482" "1" "0.146108" "1.6100976" "-4.38" "0.94779699" "" "ATCAGCTTTGCAAAACACATTGGTGCCAAAGGTTGATTTCTAGGCTTGGGGTTTCTCACG" "37807" "1" "0.146116" "1.6100608" "-4.38" "0.46476668" "" "GAGTTCTACCCTTTTTCTCCCTTTATTCTTAAAACTCATAGCATTGAAAGAATCCAACGA" "4711" "1" "0.146144" "-1.609934" "-4.38" "-0.13048098" "" "TACCTTTCTTTGTACATTGACTTACTTATTGTGACTGATTGCAGTAGGAATAGCTGATGC" "34972" "1" "0.14615" "-1.609906" "-4.38" "-0.18493228" "18120" "TTAAGTACTTAGGATGAAAGGGCTTTGAGATAAGGCCTTGCTTTCATAAAGTACAAGTAG" "35852" "1" "0.146164" "-1.6098419" "-4.38" "-0.51373696" "68525" "AGGAAGGTGCAGCTCTCTATTCTTACAATGTGTGTTACATGCTCTGTTTTTCCATAAAGG" "10742" "1" "0.146172" "1.6098048" "-4.38" "0.30933955" "50883" "CACGAAAATGGGATCATACATCGGGACTTAAAGCCGGAGAATGTTCTTTTATCATCTCAG" "16230" "1" "0.146188" "1.6097334" "-4.38" "1.06130742" "66141" "CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT" "53094" "1" "0.146188" "1.6097328" "-4.38" "0.562039" "" "AATTCAAACATACCAATAGTTTGTTACAAGGCACCAAAATCTCCAAAGCCGTGTTTTCGG" "16245" "1" "0.146204" "1.6096583" "-4.38" "0.14421103" "621677" "AATATCCTTCAGCTTAGACTGACTTCATTTCGTGATATCCTTTACCCAGAGTCCTTTTTT" "22479" "1" "0.146216" "-1.6096032" "-4.38" "-0.17870111" "109910" "AGTGTTTGAACTTCTTGGCAAAATCTGTGATATAAAATGGGGACATTGACTTCACTGACC" "10402" "1" "0.146227" "1.6095515" "-4.38" "0.45918589" "14205" "GGCTGGCAAAGTCCAAGGGCAATGCTCATGAGTTATTGTGCTTCTTTCTTATGCGGAATT" "58683" "1" "0.146236" "1.6095126" "-4.38" "0.20002696" "258541" "CAAGTCAAGCAGGCCTTCAATGACTCAGTTAAAAGAATTGTGCTGTTCTTCCAGAAGTAG" "4263" "1" "0.146246" "-1.6094647" "-4.38" "-0.46723044" "" "" "37328" "1" "0.146283" "1.6092966" "-4.38" "0.17570647" "" "" "23742" "1" "0.146347" "-1.6090053" "-4.38" "-0.20791671" "" "ATCATGAAACTACCTGTGACCTCATGTAGATATTCACACCATGTCTCTGATGGCAACGAC" "1560" "1" "0.146388" "1.6088164" "-4.38" "0.75445681" "" "TTCCATTAGGAAACTTAGGAAGGAGGAGGGCAAGAGATGAATCAGCAGACTGATGGTGAT" "57263" "1" "0.146395" "-1.6087857" "-4.38" "-0.27464286" "" "" "14552" "1" "0.146412" "1.6087097" "-4.38" "0.34194566" "434341" "TGGCTGACCAAGTGTCACTTGGACCTGCCACAGCTGACCATGCTCCTGAACCTGGTGAAT" "50088" "1" "0.146417" "1.6086841" "-4.38" "0.14702472" "" "ATTAACAGTTGATTCAAATCAGTAGTTGCTAGTCCCTAATAGAGGGGTTAGAGAACGGAC" "21749" "1" "0.146421" "-1.608668" "-4.38" "-0.202677" "226977" "CGCGATTCATCGCAAAACCTTCTAATGCCCGAGGAGGGTGGACATACTGGGAGAGAGGGA" "37110" "1" "0.146429" "-1.6086302" "-4.38" "-0.13336624" "98828" "TCGATTTCCTTAAGCTGAAAAGAAATGAGCAAGAGGACGACTGAGTGCTGCTTGGAGAAC" "40149" "1" "0.146435" "-1.6086031" "-4.38" "-0.23636786" "" "GATTTTCATTGACTTTCACAACGTTCTTGGCCAAGTGCTTCATGACTTCCAGTGCTTCAC" "41759" "1" "0.146441" "-1.6085767" "-4.38" "-0.19050971" "" "TTTATCAATCCCGGGCTGTGCTCTTGTGTTCTCCAGCAGTTACCTGTAAGGAGGAACTGA" "4609" "1" "0.14645" "-1.6085343" "-4.38" "-0.15457074" "" "TATGGCCAGAGTGTTCCCATTCCATAGGTGAGTTCTGTTTGTCATCCTTATAGACTGCCT" "16229" "1" "0.14646" "-1.6084889" "-4.38" "-0.14080841" "230233" "ATAGGGAATGATGTTTCATGGTTTCTACCTCAAAAAGTGAAAACAAGTGGAACCACGTTT" "60335" "1" "0.146461" "-1.6084844" "-4.38" "-0.13758602" "625540" "TTGCAAATGGGAAAAGCATACACGGAGCTGCCTGAAATTTATCACTCGCATTCGCGAACT" "36762" "1" "0.146496" "1.6083244" "-4.38" "0.16561002" "" "GGACCATTTCTCCCTAAGTCTGTGTTATTCTTTATTGTGTGAATTCTGCATTTTTGTGAT" "57228" "1" "0.146506" "-1.608278" "-4.38" "-0.14234986" "66132" "ACTGCGCTTCCATATCCTCGGGCCCCCAATACCTTAATTTTACGTAGTGGAGTGAAACTG" "4488" "1" "0.146513" "-1.6082488" "-4.38" "-0.24798764" "" "TATCCATTGGTGATGTTGCAAAGAAACTAAGAGAGATGTAAAACAACACTGTAGCAGATG" "12040" "1" "0.146515" "1.6082367" "-4.38" "0.14598203" "" "TATAAAAACACGCAGAGGGTGTCTACCAGGAGCTGGAAGTTGTGACATGTACAAAAGGCA" "27284" "1" "0.146517" "1.6082275" "-4.38" "0.22568166" "108114" "CCTGTGTTTATCCAGTCTCCAAAAACAGGACAACTCCTGCAGCACTGGGCTGTTGGGGAT" "28137" "1" "0.146519" "1.6082206" "-4.38" "0.27589462" "" "ATACTGGAGAAAGAGACTTCTTGTCTACCTGAACTCATCCTGACCACTTCTCTCAGTTCC" "60906" "1" "0.146539" "-1.6081294" "-4.38" "-0.20625239" "69737" "AACAAAAGCCGCAGGCCTGACGAATCTGCAAGCATCAAATAAGCATGAGAGAGAGAAAAA" "28024" "1" "0.146559" "1.6080378" "-4.38" "0.19382297" "54713" "TTTGCAGAAACTTTGACTTAAAGAGACATGTGCGCAAACTTCATGACAGCGTGGGTCCCA" "3035" "1" "0.146638" "-1.6076785" "-4.38" "-0.16181247" "" "GTCTCTTCCGCGTTGCTGTAACCGTGCTTCCACCATTGTGTTCTTTGTACAATTGAAATG" "53403" "1" "0.146638" "1.6076772" "-4.38" "0.14665594" "" "GCTGTGGCAAACATTTGTTGCCATTTTGTTCAACCATAAAACTTGTCAAATTAGTGGTTT" "36416" "1" "0.146639" "1.6076745" "-4.38" "0.227029" "20682" "ATAAAACCTTAAAGCGTTCTTATAATATGGCATCTTTCGATTTCTGTATAAAAACAGACC" "33417" "1" "0.146644" "-1.6076493" "-4.38" "-0.1963998" "22114" "GGCCACTGAGCCCTCATGGATCCCTGAACCTGGTGCTGATAAGAAGTCTGCCACCAAGTT" "42621" "1" "0.146649" "-1.6076255" "-4.38" "-0.21827131" "" "GCAGTAGCCAAATATCAGACTTAATGCGACTATTCTTACTTAATTACAGATGTGTTTGCT" "57993" "1" "0.146673" "-1.6075179" "-4.38" "-0.23389269" "" "TGTGAACTTCAAAGAAGCTGGGTGACACTGGTCTTCTAATCAGGTGAGCTCCCCCCAGAG" "347" "1" "0.146722" "1.6072956" "-4.38" "0.3308416" "" "AGCCATAGTTGTTGGTTATATGTGGACAGTGGGTTTGAAGGTATAACTGTCTTTAGCTGA" "38358" "1" "0.146725" "-1.6072804" "-4.38" "-0.12462754" "232536" "GTACCACGAATCTTGGAAAACTGAAGACTGGGAAAACAGTAAGACCGAGGAAGACATGGA" "62389" "1" "0.146734" "1.6072396" "-4.38" "0.24971971" "" "TGTGATAAGGAGACCACACAAGCATGCCTCCATTGTCTTTATCTGTGTACTTGGTAGCAC" "40036" "1" "0.146745" "-1.6071904" "-4.38" "-0.28853468" "14472" "GAGAGTATATTCATTAGACGGGCTTAAAGGGGGCTACAGCCACACCAGAAGATACACTAA" "33158" "1" "0.146746" "1.6071865" "-4.38" "0.17283782" "" "TTTTAGCACCTTGGAGAAGACAGTTAAGACAAGTGGTACTGCCTGTCTCAGATGACAGGT" "51905" "1" "0.146768" "1.6070842" "-4.38" "1.63253232" "55985" "GATTTATTGTCTTGCATTAAAACCAGTAACAATTGAAAGATCCTCAGCTTAAAGGTCCAG" "43172" "1" "0.146774" "-1.6070596" "-4.38" "-0.16454871" "94093" "GTTGTAGAAGTTGTACTAGATTAGTTTGAAGCCTTGTTTAAAACCCACATTGTTTTGGCT" "27631" "1" "0.146778" "-1.6070417" "-4.38" "-0.17526755" "" "TCCAGCAACATTGTGTTTCTTGGCTTCGGAGCATCCAGCAGGTGCTGCAGGTTCTTCTGA" "46479" "1" "0.146822" "-1.6068407" "-4.38" "-0.18815011" "" "CGCTGGACAACGTCACCGGCTTGTAGAGCAGCCGCCCGCAGCGCGGACAGCCCAGCAGGT" "33469" "1" "0.146835" "-1.6067795" "-4.38" "-0.29072988" "545156" "CGCTTTAAAGGAGCCAATTCAGCTCCCCAAAACACCAGCCAAACTGAGGAACAATAGTAA" "991" "1" "0.146843" "1.6067434" "-4.38" "0.20750164" "110208" "AACGATCTGCACTGAGTTCACTATTGCAAATTGATTTGTTTTCCTTTAGCCTTGTTCACT" "60136" "1" "0.146854" "-1.606695" "-4.38" "-0.14201258" "" "ATTCTCAGCAGCCCTAAGGAGGAAAATGTATCCACAGCTTTGGTTTTCCAGGTTCTAACG" "45216" "1" "0.146861" "-1.6066634" "-4.38" "-0.15108337" "22213" "AAAGCAGTGCAGGCCTGTTGTCCCTGCCTCTCAGTTCCCAGGTGTCCCAGGAAGCATTTT" "37672" "1" "0.146864" "-1.6066496" "-4.38" "-0.17437925" "353170" "TATGCAAAATCTCTCCTCCTGTGAATGAAAACAGATGGGACCTCAAAGAAGGATGCCCTC" "15692" "1" "0.146865" "-1.6066438" "-4.38" "-0.1852006" "59310" "AAGGAAAAGGCTTTGTCAAGGCTGACTTCATTAAGGAAAAGCTTATGACGCAGGCTGACC" "54594" "1" "0.146885" "-1.6065547" "-4.38" "-0.14362415" "13663" "GTATTTTGTGAATTTGTTGTTACTGTTTTTCTGTGAAGCACATACATTGTATGTGGGAGG" "33245" "1" "0.146922" "-1.6063855" "-4.38" "-0.14457278" "" "TCACCTGGAGAAACCTGCCAAGTATGAAGACATTAAGAAGGTGGTAAAGCAGGCATCTGA" "8989" "1" "0.146923" "-1.6063806" "-4.38" "-0.30985067" "232813" "TCTAGATGACCAACAGTAGTGACTGCATAATGATTGTGTCATCAGAGTCCTTAAGTCCCT" "39062" "1" "0.146932" "1.6063377" "-4.38" "0.57238181" "" "" "38059" "1" "0.146952" "1.6062472" "-4.38" "0.33451299" "56792" "TACAAACACTATTGGACGGAGCTGAGAGGGACCACGCTGTTCTTTTACACTGACAAAAAA" "23650" "1" "0.146954" "1.6062374" "-4.38" "0.43293488" "545366" "CAGAAAGCAAGAGGATCACTGCCATTTCGTACAAAGTGCATTAATGGCACCATCAATTAT" "33703" "1" "0.146977" "-1.6061349" "-4.38" "-0.17349182" "109791" "TCTTTCTCCCTCTGTCCCATCTGAGCCAGCCAGCTGTTGGCAATTAAAACCCACTTGCAA" "61930" "1" "0.147021" "-1.6059335" "-4.38" "-0.12917538" "223499" "TATAACCAGAAGTTAAAGGAAAAATTTCAATACCATCCACATGTAAAACGGATTGCTCGC" "52355" "1" "0.147048" "1.6058103" "-4.38" "0.21146849" "77744" "GGTCAATGAACTGCTTGTTAAGACTTTGAATGGTAGTCTTGAATTTATCAGTTCTAGGAA" "62062" "1" "0.14705" "1.6058041" "-4.38" "0.36891927" "" "CCCAAGGAAAATCCCGGGCCAAGGAAATAAGGGGGCTGGGGAATTCTCCCACCCAAAAAA" "42512" "1" "0.147053" "1.6057908" "-4.38" "0.26876776" "111174" "CCTTGAAGATGGTTCTCCTTGGTAAAATTTTCCAAAAAGATTCATCTAGGTCTAAGCTAT" "31327" "1" "0.147063" "-1.6057447" "-4.38" "-0.21852944" "" "CTTACACTAGTCTGTCCACAGGAAAGGCATTGAAATAAAAGGAAAGATGAAGAGCAATAC" "22963" "1" "0.14708" "-1.6056674" "-4.38" "-0.1573051" "" "CGAAGGACTAGTCCATCAACAAAACACCCACTCCAATGAAGCATGCCTATATTCATCTTG" "41553" "1" "0.14712" "1.6054837" "-4.38" "0.19015874" "" "" "49755" "1" "0.147123" "-1.6054702" "-4.38" "-0.38187946" "" "TTCTCTCAGGTACTTCCAAAGGCTGATGGCTGACACCTTGGCAACAAAAATGTATAACTA" "61552" "1" "0.147151" "1.6053422" "-4.38" "0.52822874" "" "CCCTCAGTATGCATTTTTTCAGATGCTCAAACTACAGTAATATGCAAAATATCTAAGAGG" "38820" "1" "0.147153" "-1.6053328" "-4.38" "-0.16633236" "" "TGGGTAAAATCACAAACCAAGTTTAGAGTTGAGGAGGATAAATGCTAGACCTAGCTGGTA" "7590" "1" "0.147191" "-1.6051603" "-4.38" "-0.26162123" "218630" "CAAGAGACAGTCCCTGGTGCAACACAGGAAATGCTGGAATGCCTTTTGCGTATTGTTATA" "30425" "1" "0.147196" "-1.6051399" "-4.38" "-0.21999849" "68277" "ACTATGACTCCAGAGAAAGACTTTCCAATGGAGAAAGATAAGCTATGCACATACTGTTAT" "48667" "1" "0.147201" "-1.6051166" "-4.38" "-0.12949134" "" "ACAGAAACCTAATTACATCAAGAAATTTGCATCAAGTGGCTGTGACAACCTCATCAAGCT" "50023" "1" "0.147204" "-1.6051023" "-4.38" "-0.22406313" "78787" "GGGGTAAAAAGAGACTGTTTGTTGTTGTTGTTGTTTTGTTTTAAAGAACAGAACCACAAC" "39103" "1" "0.147208" "1.6050853" "-4.38" "0.16312334" "" "CCCTGTATATCTGTCTAGACAATAAATTCATTTACTTGACTTCACTATGACTCATCCAGA" "27886" "1" "0.147235" "1.6049613" "-4.38" "0.238006" "26425" "GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA" "44235" "1" "0.147263" "1.604836" "-4.38" "0.14130245" "" "GTGTAAAGAAGTCCATTTAATGAACATTATAGTCATGTTAGACTTGGAAACAGCCAACTC" "53955" "1" "0.147327" "-1.6045428" "-4.38" "-0.15897281" "107951" "AAACGTAGACAAGTATGAGCTGTTTGAAAAGCTGGAACTTGTGAAGGGCCAGAAGCGGAA" "49825" "1" "0.147335" "-1.6045075" "-4.38" "-0.13046074" "74182" "CGTCTGCATTTTTCTGAGAAACCTCCTGTTTCAATTAGCAAGAAAAAGTTCAAAAAATCG" "43529" "1" "0.147338" "-1.6044967" "-4.38" "-0.32944263" "80718" "CTCAGCTCAGCAGAACTATAGCCAATGTTTTGTTTTGTTTTCCTGAATGCTATCTTATTT" "2903" "1" "0.147339" "1.6044878" "-4.38" "0.3533292" "104086" "TCAGATCTGTTGCAATCATGTTCCAGAACTCAGTCTATATCACTTTCCTTCCCAAATGGA" "5629" "1" "0.147341" "1.604481" "-4.38" "0.19030878" "" "CCACACAGAAAGTATCCTAAATTTCCAATTTCTGTTTGGTATAGAAAAGATCCTACCCCT" "37462" "1" "0.147349" "1.6044444" "-4.38" "0.20271531" "" "" "25711" "1" "0.147383" "-1.6042885" "-4.38" "-0.25416878" "258317" "ATGACTCAGACTCCGACTAAATCCTTTCTACAGATGAAACATGATGAAATTGAGGCAGAA" "29957" "1" "0.147385" "-1.604283" "-4.38" "-0.19997154" "" "" "60549" "1" "0.147391" "1.6042527" "-4.38" "0.14980113" "22195" "TAAAATCTGCCATGAGTGATTTCAGCAAGTTTGAGCAGAGACCCTGAGCAGTGCATTCAG" "4588" "1" "0.147395" "-1.6042371" "-4.38" "-0.23016623" "" "TATGACTCTCATATGCAAAGGCTTTACCACATTGAATGAACTCAGAGGGTTGCTCTGCAG" "26702" "1" "0.147401" "-1.6042104" "-4.38" "-0.18204445" "" "TACAAATACTTAGGCATATGCTGTTGTGAATAGACTCGGTGATGTGGGGTGGGTGTGTGT" "50761" "1" "0.14741" "-1.6041661" "-4.38" "-0.1375281" "67912" "GATACTACCTAATCAGGTCAAGACAGAGTCATAACAAGTGGTAACTTTGTTATATTCAAG" "22715" "1" "0.147412" "-1.6041594" "-4.38" "-0.25329148" "52897" "CCTTTCTTACCATTCTGTATGCTTCCACGGTGTGACCATTCAAATTAACAGTATTATTAT" "18561" "1" "0.147416" "1.6041411" "-4.38" "0.89069878" "" "" "43490" "1" "0.147419" "-1.6041273" "-4.38" "-0.1815104" "77864" "ATTGTGGTTGATTAATAAAATTACTATACAGTCATGAAATGTACCCGAAAGGCGTTGTCC" "58883" "1" "0.147443" "-1.6040189" "-4.38" "-0.15461383" "" "ATTCTATAACCCAGTGTCATTCTACAGTCACCTGAGCATATCTCCATGCTCTGAGGACTG" "4672" "1" "0.147447" "-1.6040011" "-4.38" "-0.27346315" "381511" "ATTACCCTGGCAGTTCTTCAGTTGGAAGGGCAGATCGATGTTTGAAAGAAACTAATATAG" "33103" "1" "0.147458" "-1.603949" "-4.38" "-0.18464644" "665180" "GTGTCAACGGAATGTCTGACAACCCGTCCCTGGGTGTGCAGCAAGATGGCCTATACGTGA" "3796" "1" "0.147473" "-1.6038835" "-4.38" "-0.35071682" "218639" "AGTTGACAGGCTCACATGGGCATTTGCTAGGCAACAAGAACTTGCCCTATTCACAATTTA" "26331" "1" "0.147493" "1.6037909" "-4.38" "0.14283298" "" "GATCTACCTCCGCTCTCACAACCTTAAGTGCAATTATCCTTAATAAACAAATTGGATTTA" "45504" "1" "0.147497" "1.6037742" "-4.38" "0.24799427" "104015" "CTGTACATATCTTGTGAGATGTGCTGTCATATGAAATAAATATGTCTTTATCACCAGCTG" "61426" "1" "0.147509" "1.6037204" "-4.38" "0.13832765" "" "TAGTGAAAGTAAGCAACTAAAGCAGCAAGGCAGAGCGAAAGAAGCGAGCAGATACAACAG" "7867" "1" "0.14755" "1.6035318" "-4.38" "0.42298292" "21452" "ATAAGGCAGCCTTTGGTCATCGGCAGGGCCATCCAATACAATTAAAGCCTTGATTTACCT" "13087" "1" "0.147556" "-1.6035065" "-4.38" "-0.13363715" "72611" "CCCACGTATGCATTTGGGTTTGGAACGTGCTTTTGTACTTCTACTTGAATAAAGGTGTGT" "39773" "1" "0.147568" "-1.6034535" "-4.38" "-0.25748617" "403185" "CACCAGATGACATAGCACAGCTATTTATTGTGTTTCTTGGACTGATAACCAAAAACAAAA" "26403" "1" "0.147609" "1.6032664" "-4.38" "0.63413603" "320832" "CATACAGTGCAAATATAGTCCACAGTGTGTGCTCAGGTAAATCATGATATTTTCATTCAA" "54068" "1" "0.147615" "-1.6032397" "-4.38" "-0.18063665" "19070" "TCACTGGTGTGGCACTCATGGTTTTTAAATCAGTTTAGTATTATCTGTTGATAATGCCTG" "14005" "1" "0.147644" "1.6031085" "-4.38" "1.28187878" "" "TTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACTGCCATATACTACTGTGCCAAAAA" "9864" "1" "0.147647" "1.6030922" "-4.38" "0.4692631" "320207" "GTAGAGACATGCATGGAACCCAATACAGCAAAGAGCCTGAAGTTTAAATCTGTCAGACCC" "48038" "1" "0.147689" "1.6029026" "-4.38" "0.15919044" "" "AAACCTCTGTGAGGCAGGTGGACGCTGGGACGCTGTGAGGCTGGGACGGAAAGGAAGGAA" "58831" "1" "0.147693" "1.6028832" "-4.38" "0.32276346" "238831" "ATAATAAGCACACGGTGTTTGGAAGAGTGAGTAAAGGCATGGAGGTTGTGCAGAGGATTT" "26659" "1" "0.147698" "-1.6028637" "-4.38" "-0.21892943" "18710" "TTCTCCAAGACTTGGAATGGTTGGCAGACTTGCTCCAGATGCAATAAAGACATTGCAGTG" "44878" "1" "0.147738" "-1.6026818" "-4.38" "-0.24049957" "14706" "TGTGGCTCATGTTGGCATCATCAACCGACAGAGTAGACCATAGTCCACAAAAGTCAAGAA" "61445" "1" "0.147768" "-1.6025471" "-4.38" "-0.1427742" "" "" "50110" "1" "0.147777" "1.6025069" "-4.38" "0.14076924" "" "" "3047" "1" "0.147789" "1.6024514" "-4.38" "0.35183467" "320614" "AAACTGTGTGGTGGGAGTCAGAGGTCTACGTGTAAATAAATTCTGCTGGGTTTCATGAAC" "8908" "1" "0.147809" "1.6023624" "-4.38" "0.64300814" "" "CAAACAAATTCTTTAATATTGAAAACATTTGAAATCATTTATCTAGCTTGGATTTTCCAA" "29183" "1" "0.147811" "-1.6023498" "-4.38" "-0.16493101" "19053" "TTGTCATGACAGTGCTTGCATCCTATTTGGTGTACTGAACAAATAAAATTTCCGATTTAG" "60521" "1" "0.147824" "1.6022943" "-4.38" "0.17839868" "" "CTTTGAACGATGGCTGGAGAAAACCTACAACAGAGATAAAAAGGTAAAAGCAAGGGCAAT" "8280" "1" "0.147832" "-1.6022566" "-4.38" "-0.16954142" "69718" "TTCTTTTTCTCAGTGTTTGTAATTTGTACTATTGATGGGATAGTCTTGGAGTGCAAGGCT" "9409" "1" "0.147837" "1.6022314" "-4.38" "0.25103782" "13614" "CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC" "28513" "1" "0.147842" "1.602211" "-4.38" "0.30159838" "14674" "CTTAGTAGAGGCACACAGTGCAGACCTTATAGACGGTGTTCCTAACGAGACATGGTTTAT" "17783" "1" "0.147856" "-1.6021496" "-4.38" "-0.2095966" "107094" "AGCAAAGGTGACAGCATTGAGGAGATTTTGGCTGACTCTGAGGATGAGGATGAGGAAGAA" "857" "1" "0.147859" "-1.6021346" "-4.38" "-0.25771199" "320924" "TATGTCAATGGTGACAAGGTACTGGCCTCAAACGCCTACCTTCCAGGACCTCCTGGCCTG" "27731" "1" "0.147866" "-1.6021005" "-4.38" "-0.12768567" "26754" "AACGTTGCTTAGTTACCACCAAGTACTTCTCAAAGCTGGTGTGTGGAAGGAAAAGAAGCT" "3585" "1" "0.147875" "1.6020615" "-4.38" "0.16040945" "217718" "TGTCTTCAAACGGTTTTCTATAGCTAAATCTTCGTAAATTGTCCTGTTTATCCTCTATGC" "4789" "1" "0.147878" "1.6020469" "-4.38" "0.19102314" "67374" "CTAAAGTCTGAAGTCTTAAATTGTTCAAGGCAATCGCTTAACTGTCAACCCTTATGTAAT" "61228" "1" "0.147884" "1.6020232" "-4.38" "0.15805114" "14060" "CAATTTTAGGAAGACTCCACTAAGTTCAGTGTTCTGAGCCTTTACTTTTGCATAAAATTG" "59775" "1" "0.147901" "1.6019463" "-4.38" "0.29193474" "19041" "TTCTGACTTGGATCAAAACTATCAACAGTGCCTGCTCAGTAGTGACTTTTCTCATTGAAC" "36095" "1" "0.147915" "1.6018814" "-4.38" "0.16492849" "" "GGTTATGGCTGCTGCCGCCCACTGTGCTGTGGAAGATACTGGTCTTATGGCTTCTACTGA" "29459" "1" "0.147919" "-1.6018641" "-4.38" "-0.14154142" "" "AGAAAATACCCTTGTCCCCTGTTTCAGTGGCTCTCCACTGGAATTATAGGATAGTGGCTA" "53100" "1" "0.148057" "-1.601238" "-4.38" "-0.20720674" "" "TGAGAGAAACTCTCGTTCGAGACATAGAATCCATCGTTCTTGACGAGTTAATATAAAAAA" "27900" "1" "0.14808" "-1.6011344" "-4.38" "-0.17379852" "74269" "CTCCTGGCTTCTTGACTTTGGCATCTAGTAAAGTTTTCAAGTGCATGTCCTGACCATAGA" "30539" "1" "0.148099" "1.6010488" "-4.38" "1.16370202" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "17928" "1" "0.148118" "-1.6009616" "-4.38" "-0.15184612" "67966" "GAATGCTTTATGTGGGTATATGTTACAGTGTGTATGGGACAGTCTTTGACTGTACTGTAT" "1159" "1" "0.148127" "1.6009245" "-4.38" "0.27058312" "" "CATAAGTCTGCTATTTCGGTCTCTGTGACTTGTGGCTGCACCGTGATTAGGGTTTGATTA" "8515" "1" "0.148144" "-1.600847" "-4.38" "-0.17189979" "432561" "CAGAACCAAGGTTTGTTCTAGCCTAAAGATGGCAGTCGTCCCTATACCCACCCATAAGCC" "43753" "1" "0.148147" "1.6008336" "-4.38" "0.19041319" "" "TGAGTTTTCAAGTAGAGATTGAGTTTGCAAGGAGTGCATTTACCAAGTACCGTGGTCCTG" "32273" "1" "0.148171" "-1.6007252" "-4.38" "-0.16193134" "" "CTCCTTCACATAAAGGAAATGACCAAAAAGGGTATAAAGGAGAGGATAGAGACATCACAA" "16618" "1" "0.148188" "-1.6006454" "-4.38" "-0.20421547" "23792" "TAATGACTACAGAGCCTCAGATCTGAGAATTGGGATGGGGTACAAGACAAAGGTCCCTTT" "47057" "1" "0.148193" "1.6006235" "-4.38" "0.36967749" "" "TGGAGGATCCCTGAATCTCTCTTGTGCAGCCTCAGGATTCGATTTTAGTAAAGACTGGAT" "265" "1" "0.148197" "1.6006089" "-4.38" "0.68717955" "56312" "CAATGGATACAGGACATCACACCCAGCAATGGATACAGGACCTTGGAGAAATTAGGAGTT" "1563" "1" "0.148212" "-1.600541" "-4.38" "-0.48580345" "" "TTACATCAACCTGAAGGCGTAGGCGAGGACGACTGGAGGACTGGCCACATCCTTTCCAGA" "8004" "1" "0.148218" "-1.600511" "-4.38" "-0.14530644" "66511" "GGCCACAGAATGGGTAACACGTGGTACCAACTTTGATTTGGTCAAAGTTGATGTTGCCTA" "49056" "1" "0.148239" "-1.600418" "-4.38" "-0.15877139" "67030" "CTCTGCATCTCACTGAAAATATCAGAATATTCATGTATTTTCCTTGTCCTTGAGTTTTCC" "45047" "1" "0.148276" "-1.600251" "-4.38" "-0.51365307" "13384" "TCTTCTGGCTTGCAGCACTGAAATGTTTGGGTTGGTTTTGGTTTTTTGGTTTTGTTTTTT" "52314" "1" "0.148279" "-1.6002372" "-4.38" "-0.16761082" "108902" "GATATTATTACTATTAACCATGTTGGGTGGATAGCGGCAGAGCAAAAAGTTTGAATGGGC" "24222" "1" "0.148301" "1.6001392" "-4.38" "0.94802271" "219132" "AAGAAAGGCAAAGGCAGATGAAGAAGCAGCTTGAGGCACTTGCAGACTTACAACAAACCT" "24364" "1" "0.148306" "-1.600117" "-4.38" "-0.25517525" "14816" "CCCTTTCAGAAATGTGTAGAAAGCAAGGGGGTGGGGTGGGATGGAGGACCACAGTCTGCA" "43066" "1" "0.148309" "-1.6001034" "-4.38" "-0.19244425" "14718" "CGGTATTTGCTCTTGTGATATGTGGCACATTGTGATATTTTCTTAGTCTGTTCTGTTTTA" "43874" "1" "0.148309" "-1.6001017" "-4.38" "-0.14249743" "210710" "CCTGTACAGAAGAAACTTCTCCTTTCAGAAGAGCAGAGAGTAGACTATGTTCAAGTGGAT" "56771" "1" "0.148344" "-1.5999414" "-4.38" "-0.23760349" "" "GTCACTTGGGTACCAGATACTTAAGTAATCTTAGGTAACACTGTGAATAATGGATCATTT" "10891" "1" "0.148354" "1.5998983" "-4.38" "0.93619334" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "55342" "1" "0.148354" "-1.5998968" "-4.38" "-0.18487583" "" "TCATAGGAGCAGCGAGCAGGTTGAGAAAACCTTCCTTCCTATTCACCTTTAGTAAAGAGG" "46526" "1" "0.148374" "1.5998064" "-4.38" "0.16153598" "210172" "GAGGCTTACTTCATTTCAGTTTTGACAGTATGAAATCTGTAGGTGACCCCAGTACTCAGC" "20534" "1" "0.148407" "-1.5996593" "-4.39" "-0.16017919" "" "CGGATGTTTTTAAAGAAAGTAGCTGGTTTCCAAAAGATATAAATGAAATTTGGGGAGCAG" "28360" "1" "0.148411" "-1.5996404" "-4.39" "-0.15968081" "21807" "ACTGCTTTGTGGCAAAAACCACACCTGAAGAAATTTTAAGAATTTGGCCCAGTTAGTCAC" "35602" "1" "0.148418" "-1.5996077" "-4.39" "-0.19565712" "" "CCAGCATGACAGAAATGTCAGGAGATGTCTGGAATTAAGAGAATTACAAAGAGAAGGGGG" "1984" "1" "0.148426" "-1.5995733" "-4.39" "-0.14030904" "" "GCTGGGGTTCCAAGTGTGCTCCACATCTTCCTGCAGTGTGATGAGAGGTGAGAGCAAGGA" "37178" "1" "0.148438" "-1.599522" "-4.39" "-0.14831233" "" "AATGGAGATTGCCTCTGTCCACTTAGATTCATAAGCTGTCCCGAAGTGATCTTGGCATCA" "19739" "1" "0.148439" "-1.5995147" "-4.39" "-0.16053903" "170930" "CGCATAGTGCTCTCTCTTTCTTTTCCTTTTTTAAACTAAATGACCGATGTTCTGTTCTGG" "41410" "1" "0.148457" "1.5994338" "-4.39" "0.17799051" "" "AACTGTCTCTTCGTGGAAGCCACGTAACGATGGAAGCCAAGCAATCAATATTGGGATTCA" "52729" "1" "0.14846" "1.5994212" "-4.39" "0.4707594" "78816" "CAGATCAGTAGATCCTTGGGGACTACCCGAGTCTCTGACCTCTGAGACGGGTGTCTTGAC" "2788" "1" "0.148464" "-1.5994018" "-4.39" "-0.44217351" "74646" "TGAAGCAGCAGCACCCAGGCCCTTCCCTGAACCAGATGCAGAGAATAAACTATGAGAACC" "8633" "1" "0.148498" "-1.5992492" "-4.39" "-0.13990824" "" "" "61054" "1" "0.148502" "1.5992333" "-4.39" "0.62040197" "79410" "GTGGTAAATCATACATCTGTATTTGTGGTAAGAGACTGGATAAATTCCCTCATTGACTCT" "45526" "1" "0.148514" "1.5991768" "-4.39" "0.1700587" "546213" "GATCAAAAACACAACGGATTTTCATATGCAGATTTTCAGCTTCATGCTAATCAGTTTCAC" "58243" "1" "0.148575" "-1.5989019" "-4.39" "-0.14616316" "237400" "ATCCAGAGTTTTATTTTTGGACTTGAAAGCCTTCTTAATAAAGTTGTTTTCCTATATGTA" "4237" "1" "0.148579" "-1.5988832" "-4.39" "-0.2601342" "72795" "CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA" "23526" "1" "0.148583" "1.5988673" "-4.39" "0.15315244" "" "CCTTTGTGGGTTTAAGGCAGATATTGGATATCCTTTTAATCTATATTTATTAGGCAAGCG" "49440" "1" "0.1486" "-1.598788" "-4.39" "-0.19036588" "58521" "ATTAAAGAATGGGGGGAAATACATTCCAAGATGTCTTTAATTCGAACTGAAAGGCTATTG" "33445" "1" "0.14861" "-1.5987436" "-4.39" "-0.1842791" "381314" "TCACGGGGACATTCGTCATCAATCTAGAAGGTGGTGACATTCGTGAGGAGTCTTCATATA" "55470" "1" "0.148679" "-1.598433" "-4.39" "-0.14057451" "21945" "CGACGCATTCTGGCGAGACTACATTAATGGCTCATTATTAGAGGCACTGAAAGGTGTCTT" "57310" "1" "0.148701" "-1.5983345" "-4.39" "-0.16136971" "11876" "ATATATACATATATACATTGTAGTCGCGTTGCTGGACCAGCCTGTGCTGAAACCAGTCCC" "32007" "1" "0.148705" "1.5983174" "-4.39" "0.17901675" "18127" "GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA" "41634" "1" "0.148711" "-1.5982917" "-4.39" "-0.16728773" "224111" "TCTTTCTTACCAGATGTGGTGACCAAATGGAAGTGTATGAATAAGAATAACATCTCTCCT" "7868" "1" "0.148745" "-1.5981366" "-4.39" "-0.50216438" "109594" "TTATGAGAAATGTAATGCGATTTTATTACTGGCGTGGATTAAACTTATGAATGTTTCCGG" "42319" "1" "0.148756" "-1.5980898" "-4.39" "-0.25995756" "574405" "TGAGACCTACCTGGAGGACGAGGACCAGCTGCATCTCGTGGCCAGACATTTGCAAGAAGT" "25073" "1" "0.148761" "-1.5980636" "-4.39" "-0.31992718" "" "TGTCACAAGCTGGTCTATTCTCTTTTTTCCTCTTTTCCTTTTGGGGGAGTGAGGTGAGGT" "51964" "1" "0.14878" "-1.5979778" "-4.39" "-0.20153171" "208650" "ATATTTTAAATATTGATGCAGGTACTTTCTGTAAGCCTGAAATGTTGAGCTTCGAAGGAG" "49672" "1" "0.148824" "1.5977818" "-4.39" "0.16551476" "" "TTTATATTTATGGGAACCAAAGAGGCAGCTCAGCGTTAGAGACCTAGAGATCTGCCTAGC" "47759" "1" "0.148842" "-1.5976998" "-4.39" "-0.13459321" "69902" "ACCACTCTAGAGGGAACAGCTATTTATTTTGCTATGGACAAAGACAAGGGAGGGTGCTAG" "11267" "1" "0.148843" "1.5976954" "-4.39" "0.22880264" "" "CAACCATCACCATATGCTTGTTGTACCATAGACAAGAAGTGTGTGTATAAATAGTTATAG" "33291" "1" "0.148849" "-1.5976718" "-4.39" "-0.13240292" "68051" "GCATGCCTTGGAAAGACTTAAGTAATGCAAACGATTGTGGGGTTTTGTTTTTGTTTTAAT" "26362" "1" "0.148864" "-1.5976013" "-4.39" "-0.19888707" "" "ACCTATGCCTGCACTCAGGCCGCATGCAGATGACTGTGACTTCAAGTTCGAGACCAGCCT" "30800" "1" "0.148873" "-1.5975625" "-4.39" "-0.17942043" "" "CAACAAGGGAGAGTCCTTTTCTCACGAGTTGCCTGGCACCCCTCAACTACACTCAGGTAC" "554" "1" "0.148948" "1.5972265" "-4.39" "0.95013354" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "23693" "1" "0.148948" "1.5972231" "-4.39" "0.35821706" "101320" "CGCCACCAATTTGTATTAGAGAAGGCACTTTGATTGTACAATACTTCACATTGCTTTTTT" "15588" "1" "0.148955" "-1.5971934" "-4.39" "-0.14231096" "" "" "23139" "1" "0.148962" "1.5971617" "-4.39" "0.25450101" "224008" "CTGCTAGATTGTTCTGTAAAGCTTCAGCCAGTATCTCATATTGAAATATTACTGTTCTGT" "34630" "1" "0.148971" "1.5971195" "-4.39" "0.15691392" "240322" "TGATGCACTGTATCGATGTACACTGAATCACCATTGCGCTGTTGGTGAAGGTGTAGAGAA" "50439" "1" "0.148974" "-1.5971074" "-4.39" "-0.29230906" "56526" "AGTCTCAGGGCTCTCAGGCTGGGGGCTCACAGACTCTGAAAAGGGACAAAGAGAAGAAGA" "30218" "1" "0.148991" "-1.5970309" "-4.39" "-0.37689094" "70359" "GTGACAGTTTCATCCAAGTATCTCCTGTGCTTTGATCATGCCCTTCCCTTATCTCACTTG" "21612" "1" "0.149001" "-1.5969859" "-4.39" "-0.24639071" "" "CCAACACTTGTGCTATGATGTGAATTGTCCTTGGAAAGATCTCAACTACCCTGCCTGTCT" "1432" "1" "0.149011" "1.5969405" "-4.39" "0.48193779" "14205" "GGCTGGCAAAGTCCAAGGGCAATGCTCATGAGTTATTGTGCTTCTTTCTTATGCGGAATT" "47664" "1" "0.149021" "1.5968953" "-4.39" "0.34351442" "215280" "ATGTTGTATATATTCCTGAGCTATTGCTTGTATCAGCTGCAGCCTGCCAGGGTCAGACAT" "30270" "1" "0.149029" "-1.596861" "-4.39" "-0.18427863" "246747" "ACAGGGTGTGTTGGATACCTATTAAAGAAATGGGGGTGCTCTTGTGCCCCTACAGAGCTT" "4372" "1" "0.149031" "-1.5968535" "-4.39" "-0.23305967" "15444" "AGCCACACGGAGCATCTTGGTTCTTTTTAATAACTTCAAAATAAAGTCTTGTTTCAGTGC" "26996" "1" "0.149031" "-1.5968528" "-4.39" "-0.23280761" "66606" "CTCCCCCTTTTGTATTTATAACTGTACTAATCAGATTACCTTCAAGAAAACCATTGCTAC" "45608" "1" "0.149056" "-1.5967414" "-4.39" "-0.12084558" "68634" "ATGTACAGCATCTGTACTTGGCTTGCCTTGATGAAGGTAAAATAAAGAAATCGAACACTG" "27739" "1" "0.149063" "1.5967077" "-4.39" "0.67682901" "215015" "TGCTGTCTTTTCTCTACACCCATGGATTCTCTGAAAATACTTTGCAGTTCCTTGTGTCTT" "62168" "1" "0.149066" "-1.5966964" "-4.39" "-0.26721266" "" "TAAGCATTGCCATCTCTGATATTTCTTCCTCTGGAGAGAAACACAGAGCCATGACCTGAG" "45995" "1" "0.149092" "-1.5965781" "-4.39" "-0.14765347" "239114" "GCGCCCCTTTGTTCTTTAGCTTATGGATGGTCTTAACTTTATAAAGATTAAAGTTTTTGG" "17127" "1" "0.14911" "-1.5964978" "-4.39" "-0.26946227" "14137" "AGAGATTTATCACTGGATCCCCAACTCAGACCCATCATCAAGCAAAACCAAGCAGGTCAT" "41164" "1" "0.149113" "1.5964852" "-4.39" "0.25133584" "" "TAAACCTGTGTGTCTGCCAATGTTCTGACCAGGTGTGTGCCCATTGTTGAACCTTCATTA" "25144" "1" "0.14913" "-1.5964084" "-4.39" "-0.13698388" "70701" "ACGTTTCGAACTGCTCGTCTCTTACTCGTGTGCATTGGAATTCGTATCCTTGTCATCGTA" "54221" "1" "0.149139" "-1.5963682" "-4.39" "-0.17889506" "" "TCATCTGCAGTGCCCAGCCCAGCAGGCCACCCATAACCTATAGCACCCAGCCTAGAAGGC" "12752" "1" "0.149151" "1.5963139" "-4.39" "0.31889795" "20259" "CATCTCAAGTCAATGCCACTTGGATGCCATTCACTCCCAAGTGTCCTTACATAGGATGAA" "56883" "1" "0.149155" "1.5962973" "-4.39" "0.21802143" "170833" "GACGAAGAATAAAAACTGCACTGGGGACACAGACCATTGCTTTTAAAATAAAGTTTTTAC" "34656" "1" "0.149163" "1.5962596" "-4.39" "0.26608556" "229658" "TGCTCCACCAAGTACTCTTTCCTTTATCAGTTTCAGGGATCTCATTTCAGGAAAGGAGAA" "59819" "1" "0.149185" "1.5961594" "-4.39" "0.14293236" "56643" "AGGCAATAGTATTGTTTTTTCTAACAGTTTTATGAAAACAATATTGAATTTACAGAGGGC" "24770" "1" "0.149187" "-1.5961534" "-4.39" "-0.1783031" "100038395" "CTAAAAATCAACAAGTGGATAGAAATGGGTGCAGGGTAACTGACAGACCGGGAGAGAGTT" "40553" "1" "0.149194" "1.5961192" "-4.39" "2.08130202" "" "AGCAATGGGCATACAGAGGAGAACTACAAGGACACCGCACCAGTCCTGGACTCTGACGGT" "7646" "1" "0.149204" "-1.5960735" "-4.39" "-0.18069218" "" "ATGCACCCCTTCTAAAATGGTTGTTGTCATAGCCTGACATAGTTGTCAAAAGATCCATGT" "47741" "1" "0.149251" "1.5958623" "-4.39" "0.75111747" "14129" "CCACATGTGCAGGGCATGCAGACACAGACATATGAACAAGAACAATTAAAAAATAAATTA" "49267" "1" "0.149253" "-1.5958549" "-4.39" "-0.14646059" "546161" "AAACTTTATGTGACGAAGTGAGCATAATTCGGATGGTGAGAAATGGTCGCAATCCCTGCT" "3987" "1" "0.149258" "1.5958343" "-4.39" "0.31213154" "16429" "ATTGTGGGCTCCAAGGCATGAGAAACACTGACTTAGTAACTGGAATGCTAATGAGCAATA" "53150" "1" "0.149315" "-1.5955774" "-4.39" "-0.18046771" "67928" "CTGGGACCTACTTCAGCATTATAAAAAGGACCGTACCATCTTACTGACCACACACCATAT" "30742" "1" "0.14934" "1.5954661" "-4.39" "0.20003049" "" "" "49711" "1" "0.14936" "-1.5953757" "-4.39" "-0.32921906" "667433" "CCCCTGCTCAGAATCTAAGGTGACTTGCTGTCTTGTGGGCCCCATGTTCTTGATACTCAC" "53862" "1" "0.149372" "1.5953215" "-4.39" "0.19638665" "" "" "25750" "1" "0.149411" "-1.5951478" "-4.39" "-0.14130264" "" "CCTATTTTAAAGAGGAAGCTAGAGTCAGTGAGAAACGAACAGCAAGGACAGAAATTGGTA" "23398" "1" "0.14944" "-1.5950181" "-4.39" "-0.23141289" "14860" "GCTGGAGTGGAGTTTGAGGAAGAATTTCTTGAGACAAGGGAACAGTATGAGAAGATGCAA" "39993" "1" "0.149446" "-1.5949906" "-4.39" "-0.14903872" "24060" "GAGCCTTAAGTCAACCCCAGATGGTAGGTTAAATAATGTCAACAAAATAATTGTATGACA" "18201" "1" "0.149499" "-1.5947525" "-4.39" "-0.13786396" "" "TGTTGTGGATCTGATGTGCTGCCTGGAGAAACCTGCCATGTATGATGACATCAAAAAGGT" "12202" "1" "0.149512" "-1.5946956" "-4.39" "-0.18086663" "51885" "AAGATAACCACAGTAAACAGTGGGTTGGCTCATGTAAGAACGGAATCACGCTCCTGAACA" "24563" "1" "0.149523" "-1.5946457" "-4.39" "-0.15397897" "78028" "AACGTTAAAAATATTGAGACGGAAGCTCTGAGTTCCTGAACTGGAGATTCCAGGATGAAC" "25918" "1" "0.149526" "-1.5946334" "-4.39" "-0.18537706" "66755" "GGACGACTGGATCTTAGAACAGCTCACTGGTCTCTACGACTGCAAGGAAGAGGAAATCCC" "739" "1" "0.149535" "1.5945917" "-4.39" "0.50261158" "" "" "3273" "1" "0.149557" "-1.5944926" "-4.39" "-0.41788534" "69307" "AAACTGCGACAATTACATTACACCAGGCCCACCAAGACGACTCTGCCTTTTGAGTTTGTT" "54101" "1" "0.14957" "1.5944371" "-4.39" "0.81853522" "54445" "AGCCTGGGGTCACCTGGAACTTCCTCCAAGGAGATAAGGGTCACTCTCCGAAACCCCTAT" "10117" "1" "0.149583" "-1.5943788" "-4.39" "-0.18594901" "93722" "AATGATAACAGTCCTGAGGTGACCATCACATCTCTCTTCAGTCCAGTGACAGAAGATTCG" "44096" "1" "0.149603" "-1.5942866" "-4.39" "-0.16181568" "257938" "ACACCTCCTCGTGGTTGTCCTGCAGTATGGATGTTGCACCCTCATCTACCTTCGCCCTAG" "41694" "1" "0.149615" "1.5942341" "-4.39" "0.1877187" "100505352" "TAAGAAGGAGATTACCTAGGGTAGAGCCTTCTGACCTTGATGGCTCTATTTGCTCTTCTC" "38219" "1" "0.149638" "-1.5941315" "-4.39" "-0.16438585" "" "ATTTTGACGTTAGCCTGTTGGTAGCATAGTCACTCCGAAGTACATCCACCACACATGGAT" "1067" "1" "0.149643" "1.5941085" "-4.39" "0.37917029" "" "TATGTCTAATGTATACCGTGAATGCTATGAGGCCTGTCGAGATGGCTCAGCAGTTAAGAG" "32741" "1" "0.149651" "1.5940747" "-4.39" "0.21949425" "74686" "AGGCTTTTTGGATTAATCTAGAAGTGGAATACCAAACTGTCATCATTGCCATCATCACCA" "9277" "1" "0.149664" "1.5940127" "-4.39" "0.93209409" "236573" "AATATAAAAGTGCTGATTTGAGGGTGGCTGTGTCCTGCACACATGAACAGAACAGCTCAT" "29412" "1" "0.149679" "-1.5939496" "-4.39" "-0.22577318" "" "TGCATAAAGTCCTGGGCTCAAAACCGAGCGCCCAGAGTACAAAGGAGTCAAACGCCAATA" "580" "1" "0.149696" "1.5938701" "-4.39" "0.35411856" "" "" "17453" "1" "0.149711" "-1.5938047" "-4.39" "-0.14523239" "320808" "AGAAGACATTCTGTTCTGTTGAAGTAGGTAACAATGGAGAGAAGAAAATATCAAACTTCC" "19417" "1" "0.149722" "1.593755" "-4.39" "0.97363355" "" "TATTATAGGAAACAGTGTGCCATGACCAGCATGTATGTGTAGTAGGAACTAGAGAAGTAG" "33343" "1" "0.149733" "1.5937059" "-4.39" "0.45578621" "" "" "53681" "1" "0.14977" "-1.5935391" "-4.39" "-0.21968674" "50791" "TTCCAGCCTCTCCATGTGCATGAAAAGTGACAAGCATGGGTCCCCATATTTCTACTTACT" "6435" "1" "0.149808" "-1.5933699" "-4.39" "-0.15620653" "" "AATACAGCTGAGTGTGATGTCATTGAAACCAGATGGAAAGACCAGAAATCCCTTAATCCC" "22475" "1" "0.149819" "-1.593323" "-4.39" "-0.13077405" "" "AAGTAATTCATAAATTATGTCCACATTAGAACAAAATGAATTTTCCTTTGTGTGTGTTAT" "38798" "1" "0.149825" "-1.5932945" "-4.39" "-0.16833041" "214133" "ACGCACAGTGATGTATAGTTCACTTTACAAGGTAGTTTGGTTAACTTGTTAGGGTTTTTT" "44449" "1" "0.149853" "1.5931713" "-4.39" "0.47149243" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "60646" "1" "0.149884" "-1.59303" "-4.39" "-0.12627296" "23988" "TCCTGCTACTGTCACACAGTATTTATTGTTCCTAAAATGACTGGGAGGGGCTCTGAGCAT" "62795" "1" "0.1499" "1.5929617" "-4.39" "0.47177999" "13025" "CTCAATGTGTAGAGGAGAAATGGCTCCTGATTTGCCTGAATATGAAGATTTGGGAAAGAA" "3442" "1" "0.149909" "-1.5929209" "-4.39" "-0.1896365" "76487" "AGATTCGATGTATTTTCTTCCGTGATTGGATACAAATGTCTTTTAAGAAAGTAAAGGCCG" "54904" "1" "0.149926" "1.5928451" "-4.39" "0.26918236" "12477" "CTTGGAAGCAGCATAAGGATATAGCATTATGGTGTGGGGTCAAGGGAACATTAGGGAATG" "7034" "1" "0.149928" "-1.5928347" "-4.39" "-0.14868915" "100090" "GCGACACAAAGGTGTGAGAAAGTTCGAGTGCACCGAGTGTGGCTACAAGTTCACACGGCA" "60336" "1" "0.149963" "1.5926777" "-4.39" "0.29376581" "16542" "CTACTGTATCCTTTAGAATTTTAACCTATAAAACTATGTCTACTGGTTTCTGCCTGTGTG" "14026" "1" "0.149965" "1.5926671" "-4.39" "0.44707303" "" "TCGGGATCCTGAAATGATGATGTCGGGCGAACGGGAAACATCGAGTAATCCAAAGGGACT" "1183" "1" "0.149966" "1.592667" "-4.39" "0.53586797" "" "GTTCTTCTTATTTAGAGATAGTGACATTTTTGGAAAGTATGCGGACTGAAATTGCTGATG" "43195" "1" "0.149968" "1.5926562" "-4.39" "0.13315882" "57913" "AATTAAGATAGCTTTAAACTTGACTCGACCAGTGGGCAGAGCCCTATCCTTCTACCTCAC" "54117" "1" "0.149985" "-1.5925801" "-4.39" "-0.21261913" "13607" "GGGATGTAAGTTTGTGTAAATTAATGGTTTATTCTTTGCAAATAAAGTGCTCCCCTCACC" "24277" "1" "0.149996" "-1.5925289" "-4.39" "-0.20402317" "229004" "AGAGCCATACGAAAATAATTCTCAAATCAGCTTCAGAATTAGTTCATAGCACTCCTTCCC" "58770" "1" "0.150001" "1.5925069" "-4.39" "0.1622736" "381970" "TGATCTGAGTGCCATCTTGCTGACCTTTCTTTCTCTCTGTAAGTTGGATTCCTGACACCT" "22691" "1" "0.150013" "-1.5924557" "-4.39" "-0.29397797" "" "TGTGAAGAACCCAGGAAGGAAAGCTGGAGGAGAGCATGGTGGGTGGCAGAGCGGGATTTG" "41291" "1" "0.150021" "-1.5924173" "-4.39" "-0.2055896" "" "TGAAAAACAAGATGGAAGCAGATTGCCTCCCTTTAAAATGGTCGCTATGGGAACCCCAAA" "62570" "1" "0.150057" "-1.5922583" "-4.39" "-0.14668416" "66597" "GGTGGCACTGAACAATGTGGCAGAGTTTATATGCAAATACAAACTATTATAAAGTCTTTC" "15240" "1" "0.150086" "-1.5921297" "-4.39" "-0.15639083" "" "TTTGAGGTGAAATCACTAATCTTTGACCAGAGCAGTAACTACCTGGCGCTTGGGGATACA" "44752" "1" "0.150116" "-1.591996" "-4.39" "-0.29644899" "18751" "CCTGTGAATTCGTGTCTCTTGGAGGAAACTTTTTGTTTAAGAATTGGTATGATTAAACTG" "28942" "1" "0.150122" "1.5919673" "-4.39" "0.33079929" "" "" "12308" "1" "0.150123" "1.5919641" "-4.39" "0.16618857" "328479" "GAAGGGAAAAATCCTGAAAAGATTTCTAAACTGTTCATATTTTGGAGAGCTGGTCAATGA" "25560" "1" "0.150126" "-1.5919506" "-4.39" "-0.19716685" "103236" "AGACTTTTTTGAGAAGCCAGACTACGACTACCTGAGGAAGCTCTTCACTGACCTCTTTGA" "13965" "1" "0.150132" "1.5919219" "-4.39" "0.37275294" "20723" "TTCCTTCATTGATGAACAGTGATGTAAACGTATAAGCCAAATAAACCTTTTCTACCCCAA" "30046" "1" "0.150154" "1.5918275" "-4.39" "0.20307031" "77296" "GAAGAAGCTGCATTGGCTGCACAGTCCAAGTCTAAATGATGCTTTAGGCTAAACTGTGTC" "60259" "1" "0.150202" "-1.5916097" "-4.39" "-0.11997672" "69125" "CAGGAATGGTCTTACCTTTTAAAAGCTTGTGGGAAACTGAATTTGAAATGACAAAATGTC" "62699" "1" "0.150211" "-1.5915701" "-4.39" "-0.18997483" "213819" "GCTCGGTGACAAGGTTTTGTTATTGTGTATGTTGTTGTTGCTTATTTTTAAAAAGGCCAA" "52893" "1" "0.150241" "-1.5914391" "-4.39" "-0.13202914" "69556" "TGGCAGTTAGCATCAGTAGCCTTAAGGTTGTTGTGACCTTCCTGTGCTTGGGAATCTTAA" "9076" "1" "0.15025" "1.5913956" "-4.39" "0.66494879" "17312" "CTGAAATCTGTGATATTTTGTACAGTGTGCAGCTTATTGTAGGCAACTTTTGAATGTAAC" "17901" "1" "0.150257" "-1.5913654" "-4.39" "-0.15623485" "" "TCGTGCTAGTCACACACTACCTAGGAAAAGCATGTTCTCTGCACTTTCTTCACTGACACA" "55264" "1" "0.150272" "-1.5912988" "-4.39" "-0.13108855" "" "AGCACATGTATTGTGCAGTTGTCTTTACACTATTAACAGTTAACACAATCTTACTAGGAC" "10778" "1" "0.150302" "-1.5911676" "-4.39" "-0.64151743" "" "GGAGTTGTGTGTCTGTTCTAAATGTATGAGGGGCAGTTATGTAATTTACTACCAACAGAA" "32600" "1" "0.150306" "1.5911487" "-4.39" "1.04563723" "" "GAATTGAATCTCATTGAAGATGGGTTGCAGCTGAAGTCTGTAAGGCACAGTTACATGCAG" "8075" "1" "0.150315" "1.5911098" "-4.39" "0.91484071" "" "AAGCTTCACATCAGCCCTTGCAATATGACTAACCAAAACACAAATGAATACCTAGAAAAA" "41878" "1" "0.150334" "-1.5910243" "-4.39" "-0.14359563" "12449" "CTGTCTTTATTTCTACATTTCTTCTAATGGGGAACAAAAGGAAGCATTTGAAATAGAGGG" "4975" "1" "0.150342" "-1.590988" "-4.39" "-0.14540365" "217732" "TGGTCACTAGCTGGAAGGTTTTGTTCATTTATACTTGAAATAGCACAGACTATCTAAAAG" "52086" "1" "0.15036" "1.5909074" "-4.39" "0.90978343" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "4946" "1" "0.150376" "-1.5908379" "-4.39" "-0.13061552" "319865" "GTGTCTTGCAATATCAAATAAGCAGTTAAGATTTAGGTCCTTATGTGAACACTAACAAGC" "5408" "1" "0.15043" "1.5905941" "-4.39" "0.63828" "232408" "GGTTTGTATTGATTGACACTCGCCAACTAGTTGACTAATAATGGACTAATGCTGTGTTCG" "52977" "1" "0.150445" "-1.5905282" "-4.39" "-0.2421767" "654788" "GCTTATGGCACTACCTCCAGCAATCAAAACTCTTAAAATACAAAGGGATACTTTTTTCTT" "54019" "1" "0.150457" "-1.5904774" "-4.39" "-0.20030321" "" "GTATAGTAGCAGAAATGATACCAAAGCTAAAAACAAAGACACAGAAATCAGGAGGTGCCG" "31702" "1" "0.150463" "-1.5904512" "-4.39" "-0.14246316" "64659" "ATTGAATTGTCTTTCAACTTTAAAGCATAGTACAAGAGTGGAATAAACATATTTTCTGTG" "53468" "1" "0.150481" "-1.5903669" "-4.39" "-0.15039459" "217011" "GAGTAGCAAGCGGCGGGAAAGACAAGTGCCTCCGGATATGGAGAAGATGACTCCACAGCT" "13709" "1" "0.150504" "1.5902662" "-4.39" "0.22357955" "17970" "CATTTTTGTTTCTTGCTGACAAGTGAGCAGTTGAAGTTCTAAGCTGTATTTTTACTGCTA" "15655" "1" "0.150506" "-1.5902556" "-4.39" "-0.22241144" "76820" "ACCTGAATTTGTATCCTGACTGATTCAACCCAGCCGAGCATAAATTGACTTGAGCGCCTT" "26188" "1" "0.150546" "1.5900799" "-4.39" "0.46307032" "12960" "ATCAGGATGGATTCCCAGGAACATAAGATCTGCCTGTTCGAAGGGGCCAACTTCAAGGGC" "26097" "1" "0.150549" "1.5900674" "-4.39" "0.15467488" "241636" "TTTCTGAAGCCATAAGACAAAGCAGAAACAAGGTTGAGAACCAAGTGGTCCCCCAACTCA" "15752" "1" "0.15055" "1.5900633" "-4.39" "0.12306907" "235542" "AACCATTACAGGTAAATGAACATAAAGAATTTTCAGACCATGATACTTATCTTAAAAAAT" "59154" "1" "0.150586" "-1.5899007" "-4.39" "-0.18100105" "58242" "CAAGACTGACTCTGACTTGATAATTGTTGAAGCTGTGTGATAGATGTTTGAGAATTCATT" "12877" "1" "0.150632" "-1.5896962" "-4.39" "-0.14251649" "" "" "35624" "1" "0.150635" "-1.5896849" "-4.39" "-0.21612604" "381406" "GGTATTTGTTATATGTATGAAGACTGTGCTCGAGGCTAGTTCAGTGGATGTAAACTCCAC" "40808" "1" "0.150644" "-1.5896447" "-4.39" "-0.15279482" "" "TGACTTTAACTCAATCTGTTGGTGCCAGAACGGATATTATGCGGTGCCCATAGCAACCTT" "45977" "1" "0.150662" "1.589564" "-4.39" "0.18829617" "170786" "TCCTTGTCAAAGTCTACAAAATACCCAGTTCTCAGGAAGAAAACAATCAGATGAATGTCT" "17539" "1" "0.150679" "-1.5894863" "-4.39" "-0.21616534" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "16454" "1" "0.15068" "-1.5894816" "-4.39" "-0.21853639" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "20794" "1" "0.150685" "-1.5894626" "-4.39" "-0.13686661" "" "TCCAAGAGTAAGAGATTCCTCCCAAGCCCAAGTGACTCCTGTAAATGTAACTGATTTTTA" "23860" "1" "0.150707" "-1.5893613" "-4.39" "-0.19922644" "238247" "TTTGCAAACAGAAGTATCTCAATGTCAAATAAAAAGGAGCCCAGTGGGCGTGTCTTAAAC" "46382" "1" "0.150727" "-1.5892765" "-4.39" "-0.19867796" "" "CCGGGCCGATCTGTATATAAATCTCACCATCCAATTACAAGATGTAATAATTTTGCACTC" "49984" "1" "0.150736" "-1.5892349" "-4.39" "-0.16379524" "399599" "TCAAACGACTGTGGGTCATGTTGGAAGTCCCTGAACAGAATCGGGTAGACATGGTTATTA" "12686" "1" "0.15074" "1.5892168" "-4.39" "0.9353555" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "49611" "1" "0.150742" "1.5892086" "-4.39" "0.29852944" "100033459" "TGGCCATGCTTGCTTTAATAGCTATGCAGAGTTCTTCTGAGATTTGTAACTACGACAAGG" "30009" "1" "0.150748" "-1.5891814" "-4.39" "-0.1561659" "" "TACACAAGAATCTGCATACTTCAGCATGTGGCCTGGGACTTCAGATCCATGTCTACAACA" "43121" "1" "0.150757" "1.5891406" "-4.39" "0.18522207" "" "GTTTTCCCGAATTCCCCCTTAACATTACCTCTCATCAAACTTCTCATCCTACTGAGATGA" "35257" "1" "0.150769" "-1.5890873" "-4.39" "-0.23589397" "" "ATCGGTGATGTTGCAAAGAAACTAGGAGAGATGTGGAACAACACTGCATCGGATGACAAG" "36356" "1" "0.150784" "-1.5890219" "-4.39" "-0.21289854" "" "ATTTAAAGAAACCCTTGTGGATGAAGTCAGGTTGTGCAATATGGGGAGCCGCAATGTTTA" "62404" "1" "0.150801" "1.5889451" "-4.39" "0.12705508" "" "TGGTTTCAAATATGGCCGCCATGCTGTAAGAACAGGAAAGAAAGCCCTGTTTCTAAAGAG" "60434" "1" "0.150801" "-1.5889436" "-4.39" "-0.16930536" "208440" "CCACCAGTACGCTTTGTACATCTGTGATAACGCCTGTTTTATATTCAAATGAACAAATAA" "17797" "1" "0.150805" "1.5889275" "-4.39" "0.44753526" "21894" "TACCTATGGGGCTTGAGGGTTGTAAACCCAAACAGGTCAGACTCCAATAAAGGTGATTCT" "10373" "1" "0.150833" "-1.5888042" "-4.39" "-0.12924513" "22290" "ATCTCCAAAAGTCATTGGAGGAAGATCCTAATTCTGGTCAATCTTGGTATTTCCTTGGAA" "2328" "1" "0.150839" "-1.5887753" "-4.39" "-0.26489304" "67897" "CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT" "35308" "1" "0.150901" "1.5884997" "-4.39" "0.2441782" "18802" "GAAATAACTTTATTGGCCAATACACCCTACCTTGGACCTGTATGAAACAAGGCTACCGAC" "54306" "1" "0.150943" "1.5883148" "-4.39" "0.35272278" "" "CTGCTCCAGTCTCTCCTGACTCAGGCCTTGCACTTTCGTTGTTTCATGAACACTGAGAAG" "40743" "1" "0.150947" "1.5882969" "-4.39" "0.18075468" "12091" "GTTGACACTCCGGTCATTTCCTGACCTGACTTGACCATCGGTGGCCATTTTCCAAGCCAG" "26590" "1" "0.150947" "1.5882959" "-4.39" "0.51516703" "14619" "CAAGTTGAACCATTACCACTATGCCTTATGTGTATCCTACAAGATGACAGTCAACAAATC" "254" "1" "0.150955" "1.5882625" "-4.39" "0.28779195" "258489" "TATCTTCATCACCATCTTGAAGATTCGTTCCACTGAGGGTCGCCAAAAAGCCTTTTCCAC" "14731" "1" "0.150966" "-1.5882125" "-4.39" "-0.16627748" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "25287" "1" "0.150979" "1.5881565" "-4.39" "0.56265094" "381693" "GAAATGATCTCAGCCCATGTGGGCTCATCCTGAAGCAATTAGAGTTGAAATTTCAGAGAG" "31967" "1" "0.150991" "-1.5881018" "-4.39" "-0.18204901" "640530" "GACTTCTTAGTAAGGAACCTGCAGCCTGCCATGGTGAAAGTCTATGACTACTATGAGACA" "39851" "1" "0.151003" "-1.5880473" "-4.39" "-0.17244968" "241764" "TTTGATGGCTGGAGTCACAATTATGATTTCTGGATTGATGCCGATCACCCAGACATCCAC" "25558" "1" "0.151048" "-1.5878476" "-4.39" "-0.14309906" "435206" "ATTGTCTCTGGCAAAATCTTGAGGGAGAATTCCTCAACCACCAACCTGTTTCCTGAATAG" "31296" "1" "0.15105" "-1.5878425" "-4.39" "-0.1917149" "" "CTTTCATGTCATTGAATACCTTGATGACATCATCAGAGTCAGCCACACCAGAGGCCATGT" "57804" "1" "0.151051" "-1.5878368" "-4.39" "-0.16286076" "237782" "AGCTGCTCGTGTGCATGGAATGCTTCTTGTAATCTTGAAAATGTGAGACCTTTTAAAAAA" "30656" "1" "0.151062" "-1.5877852" "-4.39" "-0.1258289" "12015" "TGGAGACCAGCAGCCCAGAGTATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAA" "5134" "1" "0.151065" "1.5877749" "-4.39" "0.63998945" "" "" "18384" "1" "0.151079" "-1.5877116" "-4.39" "-0.21134374" "228730" "CCCGATGATTTTGATGATTTTTATGACACATGAGCTGTTGCATGCTTAGAAATAAAGTCT" "41423" "1" "0.151101" "-1.5876124" "-4.39" "-0.23438447" "" "TTTTTTCCCCTCAAAAGTCCTTTATTTTCTGATGAGCTCATCAGGCAGTTTTCAAAATCC" "52819" "1" "0.151113" "1.5875605" "-4.39" "0.65695956" "243771" "TGACTTATAATGATGTTAGTATTGTATTTTTAACTCTTTGCTGACTTTGATGTTTATTAA" "8117" "1" "0.151119" "-1.5875334" "-4.39" "-0.22361211" "26556" "GAGCTAGCTACCCTCAAAGGCAACAATGCCAAACTCACTGCAGCCCTGCTGGAGTCCACT" "2812" "1" "0.151119" "1.5875334" "-4.39" "0.54949026" "14174" "GCTGTATGCTTCGGATCACTACAACGCAGAGTGTGAGTTTGTGGAACGGATCCATGAGCT" "27345" "1" "0.151129" "1.5874921" "-4.39" "0.44734853" "24047" "AAGCTCACTTGCACTTGGCTCCTGAACCCCTTCACGCCACAGGAGGACATCTGAGCGATT" "23095" "1" "0.151142" "-1.5874322" "-4.39" "-0.14659444" "" "AACACTTCCTGAGAGGTCCTGTCATCCAGCCAGACTTAAGTTGCTCCCTCTCCAGGCCAG" "35963" "1" "0.151148" "-1.5874078" "-4.39" "-0.27789812" "12322" "TTGTTTGTTTTTGTTTGTTTCAAATCTCCCCTGTTGCAAAATAAAAGTCCTGGTCCTATG" "1286" "1" "0.151151" "-1.5873937" "-4.39" "-0.1896458" "319478" "GGAGATTAACAGTTTGTACACAACACTATGGTTCTGCAAGTTAAAAATCTGGAGCAATAA" "45889" "1" "0.151151" "1.5873916" "-4.39" "0.27998705" "20787" "GGTCGGCATCCACAGGCCGCACACTTCCAAAACAATCGTGGTATCTTTATTGACTTTTTT" "34262" "1" "0.15118" "-1.5872651" "-4.39" "-0.48864075" "" "" "56227" "1" "0.151212" "-1.5871203" "-4.39" "-0.17079851" "258274" "GGCAACATTAGTCATCCTGATTTCATATGGCTACATCACTGTGACCATCCTCAGCATGCA" "51227" "1" "0.15124" "1.5869986" "-4.39" "0.50781778" "" "TACCCACCAGAGGCAAGACAGCCTGAAGAAACATCTAAAGTCTGAGATCAAAGTGATTGC" "58068" "1" "0.151243" "-1.5869865" "-4.39" "-0.16141714" "319748" "TGCCTGTCTCAAAGCCTTCAAGGATCCTGGCTACTTCCGGAAGCATCTGGCTGCCCATCA" "2683" "1" "0.151252" "1.5869463" "-4.39" "0.15106797" "78609" "GTATGACTATCCGTAGCCCAAGGTCTGTGTGGTGCTAATGCAATTAAAAGAATCTCACAG" "42116" "1" "0.151253" "-1.5869398" "-4.39" "-0.29645516" "219170" "GAAATGGAACGTTCATCTGAACAGGAAGATGTTTCAACATTACCAGACCCCTTTCCAGCC" "37707" "1" "0.151271" "-1.5868615" "-4.39" "-0.13541893" "26894" "CCAATGGAAATCCTGGAAGGATTTATATCTCCTCCTGTGGTTCTGGTGGGGAAGGAAATA" "33315" "1" "0.151294" "1.5867599" "-4.39" "1.2129895" "219132" "CCATGGGTTTATGCTCACTATCATATCACATTGCCAATATTTAGCACACTTAATAAATGC" "2116" "1" "0.151303" "1.5867185" "-4.39" "0.81915024" "" "ACCTTTAGCAAGATCAAGGCCATCAAGAGACAAATGCTGGAATACAAAAGGAACTATTCA" "3665" "1" "0.151328" "1.5866069" "-4.39" "0.16128541" "" "ATTCATACATTCTGCTGAGACATGGGCTGTATAACCAGGCGGTAGCCAAGAGTTTCTAGT" "58062" "1" "0.15133" "-1.5865985" "-4.39" "-0.32335325" "338352" "GTGCTGTAAATCACATTTCCCTTGTCAGATCATTTACAGATACATTTAAAGGATTCCATG" "42112" "1" "0.151334" "1.5865812" "-4.39" "0.31001564" "" "ACATGCCAGGAGGCTCTACTTATGGATTTTATGCCTATGCTGCTGCCTGCAGTGTCGTCC" "20545" "1" "0.151338" "1.5865652" "-4.39" "0.28691857" "225115" "AAGTTCTGCTTCCGGTGCTAAAGCAAACAAAGACTTTGTATTCTTAGGGTGAACTCTGAA" "16358" "1" "0.151369" "-1.5864273" "-4.39" "-0.25626391" "237411" "CCATATAAATGCAGTCAATGTGGTAAAACCTTTGCACGTAACAGCCATGTTAAAATGCAT" "47899" "1" "0.151372" "-1.5864143" "-4.39" "-0.15590873" "75561" "AGAGTCGGTTATTGATTATAGACGTCAACGTCCACCTGGAACGGTTCCTTAGCATCTCAT" "49188" "1" "0.151374" "-1.586406" "-4.39" "-0.23279376" "270685" "ACAGAAACGGAGCAAGTTAAAGGCTTGTTCTAATGGAATGAAACCCACAGGACTGGGCAA" "43366" "1" "0.151423" "1.5861887" "-4.39" "0.19270241" "" "CTGTAGATCCTACACAACGCTTGTGTGTAATCACAGACTTCATACTTCTGAGACACTTTC" "3154" "1" "0.151429" "1.5861631" "-4.39" "0.76258394" "" "TGCAGAAAGGTTTCGGCACAATAAATCCAAAAAGTAGGGACACAGGTCAGAAAGGAACAA" "23206" "1" "0.151433" "-1.5861416" "-4.39" "-0.2194263" "12867" "AAAGTTTAAGAGATGATCTGAAAATTGGATTAAACTCTTGAACTCTTATACTAGAAAAAA" "53488" "1" "0.151463" "1.5860089" "-4.39" "0.70684404" "71607" "TACCGCACAGAATGTGTTCAAGGCCAGCCTAAAAAGTTTGCTGAGACTGGCTCCAAATAA" "44710" "1" "0.15149" "-1.5858909" "-4.39" "-0.16011951" "" "AGAAGCAGGCTGGAATACTTCACCCTGCCAGTCATGTTACCAGAAGGTGAGGCTAAATGA" "20327" "1" "0.151491" "-1.5858882" "-4.39" "-0.16335271" "117600" "GATGTCTGAAGATGAAAATGAATTAGTGGCAAGAGTGGGTGATCCACAACCTTCCTTGGT" "57968" "1" "0.151492" "1.5858809" "-4.39" "0.88055015" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "18630" "1" "0.15153" "-1.5857144" "-4.39" "-0.14454547" "" "" "46659" "1" "0.151531" "1.5857111" "-4.39" "0.42926462" "22420" "TTCCTCAGAATTACTGGGATGGATGGGTGAGTTTAGTATCAATAAAGACATTTAAATCCA" "903" "1" "0.151536" "1.5856889" "-4.39" "0.58531403" "" "GAGTTTTGTTTTAAAACCTTCAGGTCCATTCAGATGCAGAGCAGAGCAGAGGTCAACAGT" "57637" "1" "0.15154" "-1.5856689" "-4.39" "-0.16813323" "228071" "CTCGCTTTCACGCCGTACCTGACTTGTCAGTTTGTAGCCAAACAACCAATACTAAGCTTT" "61546" "1" "0.151542" "1.5856627" "-4.39" "0.45174881" "" "CTGCTTCCCCTAAACCATCTTATCAATGATATAGCTTCAGGAGAAAATTTTAAGGAAAGA" "4647" "1" "0.151567" "1.5855484" "-4.39" "0.19880867" "" "" "58617" "1" "0.151611" "-1.5853576" "-4.39" "-0.16446234" "" "" "22982" "1" "0.151632" "-1.585263" "-4.39" "-0.17098886" "20807" "GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT" "37688" "1" "0.151637" "-1.5852413" "-4.39" "-0.21111998" "380698" "CATGTCCAGAGTTCTGTAGATGGTAGCCATGGGAGCTTCAAGACAGAGGTCTCCACCCAG" "26831" "1" "0.151689" "1.5850133" "-4.39" "0.71234997" "" "TTTTCCAGGAGCTCTGTGGGACCGCAAACCTCCTGAGCTATAAATCGCTAGCCCAGCCCA" "28510" "1" "0.151701" "-1.5849597" "-4.39" "-0.25614968" "" "CTCAAACAGATGAGCACCAATAAATGCTGTACAGCCTCGGGAAAGCTGCAGGGGAAAGAC" "54043" "1" "0.151727" "-1.5848442" "-4.39" "-0.15521555" "12632" "AGTGGTTAAATGTCTAGGCTTCCATTTAAAACTACACAAATGACTTGGGATCTTTTTAGC" "10469" "1" "0.151739" "1.5847915" "-4.39" "0.24251066" "12525" "CCTGAAGGAACTAAGAGTCACCCATGGTCCTCTATCTATTGTTACTATCATTTTATACCT" "724" "1" "0.151751" "1.5847381" "-4.39" "0.84249984" "" "ATCCTGTAACTTTTAGGTGAAGATGTGAGCCAGAAATCCCTGTTTGCTCAAGCTCCTTCC" "7114" "1" "0.151752" "-1.5847328" "-4.39" "-0.14563887" "72611" "GATCGGCTTTCCATCGGGAGTGCTCATCCCAGCACGGAAACTCCTTTTCCAAGATTGTAA" "9873" "1" "0.15177" "1.5846521" "-4.39" "0.18547356" "" "GTGCACCCTTCTCTTGCTGGTAAAATGCTGTTGGAGATTGATAACTCAGAATTACTTCAC" "59768" "1" "0.151771" "1.5846504" "-4.39" "0.15008569" "" "" "3020" "1" "0.151794" "-1.5845475" "-4.39" "-0.31321919" "100503238" "GTGTAATGCCCTCTTTTCAGCTCTTTATAAGTGATTACATTACAGTTAAGACATTCTCTG" "37783" "1" "0.15184" "1.584345" "-4.39" "0.19027254" "" "TTGTGCAATCTTTTCTGGATGGGCCACACCCTGAATGCACCTTAAATCTCCTACTTTTTT" "59337" "1" "0.151842" "1.5843368" "-4.39" "0.17657099" "18127" "GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA" "50698" "1" "0.15187" "-1.5842121" "-4.39" "-0.15116675" "" "" "56147" "1" "0.15191" "-1.5840344" "-4.39" "-0.14331247" "76123" "CCTTGGCTAGGGTTTGTGTAATAGGGATTTAAATGACTCCTACATTAGAACTCAGTCTTT" "14904" "1" "0.151912" "-1.5840257" "-4.39" "-0.21270775" "547176" "TTCTAACATTGTTCTTGCAGTGATGGAGAAGAATCCCCACACAGCAGACGCTCAACAACT" "53107" "1" "0.151923" "1.5839793" "-4.39" "0.43684654" "67849" "TGAGGAACTAGTGTGCAGCCTAAGGGCAAGGTGGCTTGATCTCAAATAAACTGTGTAGAA" "56202" "1" "0.151926" "-1.5839626" "-4.39" "-0.18684296" "" "TCTACAGAACCCATCGTTATGAAAGATGTCACGTATACAGAAAGAGTTTGACGTAATCAT" "22605" "1" "0.151928" "-1.5839578" "-4.39" "-0.15864376" "77485" "ACATAATTCATGGATCACTTCATCAGAACAATGTATTTGCCTTAAATCGTGAACAAGGGA" "61951" "1" "0.151937" "1.5839171" "-4.39" "0.15803712" "" "TAAGAGCTGTTAGCTGTGAGTCTTTAGTTTAGACACTACTAGAGAGACATGCCCGAGCCT" "7475" "1" "0.151952" "1.5838483" "-4.39" "1.0914118" "11433" "GCTTTCCTTTCAGTCAAGTCTTACTGTCACTGCTATTCAATAAAACAATGCTTTGTCTCC" "39171" "1" "0.151986" "1.5836988" "-4.39" "0.58441127" "319236" "TAATCTACATGTGGCCAACATAGTAGAGAGGCTCAAAGAGTTCAAGCCTAGCCCAGAAGA" "61737" "1" "0.151989" "-1.5836872" "-4.39" "-0.46287817" "225288" "GTACACACATACAAGCACAGCTTGTTTACCAGTTGTGGATTTTAGATGTACTAAATGTTT" "13031" "1" "0.151995" "1.5836593" "-4.39" "0.15023007" "" "CAGTTTTGCTGAGTTCTGCTGGTGTCCCAAAGCTAGGAATCTAGAGCCTATCATGAAAGA" "60997" "1" "0.152019" "-1.5835554" "-4.39" "-0.12485452" "51812" "CTCCTGTGTCTCCAGTGAGTCAGCTTTAGACTCCTTTTTGTTTTTGTTTTTGTAAATAAA" "6638" "1" "0.152051" "1.5834135" "-4.39" "0.51584544" "54483" "ATGGATTTCAGGTTACTCTTGACTGTGGTCCAGGCTCCATACAAAATGAAAGAAAATAAT" "2738" "1" "0.152074" "1.5833112" "-4.39" "0.51878676" "319236" "CTGGCTCTGATATGTATGTCCATTTGCCTGAGCTCATCGTACCATTTTCTCTCTCTTTTT" "57591" "1" "0.152078" "-1.5832958" "-4.39" "-0.18859213" "269999" "TTACAGGGCTCCTCAGATGAGCCACTTCACCCTTGGTGACTTGTGGTGGTCGTTCCACTG" "1550" "1" "0.152081" "-1.5832821" "-4.39" "-0.1632549" "665635" "CACAGGCCCAGGGGCTCATGCTTGAAGGAGAAAAAGGCGACAAAAATAAATAAATAAAAG" "39666" "1" "0.152103" "-1.5831851" "-4.39" "-0.21656466" "" "TGAACCCCAAGTCCAGGGACCAGCCTGATCTCCACGCCCAACCACTTCAGAGAAGAGAAA" "47156" "1" "0.152115" "-1.5831308" "-4.39" "-0.12854652" "21854" "AGCTTAGAAGATAAAGGACCAAAGGCCAAATAACAGTGACACTCCACCATCATTCCTTCG" "11864" "1" "0.152119" "1.5831142" "-4.39" "0.72418294" "624696" "ATGGACATACCTTTATCCTGAGTGACCCTTCTAAGACTGGAATTGGTGCCCCTACTGTTA" "2910" "1" "0.152132" "1.5830577" "-4.39" "0.99425247" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "24532" "1" "0.152155" "-1.5829531" "-4.39" "-0.28910171" "" "ATGCTAAAGAACAGAAATTGTTTTTGGAGGTGTCTTATGTTCTTTGCTTATGACTCAAGC" "54742" "1" "0.152164" "1.5829159" "-4.39" "0.94609778" "18826" "TTTGAATAGCTCCCACTAGATAAGCAATTTCCACGAGAACCTACCAAAAGCTAAAAAGCC" "20889" "1" "0.152174" "1.5828698" "-4.39" "0.20095212" "214189" "TTAAAATGGATGCTTCTTCTACTGAAGAAAGGAAGAGGGACTTTGAGAAAATCTTTGCCC" "26667" "1" "0.152218" "1.5826753" "-4.39" "0.37889677" "" "CATATGGAAGACATTGCCTAGGTTTATCTACTGGTCTTGAAAAGTAATCATACTCATAGA" "31533" "1" "0.152259" "-1.5824967" "-4.39" "-0.15900323" "15432" "CCTGTGCTAACAGTTGCCGTTTATGTTTTGTTTTGATTTTGTAAAATAACACTTCCCTGT" "42522" "1" "0.15226" "1.5824927" "-4.39" "0.14818652" "100043092" "GAGGAACTTTGGGGACCACTGCTAAAATCAGACACATGAATAGCCTTGTCAGAGAGATGG" "30087" "1" "0.152272" "-1.582439" "-4.39" "-0.12872798" "" "TCTCTTGCTTGTAATATTCCTTCGGATTTTCTCGTTCCCTCTCTAACTCTGACTTCCAAA" "11832" "1" "0.152273" "-1.5824356" "-4.39" "-0.1405619" "623583" "TCTCAGGGACTTCAGATCTTTCTATTTGCATTCTTTCTCATTTTCTATGTAGGAATTGTG" "53890" "1" "0.152275" "-1.582424" "-4.39" "-0.1512706" "" "GCTGCTAATGAGTAATTCCACTGCCTTACTTATTACAAAACAAATGTCTCATGGCTTTTA" "38174" "1" "0.152277" "1.582417" "-4.39" "0.26273959" "72042" "ATGCTGCACCGGGCTGGGCTGTGAGGACCATCTCTGGCATTCCGACAGTTTACAGAAGTA" "3813" "1" "0.152299" "1.5823224" "-4.39" "0.85829976" "" "TTTGGATCTTGCACAACTGCAGGACTCATGCAGTTGGAAGTAGAGTATCCGCCTGCCTTT" "45703" "1" "0.152315" "-1.582248" "-4.39" "-0.13288005" "11704" "ATTCTTCCTGAGCTGCCTCTGGAAGCTTGGCCAGCGACAGACAAGACCAAGCGGGAAGAA" "19430" "1" "0.152329" "-1.5821889" "-4.39" "-0.15170929" "75398" "TGTGGATATTGCTATGAGAAAGTACGCCAGGAGACGACAAAAATCAGACAACAAATAGGG" "21219" "1" "0.152345" "1.5821166" "-4.39" "1.00208812" "" "ACTTCAGGAGTTTCCAAAAGCGGATGCTGACGTTCGAGGTCAGGCCATTGGGAGAGTCGG" "639" "1" "0.152357" "-1.5820634" "-4.39" "-0.12370738" "17463" "TTCATAATTGCTAAATGGAATTCATGGATCCCATACAATGCCGCCCAACACTTGAGCTTG" "56595" "1" "0.152371" "-1.5820031" "-4.39" "-0.2585965" "100039239" "TGCTTCAACTCCTGTGTCCTTATTATATGACCCCTAAATAAATCAGCACCTGTGAGCTCC" "29563" "1" "0.152373" "1.5819961" "-4.39" "0.27694596" "21755" "CAATCGATTTGGCTCAGGATTCTGTGATTTGTCTACTGATCTATTCACCAAGAGCCACTT" "54923" "1" "0.15245" "-1.5816578" "-4.39" "-0.24028781" "" "GCAAAGATTTGGGGAATTTAATACTGGAGAGCTGAACTAAAACAGTAGACAAACACTATA" "40061" "1" "0.152453" "-1.5816448" "-4.39" "-0.14954591" "66970" "CTGCCCTTCCCCAACTGTTTGTGCTGTGTACATCACTGCTTTATATAAGTTGTTTTTTAA" "58433" "1" "0.152457" "-1.581626" "-4.39" "-0.29892352" "" "AGCTCCATCATGCCTGAGCCTCCTCCAAGATCAAGGCGAACAAGGAGAGAGGCATAGGCA" "6596" "1" "0.152469" "-1.5815713" "-4.39" "-0.16579418" "102657" "AGAGACCTACTTCCAGTGTACTCCAACAACAGGCGTGAGCATGGTGCTGGGTACTAGGGT" "55750" "1" "0.152473" "1.5815563" "-4.39" "0.69999201" "" "TTTGCCACTGAATACATCCATTGTGGGTTTGGCTTGAATGGTGCTTAAAAACCATCCCTG" "46911" "1" "0.152506" "1.5814089" "-4.39" "0.28850236" "107522" "TAAAACAGTGCCAGTGGGATCAAGCCCATGTGAACCAATACAGTGTGAGTCCAACTAAAT" "14577" "1" "0.152507" "-1.5814039" "-4.39" "-0.25359773" "56177" "GGAGACCAAGTTCAAGCAGGTGGAGGAGAGCCATAAGCAGCATCTAGCCAGGCAGTTCAA" "70" "1" "0.152512" "-1.5813847" "-4.39" "-0.19494976" "328329" "GGTTTACAGACTTTGCTTTTAACTGTCCCGTTTTCTTTAAAGCACAGCCAGCTGCTTGTT" "46117" "1" "0.152541" "-1.581255" "-4.39" "-0.17826851" "243846" "ACCACCTAAGCCTCCCACTTTTGGAGAGTTCCTTTCTCAGCACAAAGCTGAAGTCAGCAG" "34357" "1" "0.152544" "1.5812435" "-4.39" "0.31235885" "385643" "GGTGGTAGCAGGAACTAATTATGTTATTGAGTTCATAGCCAGAGAAACCAAATGTTCCAA" "59652" "1" "0.152588" "-1.5810499" "-4.39" "-0.18615477" "72507" "TTGGGCAGAGAGGGGTTGGGTTTTAAAAATATTTTTATTTATTATTATTTTTTATTTTTT" "28680" "1" "0.152636" "-1.5808377" "-4.39" "-0.17587415" "381373" "CAGACCCTTTGTGTGGATTATATTATATATAAAATCTCCAAGTCCTGCTTGATGTCTACT" "28987" "1" "0.152668" "-1.5806989" "-4.39" "-0.32885942" "270672" "AGATTGTTGAAGAGGACTATACACTTTCTGATATTCTCAATGATATCACTAAGGAAGACC" "41821" "1" "0.152689" "-1.5806065" "-4.39" "-0.19446609" "" "ACATGGGACTTGTCAAGGTTTTCAGATATCCTCAGTTAAGTCTGTTTCCTTTCCTGCTGC" "5386" "1" "0.152697" "1.5805691" "-4.39" "0.35168993" "239081" "CAAGGGGGCAAAATGATATATTAAATTCCACTGGGAGGGAAGTCTTTTAAAACACTGAAA" "31938" "1" "0.152701" "-1.5805519" "-4.39" "-0.13015091" "11739" "CCAATGTACTGAGAGGCATGGGTGGTGCTTTTGTATTGGTATTGTATGATGAGATCAAAA" "36349" "1" "0.152703" "-1.5805446" "-4.39" "-0.23410002" "224090" "CATCCAGAAAGACACGCTACATGAAGGTAAATTTCATATACACCTTGAAAATCTGTTTCA" "22915" "1" "0.152706" "-1.5805322" "-4.39" "-0.16221655" "66665" "CTGTTACAGTCTTCTAAAAGTCACCACTATGCGTGCTATAATTCTGAATGTAACATTCTT" "45933" "1" "0.152714" "1.5804956" "-4.39" "0.17853405" "219019" "CATTACTTAATCCTGTGATATACAGTCTGAGGAACAAAGATATGAAAAATGCCCTGCAAA" "48814" "1" "0.152747" "-1.5803483" "-4.39" "-0.17987324" "108927" "AAATGGACCAAAGGCTAAAAACATTGCAGGGCATTGTTGTTTCTATTCCACAGAGTACCG" "30335" "1" "0.152785" "-1.5801836" "-4.39" "-0.15327266" "234135" "CTTTGCAATCAGCAAAAGAGGTGTCCTTGTTTTTAGAGTTGAGAGAGAGAAAATTAAAAG" "2782" "1" "0.152806" "-1.5800926" "-4.39" "-0.2148477" "72720" "CATGACTTAACTCGAGTTGTCAATGGTAATGCTACACTCTACAAATTTAAAGATGGTAGT" "25688" "1" "0.152808" "-1.5800845" "-4.39" "-0.20869295" "11834" "TACTCATGCTGCCTTGAAACGACACGACTTGGTCAAGTTGGGTTTCAAGTATGACAACAT" "61125" "1" "0.152818" "1.5800405" "-4.39" "0.17746551" "320549" "CCTAGAGCTCTATTCCTATGGAGTCCCAAACTCTATGAAGTAACCATAGTGTATAAAAAG" "44225" "1" "0.15283" "-1.5799844" "-4.39" "-0.17432399" "" "AGGCAATAATGCCTCTATCACATAAGAGAGGAACCCTTTGTGGACCGATTTCCATGCAAC" "34882" "1" "0.152837" "-1.5799565" "-4.39" "-0.2491448" "56636" "TTTTTGGGTTTCCACTTATTTATTACGGGTATTTATCTTATTTATTTATTTTAGTTTTTT" "18004" "1" "0.152853" "-1.5798851" "-4.39" "-0.26506555" "76157" "CTGAATGCTATAACCTTTAAAAAACCCATTTTCCCATGTAATACTCTTTCGAGGAAATGC" "24389" "1" "0.152861" "-1.5798519" "-4.39" "-0.17308577" "75058" "AGCCCTCCTTCGTACCAGTGGACATCACTTGTTTTTAGGGGCTATGCAAAGCTACTAATA" "9217" "1" "0.152868" "-1.5798197" "-4.39" "-0.17782425" "" "CCAACCAGTTAGAAGTGTGGGGGTAGAGTGGGAAATGAAAAATGTCATTGATAAGAAAAC" "3004" "1" "0.152904" "1.5796601" "-4.39" "0.14123956" "" "TGTCAAACTAGCAGAAAAGGATGATGTCCCTAGGAGAGAAGAGCAGGGGATGATGGGAAA" "14825" "1" "0.152909" "1.5796379" "-4.39" "0.11958832" "22305" "CAGCAAAGATGAAATCAGAACATATTTTCTGACTTCCAGTAAGAGCACACACATAAGAAA" "18528" "1" "0.152919" "1.5795951" "-4.39" "0.16333301" "381668" "CGTGCAACCCTCCCGAGGTGGAGGCGCGGTAGTCCCGGCGTAGCGAGCTGGCTCACTTAA" "26052" "1" "0.15293" "-1.5795492" "-4.39" "-0.1618081" "" "CTTAACTGCTGAGCCATCTCTCCTATGGCTGGAGATACATATATTTAATATATTGTGTAA" "16748" "1" "0.152935" "1.5795257" "-4.39" "0.17957444" "" "CTGTTGGAATGAAGATGCTTACTCTGTGCAGTATTGTATTTCAGAAGTACATAACTTCAT" "13846" "1" "0.152957" "1.5794301" "-4.39" "0.88614201" "15162" "GCCTGGAATGACTGAATTCAATCTATAGCTGTGATTTAAGTGGAAACTGTTAGAATAGTA" "58548" "1" "0.15298" "1.5793299" "-4.39" "0.28574925" "434168" "TTGGTGTGACAAAGCGAAAGAAGAAGAAGGACAAAGACAAGGACAAGGCCAAGATTCTGG" "31530" "1" "0.153026" "-1.5791282" "-4.39" "-0.17619918" "" "ATAAACAGCCAATGTCCTTACCCTTGATTTACATGTGGCAAGGCTGAGTCAAGGCACTGA" "16420" "1" "0.153045" "-1.5790421" "-4.39" "-0.15253819" "" "CCCAGCAGACCAAGGAGGCCACATTGTAAGGAGAGAACAAGGGCCCTGGTCAGACCTGTC" "34906" "1" "0.153049" "-1.5790239" "-4.39" "-0.1940196" "" "TTCAGACAGAGCGAATGCATGTGGAAGGTTGCTCTGCAGGCGTTTCGCTCGGTTGTCTGG" "28985" "1" "0.153108" "-1.578765" "-4.4" "-0.24912223" "71773" "ACTATACCCAACAACAATCACTGAGGTTACTGTAGTTCACAAAATTTGCATAGGCATAAA" "15800" "1" "0.153112" "-1.5787498" "-4.4" "-0.17284596" "15416" "TTCTGTTGTCTGCGCCTGAAAAGGGCGGAAGAGTTACAATAAAGTTTACAAGCGAGAACC" "9072" "1" "0.153112" "1.5787484" "-4.4" "0.28591032" "" "GCCTTTCCTTTATGAGGAAAACTTCCCACTGAAAAAGCTATTCAAGTGTTATATGAAGGT" "31335" "1" "0.153117" "-1.5787286" "-4.4" "-0.15602524" "234915" "AAATTTTGTACAAGTATATAAGAAACTTATTATTAATAACATCCCCATAAATAATAAAGC" "10976" "1" "0.153119" "-1.5787185" "-4.4" "-0.13951574" "" "CTCATTTCAAATCAGTTAAATATTATGGGTGAAACATATCACTCATTGCCTCTGACCTCT" "47419" "1" "0.153173" "1.5784813" "-4.4" "0.6914619" "" "ATTGTGACAAGGGGACAGGGTCTTGCGCTTGCTATGAGATCATTGTGATGCTTGTAGAAA" "14138" "1" "0.153176" "-1.5784683" "-4.4" "-0.14492467" "545477" "GTAGCAGAAATTGTCTCAAGTGTCTCTCTAATCAGAAACAATAAAGGTCTCCTTGGATTC" "30282" "1" "0.153176" "1.578467" "-4.4" "1.13908556" "100038882" "TGTAGACACGCTTAAGAAGAAGGTGTCCAGCGGAACAAGTCACGAAGACCAGTTCTGGCT" "47500" "1" "0.153232" "1.5782218" "-4.4" "0.13582876" "" "CTTCTGGAAAGAAAAGCCTGTTTGTTTTATCTTTGTATTTCCTCAAAGGACTAACACAAC" "7585" "1" "0.153233" "1.5782213" "-4.4" "0.70080272" "" "TGCAACTCACTGGGTATGCAATGTTCTTAACTTTAGGTTGTTTCCTACAAATGCCCTTGG" "36429" "1" "0.153247" "-1.5781591" "-4.4" "-0.15703307" "78244" "AGCAGTTTAAATTAATCCAAGCTGCATATGACGTCTTAAGTGACCCTCAGGAAAGAGCGT" "11737" "1" "0.153261" "-1.5780967" "-4.4" "-0.18652743" "28077" "ATCTGGAGGAGCACCTGGAGAAGTTCGTGGAGAACATTCGGCAGCTCGGCATCATCGTCA" "55418" "1" "0.153276" "-1.5780316" "-4.4" "-0.15238562" "" "TATTGACTAATTTGGGTGGGGTGGGGGGACGGTGGGCGATGGAGCAACCCGAGGACATGG" "14703" "1" "0.15329" "-1.5779714" "-4.4" "-0.24969509" "73178" "TGACGTGGAGAAAACATTTTCATGCCTAAAAATGTCTTTGAGATAATGCCAATTCTGATG" "8565" "1" "0.153325" "-1.5778159" "-4.4" "-0.20271205" "68396" "CCCTTCTGCTCAAAAATATGAGTTGTGATCTCTCTCAGTGTGTCTGTCAGCCTCTGGTTT" "43147" "1" "0.15333" "-1.5777932" "-4.4" "-0.12930247" "" "AATGTCATTGAATGGTCATTGGGCAATACTCAGGCCAGGATCACCAGAAGATGCTGTTCT" "27901" "1" "0.153335" "1.577772" "-4.4" "0.21017313" "" "AACAGGATTCGACAGGACACAGGCATGGGAGCAAGTAACTGAACACTTTTTAACAGACTC" "49314" "1" "0.153344" "-1.5777354" "-4.4" "-0.12615694" "19384" "GTGGGGAAATCTTGTTTGTTACTGTCATTCCCATTCTTTTCGTTTAGAATCAGAATAAAG" "16114" "1" "0.153355" "-1.5776876" "-4.4" "-0.14859172" "239611" "TATCCAAAAGCCACAACAAGAGAAGGTCTGCTTTCAAGCTCAGGTCCTGGTGCTTTTGTA" "46338" "1" "0.153383" "-1.577565" "-4.4" "-0.17810356" "" "TTTGCATTTGTCCTCTGAGCGTTGTCGACCTCCTAGGGGAGCGATTAGATCAGGGCGAGG" "40107" "1" "0.153394" "1.5775149" "-4.4" "0.23509793" "16992" "AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC" "35322" "1" "0.15341" "1.5774463" "-4.4" "0.13642292" "16189" "GTCCAAGTCCACATCACTGAAAGACTTCCTGGAAAGCCTAAAGAGCATCATGCAAATGGA" "8442" "1" "0.153464" "-1.5772083" "-4.4" "-0.12964503" "227699" "TGTGCAGTTACTGCAGTGTTACCTTCAGGAGGATTACAGGGGTACTCGGGACTCACTAAA" "53264" "1" "0.153467" "1.5771938" "-4.4" "0.81917077" "12506" "CCTGTGTGCCCAGTCCTTTACAAAGATTTCAAATCAACCTTTTAAAAACTGTGCATAATA" "15769" "1" "0.153478" "1.5771486" "-4.4" "0.18737305" "" "GGAAAAGATCTTTACCAATTACACATCCGATAGAGGGTCTATATCAGTATGAAAAGAACT" "22231" "1" "0.153481" "-1.5771349" "-4.4" "-0.19486619" "110876" "ACACACGGAAAGGGTATACTTCTCATTTCAGGATGTTTTTAGATTTTTTGAGGTGCTTAA" "52732" "1" "0.153496" "-1.5770706" "-4.4" "-0.15440566" "382099" "AAAGACTGACTCGGACATCATTGCCAAGATGAAGGGCACCTTTGTGGAGAGAGATTACAA" "56966" "1" "0.153501" "-1.5770458" "-4.4" "-0.20085837" "20256" "AAGCGTGACCATGAATACATTTTAATCAGAAGAGGTTTTTTATTTTAGATACTGGCACCC" "51827" "1" "0.153509" "-1.5770119" "-4.4" "-0.13446781" "" "AAGCGCTGAATGGACGGGACTATTTAACATGAGCTTCCTAGCGCAAGAGGCGGATCCCCC" "48408" "1" "0.153559" "-1.5767927" "-4.4" "-0.19148511" "16653" "AATCCCGTTTCATGTCTTCATGTTGAAACACTTCTGCATTTTTATTTGAGTGCCAATTTC" "36693" "1" "0.153572" "-1.5767346" "-4.4" "-0.197284" "550619" "GCAGGCAGTGGCATCAGCAGTATCAACGTGGCACTAGAGATCAATGGGGTGGTCTACACT" "62616" "1" "0.15358" "-1.5767031" "-4.4" "-0.19319827" "" "" "12218" "1" "0.15358" "1.5766995" "-4.4" "0.33200261" "" "TTCCTTTCCTTGGTGACATTTGTGACTTCACTCATATTTTCTTGCCTGTGGATCAAACCA" "5017" "1" "0.153583" "-1.5766903" "-4.4" "-0.39254854" "" "TTGAGGGACTTGGCTGTGACATTTACCATCTTTGGACACGTTTACTTTGCAGAGGAAGCA" "11913" "1" "0.153594" "-1.5766418" "-4.4" "-0.22148955" "14547" "CGACTTCCTGAAGAAACTCTACGATGTGGTTGACATCAAATACAAGAGGAATTTGAAGGC" "31338" "1" "0.153611" "-1.5765656" "-4.4" "-0.14508047" "14773" "CCCCAATAACAAACCTCCAAGTTTCTCAAAGAAATTTCCACTCAGGTCTGTTTTCCAAGG" "33123" "1" "0.153615" "-1.5765501" "-4.4" "-0.16619783" "" "ATCCCTGTCTTGTGCCACCATTAGATTTCACAGCATTTAAATATGAGAGGTGAATGCAAC" "29657" "1" "0.153627" "-1.5764947" "-4.4" "-0.19632204" "" "GCAAAACTATTTGAGGAGCATGGAATCCTTAGAGAAAATAGCATTGATCTATCTAATGCG" "13802" "1" "0.153629" "-1.5764869" "-4.4" "-0.12063465" "" "AGAGTACCTGAGGACAAGAGCCAAAATTATTGATCAATAAAAGAATGAACCAGTTCTTTC" "52372" "1" "0.153638" "1.5764486" "-4.4" "0.14081496" "11542" "CAGAGGGCTCCCGAATGTCCATTCTGATCATTTGTATACTGATTACCAGTTTGGGGATCA" "35155" "1" "0.153638" "-1.576446" "-4.4" "-0.26647402" "" "CAGGAAAAAGAAAACAGAAGGCATGGAAGAGAATGCTTTGTTGGTTGATGGCTTTACAAG" "18671" "1" "0.153665" "-1.5763291" "-4.4" "-0.15622355" "" "AACCTGAGGGCAGCTTCCAAACCTGACCATCTTCCCCAGTGTCTGTCCTAAGCTCCGGAT" "50928" "1" "0.15369" "1.5762212" "-4.4" "0.13808426" "56429" "TATAACTTGAGCTTCAGATTCAGCTTCGTGAACTTGGAGAGAAAGAAGGAGCTTGAGAGA" "61388" "1" "0.153699" "1.5761807" "-4.4" "0.48842489" "27386" "TCAAGACAGAGATCGCCGAGCCCATCAACTTCGACAACGAAAGCAGCATCTGGAACTACC" "12129" "1" "0.153711" "-1.5761307" "-4.4" "-0.20004824" "76820" "GGCATTTCTCAAGTGTTTTAGATATTAATAACTAACATTGGGATTTTACTTTGCCAGCCC" "21064" "1" "0.153739" "-1.5760087" "-4.4" "-0.24335306" "22354" "CCAGTTAGCAGTCCTGATTCCGTCTTGACATATTGTTTATCCTGTATTTTTGCATTAATT" "30604" "1" "0.153752" "1.575952" "-4.4" "0.46416679" "12977" "TGTGGGGCTTACTTAGCCTTCTGGTTACAGACTATTTCCATGCTAGAAAATACATATTTT" "22810" "1" "0.153809" "1.5757027" "-4.4" "0.5340227" "66940" "TGATTGGTGTTTCTGAGCATTCAGACTCCGCACCCTCATTTCTAATAAATGCAACATTGG" "24329" "1" "0.153817" "1.5756653" "-4.4" "0.60707529" "208890" "CCACTGGCCAAGACTTGCTGACCTTCTATTTTTTCTAATTTTCCTTAATAAACAGATTCA" "55184" "1" "0.153826" "-1.5756288" "-4.4" "-0.14593661" "" "" "60530" "1" "0.153856" "-1.5754945" "-4.4" "-0.1298991" "22270" "GCTTTGTGGACATGGGCAGTTCTGATGGGGAAATGACACACGACTCACAGATCACCCAGG" "3415" "1" "0.153876" "-1.5754106" "-4.4" "-0.18574212" "" "TTATCATAAAATGCTTGACCTGTGGCCTTTGGCTTCAGGGAGCTGCTTCCTAGATTCCTT" "4943" "1" "0.153884" "1.5753761" "-4.4" "0.43525412" "20354" "TTTCTACTTGGAACTGTACACATTTGAAAAGTACCCAAATAAACCAGAAGCTTTATCGTT" "46219" "1" "0.153914" "-1.5752457" "-4.4" "-0.13790256" "17913" "TTTCTGGAGAGAGTGGGGCAGGCAAGACAGAGGCCACCAAGAGACTGCTCCAGTTCTATG" "30297" "1" "0.153948" "-1.5750947" "-4.4" "-0.23862561" "" "" "17039" "1" "0.153978" "-1.5749643" "-4.4" "-0.29092856" "16372" "GATACCTACGGTTCCAGTTTATTCACATAGAAATGTGTTTCCAGAAAGTAATTCAGGTTT" "59467" "1" "0.153998" "-1.5748781" "-4.4" "-0.43884908" "" "TTCAAGAAGCAAGGAAGGCTTTCAAGATTCAGTGAAGCTGCATTGATGGAGCCACAGATA" "8061" "1" "0.154002" "-1.574858" "-4.4" "-0.19302112" "68995" "GCCTCTATGATTATGCTGAATAAAAATTCCGCGGATGCTTAATTTCTGTTAGTTTCAGAA" "22487" "1" "0.154016" "-1.5747978" "-4.4" "-0.19085224" "108797" "CTTTGCTCACAATGGGAACAACAACAATAACGGCAATGGTTACACCTACACAGCGGGGGA" "51568" "1" "0.154031" "-1.5747321" "-4.4" "-0.19639232" "" "TTTCAGAATCACATTCACAGAGGACGGTGTGCTTACTGCGAGAAAGACGTCTATCATGGA" "58547" "1" "0.154037" "-1.5747055" "-4.4" "-0.15442863" "57776" "GGAAACTGGGCATAGTGTGCCCAATTCCTGTATTACTTTTGTAATTTCTGTAAACTTAAA" "61998" "1" "0.154043" "-1.5746816" "-4.4" "-0.13637841" "18693" "CTAGCCTATGGCCCTAACCAAGGCAGCTTCACTGATGGAGAGGAGGAGGATGAAGAGGAG" "33676" "1" "0.154047" "-1.574665" "-4.4" "-0.21201191" "" "GCCCCAAGGTCGCGAGCCATTCTGGGAAATGTAGTTCAAGAGGGCTCGTGAGTTGTGCTA" "46650" "1" "0.154069" "-1.5745687" "-4.4" "-0.19610694" "332397" "TGAGAGACGTGTATTTATACAGTGACAGTATTATGAATCCATTAATCTCCCCAGTAACTC" "6589" "1" "0.154087" "1.5744878" "-4.4" "0.63293793" "50498" "AGCACTGGATAATTCACTTGACTTCTTCAGACCTCAATTTCCAACCCTGTGGGATGATCT" "32241" "1" "0.15409" "1.5744763" "-4.4" "0.4628857" "18542" "CCTGATGTCCTAGCCAGATACAGCCTCAGAGCTCATCCAAATAAATGTTTCTTGACTCAG" "8949" "1" "0.15409" "-1.5744743" "-4.4" "-0.15533242" "66854" "TGCAAACGACTTGGCTGGAAGGCCGCATCCGGGATGAGTTTGACAAGCTCCGTGATTTCC" "49915" "1" "0.154099" "-1.5744385" "-4.4" "-0.15551233" "" "GCACTCAGGTTCCTCTCTGAAAATTAAATTTTAACAGGTTTTTGATTGTCACCTTTCTTC" "497" "1" "0.154155" "1.5741928" "-4.4" "0.34491311" "50795" "TGGCTTTCAGAACAAAACACTTCCCAGAGAGCAATCATAAATAAAGATTGATGCCAAGAA" "54042" "1" "0.154172" "-1.5741207" "-4.4" "-0.12898021" "28109" "TTTTTTGGTGGCATGTTACAGTCTTGGCAAAAAGTTCTCTTCACACATTCCTTTTTGTAT" "32576" "1" "0.154175" "1.5741076" "-4.4" "0.14034659" "75974" "AGATTTGGAAGGAAATGGCAATGAGACTGACCTTTCTCAGGAATATTTGGAGCTGTGCAA" "57888" "1" "0.154177" "-1.5740977" "-4.4" "-0.46963318" "" "ACTTAACCCATTTGACCTGGAAAGCAAATAAAAACAAGCCCCGTGCACAGGATGGCTAAA" "13425" "1" "0.154207" "1.573969" "-4.4" "0.29527404" "" "TAAAAGAGGGCGCTAGTCTCTTTCAAATAGACAGCAAAGAAGAAATGGTAAAGACTGTTA" "57766" "1" "0.154218" "-1.5739208" "-4.4" "-0.16829768" "257889" "CAAGGAGGTAAAAGAAGCAGTGATAAGACTGTGGTGGAAGACTTGGATTTCACAAAGATA" "1529" "1" "0.154253" "-1.5737666" "-4.4" "-0.45357526" "" "GTACTTGAACAACCTACATCATTTTTCTTTCCTGGACCATATTTTAGAAAGTTGAGCCAA" "13421" "1" "0.154272" "1.5736824" "-4.4" "0.17614219" "" "GAGCTGTTTCCACCAGCAGACTTGAGTTTTTAGCACCTTGGAGAAGACAGTTAAGACAAG" "37725" "1" "0.154276" "-1.5736648" "-4.4" "-0.12460766" "" "TCCGACACCCAAGCTCATGGTCCCTCAACTGGAACACGTAGTACAAGAAGAGAATGTAGA" "60144" "1" "0.154296" "1.5735806" "-4.4" "0.15092354" "94118" "TTCCACCGATGGAGTAAAAGGTAGGCACGAGGTCTGTGCTGACTGCAGAGAGGAGCGGTT" "14893" "1" "0.154319" "1.5734812" "-4.4" "0.68559216" "12332" "CCTGCTGGGTCAGCACTGAGGTGCCCTCTGGATGCTCAATAAAGGACACATTCCATTCCC" "35741" "1" "0.154351" "-1.5733397" "-4.4" "-0.13830232" "" "GACCCAGATAATGTGATAGGATCTTCCTGTGACTTGGGGCCATATTCTACTTAGATGAAC" "4028" "1" "0.154361" "-1.5732954" "-4.4" "-0.12361945" "53380" "TTGTATTTCAAGTACTACAGACCTGGATTTCAAGTATTACAAACAATAAACTGTTGAAAG" "24403" "1" "0.154387" "-1.5731845" "-4.4" "-0.23044269" "67131" "TTATCCTGTGGCCCTTCGTTGTCCAGTGGCTCTTCCGACAGTTTCGGACCCAGAAGAGGT" "58889" "1" "0.154452" "-1.5729026" "-4.4" "-0.16502509" "66637" "AGGTATCAGTGAGTGGTACGGAGAAAACGCTACAGCAAGAAAACGGACACAAGAGCATTA" "36618" "1" "0.154497" "1.5727034" "-4.4" "0.24875995" "" "AACCAGGAAGGGCTCCTGCTACTTTAAGACGGAGAACAGTCGATTCGCGTTGCCTGGGCA" "59936" "1" "0.154498" "1.5727017" "-4.4" "0.38312473" "258500" "TCATTTCCTACTCTGGATGCATGGTTCAGCTCTACTTCTTCTTCATATTTGGTATTGCAG" "51593" "1" "0.154504" "1.5726736" "-4.4" "0.20856016" "666806" "CATTTGGCATGAGTGTGTCTTGTCAATGCAAACTGATGACTTTTATGTTTTGAAGTATTC" "8012" "1" "0.154532" "1.5725547" "-4.4" "0.25299457" "19663" "TTTGTCACATATCAACCTACTGCAGACCAGCAGAGGGAGCTCCCGTGTTGAATTTATTAG" "55651" "1" "0.154534" "1.5725445" "-4.4" "0.16530401" "" "ACTCCTACTAAGAATATTTACTATTAAAATGAAATCCTATTAGAATTTAATATTAATTGT" "15807" "1" "0.154561" "-1.5724289" "-4.4" "-0.13476687" "" "" "38487" "1" "0.154587" "-1.5723131" "-4.4" "-0.1665663" "" "TTGAGACTATCACACCCACTTCGGGAACTGGGGCTGCATATGGTTTCTAACTTCATTTTC" "25472" "1" "0.154599" "-1.5722626" "-4.4" "-0.19651874" "" "ACCTATAATCTTTAAGAAGTGTTCTGGGGCCCTTTATTTCTTCAAGACCTTTTTCTTGTT" "57673" "1" "0.154604" "1.5722408" "-4.4" "0.37281151" "" "ATCTCACATTCCAGTATGTCAGAGTGCTAGAGGGACCTGAAGCAACCACACTTCTCTTAT" "18402" "1" "0.154623" "-1.5721571" "-4.4" "-0.13826526" "" "AGGTCAGTTTTGACACTAGATCAAGGTCTTCTTCCTGAGACTGCTTCAAAGCTGAGAAGG" "38635" "1" "0.154649" "-1.5720467" "-4.4" "-0.4209414" "13345" "TTATTGAGATATTTTACCAGCTAAGTGACTGCCACGCGGTTGTGTATAACGCTCCACACC" "30805" "1" "0.154672" "-1.5719466" "-4.4" "-0.42006926" "208613" "TGTTCCCCTTAAATTGGCCTTATTTGTGGTCATTATTTTGAAATATTTACAAAGCAATTT" "20228" "1" "0.154679" "-1.5719136" "-4.4" "-0.26607702" "240916" "GTGTGTGAGATCTGAGCTCCAAGGCAACAGTGTTAGCACAATAAAGAAACTTAAAGACTG" "21011" "1" "0.154708" "-1.5717889" "-4.4" "-0.13936669" "14066" "AGCACGGGAAAGAAAACAAACATTACAAACACCAATGAATTCTCGATTGATGTGGAAGAA" "18270" "1" "0.154734" "1.571678" "-4.4" "0.63340787" "" "CTCCAGAAATGAGATCCTGATCACAAGAAAAATTTGGGATCTTTTGGAAGAATAAAAGAC" "53041" "1" "0.154765" "1.571543" "-4.4" "0.15374537" "14311" "TCTATGACACATACTCGCTTTCCTATGACCTGCACTGCTACAAGGCCAAGCGCATCGTGA" "4918" "1" "0.15477" "-1.5715199" "-4.4" "-0.2692936" "" "GGTGAATTGTTCAAGCTAATCTATTCAGTTCCATTGAAAGGCGTTTGTATTGTAGGAGTG" "44457" "1" "0.154789" "-1.5714395" "-4.4" "-0.13082904" "98828" "TCGATTTCCTTAAGCTGAAAAGAAATGAGCAAGAGGACGACTGAGTGCTGCTTGGAGAAC" "41334" "1" "0.154794" "-1.5714171" "-4.4" "-0.14116199" "11806" "TTCAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAA" "10426" "1" "0.154852" "-1.5711625" "-4.4" "-0.13776282" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "28624" "1" "0.154854" "-1.5711567" "-4.4" "-0.2829213" "245595" "GTGGCTGTAAATGATGTACACGCTGTAAAATAAGATTGTTACTGTTACGTGGACTTATTA" "5744" "1" "0.154855" "-1.5711513" "-4.4" "-0.2047237" "19014" "TGACTTCATGATTGGGGAGGAAGATGATGATCTCATGGATGTGGCCCTGATTGGCAATTA" "58690" "1" "0.154856" "-1.5711476" "-4.4" "-0.18607757" "" "" "55003" "1" "0.154864" "-1.5711105" "-4.4" "-0.2484235" "230775" "GAAACGGCACTCGGAACTCTACCACGAACTCAACCAGAAGTTCCACACTTTCGACCGCTA" "60277" "1" "0.15487" "1.5710855" "-4.4" "0.62072551" "16855" "TGGGGAAGGAAGCAGAAAGATCCCCGAGTTCCATCTAAGCTCCTAATAAAATGTTGAAGG" "18980" "1" "0.154885" "1.5710201" "-4.4" "0.15564544" "" "" "19483" "1" "0.154892" "-1.5709895" "-4.4" "-0.20869805" "15559" "CTAAAGTAGATCTGATGGCTTCAAACAAACGCAATCTCTACTCTGGTTTTCAAATACAAT" "12034" "1" "0.154901" "-1.5709519" "-4.4" "-0.1369252" "" "ATGAATCAAGAACCCTTGGCAACAATTGATGCTCAAGAAGGAGGTGACTGTCCGAGAAGT" "5795" "1" "0.154904" "1.5709403" "-4.4" "0.29967254" "58859" "CTCCCATAGCTTAAGCAGCCCCGGGGGCCTAGGGATGACCGTTCTGCTTAAAGGAACTAT" "19048" "1" "0.154904" "-1.5709382" "-4.4" "-0.12789127" "20615" "GCCAAGCTGAAGAAATTAGCCATCACAATGGTATCCTAGGAATCTATTACTTTCAATTTA" "32593" "1" "0.154915" "-1.5708905" "-4.4" "-0.27145335" "239167" "TGTCTTTCTTGCTTTCTGACCTCATACGAAGAACATTGAGGTGTCAGGGAGCTTCCAGAA" "10542" "1" "0.154924" "-1.5708509" "-4.4" "-0.23366843" "212706" "CTCCAGGCCTTGGACCTAGGCTGTAGTTCCTTCTATGTTCCCAACAATGGAAAGAATATA" "36716" "1" "0.154929" "-1.5708296" "-4.4" "-0.15514147" "78933" "AGATGTACAATGACCCAAAAACAAGCCTGGAGTTCTATATTGACATCCACGCTCACTCCA" "48132" "1" "0.154957" "1.570707" "-4.4" "0.17530155" "" "" "23690" "1" "0.155" "1.5705229" "-4.4" "0.15314742" "11875" "AATCAGGAAAGACACTGCTCTTGGACCCAAGGAAGCTGCAGCTCTCCAGAGCTGGACCCT" "16515" "1" "0.155042" "-1.570342" "-4.4" "-0.16042908" "66132" "TTGTATCAGGAATTGATAGGTCATAATCTCATCCCTCCGTTGGAAACTCTAAAAGCCTTC" "51329" "1" "0.155043" "1.5703374" "-4.4" "0.2178266" "56758" "GCAGTAGTTGACTTTGCTGTATGGAAAAATAAAGCGAAATTGCCCTAATAAAACTTCTCT" "35571" "1" "0.155051" "1.5703005" "-4.4" "0.1920271" "75778" "ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT" "29834" "1" "0.155091" "-1.5701301" "-4.4" "-0.1647558" "68055" "AGGCTTAGTCAACTTGAAAATTTACGAAAAAGCCTATTGGAACTGGAAATAATTGCCTGT" "34203" "1" "0.155096" "-1.5701078" "-4.4" "-0.36277572" "70729" "CCACTCCCTGGGAATGACATTCTGGAATTCAGCCGAGGTGTGACTGATCTGGATGCCGTA" "48961" "1" "0.155101" "-1.5700859" "-4.4" "-0.22562296" "" "TGAAGAAACTAGGAGAGATGTGGAACAATCTGCAGCAGATAGCAAGCAGTCCTAGGAGAA" "34780" "1" "0.155128" "-1.5699668" "-4.4" "-0.14872277" "399603" "CGTGGGAATTATGCTGTCTGTGTTCACGAAAAGTATCTTATTTTCAATACAACAGTTACA" "12353" "1" "0.155183" "-1.5697298" "-4.4" "-0.3037121" "211922" "CTGTCAGAAACTCCTAGTGACTGTGGCTTTTAGAAAAATGCTATGATGAAAGCAACCTCA" "32402" "1" "0.155201" "1.5696502" "-4.4" "0.71889295" "" "AACCTGGCAATTCTGCCCTCTATGGGATCCCTAGCTTTCTGATTATGAGCCCCAATGTCA" "877" "1" "0.155229" "-1.5695307" "-4.4" "-0.23313411" "14406" "GGAAAAAATTAGAATACCTCCCGTATCTGTGAAGAATCACAATAGAAAAGCCTAGATTAG" "45322" "1" "0.15524" "-1.5694827" "-4.4" "-0.15369572" "66704" "AAGTTGACTTTTCTTTCCTCGATGCTAGTTGTCTGTAGCTTTTCACTGTTCCTTATACCC" "57583" "1" "0.155247" "1.569453" "-4.4" "0.35491587" "" "GCTCCATCATTATGCTTAACTACAGTTTATTTATACCTTCTGGTTCTAGACAACTTCTCA" "5549" "1" "0.155304" "-1.569206" "-4.4" "-0.18478641" "666704" "CTTTCTGTCTGTCTACTATTGTACCACCTGGCTGTATTGCTTTTTAATATTGCACCGAAG" "36708" "1" "0.155306" "-1.5691988" "-4.4" "-0.21567064" "16392" "CCCCCAAAGATGTGTATAGTTATTGGTTAAAATGACTGTTTTCGCTCTTTCTGGAAATAA" "24254" "1" "0.155308" "-1.5691898" "-4.4" "-0.16469731" "21781" "CAAGCGCCATATGTCTTATTATGACTCCTTCCTTAAATTATATTGACTGTCGTAATTCCA" "56616" "1" "0.155317" "1.5691481" "-4.4" "0.13916384" "" "" "51872" "1" "0.155318" "1.5691459" "-4.4" "0.1792384" "" "ACCTCTGACACAACATGGAGCCCAGGTCAGAGCTGCAGTCCAATCTAGAGGAGCTGAGGA" "59048" "1" "0.155318" "1.5691446" "-4.4" "0.94874003" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "51378" "1" "0.155362" "-1.5689556" "-4.4" "-0.28170463" "67897" "CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT" "33228" "1" "0.155373" "-1.5689084" "-4.4" "-0.18587571" "271697" "GAAGCGCTCGTTCATGATTATTTCAGTGTCTTGCCATCCCAGTTGTACCAGCTTCCTGAT" "10073" "1" "0.155409" "-1.5687534" "-4.4" "-0.1345326" "" "ATCTTGACCAAATAAACCCTGTAGCCATCAGCACAGTGGAATGAGCTGCACTGAGTTTCT" "28905" "1" "0.155421" "1.5687009" "-4.4" "0.25378394" "" "TAAGTGGGGAAACTGAATGCCTTGCTGGAATGAGGCTTCATCAGGGCTGGGAAATTAAAT" "7294" "1" "0.155424" "-1.5686881" "-4.4" "-0.16489007" "19046" "TATGTGTTACCATAGATGTGTGAAACCTTATAGCGTCCTTGAAAGTGTTAAATTGAGAAC" "55236" "1" "0.155435" "-1.5686397" "-4.4" "-0.22991211" "68703" "ATCTGCAACCATTTCCTTCTCCAGATGGTGATACTGTGACTCAGCATGAGGAACTTGTCT" "31416" "1" "0.155436" "1.5686343" "-4.4" "1.45635416" "71957" "CCTACATAGCTGTAGATTAATCTCTGCCGAGCACAATAAATGTTGTACAATCTCCACTTC" "56757" "1" "0.155448" "-1.5685817" "-4.4" "-0.17998166" "72667" "ACCTGGTGCGCCACCGCAAGACACACTCTGGCGCGCGACCTTTCGCCTGCTGGGAATGTG" "39509" "1" "0.155453" "-1.5685625" "-4.4" "-0.35081115" "105349" "CCAATCACTGCTTAGCAACTCACCCCCAGTTAATTCAATAAATTTTGCTTCTTTTCTATA" "31744" "1" "0.155459" "-1.5685363" "-4.4" "-0.24773407" "268445" "TGACCTCATGGCTGTCAGCAACGCACTTTTTGCCAAGCTCCGGGACTTCATCACGTTGCG" "14740" "1" "0.155473" "-1.5684756" "-4.4" "-0.33632075" "12921" "CAGCGACAGGTGGCTCCTGGGACAACTAACTAACTAAGCCCTTGCTCCCAGGCTTGGAAT" "46904" "1" "0.155484" "1.5684266" "-4.4" "0.63220889" "66824" "ACCTGCAAGGACTCCCTCCTCCAGGCCTTGAAGGAAATACATCCCTACTTGGTGATGGAC" "33628" "1" "0.155495" "-1.5683789" "-4.4" "-0.2701306" "" "TGTCCTGTGCAAAGGGTATGAAATGAATGTCTCAGAAGGAAAACGCCCTCTGTTAAAGAT" "10390" "1" "0.155535" "1.5682088" "-4.4" "0.76558476" "" "CAGGAGAAGTCTTACAAAGGTCAAAGCATGGCAAAAATTATTCCTGAATACACCCAAAGT" "61242" "1" "0.155542" "1.568176" "-4.4" "0.2757002" "11828" "ATCTGGAGCTATGACCCTTGACTGGGGGCTGTGTAATATGTTTCTGTTATAAGATAGACA" "61076" "1" "0.155574" "-1.5680374" "-4.4" "-0.21652416" "73043" "GAGTTCAAAAGCTGGAGATGTTTTCATGGTGCAGCTTATTTGTAAATATTGTGCTTAATC" "33785" "1" "0.155583" "-1.5680016" "-4.4" "-0.16937044" "67890" "CAGCTACTTGCCTTGAAAATGTTATTGTCTGCATTCTCCATTTCAGTGACAATATTCATT" "4531" "1" "0.155583" "1.5679991" "-4.4" "0.24028613" "" "AGAGAGTCCTTTCTCTAAGGTCAACATTCGTCATAACTGTGGCAATCTTTTCTAAAAAAG" "30061" "1" "0.155596" "-1.5679454" "-4.4" "-0.35637637" "258016" "AATGAAGTTGCTATCATGGTATCCAGCATCATTCTCCTGATGACTCCATTCTGCCTGGTC" "54040" "1" "0.155604" "1.5679096" "-4.4" "0.44092024" "" "CACGTTTTTCCAGCTTGCTTTTCCAATGTCACAAAACTCTTTCCACATAATTAAATGTTC" "56062" "1" "0.155605" "-1.5679074" "-4.4" "-0.17660881" "94060" "TCAAGAAAAGCCCAGCTAGTCTTGTTTTATCTGATCCTGGAGAGTCTTCTCTGCCTGTCT" "59612" "1" "0.155615" "1.5678604" "-4.4" "0.21590069" "75778" "ATCTCTCTAGGACAAATGTGTAGTTCTAACACATGAACAGACTTTAAAGCTAACAAGCAT" "61191" "1" "0.155628" "1.5678082" "-4.4" "1.3729208" "" "CAAATTATCATTCAGCTCTCATATCCAGACTGAGCATCAGCAAGGATAACTCCAAGAGCC" "9509" "1" "0.155633" "1.5677859" "-4.4" "0.91735788" "114564" "TGTGTCTATCTCTATGGAGTCCCTACAAACAATGACCAATAAACAATGGTAAGGCGTACC" "57517" "1" "0.155669" "1.5676312" "-4.4" "0.38423752" "" "CTCAGGAGAATGTAGGAAAGATTTCCTTTGCTACAGTTTTTGTTCAGTATCTACTAAGTT" "21767" "1" "0.155677" "-1.5675943" "-4.4" "-0.34821391" "320981" "ACTCTTTGCTAGGAATAGTGATATATCAAATGCAAGTTCCATACTTCAGTAGTTCAGAAG" "52615" "1" "0.15576" "-1.5672372" "-4.4" "-0.23213377" "231503" "ACAGCCCGGAATGTAATGTGGAAAACGTTGTTTTGTAAATTCACCCTGAAGTATAGCTTC" "51622" "1" "0.155771" "1.5671908" "-4.4" "0.18242611" "" "TTCCCCTTCGAAAATAGGTGTTATAGTCAAGATAATGTACTTGGGTCATAAGACAGTGTG" "20163" "1" "0.155791" "-1.5671032" "-4.4" "-0.22004197" "" "AGGCAAACCCTGTCATCTCCAGGTTTCTCTTCATCACTCCCATCCAGTTTTTACCCGTAG" "42395" "1" "0.155796" "-1.567083" "-4.4" "-0.24645198" "77134" "AGAAGGCGGAGATCATTGCCGACAAGCAGTCGGGCAAGAAGCGCGGCTTCGGCTTCGTCT" "35629" "1" "0.155798" "1.5670735" "-4.4" "0.26359223" "" "CCATTGGAGGGTTTAAAAAGGGCAATGGCTTTTGACATTAAACTTCTAAAAAGCATCATT" "1967" "1" "0.155824" "-1.5669621" "-4.4" "-0.19933918" "75665" "ACTCAGAGTGACCTCTGAGGACAAGGAGCCAAAGGAGCAGCTTCAGAAGGCCATCAGGGA" "21129" "1" "0.155854" "-1.5668324" "-4.4" "-0.20109528" "" "" "57779" "1" "0.155859" "1.5668102" "-4.4" "0.47225517" "" "GAGTTTCCGTCTTCTGTATTCCTCTTACTAAACATAAAAATCTCACGCTCTTCAGAGTGT" "25928" "1" "0.15594" "-1.5664591" "-4.4" "-0.1764456" "259012" "AACAAAGAGGTGAAAGAAGCTGCAAAGAGAGCCATAGAGATGAAGTCCTTCTCATGTTAA" "13422" "1" "0.155941" "-1.566455" "-4.4" "-0.48926063" "" "AGAGACAATCAGAGAAGAGGAGATATGCAGCTTTCTAAGGCAAATGCCCTCCACTCCACT" "41823" "1" "0.155948" "1.5664267" "-4.4" "0.32694022" "78749" "ACCTGTACTTTGGGAAGATTTGTGCATGGACTGAACAAGAGTATCTGGAACTAACTATGT" "59753" "1" "0.155953" "-1.5664026" "-4.4" "-0.29764411" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "28579" "1" "0.155975" "-1.5663095" "-4.4" "-0.19917851" "19647" "GTTTAAAAAGTCAGTGTTTTTGGAGTTTTCCCCACTTTTGGATAAATGAGTTTTTTGGGG" "48339" "1" "0.155986" "-1.5662621" "-4.4" "-0.15663264" "" "TTCAAAATCTCTTGCCTATGGAATAGTGCCCACCTCCTTCCATGTAGTGGGCAACCTTTT" "40904" "1" "0.155988" "1.5662519" "-4.4" "0.11945819" "" "" "37870" "1" "0.156039" "-1.5660333" "-4.4" "-0.14669572" "67144" "GCACATAAAATTGAACAGCTTTCTTTCAAGGTTGTTATGGTCTCATATGGCAAAAAACCA" "8438" "1" "0.156045" "1.5660083" "-4.4" "0.77944781" "" "AGCAGGTGAGTCGAAGCTGATGCTAGCCTAGACCAGGTTACTCACCACCACCTGCCTCTA" "27480" "1" "0.156049" "-1.5659887" "-4.4" "-0.50135321" "54711" "TCTGAGTGTGGTAAGAATTATAATACAAAGCTGGGATACCGTCGTCACCTGGCCATGCAT" "56455" "1" "0.156052" "-1.5659759" "-4.4" "-0.22622882" "26556" "TTTGACACCAGAAAGTATCAATGGGACAGACGATGAGAGAACACCCGATGTGACACAGAA" "14744" "1" "0.156071" "-1.5658962" "-4.4" "-0.20061988" "18314" "ACAGCTTAAGGAATAATGAGGTGAAGGCTGCATTGAGGCGAATCATTCACAGAACTCTGG" "61318" "1" "0.156072" "-1.5658901" "-4.4" "-0.12169112" "239099" "ACCATGGTCTTCTAACTCAATGATGTTCTAGAACTGGGAATTACTGGTAACAATTGGTTA" "6443" "1" "0.156084" "1.565839" "-4.4" "0.17175836" "" "" "55552" "1" "0.156086" "1.565831" "-4.4" "0.8900673" "12506" "GTCAGCAATCCTGTAAGCAGCAAGAACGACACAGTGTACTTCACTCTACCTTGTGATCTA" "23744" "1" "0.15609" "-1.5658142" "-4.4" "-0.2906529" "" "GGGAGTTCCAGTACAGAATACAGAGTGGGACTCTATTTCAAAACATCAAGATATAATAAA" "59088" "1" "0.156095" "-1.5657936" "-4.4" "-0.16347592" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "20994" "1" "0.156103" "-1.5657571" "-4.4" "-0.28502328" "105278" "TGCAGATGCGGAAGCAGACATTCCTGGAATCCACTCAGTAAATAAATTCCAGTGTGACTC" "16369" "1" "0.156124" "-1.5656688" "-4.4" "-0.17788344" "" "CATAAAATATTGGAAGACAGAAGAACACTCATTAGGGTGGCTATGCTCTAACAATGTAAT" "48250" "1" "0.156137" "1.5656112" "-4.4" "1.48915836" "100048271" "CCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGTGGAGGCACAAA" "54886" "1" "0.156165" "1.5654926" "-4.4" "0.12604891" "" "CTAGCTAAGATAACCCCTTACAAAATGCTTTTGTTGACAAGGCTTACTCTTGGTTAGGGT" "43041" "1" "0.156167" "1.5654825" "-4.4" "1.20380254" "268482" "GACGGAACCGTATGGGTTTAACAACACTAACTTTAATTAAAGATTAATGGCAATGAAGTG" "45461" "1" "0.156179" "1.565433" "-4.4" "0.16568527" "57784" "CAAAGCAAGGCTCTGTCTCACCTGTATTACTGGAATTTTATTTTCACTTGTTATTGGAAT" "11090" "1" "0.156183" "-1.5654121" "-4.4" "-0.16698976" "627648" "CCAGTCACAGACAAGTGGACACTGCTGCCCACCAACATGAGCACTGGGAGGAGTTATGCA" "43039" "1" "0.156195" "-1.5653636" "-4.4" "-0.19128724" "66671" "AATTATATACCTCAATGTGCTATTTTCCCAAATACAGATTGGGGAAAATAATGCCTGCTC" "28588" "1" "0.156197" "1.5653547" "-4.4" "0.26057521" "77975" "GAGTCAGTAGAATTCTTGGTAATCATATAAAATGCACACGGTTCTCTTAATAAAGGTCTC" "33437" "1" "0.156199" "1.5653442" "-4.4" "0.79154216" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "12979" "1" "0.156209" "1.5653015" "-4.4" "0.98564435" "215900" "TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG" "34167" "1" "0.156217" "-1.5652692" "-4.4" "-0.15620311" "" "CTCTGCGGCCTCCGCAGCCTCCACCTCAGCAGCAGTGGTAGCCGCGGCGGCCATTCATTG" "56436" "1" "0.156227" "-1.5652256" "-4.4" "-0.21251233" "225326" "ATTACGTACATTCTTGGAGTTGGAGACCGGCACCTGGATAACCTTTTGTTAACAAAGACA" "4255" "1" "0.156227" "-1.5652254" "-4.4" "-0.34275193" "" "" "1594" "1" "0.156269" "1.5650451" "-4.4" "0.4403675" "" "TAAGGATTCCTTGAAATGCCCACATCCTGGTGCCTAGAAAGTGTGATTGGATATGGGAAC" "8021" "1" "0.156275" "-1.5650179" "-4.4" "-0.20812663" "234664" "CGAGGCACAATTCCTGATATGATTGCAGATTCAAACAAATACATAAAACTGCAGAATGTT" "8436" "1" "0.156289" "1.5649569" "-4.4" "0.43868645" "17215" "AAGCTTTCTTTGCGATTAGACTAGTATGTATTGTTGACCTAAATATCCAAGACATTGATA" "21743" "1" "0.156292" "-1.5649457" "-4.4" "-0.29931954" "56087" "GTTCTTAATGAATCTGCAGAAATTTGAGAACAACATTCAAAGGACTATACAGCAGCTTGA" "39196" "1" "0.156294" "1.5649355" "-4.4" "0.59606619" "" "TGGAGTCCCTACAAACAATGACCAATAAACAATGGTAAGGCGTACCAATAACAACCAGCA" "17947" "1" "0.1563" "1.5649111" "-4.4" "0.18167208" "" "AAATAGCTTACTCTGTCTGGGAAGGATGTTCAATACTAGTTGCCTAAAGAGTGCACAAGT" "15522" "1" "0.156305" "1.5648906" "-4.4" "0.13106097" "" "TTTGTGCTGATTGTACAGCCACAAAACTTAGCACAGCATTGTTCTGAGAAGGCCTGGTAT" "51506" "1" "0.15631" "1.5648663" "-4.4" "0.13009495" "55961" "GAGGTACAGACAGGACAAGTTTAAATTACAATAGCTACAAGTTCCAAAATTCATGAATCC" "19691" "1" "0.156332" "-1.5647728" "-4.4" "-0.1431293" "" "TAGGGATCAAACTTGGGCAGGGCTTAGTGGATGAGCCATATTTGTAATTCTGAATTTTTT" "57714" "1" "0.156333" "-1.564769" "-4.4" "-0.14993839" "68346" "CCAGCAGCAAATGTGTTTGATCTGGAAGAGGCTGTCAAGTCCTTCCATATTATTTGATTT" "37754" "1" "0.156346" "-1.5647135" "-4.4" "-0.18980513" "" "" "29064" "1" "0.156347" "-1.5647069" "-4.4" "-0.16635094" "" "TGGTACAAGCACCTTCTTAGTGGAGAGATGGTTTTCCTTATTCGACAAATGTCTTCTTCT" "7848" "1" "0.15636" "-1.564652" "-4.4" "-0.23306001" "229227" "AAAGATCTATTTGTATATAATTTGAGTAATTGTGATGATTGTATACCACAAAAAGATTGT" "36311" "1" "0.156392" "-1.5645138" "-4.4" "-0.27847511" "13592" "TTGGTTGTGTTTCTTGGACTCTTAAGACTCAGTCTTTGACTGTTTCCTTTCTATGCAGAG" "33010" "1" "0.156403" "-1.564468" "-4.4" "-0.18015463" "96957" "TCCCTTCATATCTTGAGCAAAATAAACATCTCCTACTATTCTGTTTTGTTGTTGACCTTG" "45124" "1" "0.15643" "-1.5643509" "-4.4" "-0.21059322" "" "TTAATTTACCAACGAGACAAGGCTGCTTTCTACCACATGCTGAATTGGTTGGCAGCTGCT" "59108" "1" "0.156479" "1.5641398" "-4.4" "0.15741145" "17172" "CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA" "516" "1" "0.156507" "-1.5640228" "-4.4" "-0.17334924" "74498" "TGCCAAAAGTTGAAGTGTTTATCCCCAATAAGTTAATATTCTGTACAAGATCCAAGTGAG" "54272" "1" "0.15652" "1.5639656" "-4.4" "0.51843555" "20194" "CAAATGAGATCCAACTCCAATTCAACAATCTGAGAGAGAAAACTTAATCCAATGGCAGAG" "62424" "1" "0.15652" "-1.5639647" "-4.4" "-0.14519902" "20817" "CTGCAGTGAGTACGGCTCCACAGCAAAAACCTATAGGAAAAATATCTAAAAACAAAAAGA" "25669" "1" "0.156552" "-1.5638292" "-4.4" "-0.31875445" "" "CCATTGACAGTTGAATGTTGAGCCATGAAAATTGGGTTGTCTTTCTTTTCCAATAAACTT" "58305" "1" "0.156567" "-1.5637612" "-4.4" "-0.14976511" "11739" "CCAATGTACTGAGAGGCATGGGTGGTGCTTTTGTATTGGTATTGTATGATGAGATCAAAA" "60952" "1" "0.156575" "1.5637274" "-4.4" "1.86799032" "" "ACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAAGATTGGTCCTGGAA" "61804" "1" "0.156577" "-1.5637212" "-4.4" "-0.27010481" "208748" "GTGGGGATGTTAGATATTAAAGCCTTTCACTCCATGTCTGTATTTATCCTGTGATTAAAT" "59292" "1" "0.156619" "1.5635405" "-4.4" "1.24054992" "620078" "AGCAAAACACATCTGAAGGCCTACCCGGAAATCAGGAATCAGGTTCACCAGCTGTAAAAA" "26257" "1" "0.156623" "-1.5635227" "-4.4" "-0.1601242" "67538" "TGGCGTTCTGTAGACACCTTGTTCATTGTTCAAAGCCAAAGTTATTCCATATGAAAGGGC" "48156" "1" "0.156631" "-1.5634875" "-4.4" "-0.1571862" "71538" "GTTGAAATCATGTTTTCAAGCAGGTTTCTGAGCAGATCTGTCACATCCACTGCCTTGTGC" "31869" "1" "0.156635" "1.5634717" "-4.4" "0.29971461" "20397" "CTTTCCTAACTGCAGCAATAACCCTTCAAAAGCAATTGAATAATAAATGTCCCAAACTGT" "21531" "1" "0.156644" "-1.5634308" "-4.4" "-0.15424167" "11624" "GGAATAAATACAAGTGCCCTTATATTTGCAGATTCGACTGGGGGAAAGTCCTCAAGAACT" "47649" "1" "0.156672" "-1.5633114" "-4.4" "-0.18017195" "" "AAGAGGCAGATCAGATTCTGGTTTGATGGGCAACCTATCAATGAAACAGACTCACTTGGC" "17317" "1" "0.156678" "-1.5632851" "-4.4" "-0.14361744" "54338" "AAATTTCTGACTGTCCTTAAGACAGTAGAGATGTCTCTCTTTTATTTGAGTTTGTGACTG" "9827" "1" "0.156692" "-1.5632248" "-4.4" "-0.2159277" "" "AACAAGCTCTTGGCGATAGTGACCAGCGTGCAATAATCCTTCCAGGTGTCCCCCGGGTCA" "48039" "1" "0.156701" "-1.5631891" "-4.4" "-0.13749731" "27362" "CCGTAGAATTGGTGTAATGGGGAAGATTGTATTGCACGTCATTAAGCTGAAAAGTTTAAA" "61691" "1" "0.156707" "-1.5631622" "-4.4" "-0.17118219" "" "AATCCCAGTATGTCAGGGTTCTAAGGGGAGGTGCGGGCAGAGGTCAGGTTGCAATAGCCT" "49091" "1" "0.156713" "1.5631346" "-4.4" "0.23125828" "22156" "TGATTTAGTACCAGTGTTCTGCAGCTTTCTGCCGAGGTATTTAGGTTTACCTGGACATGG" "2516" "1" "0.156726" "1.5630809" "-4.4" "0.38484448" "70086" "CAGGCATGCTCATGAACATTGGTGTCCACCTTCATTCACTCAGAGTCTCCAACTTACTTT" "11860" "1" "0.15673" "-1.5630637" "-4.4" "-0.13091466" "" "TAAACAGAAAATTGATGAGAGGGGAACGAAATCTAATCTCTCTTCCACCCCGGCTCTTCG" "41331" "1" "0.156732" "-1.563055" "-4.4" "-0.17612207" "73327" "ATTCTGCTATTTGGAGTTTGGAGATAGATTCTGAGGACAAGTGGAACCAGAGAGGACAGG" "23209" "1" "0.15675" "1.5629793" "-4.4" "0.39356313" "" "TCCCAGCATAGATTCAAATGCTTACCAGAAAGGGCCTGATTTTCTTCAACAAAAAGAGTC" "53399" "1" "0.15677" "1.5628924" "-4.4" "0.34594731" "320635" "CTCAGAGGCATACAATGCTGAAGGGCAAAGTGGATTTGGAACCAAAAGAAAGAATAAAGG" "19223" "1" "0.156779" "1.5628555" "-4.4" "0.66156739" "15002" "GTCTTCCTGGTGGGGGTTGTTATCCATCTCAAGGCTCAGAAAGCATCTGTGGAGACTCAG" "62947" "1" "0.156799" "-1.5627675" "-4.4" "-0.13855501" "67463" "GGACATATCATGTGCATCTTCTCAGAATTACAAGAGACTTCCCCATCCTTTGTAACTGTA" "51806" "1" "0.156799" "1.5627657" "-4.4" "0.24536418" "207932" "TTCCAGCAAGAAAGCTAAGAGGACTTTATTCAGCTGACCAACAAGTAAGCCCTTATAGTC" "2105" "1" "0.156805" "-1.5627409" "-4.4" "-0.25300974" "" "TGTTGTACTTGTGTGGCTGTGTAACTGTTTTTCTTTTCCAAGAGCAGAGTTAGCTGTGGC" "28481" "1" "0.156828" "-1.5626429" "-4.4" "-0.44595448" "319455" "AATGTATATGTGCAAGCTGATGTAAGCCTGGGTAGAGTATAATATTTAGAAAGGGTACTC" "17768" "1" "0.156829" "-1.5626392" "-4.4" "-0.17865411" "15461" "ACCTTGGGTCCTCTATAGAGAGGTGATTCCATGAGGCTGTTATCAGACTGGTAGCTGCCC" "34312" "1" "0.156832" "-1.5626278" "-4.4" "-0.16504567" "67914" "CCATTGAACAGGATGTTAATGAGAACACACTGAAGAACTTGGAGTCGTATGACAGCCACA" "51021" "1" "0.156834" "-1.5626156" "-4.4" "-0.13432859" "" "ATTTCTTAGGACTCCTAGTACTTTACTTTGAGTAACAAAGGGTCAGAGAAAATGAGCCAC" "32182" "1" "0.156854" "1.5625323" "-4.4" "0.69793243" "" "GGATGGCCTGGACTTCTTAAAGAAGCCATGAAATTCTTTTAGATATCTTTTGTTTCTTGA" "32279" "1" "0.156866" "-1.5624783" "-4.4" "-0.14205494" "" "TGTCCTTTTTATAACAGCTTTAGCTTACTTATATGTGTCGTGTGTGGCTGTGTGTGCCTG" "11100" "1" "0.15687" "-1.5624612" "-4.4" "-0.1645206" "" "TAAGAAATATGGTAGAGGAGAAAGGAAGAGATCCCCTGGTGACTGGCTGATGCTATCTGT" "3798" "1" "0.156871" "-1.5624599" "-4.4" "-0.28429662" "" "TATCAGGAATGGCTGTGTATAAATGGGGCACTGAAGGTAGAATAAATAGGAGTCTATAAA" "49039" "1" "0.156882" "-1.5624131" "-4.4" "-0.18285627" "" "" "56928" "1" "0.156884" "-1.5624043" "-4.4" "-0.21726911" "108100" "AAATCTGAACTGTGCCCTGTACTGCGGTCAACTGTTGGAATAAAGGCTTTATTTATTGCA" "47594" "1" "0.156926" "-1.5622221" "-4.4" "-0.15235174" "258319" "ATATGCAAACCTTTACTCTACCCAGTAGTTATGACCAATGGTCTGTGTGTGTGGCTAATA" "54366" "1" "0.156941" "1.5621609" "-4.4" "0.20754115" "18101" "GTGGTGACCAATTCTGTCCTGCTCAATGGACATAGCACAAAGCAAGAAATAGCACTGTGA" "16347" "1" "0.156954" "-1.5621035" "-4.4" "-0.15823327" "77913" "TGCTCCTTCAGAATGTGGGAACAAGTACTTCTTGTTGTTTCTGCTTCAAGAAGGACTCTT" "35484" "1" "0.156956" "1.5620933" "-4.4" "0.12458151" "" "GTCTTCACTTGAATGAGGCAGCAGTTGGCAACTGTGTTAAACACGTAGGCCACTTCCTAC" "36225" "1" "0.156983" "-1.5619779" "-4.4" "-0.18631617" "56150" "AGAGAGGCAGGGAGGACAGCTTTACTATTCAAAAGTTCTGTACTTTACTCTCATTCCCAA" "52757" "1" "0.157021" "-1.5618156" "-4.4" "-0.24876345" "13043" "GGTTCACACTACAGAGCATCTGCGTGTGTTTGAGTTGGTTTCTGCTTCCGTTTCTGTTTT" "60921" "1" "0.157026" "-1.5617931" "-4.4" "-0.12150648" "69860" "TTTTGAACAAATCTTATGATCATACCCTCTCTGGCTTTCATTTATGTCCGTCATGTTTGC" "44283" "1" "0.157052" "-1.561685" "-4.4" "-0.27775037" "66673" "AGTATCAGAAGGGTTTCTAAAGACCCTTCTTTTTCATTTCAAGGGTTAAATGGGGCAGAC" "31403" "1" "0.157053" "1.5616775" "-4.4" "1.64848553" "" "GCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTGCTAGA" "43848" "1" "0.157076" "1.5615823" "-4.4" "0.47557293" "22329" "TATATTTTTATAGGCAAATGGTAAAGAGGTCACTGGGTTGACTTTCAGGTACTACTTTCT" "24972" "1" "0.157095" "-1.561498" "-4.4" "-0.165695" "69090" "GAGTCTTTTGATGGCCGGAACATTTTAAAGACATTTGAGAACTTCTACTTTGGTTCCCTG" "22127" "1" "0.157127" "1.5613628" "-4.4" "0.78694452" "14744" "AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA" "38451" "1" "0.157149" "-1.5612673" "-4.4" "-0.13633843" "" "TTAGGTTTACAAAGCTTGCTGTTGAATGTTCGTCCGGAGGAGTGTAAGAAGGCAGGAACT" "48131" "1" "0.157153" "-1.5612507" "-4.4" "-0.16906783" "72865" "ACATGTTAGTAGATGAGAAGACCTTCGACACCGACAAACGCAAGGTGATGTTCCTCATCA" "23596" "1" "0.157159" "-1.5612265" "-4.4" "-0.18057901" "93893" "TTAAGTATTTTTCCAAATCTATTGTTGCTGAACATTTTACATCAGGACACTTCACGCTCC" "30566" "1" "0.157165" "1.5611987" "-4.4" "0.3496035" "78465" "TGCTTAGAGTGCCACCTGCTGGTCAAATGGCATAGCTATTTGCCTAGTTTTCTTTGAGGT" "50358" "1" "0.157185" "1.5611161" "-4.4" "0.24317189" "244810" "GGTTCCTGGGATATGAATGAGGATTTAGCTAAGATTCTAAGTACTAGTTTGGAAGACATC" "18829" "1" "0.157198" "-1.5610582" "-4.4" "-0.15778927" "242100" "GCATTGTACAACATCATCAAGACATGGCCTCACTTCAAGCACTGAAAAATGCTACAGTCC" "7337" "1" "0.157209" "-1.5610112" "-4.4" "-0.15408609" "50995" "CTGCCTGGTATGTCTGTGTAAGAAGCCAATTTTTGTGTATTTGTTACAGTTTCAAGTTAT" "14224" "1" "0.157225" "-1.5609441" "-4.4" "-0.17140764" "" "GCTCTGTCAGGGGGTCATCTGGAGTCTCACCTCGGAGAAAGTACTTGAAGGTCTCCTTCA" "7062" "1" "0.157226" "-1.5609386" "-4.4" "-0.20088761" "" "CATTCCACACATTTGCGTCCAGTTCTAACCCAGTTCGCCTGGTTTTAATAGTTGACTAAT" "9268" "1" "0.157229" "-1.5609266" "-4.4" "-0.14089929" "13018" "TTTTAAGAGAGCCATCAGTTAGCTATCAGAATCTAGGTTGATGCATTTTTGGACTTAGCT" "13777" "1" "0.157233" "-1.5609107" "-4.4" "-0.13760012" "71997" "CATGAAGCACAGCATCAAGCTGGTAGACGACCAGATGAACTGGTGTGACAGTGCCATTGA" "35478" "1" "0.157269" "1.5607535" "-4.4" "0.2488692" "241196" "TGAAGAGTTATGGAAGACTTTAGGATTCATTCACTTCTATTATCTTGGCATTCTGTAAGG" "60910" "1" "0.157291" "-1.560661" "-4.4" "-0.14016547" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "10179" "1" "0.157321" "-1.5605325" "-4.4" "-0.1357196" "171284" "GAGAAGCCTTATGGCAGGTGTGACAGTATTTGGGACTATCTACTTTTCATAATGAAGCAA" "30639" "1" "0.157338" "-1.5604593" "-4.4" "-0.19063103" "259001" "AAGTCTTTACCATTACCACTGTCTTGGTCTCTTACAGCTGCATTCTTCTCACTGTTTTCA" "8112" "1" "0.157371" "1.5603193" "-4.4" "0.27301551" "" "GAAGAAGAAGAAAAGATGTTTGAGAAGAGTGCAGGGTGTCACAGAACATTCTGGACATGA" "55993" "1" "0.157374" "1.5603075" "-4.4" "0.35971479" "266614" "ATGAATCCCATTTTGAGTGTCACTGTCTCCGTGTACCCTCAGTCTGGTCATATGCCATAT" "3950" "1" "0.157391" "-1.5602333" "-4.4" "-0.17678755" "66526" "GTTTTCCTATCTTGTCAGAATCATTCATTTGGTGCTGAATTCTTATGTGCTAGGTACAGA" "21139" "1" "0.157397" "-1.5602089" "-4.4" "-0.17042956" "" "CTTTAGACGTTTGTAGACCTTTTAGTATGTTTGGATTGGGGTGGAGGCTGAAAAACTGCT" "28512" "1" "0.157404" "-1.5601767" "-4.4" "-0.43437174" "" "AGAGACCTTTCAGTGATAAGCTGTTGGCTCCATCCCTGGTTCCATGGATGAATTATGTGA" "17314" "1" "0.157452" "-1.5599737" "-4.4" "-0.17408626" "233733" "GGAGCTTGGGATCAGGGTGAGTGAGATTTCTCACACAGGGCTGAGCTCAGCTCCCATGAT" "1767" "1" "0.157472" "1.5598852" "-4.4" "0.31012345" "26930" "ATAAGTTTGAAGCTAGCCTAGGGCACATAACAAGTCTCAGAGGCCAACCTGAGCTACAAA" "3576" "1" "0.157478" "-1.5598623" "-4.4" "-0.29854257" "" "TGTATTTATCCCAGACCTAGCTCTAGAGAGCAATGACTACCCATGAGTGGACTTCTCAAG" "4825" "1" "0.157501" "-1.5597623" "-4.4" "-0.18471333" "" "GGATGCGGTATCAGGTGGCCTCTTAGAAGCCATCCAGTTGCAATTGGGCTGGCGGAAGTT" "3060" "1" "0.157502" "-1.5597592" "-4.4" "-0.14503971" "" "CTCAGGTTACTTGCACGGAATGAACAATAGATATTTTCACTAATTAGATGACAGTTACCT" "42176" "1" "0.157509" "-1.5597278" "-4.4" "-0.19225254" "100764" "CTTGGAAGTGAGATTCTCGTCAGGGATGCTTTTGGCCCAAAGCCAGGACTCAAGCTCGGG" "36892" "1" "0.157523" "-1.5596679" "-4.4" "-0.24708338" "69696" "GTGGCTTCTACAGGATTTCAACCTTCTTGTTATAGATCAGTCTGTGGTACTGGCTTCTAG" "47510" "1" "0.157541" "-1.5595926" "-4.4" "-0.13160796" "" "GGAAGACAGACATTCGAAATGTGCTTATCAAATTTCTACAACACTGGACTAATAGGAATA" "37970" "1" "0.157545" "1.5595746" "-4.4" "0.39068168" "" "GAATCCGATTCAAGACTTGGCATAAAGTTGGCAGACTCTTAATCATCACAGGAGAGACTG" "43173" "1" "0.157549" "-1.5595603" "-4.4" "-0.15313499" "448850" "CCTGAGGCAGTTGATGATTAGCCTCGATCAGGGTGACAACAAAGCAAAGCTGATGCGAGC" "62604" "1" "0.157552" "-1.5595461" "-4.4" "-0.28981297" "208715" "AGTAATTTTAACGTTTGGGTGCCAAGAAGTGGGTTTTCTCAGAGTCCATTGCCGGCAATG" "47719" "1" "0.157555" "-1.5595346" "-4.4" "-0.14472803" "" "AGTGAATTCTTCAAGAACTTTAAAATAAAAGCGGCCCTTTCCCGGCAACTCGCGTCTAGC" "14097" "1" "0.157587" "-1.5593967" "-4.4" "-0.14527645" "" "GGACTCAAAGCTAACCTGAGTTACGCAGAGAATGAAAGCCTGCCTCAGAAAATACAATCA" "2681" "1" "0.157607" "1.5593118" "-4.4" "0.54669637" "" "AACTGAAATGGAGTGCTCAATGCACTGGAAGGAAGAAAACATCATCCTAACAGCCATGGC" "24582" "1" "0.157647" "-1.5591411" "-4.4" "-0.12303469" "12929" "AATGTCCCATAACCCTGGAGTTTGCTTTATGTAATCAGTTAATTTGGCACATGTAAATGT" "51797" "1" "0.157656" "1.5591014" "-4.4" "0.18380318" "234911" "CATCATAAAAGGTTAAGCTTGCTCACTTTCAGTATTGTTCATGTGCTGACAAAAACATAC" "28818" "1" "0.157666" "1.5590598" "-4.4" "0.20028672" "237806" "ATGTATTGTCACTTTGCAAATGGCATTGGTGAGCCCAAGTACATGCCTGTGCAATCATGG" "15393" "1" "0.157668" "1.5590515" "-4.4" "0.24811192" "319513" "ATGGGTATACTTAATTAATACTGTTTACACACTTCCTCTGTGTTCTTAATTCCTACCCCA" "54711" "1" "0.157693" "-1.5589436" "-4.4" "-0.12804753" "67443" "CACTGCTCTGTCTTGTGTAGGTTGTATACGTCATTATGTCCCTGGTTTTTATAACTATGG" "50918" "1" "0.157703" "-1.5588991" "-4.4" "-0.14053326" "" "TATCTGTTAAACCAAAGACTCAGGAACTGCTGGCCAAACCCCTTGGCCTCCAAATACTTA" "12896" "1" "0.157752" "1.5586923" "-4.4" "0.26656572" "12335" "TTCGGCCATCATTAGCCGCAATTTTCCGATCATCGGTGTGAAAGAGAAGACATTTGAGCA" "14991" "1" "0.157754" "-1.5586829" "-4.4" "-0.13144866" "257890" "CCATGGAGCAGGGCAAAGTGGTCTCCATCTTCTACACTCTGGTCATCCCCATGCTCAACC" "22891" "1" "0.157786" "-1.5585451" "-4.4" "-0.16328596" "546837" "TTAATGAAAAGCTGAGCCTGAAGTTCAGAATGAGTGTCCCCATTTCCCCAGTCAGCTACT" "44965" "1" "0.157802" "1.5584777" "-4.4" "0.19089828" "" "TCTCAGCTAACCTTTTCATGTAAGGTGAAAATTAAAGATTTGTTCTTCTGTGTACTCAAA" "34325" "1" "0.15783" "1.558359" "-4.4" "0.17397942" "14766" "TACCAGTTCATTTGTCTTTTGATATTAAAGCTCTTTATAGAGAGTCTGGAAACTGTAGGC" "50991" "1" "0.157846" "-1.5582929" "-4.4" "-0.14720859" "56258" "GGGAGGGTGTCTTTATATCCAGTATGATTGGTAAATGGGAAGTACAACTGCTTCTGATCA" "6145" "1" "0.157865" "1.5582093" "-4.4" "0.17735553" "71831" "GATGTTGACAAGTTAGTTCATCATTGATAAGTAAGTTTGGATGAGCGGTCTTTATCTTCC" "57076" "1" "0.157877" "-1.5581595" "-4.4" "-0.14308722" "" "AATGATAAGGGAAGGTACAGTTGTGTGTACCTTCAGATAGAACCCCCTTTCAGAGCCTCT" "45673" "1" "0.157888" "1.5581134" "-4.4" "0.25611213" "83380" "ACTCAAGGCCCACCCCCAACAGGCCCACAGCCGAGACCCACTCAAGGCCCACCCCCAACA" "23767" "1" "0.157899" "-1.5580637" "-4.4" "-0.19670396" "18159" "GACAAAACCAGCTAGCTGTAAAACATTGCTGTTTGTAAATTCACGTCATGCATAAATGTA" "58664" "1" "0.157905" "1.5580385" "-4.4" "0.13633777" "110855" "TGCAAATGAATTTTGGGAACAAGGAGATCTGGAAAGAACAGTGCTGCAGCAGCAACCAAT" "35005" "1" "0.157912" "-1.5580094" "-4.41" "-0.13650995" "98828" "TCGATTTCCTTAAGCTGAAAAGAAATGAGCAAGAGGACGACTGAGTGCTGCTTGGAGAAC" "31439" "1" "0.157916" "-1.5579914" "-4.41" "-0.16037219" "" "AACATTGTCAGTAATGCATCATATACCACCAACTGTTTAGCCTCCTGGGGCCAAGGCTAT" "35209" "1" "0.157932" "1.5579236" "-4.41" "0.29268977" "" "GGAACTGTGCTGATTCTTCAGTGCATCTGTTCTTAATGCTCATAAATACATATATCAAAG" "56003" "1" "0.157948" "1.5578567" "-4.41" "0.13039843" "" "ATACACACAAGACAGTTCAGTTCACAAGTCCATCAGAAGCAGACTGCAGTTGCATGAAGG" "14027" "1" "0.157974" "1.5577447" "-4.41" "0.23141295" "" "AATACAGCAGACTAGCGTTCCTTACAACAATACAGCAGACTAGCGTTCCTTACGGCAGTA" "28487" "1" "0.157977" "1.5577341" "-4.41" "0.15795735" "" "" "58284" "1" "0.15798" "1.5577221" "-4.41" "0.43226863" "" "ACAGTCTTGGGTTCCCTAGGTTGCTGTATTGTCTAGCTTTTTTACTGTTGCCCCAAGATC" "5656" "1" "0.158007" "1.5576057" "-4.41" "0.70765706" "" "GAGCTTGGTAGTGGCTGGGAGAAAAACAAAACAAAAATGAAACAAACTTCCTTTAGCGGT" "9200" "1" "0.158015" "-1.5575729" "-4.41" "-0.14877155" "" "GGAACCGCTGTCTGGATTAGATGAGAAAATGTACTGAAATCGTTTTAAAAGCAATTTTGA" "33671" "1" "0.15804" "1.557465" "-4.41" "0.17852794" "230613" "GAAGTATCCACATGGCCTGTGATTAATATCCCCCTCCATATATTAAATTGAATAAGGATT" "51429" "1" "0.158044" "-1.557449" "-4.41" "-0.16872407" "243300" "TAAAACAGGCATTTTATTTAGTTCTGGGGTAAGGGTCTAGCCAGGGATGGGTGGGATGTT" "48604" "1" "0.158047" "-1.5574347" "-4.41" "-0.12200401" "55989" "CATCAGATGCTCTCAAATAATCAAGGGAGGTTGAAAATCTAGCTTTTCAAGCCTTTTTGT" "12106" "1" "0.158101" "1.5572043" "-4.41" "1.1161041" "219131" "ACACTGATACCCTGGGTTTATGCTCACTATCATACCAGATTGCCAATATTTAGCACACTT" "48754" "1" "0.158104" "-1.5571904" "-4.41" "-0.23317372" "" "ATACCTACACACACTGTGGCACATATGGAGATATCTCGTTGGCCCATAGTATGCTTTTTT" "53499" "1" "0.158111" "-1.5571608" "-4.41" "-0.18998016" "271711" "TTCCTGGAAAGGAAGGGGAACAGGGATTGACAGTATTTAATCTATAAAGATGGAGAAGAG" "20997" "1" "0.158122" "-1.5571166" "-4.41" "-0.1866001" "" "AATTAAACCGTGTTGCCATTCTTCCCTCAAGCCACGGGACTTACTCTTGTGATCAGTAGT" "27468" "1" "0.158144" "-1.5570206" "-4.41" "-0.18714021" "14263" "GATGAGACTGAACACAGCTTCATACTGCACAGGAATCAATCACAATCTCTCTCTCTCTCT" "20471" "1" "0.158164" "-1.5569392" "-4.41" "-0.1668318" "237943" "TAGGTAGAGAGATTTTTGGCTTCAAAGTTCTGTGCCGTCTGCCCAGCTCGATTGCTATTT" "30316" "1" "0.158175" "-1.5568917" "-4.41" "-0.20751323" "" "TGTTCTGCTCTCTGTAAAGCATGTGTAAAGATATTACAAGCCGAGGCTCCTTAGCCGTCT" "55941" "1" "0.158192" "-1.5568197" "-4.41" "-0.3514801" "195236" "ATCTAAGTCTTCCAAGAAGGTAAACCACCAGTACGTCATCAAGTGCTGGCAAAGAATGGG" "42954" "1" "0.158223" "-1.5566881" "-4.41" "-0.12434608" "" "GAGAGTATATCCCTGTCTGATTTAGTCATCATGCTTATTTAATGAGTATCATCTGTGCAA" "17153" "1" "0.158239" "1.5566162" "-4.41" "1.08202591" "15957" "CACACATTACTGGAAAGATACTAAGAACCAAGAAGACTTTTGGCTTCCTAGAGAATTAAA" "49220" "1" "0.158243" "-1.5566009" "-4.41" "-0.19517788" "69928" "TGAAGCTCTTAGCCAGGCGAAATAATTCACTGCTAAAATACATTACAGAGAAGAATGAAG" "42440" "1" "0.158258" "1.5565369" "-4.41" "0.58332139" "19143" "CTCAGAGTTCTTCCAAAGTGGGACCCCCTCAAGAGTTGGAGAGAGAACTTGCGTGCTAGC" "30750" "1" "0.158272" "-1.5564779" "-4.41" "-0.1579663" "76773" "CACATTCGGTATATGGTTGCTAAAATGTTTCCATGGCTTGCTTACTTCGGTGTGTGATGA" "20677" "1" "0.158283" "1.5564299" "-4.41" "0.43730268" "" "TCAGATTGCTAACATGATGGAAGAGAAATTCAAACCCGATGCTGGATTGGGTGAACTGAT" "27700" "1" "0.158286" "-1.55642" "-4.41" "-0.20433917" "258183" "TTGAGGAACAAAGACATTAAAGTTGCCCTGAGGAGAACACTGAGGAAAAGGAACTTTTGA" "47257" "1" "0.158294" "1.556384" "-4.41" "0.26854082" "" "AGCCTTGCAAAATAAGAAATATCCAAATCAATGAGAGAATATCCCCCTCCTCCCCACAAA" "46746" "1" "0.158315" "-1.5562963" "-4.41" "-0.15651767" "" "" "8147" "1" "0.158336" "1.5562063" "-4.41" "0.2408394" "277328" "GCAGAAATTCACTGTTCCTTCCTCAAATTTCTTTTGGTCATGGTATTATATCATAGCAAC" "19303" "1" "0.158347" "-1.5561609" "-4.41" "-0.13607415" "233724" "ACTCAACAGGAGCTACCACTTTAGTTGGATGTTTTCTTCTCCCAGTAGAGAGTAACCATG" "1020" "1" "0.158354" "-1.556128" "-4.41" "-0.17118386" "330503" "AATCCGTAATTAAGATTGAGAGACTTAGTTGGATGTGGTGGCTCATGTCCTCTGGGCCTA" "55943" "1" "0.158354" "-1.5561274" "-4.41" "-0.18717918" "22755" "TTTCTAGATCACCAAAGAATTCACACTGGGGAAAAACCGTATAGATGTGAAGTGTGTGGG" "39214" "1" "0.158362" "-1.556094" "-4.41" "-0.16572138" "" "TAGTCAGCAAAGATCTGCTCAGACTTGAATTAACCAGGAACTTGGCATCAAAGGGTGTGG" "57630" "1" "0.15837" "1.5560624" "-4.41" "0.22452953" "100210" "TTCTAGAGAAGAAGCCACGCATAGCACCCTTTGTGGTGCCGACAAGCTCAAGCCCCAGGA" "38370" "1" "0.158373" "-1.55605" "-4.41" "-0.13828662" "" "ATGTGTGTGGGCAAAAACTCCAGTCACTATTTGTGACTAATTGCATAACAGGTTCTTTTA" "48577" "1" "0.158374" "1.5560432" "-4.41" "0.26361313" "26425" "GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA" "21092" "1" "0.158375" "-1.5560421" "-4.41" "-0.15118587" "66271" "AACTTCCAGAATCAGACAGGAATCTGCTTGAATATGGATCAGCATATATTGGACTTAATG" "20041" "1" "0.158408" "-1.5559017" "-4.41" "-0.15794536" "17927" "TTTTGTTGTTGTTGTTGTAGTCCTTCAGTTGTTTGTTTGTTTTTTCATGCGGCTCACAGC" "42803" "1" "0.158408" "-1.5558988" "-4.41" "-0.15223254" "208092" "CGGAAACTTCACCCAGGAGGATGAGGACGCCATCCTGGAAGAGCTGAATGCAATCACTCA" "8288" "1" "0.158414" "-1.5558723" "-4.41" "-0.14540561" "" "AAATAATGTGGTTAGAGGTCACTTCAGCATAAGGTATTAAAAAGTAGTCACAACATCAGG" "52594" "1" "0.158416" "1.5558643" "-4.41" "0.25950277" "66609" "TGCACAGCTCTGTATTATCTTTCTCAACTCTCTCCTGGAAAGTCTGTGCTGATCATGGAC" "37140" "1" "0.158445" "1.5557442" "-4.41" "0.31082482" "57344" "CCCAAGGTTTACTCAAAGGGCCAAAGGCATCATCAACGTTGTGAGAATTATCTTCCTTCT" "6824" "1" "0.158447" "-1.5557338" "-4.41" "-0.31459668" "636931" "AAAGGATTTACAAACCAAACCACCCAACAGGAAGTGTAGGACACAGTATATGTCTTTTTT" "22607" "1" "0.158449" "-1.5557262" "-4.41" "-0.16669684" "" "GGTGCAGAGGAAAATGGGGGTCACCAGGTGAACACCAGACTTGCTTTTTGTTCAGCTTTG" "50889" "1" "0.158456" "-1.5556975" "-4.41" "-0.17965435" "" "AGGAAATTTTGGTGGAGGTGACTATGCTGGAGGTGGGAACTATAATGACTTTGGAAATTA" "43809" "1" "0.158471" "-1.5556316" "-4.41" "-0.13275907" "231329" "ATCAGGTTCATGTCTGTAATCTTTGTGGAATAATGGCAATTGCTAACACGAGGACTCATA" "55991" "1" "0.158479" "1.5555998" "-4.41" "0.30146429" "" "ACTTACACAACCAGCCAGAGGCTCCTGGTCCTTCAGGAGGAACTGAGTCACTCAGCAAGG" "57903" "1" "0.158507" "1.555479" "-4.41" "0.49408796" "101488" "GCTGTATACATACAGCTGATTATTAAATTTGTCTCTGCATAATGACTCTTCCACGACAAA" "27492" "1" "0.158527" "-1.555394" "-4.41" "-0.12799263" "" "AAAGTTTCACACCTATGAGAATAAGCTGAGGCTTGCTCGTCCTTGAGACATCCAAGGTCT" "37910" "1" "0.158558" "-1.5552647" "-4.41" "-0.16259957" "104112" "TCTGAGTCCCGAGCTGATGAAGTGGCACCTGCAAAGAAAGCCAAGCCAGCTATGCCCCAA" "34251" "1" "0.158566" "-1.5552282" "-4.41" "-0.21489022" "" "GTTCTAGTCTTCAGGAAGACCTCTGAAGAGGTCCAAGTCAAACCAGGGATGATCTTTATG" "40305" "1" "0.15859" "-1.5551285" "-4.41" "-0.16527217" "109095" "AGAGCCCAAGACTCTTGAAGAGCCAAAACACGAGACCAAAAAGCTAAAGACTCTGTCAGA" "28352" "1" "0.158598" "-1.5550939" "-4.41" "-0.22057734" "" "TTTAGACAAAGCCTGGTTGTAATTATCTTGCCCTGCCACCCGACTCTGTCATGAATAGAG" "40958" "1" "0.158613" "-1.555031" "-4.41" "-0.17507142" "" "TACGGCTTACGTCATCGGACTGCGCTAACTCCAAACCGGAGAAAGAGGAGGAGCCTGTAG" "21679" "1" "0.158621" "-1.5549961" "-4.41" "-0.15609978" "" "AAGGTGACATCAAGTGAGAGCAGCCATATCTGCAACTCAGGTACACACTTGCTAATTAAA" "29353" "1" "0.158623" "1.5549876" "-4.41" "0.19493254" "16847" "TGAAGGAAATCACAAAGGTTCTGTCGGACACAAAATGGGACAGAATTTTCTCATTGTATA" "26745" "1" "0.15864" "1.5549167" "-4.41" "0.20998255" "" "ACTTTTGCTTAAGAGTACATGTTAAACATTACTGCTTTAAATTATGGGTTTTGTTAGACA" "41691" "1" "0.158659" "-1.5548353" "-4.41" "-0.16517438" "68153" "ACGGTTTAAGACTCACAATGAACACTTGGCTGGAGTGCTGAAGGATTACTCGGACATTAC" "52806" "1" "0.158665" "-1.5548076" "-4.41" "-0.15964476" "" "GTAGACAGTCTCTGAGGAATTATCCCCTATTGAATGGTCTCATAACAGTTTTGGAAAGCG" "37786" "1" "0.158672" "1.554777" "-4.41" "0.19859471" "20852" "CTAATTTCCAAGATGTCCCCAGAAAAACTGCAACGGCTCTATGTTGACTTTCCACAACGC" "15650" "1" "0.158673" "-1.5547748" "-4.41" "-0.133637" "269470" "AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG" "20955" "1" "0.158679" "1.5547487" "-4.41" "0.61451347" "17095" "GAGGACCTACCCCATGAAGCCCAACTGGTTGCGCTTGATCCATGATCCTGTTAACCGCGA" "28177" "1" "0.158684" "-1.554728" "-4.41" "-0.2095583" "" "CTGGAACAAGTGTTTCTGTACTGACACACTGTGTGAGCCTTAAATATTTATTAAAAACAG" "56801" "1" "0.158685" "-1.5547225" "-4.41" "-0.12697592" "19152" "TTCCAGAACAATTACAACCCCGAGGAGAACCTCAATGACGTGCTTCTCCTCCAGCTAAAC" "62791" "1" "0.158691" "1.554698" "-4.41" "0.20799679" "" "TAACTCTAGAATTTTGGGCATATAGCCACCAAATGTGTCCAGTGGCTCTGGACTTCTTGG" "60873" "1" "0.158694" "1.5546835" "-4.41" "0.13508622" "" "" "54086" "1" "0.158698" "-1.5546704" "-4.41" "-0.35312511" "219170" "CAAGCAGGTGGGGGTCTGTGCTGTAACCTTGCATCAAAAATAAATAAACAAATAAATAAA" "16762" "1" "0.158701" "1.5546553" "-4.41" "0.20933254" "75458" "CATCTAGTAAGTTCATGCAGTCGCTGCACAGAGATCACATTGCCAACAAATTACAAAAAA" "12496" "1" "0.158711" "-1.5546144" "-4.41" "-0.18986238" "56747" "CCCAGGTCATCTCTTGACTATTGGGGGAGGGGGGAGGTAGTGTAAAAATGTTGATTTTTT" "28496" "1" "0.158716" "1.5545931" "-4.41" "0.47766496" "12628" "GGATACCTTTTGATGTAAGGTCCTGATTTACAGTGGATAAAGGATATATTGACTGATTCT" "54403" "1" "0.158726" "-1.5545513" "-4.41" "-0.13807476" "14760" "CTCCAAACACTTTTGTCTGATTTCTAAGAAGTCTTTCACTGTTATGTGCCAGAGATTAAA" "27563" "1" "0.158739" "-1.5544936" "-4.41" "-0.24872795" "" "AACCATGTCTCTGTTACTGTTGTGGTTGAAATCTTAACTGTGAAATCTGGACCCCTTTGA" "53030" "1" "0.158755" "1.554427" "-4.41" "0.48278335" "20848" "CACTCTGTGAGCTGATACCCCAGGCTGGGAACTCCTGGCTCTGCACTTTCAACCTTGCTA" "41143" "1" "0.158764" "-1.5543905" "-4.41" "-0.18498424" "" "" "50187" "1" "0.15878" "-1.5543188" "-4.41" "-0.18982404" "" "TTTCAGTTTCCATAGATACAACCCTTGATTGAATTGCCCAGCTAGTGGTCTGCCCTTCCT" "50470" "1" "0.158798" "-1.554246" "-4.41" "-0.21286946" "" "TCCAATGTCTTCCCCGTAGATCCCGAGATGAAGCAAGGCAGGTGGGAGCATCTAACAGGC" "21386" "1" "0.158803" "1.5542233" "-4.41" "0.48345038" "213002" "GACTACTAAATTCTTCCATGCACTGTCTTCGTGAAGAAAGCATTCATGTGCTCTGCCCCT" "49967" "1" "0.158809" "-1.5541971" "-4.41" "-0.19782833" "231148" "TTTGACCGCCTGGCCCTGTGGAAGAGGAATGACCTCAAGAAGAAAGCCTTGCTGTTCTGA" "37464" "1" "0.158834" "1.5540917" "-4.41" "0.22956319" "18088" "CACAATTGAAGCATATATTTCCACCTCTTCAAAATGTTTCCTGTGCCAGGAAAATGTAAT" "34082" "1" "0.158858" "-1.5539891" "-4.41" "-0.20189107" "270624" "ATAAAATTTGCTGATTATTTTTATGTGCTGTATGTCATTATGTATTAGCCCAGTTCAGAA" "46958" "1" "0.158864" "1.5539666" "-4.41" "0.93225536" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "57833" "1" "0.158886" "-1.5538732" "-4.41" "-0.14140802" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "244" "1" "0.158902" "1.5538033" "-4.41" "0.78772289" "" "TGTGGTGAGACAAGATGAGACATGATGTGAAATGGAGGTGCAGGTACAACCCAGGCGCTC" "32462" "1" "0.158939" "-1.5536453" "-4.41" "-0.18805163" "" "" "45842" "1" "0.158969" "1.5535202" "-4.41" "0.47479951" "12977" "TGTGGGGCTTACTTAGCCTTCTGGTTACAGACTATTTCCATGCTAGAAAATACATATTTT" "14073" "1" "0.158992" "1.5534246" "-4.41" "0.21602174" "93737" "TGTTTCCATGTTGCTGCAGTGATCTGGAATGTGCTTTACTAAGACAAATATTACAGAACC" "30100" "1" "0.158994" "-1.5534129" "-4.41" "-0.2401077" "" "GCCTCAATGTATATTTATTTCTTTGGAGCAAAAAGGTTCTGAAAACTGGTTTTCTGTAGC" "9678" "1" "0.159007" "-1.5533594" "-4.41" "-0.28206894" "50934" "TATTTCTTTTGGATTTTTTAATGTATGGCGGTTTGGGGGCAGAGCTAGAACCTTAATAAT" "54197" "1" "0.159045" "-1.5532001" "-4.41" "-0.26313745" "100042480" "GCTACCAGCAATTGAACTGTATTATTCTTTATAGAGCTAGAGCTGTTTGTTGTCTTCTTA" "40232" "1" "0.159049" "-1.5531803" "-4.41" "-0.25220416" "" "AATATCACGGAAGGCACTCTTTCTTAAAAATAGAAAATTCTCTCCTCTACTCCCTGCTTT" "48194" "1" "0.159055" "1.5531565" "-4.41" "0.30587832" "140570" "GACCACCCACCCTTTTTGTAAATCGTGATTGTAAATCCAATACAGTTGTCTTTTTCACTC" "1775" "1" "0.159057" "-1.5531456" "-4.41" "-0.1860485" "22631" "TAAAAATGAGCTGGTGCAGAAGGCCAAGCTGGCCGAGCAGGCAGAGCGATATGATGACAT" "32885" "1" "0.159084" "-1.5530333" "-4.41" "-0.25216477" "" "" "60227" "1" "0.159084" "-1.5530332" "-4.41" "-0.19689392" "105559" "AATTTGTGGAAAGGTATTGTATCTAACTTGTATCACCTTGATAGTTCTCATCTTTATGTA" "28092" "1" "0.159159" "-1.5527146" "-4.41" "-0.16511666" "330502" "GGCTAATCTTGCTTATCCATACATGTAACTGACCTGGCATAAGTGGTTTTATATCATTAA" "31911" "1" "0.159161" "1.5527057" "-4.41" "0.22193867" "227399" "ATAGAAAATCCCCAGCAGCATTTTACATTAAGTACTATTCAATAAAACTCATGAGTGAGC" "50751" "1" "0.159173" "1.5526557" "-4.41" "0.22578389" "50880" "CGTGGTACCGGGAGGCTGGTGCCTGAGCTCAGTCTTTGCCAAAGTGGGAAATCTGATCAT" "4532" "1" "0.159175" "1.552647" "-4.41" "0.21064428" "53315" "CCAGTAATGACTGTCTAAAATAAACATCCTTAAATAAATTCAACAATGAATTAATAAAAA" "48383" "1" "0.159187" "-1.5525988" "-4.41" "-0.12605349" "66622" "AGCAGTGTCAGTGAGCAGCAAAAATACAGCCAGCCTATGTTGAAGGGCTTGCATAAGAAA" "56412" "1" "0.159207" "1.5525144" "-4.41" "0.431632" "" "TAATAACGCTTATTTGCATTCTTCTCATGCCGCCAGCTCTCCCTTAAATACTGTTTCTAC" "35569" "1" "0.159239" "-1.552379" "-4.41" "-0.12696805" "109054" "TTTATCTTGTTTTAATAAACTTGAATATTGTCTTAAATGATAATTTCCCTTCTCCAAATG" "46778" "1" "0.159282" "-1.5521938" "-4.41" "-0.12585483" "" "TGCGCTTGAAATGTCAACAAATTGTGCAGTTGGCATTGCCATAGCATGATCTACTGTGTG" "28659" "1" "0.159355" "-1.5518865" "-4.41" "-0.18036635" "" "ACACCCACAAGTGTTTACAGTTAGACGATGATGTAGAGGTTGCAGTATCTGAGAACCACA" "58542" "1" "0.159364" "-1.5518481" "-4.41" "-0.19071339" "14366" "ACACACGTAAGGTATCCAGTGGATTTCTCTCTCCTGAAATTTCAACATCCCTAATTCTAG" "48348" "1" "0.159386" "-1.5517543" "-4.41" "-0.17280884" "" "TGTCCATGGTGGTGCCGCTCGCCATTCCTCACATGACCTCGGAGAAAACAGCCTGATTCT" "2599" "1" "0.15947" "1.5514012" "-4.41" "0.60566444" "16061" "TACTAAGCACACAGGATCTCACCATGGGATGGAGCTGTATCATCCTCTTTTTGGTAGCAA" "61455" "1" "0.159481" "-1.5513553" "-4.41" "-0.27077857" "13638" "CGTTACAGCGCCTTCTCGCTGGGCTATGAATTCCATGCCGGCCAAGAATACTACTACATC" "17159" "1" "0.159482" "1.551349" "-4.41" "0.40246275" "" "ACATTTAGGGGCTTTCTTTTAATGGGACTGGGGTTTTAGAGACCCAGGGAGCTTAAAGGA" "52904" "1" "0.159488" "-1.5513256" "-4.41" "-0.14468623" "67921" "CCTGAGGGTTTCTGTGAGAGACAAGTTGCTTGTTAAAGAGGTTGCAGAACTTGAAGCTAA" "60461" "1" "0.159492" "1.5513088" "-4.41" "1.27460272" "69816" "TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA" "28406" "1" "0.1595" "1.5512749" "-4.41" "0.45133689" "" "" "41737" "1" "0.15952" "1.5511913" "-4.41" "0.23981258" "14149" "AGCCCCTACCGTGCAAGACAAGAGCCGGACAGTCTGGGTTGGACTCTTCTCTCGTTCATT" "41667" "1" "0.159526" "1.5511659" "-4.41" "0.27833185" "72282" "CGCCTTATCATTGTATTTTATGTCCAGAAAGTAAAACTACAGAATCCATTGCTATGCTCA" "15285" "1" "0.159528" "1.5511583" "-4.41" "1.56318293" "" "TGGCGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGACTACAACAT" "3213" "1" "0.159576" "1.5509522" "-4.41" "0.19876093" "" "CTCAAGCATGCACAGGATCCAGGAGGCAACAGTAACATCCCTAAGGAGCCAGTCTCAGAA" "31153" "1" "0.159612" "-1.5508011" "-4.41" "-0.16172846" "56093" "GGGGTTGATTGTATATGCTCTTCACAAAACCTGCCTTTTTCAGTATTAAAATGTTCAGTA" "39075" "1" "0.159619" "-1.5507712" "-4.41" "-0.1832564" "" "AAATGAGCTATTTTTAAAGAGCAAGGCTCAGGCAATTCCACTGTTACTAGTTGTTTGTTT" "50614" "1" "0.159637" "-1.5506961" "-4.41" "-0.17089345" "" "AGAGTATGTCATGGAGTCTACTGGCATCTTTACCACCATGGAGAAGTTCCAGACTCACTT" "50796" "1" "0.159638" "1.5506902" "-4.41" "0.39556369" "353499" "CTCTGCCACCCGAATGCTACACTCTCAATTGAACCGTATTAATAAACAACAGTCAAGGCC" "11080" "1" "0.159729" "1.5503064" "-4.41" "1.62017409" "" "GCTCAAGTATAAGTTCCAATTACTTGCATTGGTATCAGCAGAAGCCAGGATTCTCCCCTA" "34743" "1" "0.159734" "-1.5502857" "-4.41" "-0.15193738" "66834" "CGGGAAGACCCGAAGAAGCCCAACAATGCCAAGTATGGTTTGTGAACAACTTTCTGAAAT" "54039" "1" "0.159759" "1.5501821" "-4.41" "0.19826343" "" "TGCATGATCACACAGGTCACAATGTATTTAAATGGTCTCCCCAGTTTGGTGAGTTGGCTC" "31559" "1" "0.159766" "-1.5501542" "-4.41" "-0.21273034" "56044" "CAGACGTCAGTCTGTGATGTTTCCACTGCAAGAATTCAAGCATGCTGTTAGGAATGTAAT" "14628" "1" "0.159773" "-1.550121" "-4.41" "-0.17520789" "214593" "TGCCAGCTCATCAACAGGCAGGACCGGGCCCACTTTGTGCATCATTATGAGAACTTCTGA" "31741" "1" "0.159795" "-1.5500308" "-4.41" "-0.13034043" "" "TTGCGGATCAGATTAAAGGACAAGACTTTAAGAAGGGACCAAGGGAATGGAGAGATGGCT" "9659" "1" "0.159816" "1.5499404" "-4.41" "0.1658996" "" "GAGATTAAACAGAGTCCTGTTAGTTAAAACAGTACCTTTGCTATCACTGTGCAACCCTCC" "35101" "1" "0.159881" "-1.5496693" "-4.41" "-0.24347595" "" "CTGCATAGTGAGCAAAAAATTGGAGATATGATTTAGAGGAGCAGGGATGGCAGCAAAAAT" "15770" "1" "0.159881" "1.5496656" "-4.41" "0.72420221" "11576" "GTGAGCCTTTTGGCTTAACTGTAACTGCTAGTACTTTAACCACATGGTGAAGATGTCCAT" "32568" "1" "0.159902" "1.5495799" "-4.41" "0.48281784" "" "" "60433" "1" "0.159902" "-1.5495797" "-4.41" "-0.35101516" "" "CACATGGAGTATTCAGTTGTTACGATGGTTTTTAATTTTGAGGTTCGTTTTGGGAATTAC" "47628" "1" "0.159922" "1.5494964" "-4.41" "0.26342702" "22156" "CTATAGTGTGGTCTAGTAGCCTCATGAGTGTTCTACTTGGCTCACAACCAGAAGCCTTAA" "37769" "1" "0.159945" "-1.5493964" "-4.41" "-0.15555966" "232853" "AGTAGGTATACTGGAACATGATGAGGACTGCTGTCATCTTTCTGTTACCCAGGAGTTGAC" "59707" "1" "0.159953" "1.5493625" "-4.41" "0.83822053" "14127" "AGGTCCCCATCTCCGTTAAAGACTTACTCACTGACATTTCTCTTCTTCCAGCCTCCTTTG" "5926" "1" "0.159955" "1.5493566" "-4.41" "0.17324944" "" "ATGCAGTCTGAATGTTCACGGTGGCTTCTGACGTGGCAGCGTGAATTCTCAGCTGGGCAG" "61059" "1" "0.159975" "1.5492712" "-4.41" "0.14007923" "" "ACACTGGATTCTTGATTTCCTAGCTACAAGATCATTGCCTCAGGTCTTGCTGCACCTTAG" "27508" "1" "0.159984" "-1.5492344" "-4.41" "-0.13533543" "110379" "AGTTGTGCCTGGAAGCCTTATAGACCAACCATCAGGGCAGAAACCCAATTACATCAAGAA" "21740" "1" "0.159988" "-1.549216" "-4.41" "-0.14510562" "66060" "AGCCAAGACCCAGTTCTCTCGCAGCCGCTGCTCCTGTTGCTGAATAAACAACTAGTGTTA" "44868" "1" "0.159998" "1.5491735" "-4.41" "0.80143617" "" "TGATCATATCCAGTGCAGCAATCAGTTCCTGCCAGGACACAGTTTAGATATGAGGTTCCA" "40389" "1" "0.160006" "1.5491411" "-4.41" "0.19616347" "18033" "TCTATGACCTGGACGACTCTTGGGAGAAGGCTGGAGAAGATGAGGGAGTGGTGCCAGGTA" "57164" "1" "0.160009" "1.5491296" "-4.41" "0.28205606" "" "TTTTGGGCTTCTTCCTAGTGACACAGCACTGCCAACTATGTGCTTGGCTCCCATGGGCCC" "43786" "1" "0.160038" "-1.549006" "-4.41" "-0.68115225" "" "TCAGATGACTATGATGGAGAGGAATATGACGTGGAGGCACACGAACAAGAACAAGGAGAC" "38393" "1" "0.160043" "-1.5489842" "-4.41" "-0.22052668" "94109" "AAGAGAGTGTAACATAACCTGTGTAATGCCACCTATCTTTAAAGCAAATCAGAGTTCTAA" "20075" "1" "0.160052" "1.5489472" "-4.41" "1.12365939" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "5349" "1" "0.160096" "1.5487612" "-4.41" "1.09947145" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "44670" "1" "0.160098" "1.548755" "-4.41" "0.13527143" "" "GAACCAGCAGCCAAACGCATACATTTCTAACCACACAGTCTCTGTTATCAGTGGTATGTT" "47470" "1" "0.160109" "-1.5487056" "-4.41" "-0.13814733" "" "TGCCAAAGACCGACAGTCTTCCTTTACTGCACTTCACAAGGTTCTAAGATGTGGAGAGTT" "15235" "1" "0.160151" "1.5485292" "-4.41" "0.17857563" "" "CAAGCAAGATGCCCATATATGCGAATCCTCTGTCAAATACATTGGTTCTTTTTTCTTTTT" "58944" "1" "0.160152" "-1.5485279" "-4.41" "-0.14788726" "" "TCTTCATTAAGGTCCTCAGATAGCTGGAGTTACAGGTCTTAGCAATGATGCACAGGTAGC" "58406" "1" "0.160159" "-1.548499" "-4.41" "-0.1545489" "" "TCTTCTGGGTGGGCTTGGTACTATAGCCCGTTGAATGTTAACTGATGAAAGGTAAGAGCT" "38232" "1" "0.16016" "-1.5484937" "-4.41" "-0.22549524" "223666" "CCTCGTACGTGTGGCTCGAGGGGACAGTGCTCCGTGTGAATAAAGTTCAAGTGCACACTC" "49858" "1" "0.160164" "1.5484766" "-4.41" "0.25874819" "" "TGAAGATGAAGATGCAGAGGAATATCGTCATCTGCTGGGACTATCTCCATTACATCTGAA" "48018" "1" "0.160204" "-1.5483068" "-4.41" "-0.17022399" "" "GGGAAAATGTGGCAGTGTACAAGTCAGTAAATTTAGCTAGAGTATTGTTCATTGTTTCAA" "49140" "1" "0.160207" "1.5482936" "-4.41" "0.20170933" "" "" "10433" "1" "0.160219" "1.5482432" "-4.41" "0.54401808" "73670" "ACCAATCCTGACCTGAGGCTGCCAACCATTCTCATTGATGAATTATGAGGATCTTGATGG" "11222" "1" "0.160241" "1.5481505" "-4.41" "0.15944493" "" "" "61044" "1" "0.160249" "1.5481168" "-4.41" "0.34409862" "74137" "TTTTTGTGATTCTCACTTCTGTTTTTTGGTTTTTGTTTGTTTGTTTGTTTTTGTTTTTAA" "54303" "1" "0.160263" "-1.5480602" "-4.41" "-0.16449195" "228491" "TGTTAAGATAAACATGTTAAATGATGGTTTGCTGCATGCTAGAACTGTACTTACTGAGTC" "409" "1" "0.160277" "1.548" "-4.41" "0.64300511" "14257" "AGCTTACCCTATACTTTTACCTGACTTTAACACCTAAACAAATCAAACCTCTGTCCTGAA" "42380" "1" "0.160282" "1.5479777" "-4.41" "0.19885542" "" "ATGGAAAACAAGTCAAGCCTGAAAGTTTTTTGAAAGGTGGTTATAAGCAAGTGTGCAAAC" "57842" "1" "0.16029" "1.5479444" "-4.41" "0.3984116" "229600" "TTCATACAGAACTTATGGACCCTCAGAATCCTGTAACCACGAAACCAGTGACCACAGAAC" "58112" "1" "0.160348" "-1.5477029" "-4.41" "-0.20088338" "" "TATCTTCCTCCCTGTCTACCATACCACCAAGGGCAAGGTCATGGTTGTTGTAGAGATTTT" "19314" "1" "0.160361" "-1.5476489" "-4.41" "-0.27479274" "19142" "CTTTGTACCTTGGATAAAAAGTGTCACCAGTCTGTAACTTATGGAAAGCTCAAGAAAATA" "25923" "1" "0.160368" "-1.5476194" "-4.41" "-0.16249172" "67412" "GACTGGCTGACTGTGAAAAATGGACAAAGTCTCATAATTATTCTGTAGGAATTGAGTATT" "7924" "1" "0.160384" "1.5475497" "-4.41" "1.03961663" "19039" "AGCAGCTTCCGTGTGGTCATACGCCCCTTCTACCTCACTAACTCCACTGACATGGTGTAA" "49453" "1" "0.160406" "-1.5474597" "-4.41" "-0.18023225" "13211" "GAAACTATTTACTGCTCACAACAATATGACCAACTATGCTACTGTATGGGCATCAAAAAA" "53486" "1" "0.160407" "-1.547456" "-4.41" "-0.23391474" "396184" "CGATGGCGCCAAGACATTGGTCATCCAGGTGAAGCCACTGACGGCAGACTCTATCCGAAT" "14972" "1" "0.160411" "1.5474358" "-4.41" "0.17853138" "547172" "CATTGCCGAGCTTTGGAAAATTGAGGAAATCAAGGACGTTCTGCTCATAGCTAGGCAGAA" "16443" "1" "0.160439" "-1.5473185" "-4.41" "-0.15756333" "" "GAGCCCCCCGCTCGTATAAAAGGAAGAGCTAGCATTTGTAAAATTAAGTCCTGTTGACTT" "45313" "1" "0.160458" "-1.547239" "-4.41" "-0.33890564" "68743" "TTATCTATGACACTTTCTACAACTCTGTTCTGAGATCACTGAAAAATACAGTAAGCTACG" "16914" "1" "0.160462" "1.5472214" "-4.41" "0.22203122" "16992" "AGGGGAAAAATAGAAAGCCGTCAGATGACAACTAGGTCCCAGACACAAAGGTGTCTCACC" "2846" "1" "0.160479" "1.5471523" "-4.41" "0.48427808" "11815" "TATCACCCCACAAGTTCACTTAGTTCCTGTTGTATAGTCTGTTGTATGCTTTTCATTTAA" "51565" "1" "0.16048" "1.5471491" "-4.41" "0.20521283" "" "AAGGGTACCAGAGATCAAACGGATGGAAGGAGTGGACCACACTCAGGGAGGTCCCACTTC" "12236" "1" "0.1605" "1.5470628" "-4.41" "0.15228822" "93871" "ACACATTTTACCTTATATATCTGGTTATTTCAATTGACATGGCTTCTACTCCTCGCCCCC" "31186" "1" "0.160583" "1.5467133" "-4.41" "0.84145368" "53314" "TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT" "26884" "1" "0.160612" "-1.5465949" "-4.41" "-0.11577145" "" "" "19368" "1" "0.160617" "-1.5465735" "-4.41" "-0.15402806" "" "" "27422" "1" "0.16063" "-1.5465188" "-4.41" "-0.2465196" "" "CGAGGAGGAGGAGGAGTGATATGTGATTAATATGCATCTGTATGAAATTGTCAATTAATA" "1935" "1" "0.160642" "1.5464661" "-4.41" "0.24842132" "" "" "18164" "1" "0.160651" "-1.5464288" "-4.41" "-0.16322544" "77055" "GAACTTCTTTGCTCCTATATCTTTAAGTCTTCTCTTAGGTCAGGGTAGTCCAACTACTAG" "6684" "1" "0.160658" "-1.5463987" "-4.41" "-0.13627171" "" "AGCCCCACCTGTTTCTCTTTTCAGCAAAAATTCTTAATGTGGAAAAACCTGTGCAAAAAA" "3013" "1" "0.16066" "1.5463929" "-4.41" "0.14385698" "" "TTTTTTCTAGGTTGCAGGGGTGGATCTGATTGGTCTCACCACAATGGTGAGAACATCAGA" "1359" "1" "0.16067" "-1.5463513" "-4.41" "-0.17384837" "" "TTAGAAAATGATAACCAGGTATTCGGTTGTAAAAGCCGGTGTTCCTCTGAGTTCTTAACA" "61215" "1" "0.160681" "1.5463033" "-4.41" "0.24662545" "328795" "GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC" "38540" "1" "0.160682" "-1.5463" "-4.41" "-0.16410736" "66456" "TTCTGGAGACATTTTTGTTGCTGTTGTTTACTGAGCATGTGAAGGGAGGTCTTTCTGCCT" "62055" "1" "0.160689" "1.5462717" "-4.41" "0.20454552" "230098" "CTACCTCCTATGTTCTATAATTTATTTCCCCACTGGATCTTAATAAAGGGTTGTTTTTGC" "8592" "1" "0.160719" "-1.5461463" "-4.41" "-0.20959274" "18667" "GTGTATAAACACATGGCATGTTTAGTTAGGCAATGCTTTTCCATTGTACTTTTTCACACT" "2899" "1" "0.160723" "-1.5461276" "-4.41" "-0.16925185" "66597" "TTACTGGGAACAGATGACAGATGGGTTTTTCATTTTTGGTGAAAGAGTAAAAAATGTTAG" "46766" "1" "0.160731" "-1.5460964" "-4.41" "-0.15925357" "99003" "TCTTCGAGAATGTAGCGTTATTAAACACCACCAGCGGCCTTCAGTTACCCAGTCTATTCA" "43355" "1" "0.160744" "-1.5460399" "-4.41" "-0.11447995" "68572" "CCAGGGCTGCCCCTTCCGTTATCCACCTCATGAATCACTGGCTGCAATAAACATCGAAGC" "57118" "1" "0.16082" "-1.5457213" "-4.41" "-0.17940531" "16177" "TACTTAGATTTCACCGTACTTTCTGATGGTGTTTTTAAAAGGCCAAGTGTTGCAAAAGTT" "463" "1" "0.160822" "1.5457136" "-4.41" "0.76579471" "" "CAGCTCAAAGGTAGAATTCAAGGGATATTAGCTGGCCATAATTATGGTGTTTTCTGCTGA" "46532" "1" "0.160823" "-1.5457076" "-4.41" "-0.15366066" "14958" "CATCTTTGTAATGATGGAGACGTACTTTTTTCTTGATTTGATATTAACCTTCTTACGGGG" "50577" "1" "0.16084" "1.5456375" "-4.41" "0.15444899" "" "TGTGGGAAATTTAATATTTGTGTTCACTCTAGGACACCATCCCATCTACCACAGCCCCCT" "31541" "1" "0.160843" "1.5456241" "-4.41" "0.34889569" "" "AGAAGAAAAAGAAGAAGAAGAAAACGGCTGGTTCCCTATTGGTCACCATGGCATCCCTGA" "58109" "1" "0.160871" "1.5455064" "-4.41" "0.68763137" "15439" "AAGGGTTGGGCTATACTCTGATGGGTTCTAGCCCTGCACTGCTCAGTCAACAATAAAAAA" "34752" "1" "0.160872" "-1.5455028" "-4.41" "-0.15202014" "268741" "ACATACCAGTAAAACGGTCAGACAACTTGCCTAGAATGTCATTGGGCGAGTGCTTTGCTT" "31277" "1" "0.160882" "-1.5454615" "-4.41" "-0.1750987" "72713" "ATAATGGTAAACAGTTCACCACGCTGGACAGAGATAAAGATACGTACACAGGAAACTGCG" "15873" "1" "0.160886" "1.5454436" "-4.41" "0.1653466" "11643" "TTGGGATCACATTTACCAATACATCTGAGCAGTTGCACTGTGAAAATACTGGGTGCCCTC" "1010" "1" "0.160887" "-1.54544" "-4.41" "-0.36044762" "" "AACACGAACATGAGAATTGAGCGTGGCACCCAGAGTGACTCGTCCCTGCAAGACGGTGGA" "49049" "1" "0.160889" "-1.5454321" "-4.41" "-0.39340442" "68525" "GAGCGTGCACAGACAGAAACCTTTTCTATAAAACAGAAGCTGGACAATGACTTAAAGCAG" "34812" "1" "0.160898" "-1.5453939" "-4.41" "-0.37754891" "" "TTAGAGCCGTTCTCATCACAGACCACCTTACAGGACAAGATGTTTCCAAAGGCAGAGAAA" "33177" "1" "0.160904" "1.5453683" "-4.41" "0.2817438" "22271" "TTTCCGCCCCGGAGAAGCCTCTGCAACTCCTGGGCAATAAATCTATTTTTTCATAACACA" "57225" "1" "0.160924" "-1.5452873" "-4.41" "-0.20000706" "20604" "AAGACATTCACATCCTGTTAGCTTTAATATTGTTGTCCTAGCCAGACCTCTGATCCCTCT" "56450" "1" "0.160925" "-1.5452833" "-4.41" "-0.23501359" "207686" "CGGGTGAAAGTGAAGCCACCACTGAATGATCCTAAAAAGAGCATCCCTACATGATGTGTT" "12288" "1" "0.160947" "-1.5451889" "-4.41" "-0.18844077" "11477" "ATTAAGACAGTGGCTCTCTGCGTATCTTTCGCGGGTCTCCTAGACACTCCCCACGGGAAG" "4319" "1" "0.160953" "1.5451653" "-4.41" "0.1977538" "" "" "1127" "1" "0.160963" "-1.5451228" "-4.41" "-0.25953271" "665610" "ACTGTAGGGGCGGCCAGTGTGGCAGAATCCAAGCTTGTCTGTTTGGCTTTTGTGAAAAAA" "43624" "1" "0.160969" "-1.5450962" "-4.41" "-0.17748127" "" "AATTTTCATTTGGAACGAATGTCCTTTAGATGCAGCCAGATGCCTCGCAGAGACAGCGAT" "26401" "1" "0.161" "-1.544967" "-4.41" "-0.13764973" "19822" "GACTCAGCACAGAATTCACTTTAAATGGAGCTGAAGGAGTGGCCCTCCTCTATGTGAAAA" "23174" "1" "0.161002" "-1.5449572" "-4.41" "-0.15657326" "20511" "AACCCAGTTTCCAGCATTCAGACATCAGTAAATATCCTTTGGTTAAAATCCCTATTCCCC" "33143" "1" "0.161028" "1.5448504" "-4.41" "0.17320583" "109212" "TGCTAGATAGTTCTGAGTCTGGAAACTAGGACCAAGGACCTGCAGGAGTCATCCCACAAA" "495" "1" "0.161033" "1.5448305" "-4.41" "0.28424369" "23801" "CATCCTATTGTCTGTCTTTGAGCCCAGTGACTTCAATAAAAGCTAACGTATTTGGCTCTC" "40706" "1" "0.161036" "1.544815" "-4.41" "0.65928991" "16855" "TCCTGGGGAAGGAAGCAGAAAGATCCCCGAGTTCCATCTAAGCTCCTAATAAAATGTTGA" "8545" "1" "0.161047" "-1.5447693" "-4.41" "-0.17884826" "100226" "ACTGGTTTAGTGATGTTAGACTTAGCCTAATTTATGAACAAGAGATCAAACTCTGTGTAG" "31092" "1" "0.161098" "1.5445569" "-4.41" "0.57381007" "24099" "CGTTGAATCTGATCCAAACCAGGAAATATAACAGACAGCCACAACCGAAGTGTGCCATGT" "48745" "1" "0.161148" "1.5443497" "-4.41" "0.13485021" "" "AGTCCTTCAAAAATCCAGCCTAGTAACTCATTGAGGGTCATTACAAGAAGACTTACTTGC" "24511" "1" "0.161159" "1.544301" "-4.41" "0.56491913" "21937" "AGCAATCTTTGTATCAATTATATCACACTAATGGATGAACTGTGTAAGGTAAGGACAAGC" "57496" "1" "0.161167" "-1.5442692" "-4.41" "-0.13187563" "70750" "AGCAGCTTAAGTTACAGTTTCTTCAGGAGCCATGATGACCTGAAGTTCACATTCCATTTC" "25682" "1" "0.161181" "-1.5442084" "-4.41" "-0.13661574" "22722" "TGTCTTAATGGTTACCAAGGCTGATTCCAATGTGGAGTTGGAATTCACCACAGTAGGACT" "53259" "1" "0.161196" "1.5441475" "-4.41" "0.18097804" "" "CCTGTAAATACAGCCAGTTCAGAAATTTCATCTGTAAGTTGTAATGCTAGATACACTAGC" "4049" "1" "0.161197" "1.5441445" "-4.41" "0.26283774" "" "AACTCATCACATAGACTTGGGGTAAATGACACACCTGAAAAGCAAAGCAAGCACACGCTG" "42945" "1" "0.161222" "-1.5440391" "-4.41" "-0.15729632" "75079" "TGGGGAGAAGCCCTATAGCTGTGAGGTCTGCAGCAAGTGTTTCACACGCTCGGCTGTGTT" "29406" "1" "0.161238" "1.5439722" "-4.41" "0.22118672" "21853" "ATTAAAAGACATGTCCTGAACTGAGCTTGGTAGTGTGAGCTAATCCCATCGTGTGGGAGA" "24044" "1" "0.16124" "1.5439631" "-4.41" "0.16446291" "258643" "ATGCAGAAACCAAAATTTCTACAAATAATGAGTGTGGAGAACAGCACTGTGAAGACTGAA" "40756" "1" "0.161248" "-1.5439314" "-4.41" "-0.12766944" "100206" "GACCCATCAGGACCAAGGACAACTCAGATTGGACTCCACAGTTCCCTTAGGTTGCCGCAC" "22092" "1" "0.161261" "-1.5438767" "-4.41" "-0.18881127" "239719" "TAGTGGCAGTATTGTAGCTGATCGGGAAATGTTTGATATCTCAGCAATTTTGCATTTTTG" "31983" "1" "0.161278" "-1.5438052" "-4.41" "-0.15447048" "" "CCAAAAGTTCTCCACACCTGAGAAAACCTGGCTCCCAAAATAAAGAACAGAGTTGTTAAA" "11882" "1" "0.161279" "1.5438" "-4.41" "0.19671742" "100038527" "ATCAACGAGATATACAAGGATATACTTCCTGCCATAAAGGATGATACGGAAAGTGAGTGA" "5221" "1" "0.161287" "-1.5437667" "-4.41" "-0.16693308" "" "" "21846" "1" "0.161297" "-1.5437262" "-4.41" "-0.16533088" "83766" "TCTGATTCCCCTTACGATGAACAGGTAGCTGCACAAATGCCCACTGTGCATTATGAAATG" "25773" "1" "0.161309" "-1.5436749" "-4.41" "-0.11462752" "258300" "GAGGTTCATAATGCCTTCAAGAAAGTTGTTGAGAAAATGAACACTTTGTTGAACTCCTAA" "51667" "1" "0.161316" "-1.543647" "-4.41" "-0.18054636" "226551" "TAGTCTGAGTTTTATTTCTGCAGATTATAACTACATGTAAGAGGGAAGAAAACTAAGCGG" "9293" "1" "0.161338" "1.543555" "-4.41" "0.15257333" "" "TTCTTATTCCGAGGCCCCAATCGAAGGCCCAGAGAGAAGTCCATTTGGCTGCAGGAGGCT" "27758" "1" "0.161343" "-1.5435317" "-4.41" "-0.20972962" "" "CGGCATCTGGGAACAAAAAGTTAGTCGCTAGTCTGTTTTGTGGGAAGGCAGAACATCTTT" "28010" "1" "0.161388" "-1.5433437" "-4.41" "-0.13320814" "66317" "GGGTTGATCATGACATTCCTCAGATTTTTTGGCATACTTAAAGTACAGCATATATTGTAG" "43324" "1" "0.16141" "1.5432519" "-4.41" "0.63894154" "16160" "GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT" "22735" "1" "0.16146" "1.5430439" "-4.41" "0.14744524" "11666" "TAGCCAATTACCTGCATTCCCTGAAGACCCCACTCTGGGACAGGTAGATATGAATGGGGA" "14778" "1" "0.161479" "-1.5429628" "-4.41" "-0.12385087" "" "" "19257" "1" "0.161496" "1.5428917" "-4.41" "0.15141846" "" "CAAAGCAAGTATTGTTCTTAGACTTTGTTAGCCATAACTGCCAGTCAAGATAAATCATAC" "61719" "1" "0.161515" "-1.5428155" "-4.41" "-0.12255389" "" "AGCCACAACCTTGCTTTGTATTTATGCGTTGGGCAAATATGATTACCTGGTAAATGGGAA" "7298" "1" "0.161531" "1.5427459" "-4.41" "0.1613075" "" "GCTCGCATGTCTATAATGTAATAATAACCTCTTGCCCTAATTCAAATATGTACACACGAT" "29308" "1" "0.161533" "1.5427384" "-4.41" "0.20521991" "" "" "39028" "1" "0.161558" "-1.5426352" "-4.41" "-0.21501122" "" "CTTCTGCTTTGATCAATGCCAACTATAGCCTTAAAACATTTTCCTATCAACTGAATCGTA" "35688" "1" "0.161558" "-1.5426345" "-4.41" "-0.17087733" "" "TAAAGCCAGTCTGCATTTCTCGCTACACATCAGAGACTCCCAGCCCAGTGACTCTGCTCT" "4713" "1" "0.161572" "-1.5425763" "-4.41" "-0.18024355" "" "CTGCTGTGCAAGTCTCGCTGGGTTCCTCTGGCTGAGAAACCTCGGTGCTCTGGAACACTA" "51407" "1" "0.161596" "-1.5424775" "-4.41" "-0.15179972" "71638" "GGTGTCTGCGGTAGAGATGATAATAGTAAACCCTACAGATTTGTTGTTTCTATATCCTCC" "37275" "1" "0.161613" "1.5424064" "-4.41" "0.2526248" "192216" "AAATTTTGCAGCAAACAATGTCCATATGTAACAAGCTTATTCTTCTACACCACAAGCCAT" "38497" "1" "0.161613" "-1.5424036" "-4.41" "-0.47988917" "" "GCTTTCTCAGGCTATAGAAGAGGACTCAAAAGTATTTGCTAGTATTCATATTTTCAGTTC" "2400" "1" "0.161631" "-1.542329" "-4.41" "-0.53927618" "" "AGAAACATCAAAGCCCTGCAGCAGCAGCCATTTAGTTCCCAATTGTTCAGAGAGACATAG" "7238" "1" "0.16165" "-1.5422523" "-4.41" "-0.18804382" "69893" "TTTCTGATGGCCTGTGAGAAACCAGGAAAGAAGTCTGTTGAATCCTGTCACAACGTTGGA" "53240" "1" "0.161652" "-1.5422408" "-4.41" "-0.15181846" "" "ATCTACATCCTGTGTCACAGGCCTTCCAAGGAAGCATTTGCCAGTTGTTAGTTTTAGGTG" "45636" "1" "0.16168" "1.5421249" "-4.41" "0.72868045" "" "CCAATGACATTTTTTGTGGAGATAAGATTCAAGTACAGAAAATAAAAGTGCATAGGCCTG" "36024" "1" "0.161688" "-1.542092" "-4.41" "-0.13046696" "22630" "CATTTGCTGCTGTTTAAGTTGACAACTTCCTTCCCAATAAAAATTCACTTACACCTCAAA" "48101" "1" "0.161695" "1.5420612" "-4.41" "0.16355344" "" "GGAGTCGAAAAGAATTTAATAACTGATGACTTAGCAAAAGTCAAGAAGTCCCAGCGATGA" "2127" "1" "0.161699" "-1.5420465" "-4.41" "-0.15128499" "66849" "TTTCTAGAACTCTTGAGATCCAAGTATTGAGATTAAAGATGTGGGCCACCACTGCCTGTC" "58745" "1" "0.161707" "-1.5420134" "-4.41" "-0.18080821" "" "AATGGTGTTGTTGATGAGGAGGACCTCCAGAAGATAGTGCTAGGACTACTGAAGAGTGAT" "61153" "1" "0.161727" "-1.541931" "-4.41" "-0.18462323" "100042226" "GCACAAAAGTGGTACACAGATACACACAGAAGCTAAACACCCATACACATAAAATAAAAA" "41814" "1" "0.16173" "1.5419156" "-4.41" "0.49297649" "" "TTCTTACCGTACTATTTTGTGGAGTCACCAAGGTTCAGACAGAGGAGACATGGAGGGAAT" "33920" "1" "0.161733" "-1.5419034" "-4.41" "-0.22192686" "" "TGAATGGACTCTGGATTTCCCAAGCCTTCTCTTCTCTCCATTGGACACTTTAACTCTGCT" "46799" "1" "0.161734" "-1.5419004" "-4.41" "-0.23902133" "65115" "CTCCTTCCTAGGTTAGGCTGAATAAGCAGCAATGTATCTTTTCTGTACTCAAAATAAATG" "17958" "1" "0.161749" "-1.5418366" "-4.41" "-0.19502633" "381350" "TGACTTCGTGAAGAAGAATGCTTGTACTCTGATTAGAGAGATCGCAAAACATACACCAGA" "34238" "1" "0.161782" "-1.5417003" "-4.41" "-0.15950094" "320538" "AACCTTAACTCAAGTGGAGCTAATAGGACTAGTCTATCTGGGGGAACAGGAAGTGGAACA" "27837" "1" "0.161785" "-1.541687" "-4.41" "-0.50861689" "" "TGTAAGAAGTTTCTTCAACGTGCAAATTGCCTGGTCTGTGGCTGTCAGTACAGCAGTAGA" "16183" "1" "0.161786" "1.5416832" "-4.41" "0.16302413" "100048775" "TACATGCAATGGTTTGGAACACCAACCCGAGATGTGCTGAACCTGTATGCAGACTTCATT" "15708" "1" "0.161803" "-1.5416111" "-4.41" "-0.15852253" "20931" "TCGTAAACTGAGGAAGAAGCAGCTCACCTCCTTGACCAAGAAGTTCAAGAGCTATCATCA" "24242" "1" "0.161837" "1.5414708" "-4.41" "0.5516779" "19124" "GGCAGACTTACTGTAGGCATTCAAAACATCTTACTAAATAAAAGAAGTTGTCTGTAACCA" "35433" "1" "0.161841" "-1.5414542" "-4.41" "-0.13009632" "432839" "TAATGCTAGAGTCCGGCCTACGACAGGCATCGTCACCTGTGAGGGATGTACGATGGGATG" "54010" "1" "0.161841" "1.5414533" "-4.41" "0.13623007" "" "CTGGTTTCACATTTATACCATCTCCGTTTTCCACTCGCGGTGGTGTGCAGAGAATTTCTA" "2871" "1" "0.161842" "-1.5414503" "-4.41" "-0.1635796" "18637" "GAGCTGGAGATGGAATTGAATGAGCACAGCCTGGTGATCGATACACTGAAGGAAGTGGAT" "48243" "1" "0.161844" "-1.5414406" "-4.41" "-0.14545893" "11739" "CCAATGTACTGAGAGGCATGGGTGGTGCTTTTGTATTGGTATTGTATGATGAGATCAAAA" "29049" "1" "0.16185" "1.5414189" "-4.41" "0.16837885" "13649" "GTTGCAAGCCACTCTAACTGTAGCAATGAAACCCTAGTATTTTTGTACTTTGAAATACTT" "1572" "1" "0.161864" "-1.5413604" "-4.41" "-0.30916358" "" "GCAGCTAAGTTTTTCTTCCCAGGCTAAATTATTGGACTTTTTGAACAAGTCCATTATTTG" "50091" "1" "0.161875" "-1.541313" "-4.41" "-0.3469776" "383563" "TGGCTTTCGTCAATAGCAGTGCGAACCCGGTCATCTACCTCCTGTTGGACCGCTCATTCC" "21380" "1" "0.161897" "1.5412212" "-4.41" "0.21697058" "" "CTACCTTAACACATTCAAATGTATTAAAGAGAGGGCCCAGCAGTTATCAGAATGCAGTGC" "14771" "1" "0.161898" "1.5412153" "-4.41" "0.33551904" "" "" "27205" "1" "0.161911" "-1.5411619" "-4.41" "-0.19903726" "" "GAGCATCCTGACTCTACTTTAAAGGCAAAGTAGAAATCAAATTAGTTGCTACAACGAAAA" "36979" "1" "0.161918" "-1.5411326" "-4.41" "-0.14627361" "16785" "ACCTGGCCAGATTGGGATTTTGTGTCCCAGGAACAAAGTTAATGCTAAAAAGTTAATGCC" "15340" "1" "0.161944" "1.5410243" "-4.41" "0.14096578" "" "CCACTTCAGTACTATTACACCTTCTAGTCACGCTTTCTGTAAATATTCACATAATTCCTA" "41951" "1" "0.161959" "-1.5409629" "-4.41" "-0.1655189" "57432" "AGTCAAGGCTTTATCAACCAGCACACGGTGGAACGCAAAGGGAAGCAAGTTTGCAAATAT" "55861" "1" "0.161989" "-1.5408384" "-4.41" "-0.33778511" "140723" "AACTTTTGTCAATGTTATTAACACCTGTGATGTACTTTTCTCTCTCTAAAACACTTCTCT" "13864" "1" "0.161992" "1.5408247" "-4.41" "0.14110232" "" "ATCAGGTAAGCCCCACTGGAGAAACTCAGAGGCCAGGCTTGGGAGAGCCTGGAAGGAGCC" "44581" "1" "0.162005" "-1.5407715" "-4.41" "-0.12768279" "107047" "GGGGATGGGTTAGAAGTGATATTGTAAAACCTCAAAGAAAAGAGGTAGTTATGTTTGTTA" "31951" "1" "0.162007" "-1.5407639" "-4.41" "-0.30538467" "" "" "27593" "1" "0.162035" "1.5406482" "-4.41" "0.23498677" "" "ACAGCCAGAACAGGACTCCATGTGGAAGAACACAAACAAGTGAGATGCACTGGTTATATG" "57136" "1" "0.162062" "-1.5405335" "-4.41" "-0.23883675" "53623" "AAGTTGGTGGAAATCTGGATTCCAAAGGCTATGGTGTGGCAACCCCTAAAGGCTCAGCAT" "43372" "1" "0.162083" "-1.5404476" "-4.41" "-0.16111292" "269470" "AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG" "44365" "1" "0.162099" "1.5403787" "-4.41" "0.17854446" "67141" "AATGAGTTCGTGGAGGTGGCAAAGACATTGAAGAACAACGAAAGCCTCAAAGCCTGTGTT" "51457" "1" "0.162106" "1.5403526" "-4.41" "0.43286706" "67512" "GACGGCCTCAGTCACAAATCACTGCTGTGTTTGGTTCTTTTTCTATAAATGAACTCTCAG" "4337" "1" "0.162149" "1.540172" "-4.41" "0.45409317" "" "TCTCTTTTAACTTTTGTTTTGAAATAGGAGGTCACCGGCCGTGAACTCATGGCTCCTCTG" "59480" "1" "0.16219" "1.5400034" "-4.41" "0.93379557" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "9561" "1" "0.162203" "1.5399469" "-4.41" "0.36633433" "" "TGAGATGCTAAATTCATCCTTCTCCACTCTGAAGATTCAACCTACAGAACCCAAGGACTC" "1828" "1" "0.162213" "-1.5399076" "-4.41" "-0.14296185" "17449" "AGCAAAATATTTTAAATAGTGTGTGCTTTATGATTTGTGAAAGTCTATCATGTTGTTAGT" "39491" "1" "0.162221" "-1.5398735" "-4.41" "-0.2148552" "18775" "ACACTCAGGTGAAGCAGATTTCCTCACTTGGAGCCTACATTGTGGTGGATCTTCTCAGAA" "13138" "1" "0.162221" "1.5398715" "-4.41" "0.28543109" "104027" "GTTAAAGGTAAAGGGATGATGCGATTTTGGAGTGATTAGTAGATTTGCCCACATATCAGG" "29142" "1" "0.162226" "-1.5398497" "-4.41" "-0.20648099" "381286" "ATTTTAATCTAGGTTCTTCTAATCTAGCATGTATCTGTGCCCTGTGTCAAGTGAGCTAGA" "11846" "1" "0.162233" "1.539824" "-4.41" "0.2735333" "29865" "TTTGAAGACTTTGTGGAACTGATGACCCCCAAATTGCTTGCAGAGACAGCAGGGATGATT" "7153" "1" "0.162237" "-1.5398064" "-4.41" "-0.32284476" "114602" "AGCACTGGGAGAAGCACGGAAAGACATGTGTTCTAGCAGCCCAAGGTGACAGAGCCAAGT" "45971" "1" "0.162238" "1.539802" "-4.41" "0.13287743" "" "AGGATTGCTTAAATCCAAGAGTTCAAGACCAGGCTAGGCAATTTAGTCAGACTTCATATC" "60143" "1" "0.162252" "-1.5397438" "-4.41" "-0.12886858" "67864" "GGTATAGATTTGGACTGTGTGTGTGTGCTCTTAAGAAAACAGTTTTGAATGTCTAAACAT" "32211" "1" "0.162256" "1.539727" "-4.41" "0.12932041" "" "CAGTAATATAGGGTGGTTGCAGCAGAAACCAGGGAAATCATTTAAGGGCCTGATCTATCA" "21144" "1" "0.162268" "-1.5396787" "-4.41" "-0.15121828" "319470" "ATAGTGGTTCAGAATGTGATTGTAGCGATTTTGATAAAATATAGCAGTGAAATAAAGGTT" "60318" "1" "0.162268" "-1.5396751" "-4.41" "-0.21825758" "66757" "GAAATCCTGATTCTGTAATGATCAACGTCTAGTACAGTTTGGAGACCTGGACAGAATTCC" "20971" "1" "0.162273" "1.5396571" "-4.41" "0.51179756" "213439" "CTTTTGGGTTAACTTCCAAGATACTGTGAAATGTTGTTACTGAAGTTTATTTGCAGCTCT" "13980" "1" "0.162284" "1.5396118" "-4.41" "0.49481509" "18782" "TACACCTGCAAGGTCATTTGCTGCTGTTTTTCTGTCTGAGTCAGAAAATAGCCACTTTAA" "57816" "1" "0.162295" "1.5395632" "-4.41" "0.24402135" "12981" "TCTGAAAACGCTGACTCAGCTTGGACAGCGGCAAGACAAACGAGAGATATTTTCTACTGA" "52499" "1" "0.162311" "1.5394983" "-4.41" "0.36600001" "12822" "GACAATGTGTGCTATGATGCCATTTCAAAGAGGCACCAAATAAAAATGACATTTTATACC" "28363" "1" "0.162379" "-1.5392157" "-4.41" "-0.13059717" "" "AGTTCAGAGTAGAGGTGCCAGAATGGAGTTATAGAAATGCTACCCAAGGGGTAGGATTTG" "33596" "1" "0.162394" "-1.5391528" "-4.41" "-0.20911339" "" "CATCTTGGATCTCTCACAGTTTTCTACCCCTGGCTTTTTTGCTTGCTATGTTTCTTACAG" "40489" "1" "0.162401" "1.5391231" "-4.41" "0.34446294" "" "CCTGCTGCAAAGAAATGGCTCGCTAGAGCATCAGAGCACGCAGCCGTGAAGTTATCTTCT" "60148" "1" "0.162402" "-1.539121" "-4.41" "-0.25667424" "26950" "AGAGCTGTTTTGGATGAATGCAGTATACAACTTAAAAATCCTGCTCAACTACTCATTAAG" "46825" "1" "0.162411" "-1.5390841" "-4.41" "-0.17037722" "15405" "TAAAAAGAGAGCAAGCTAGAAAGAAAAAGAAAGGACTGTCCGTCTCCCTCTGTCTCCTCT" "46729" "1" "0.162431" "1.5389986" "-4.41" "0.1800171" "18416" "ACACCGCTCGTGTCTTATCTAGCATGACAGATGCAGTGTTAGCTCGAGTGTATAAACAAT" "48234" "1" "0.162437" "-1.5389747" "-4.41" "-0.2061357" "" "" "39525" "1" "0.162441" "1.5389579" "-4.41" "0.16415801" "244885" "AACTAAAGGAAGAGGTGGATGAACGTGAAGAGGCCTGGGCTGACTGACCAAGCTCGCCTC" "1739" "1" "0.16245" "1.538921" "-4.41" "0.20253344" "" "" "56261" "1" "0.162481" "-1.5387914" "-4.41" "-0.1662533" "" "TTAATCAACAACTCTGTAACGTGAGCTCCAGCCTATAAAAGGGGAACCTTCCGGAGTCTT" "11965" "1" "0.162486" "-1.5387694" "-4.41" "-0.15873434" "16846" "AGTTTGGATCTTGGGTTTTCTGTTAAGAGATGGTTAGCTTATACCTAAAACCATAATGGC" "39924" "1" "0.162496" "1.5387299" "-4.41" "0.16406056" "70497" "CTTCAGACTTGCTGCAGAATCATTTTGTATTAAATAGTCTGTCTCCTCCAACCCCCAGAA" "26231" "1" "0.162502" "-1.538706" "-4.41" "-0.28506352" "" "AATGGCATCCACTCTAACATCTCCGTGTCTTACCTGGAGGGTTGCTACCCTCGGTGCCCT" "30292" "1" "0.162503" "1.5387008" "-4.41" "0.19320316" "" "GCAAGCTCTTCTGGCCGTTCAGCCATCTCACTGGCCCTGTGGAAATCTTTTGAAGAAGAT" "54066" "1" "0.162512" "-1.5386642" "-4.41" "-0.15735144" "" "AGAATATATTGCAAACTTATTCCCATCTTTCGCTCTGCCTGCATTAGCAGCGCGTGGCTT" "37636" "1" "0.162522" "1.5386221" "-4.41" "0.37788043" "100042150" "CCTACTGTGTGAATGGAGGCGTGTGCTACTACATCGAGGGCATCAACCAGCTCTCCTGCA" "29003" "1" "0.162526" "-1.5386053" "-4.41" "-0.19180358" "" "" "9373" "1" "0.16253" "-1.5385892" "-4.41" "-0.15406167" "" "TGTATGTGGAATCTCAGAAAGACAGAGTCACAGTAGTCTTCAGCACAGTTTTTAAAGTTC" "51445" "1" "0.162558" "-1.5384722" "-4.41" "-0.23429963" "258551" "ACCCTGAGGAATAGAGATATCAGTAATGCCCTGAAGAGATTCCACAGTAGGTTTTCCTAA" "60858" "1" "0.162597" "-1.5383101" "-4.41" "-0.12615483" "237082" "GTATGACTTTAAATGGCTGGAACTGCTCATATGTGGACTAAACTATTTTTGACATGTTCA" "9849" "1" "0.162623" "-1.5382045" "-4.41" "-0.15673462" "224090" "ACACTGCAAGCCCCTGAGGACAATGACAGCCATCAGTCGCTACATGGAGCTGACCATTGA" "27573" "1" "0.16263" "1.5381739" "-4.41" "0.25592507" "218442" "TGGAGTTTGAATGCAATCTGTGTGGTAAGTCTACTGTTTGTTTATAAAGGTCTCTGACAT" "86" "1" "0.162642" "-1.5381237" "-4.41" "-0.15357842" "258406" "GAGATGCAGGCAGCACTGAAGAGACTAGGGATGCATCTGCTAGTTTGTAGAAAAGAGTGA" "33370" "1" "0.162679" "-1.5379719" "-4.41" "-0.17393688" "114741" "CAAATTACCATTGTCTCTTCTGATACATCTAAGGAAGAATGGTCATGCTTCGTATACTAC" "8286" "1" "0.162711" "1.5378387" "-4.41" "0.20095686" "545732" "TTATTACACTCAGTACATTTACACGGTGTGAATGGGAGGAAGCCAGTGAGCCAGCTGATT" "1544" "1" "0.162713" "1.5378274" "-4.41" "0.46955514" "" "TAGTTGGGCTCTCCTTTGCAGGCTCTTCCAAGAGACCGCTTACTTCCGGTGTTAGCCTCC" "5513" "1" "0.162716" "-1.5378161" "-4.41" "-0.28948288" "" "GCACAGTAAAACTTTGGGGAAAGGTGTCCATGTGACAGTCACAATAAAGATTTAGACTCC" "1043" "1" "0.162721" "-1.5377978" "-4.41" "-0.44696477" "" "AGTTGAAACATTCCATCTGACGGACCTCAACTTTTCCTGAACAGAGCATCTCAGAGCTGT" "58727" "1" "0.162746" "1.5376943" "-4.41" "0.17720163" "67541" "CTCATCACAAGCAGCATGGCTAATAAAATGTGGCATTTGTATGGTAAAATGCTAAAACAA" "46748" "1" "0.162747" "-1.5376881" "-4.41" "-0.19004672" "" "ATTCCAGTTTTAGATGCTCCACATCAAAAACAAGAGTGGCATGTGGTGGGATGATGCCTG" "53975" "1" "0.16277" "-1.5375931" "-4.41" "-0.13676906" "240880" "TCATAGGGCTTTCGAACACAACTGACTTAAATTGAACTTTATATATATTCAGGCCTACAG" "10532" "1" "0.162788" "1.5375166" "-4.41" "0.19764801" "" "CGAGACTACAGTTTATCATCTCTGGACTTAATTACGATTGGGAAGATGTTCTGTATAAAA" "32459" "1" "0.162801" "-1.5374635" "-4.41" "-0.19710928" "66368" "GAAGAAATCAGAAGAGGAAGAGGATGCCACTAAGGACACTTACATCATCGAGTGTGAAGG" "32442" "1" "0.162803" "-1.537457" "-4.41" "-0.18198586" "" "TTTGGAATGGTGAATTTCTTCCCAGCACTGGCTTCTGCGTCCATATTCCACAGAGATTCA" "54621" "1" "0.162823" "-1.5373724" "-4.41" "-0.31057785" "" "CAACCTGGAGTCTGAAGATTTTGCAGACTATTACTGTCTACAGTTTTATGAGTTTCCTCC" "60112" "1" "0.162832" "-1.5373362" "-4.41" "-0.30126064" "" "CTGAAAAGACCAAGTGCAACAAGTAGAAAATTACAGACTTTCATTTCCTGGGAAATCATA" "54675" "1" "0.162833" "1.5373302" "-4.41" "0.48067917" "12977" "TGTGGGGCTTACTTAGCCTTCTGGTTACAGACTATTTCCATGCTAGAAAATACATATTTT" "51538" "1" "0.162835" "1.5373247" "-4.41" "0.19274449" "68303" "CAACGGACTTCTATGTCACTGGCCAGACCATTTGAGGACACTACAAGCAATTTTTGCACA" "23260" "1" "0.162844" "-1.5372876" "-4.41" "-0.14072357" "" "CTACAAGAGCTGGAGAGCATCTTCCAGTGCAATCACTACATCAGCACTAAGGAGGCGTGA" "31880" "1" "0.162859" "-1.5372248" "-4.41" "-0.12919103" "109229" "GCTCTTGTTGCAGTTTTGTACTCCACTTGGTTTTTCAATTGAGCTTATGGCTTTTTTAAA" "41994" "1" "0.162889" "-1.5371008" "-4.41" "-0.17109282" "16569" "GTCCACACCTCCTGTTTACATAGACTAGTTTGGTTTATAAGTTTTAGTTCTTCATGTTAC" "35814" "1" "0.162922" "-1.5369643" "-4.42" "-0.14757087" "" "CTTCCACTCGGATTTACTGTAACATTTGGAAAAGGAATAAATGTTGTCCCTTTAAGAAGA" "14570" "1" "0.162937" "-1.5369016" "-4.42" "-0.151474" "14260" "TGGCTGGTGTCTGAGGAAGCTTCCGAAAAAGGCTTGGGGCCAGAGAAGATCACAGCTCCA" "12565" "1" "0.162945" "1.5368686" "-4.42" "0.20156274" "215418" "GTGGCTCTTGAGAGCTCTTACGCCCTTCATTAGCTGATGTTGGATTTTATATGCATTTTT" "14616" "1" "0.162964" "-1.5367904" "-4.42" "-0.14750664" "" "AGTAAAATGAGAGCCTGCCAACCTACCCAAAGGTTGGTAGGAACTTTGTTACCTAGACCA" "22377" "1" "0.162968" "-1.5367733" "-4.42" "-0.14045786" "77305" "TCTGATATGACAGCTGGCACTGCACTGTTCAACCACCAGCCACTGGGGTATTTTTTAATA" "49876" "1" "0.163067" "-1.5363615" "-4.42" "-0.37181269" "76386" "TTCATCAGTTCCAGTCCAAATGTAGCAAGAAGATTAGAAGGCCCAAGGTGCCTACCATGA" "30391" "1" "0.163094" "1.536249" "-4.42" "1.07103016" "" "" "40608" "1" "0.163101" "-1.5362204" "-4.42" "-0.14328083" "620949" "TGAAGAACAAGGACTTTCAATATGATGAGGACTTGGAGACCTATTTCTGTCCCTGCCCCT" "25399" "1" "0.163139" "1.5360645" "-4.42" "0.16185346" "14198" "CTTTTGGAGATCTGAGAAGGAGATGGCTGCAGAGGCGGAGGCTCTGCGGGTCTACTTTCA" "58575" "1" "0.163145" "-1.5360413" "-4.42" "-0.1436524" "" "AGGTTCTGAGAGTTCTACATCTAGATCCACAGACAGCAGAAAGAGACAGACACTAGGCTT" "44387" "1" "0.163151" "-1.5360136" "-4.42" "-0.1401577" "" "GGGGGGGGAGGGTACAGTGAGAGTCAGGATGAGAAACATGAGGCACCTAACCAGAGGCAG" "16113" "1" "0.163161" "-1.5359754" "-4.42" "-0.13837432" "17448" "TAGTTTGCGTTGATGGAGGGTGTTGAGTCAGCATCAGCATCTCTTCCAAATTATGTCTGG" "8833" "1" "0.163166" "1.5359525" "-4.42" "0.25910042" "321007" "GCCCGAACTGAATGCTCTTATAAACAATACCAGAGGAATTATTTTTTACAGTGTCCCTCA" "43760" "1" "0.163173" "-1.5359261" "-4.42" "-0.17279857" "258607" "GAACCCACTCATCTACAGTCTGAGAAATAAGGATGTCAAATCTTCCATAAAGAAAATTCT" "4158" "1" "0.163185" "1.5358755" "-4.42" "0.20204933" "215449" "CGACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTAT" "27253" "1" "0.16319" "1.5358543" "-4.42" "0.38472543" "" "TAGAGCTAGCCGCGTGCCGGGGCATCACCTTAGGTTCACTGGTAACTGAAGAGTGTCCTA" "27239" "1" "0.16322" "-1.5357297" "-4.42" "-0.34887598" "68588" "GCCCTTGAATGGTTCATTTAAATGACATTTAAGAAATCACTTAAATGAAGTGCTCAGCTG" "43864" "1" "0.163224" "-1.5357127" "-4.42" "-0.15823816" "" "" "51205" "1" "0.163237" "1.5356583" "-4.42" "0.29649067" "193286" "TTATTTTCTGAAAAACCTGGGACTGTGAAACCTTGTGGGTGTGGGCATCTTTCTCTACCC" "3267" "1" "0.163254" "1.5355904" "-4.42" "0.44908642" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "26956" "1" "0.163259" "-1.5355669" "-4.42" "-0.17130464" "171210" "GGGGAAACCTCATATATATTATCACAATGTCAGTTCAGGTTAGTTCATTTGAACATATTC" "51932" "1" "0.163263" "1.5355509" "-4.42" "0.2712983" "18351" "GTGGATTGGTATTTATGACTCCATTTACATGCATTATTGTTTCCTATGCCTACATCTTCT" "34394" "1" "0.163274" "1.5355084" "-4.42" "0.1909012" "71776" "TTAGCCTGGTGAAGGCTCATCCTCTCTGGAGGATGGTGACATCATTCCGTCTCTGGTTTG" "15501" "1" "0.163298" "-1.5354092" "-4.42" "-0.21563424" "13638" "AAGAGGCAAATATGCCCCAGAGAGAACAAACGAAGCATGGGAGGTGCCCCCTGTCCTCTC" "38419" "1" "0.163335" "-1.5352557" "-4.42" "-0.24402677" "102747" "TGGTAAGATGCAGGTTAGACATGATGAGACACCACCACTACCGCACAGTTTAGAAAGAGT" "57174" "1" "0.163335" "-1.5352524" "-4.42" "-0.1508242" "" "" "35417" "1" "0.163395" "-1.5350051" "-4.42" "-0.18786905" "246735" "ATAGACAAATCAAATCGTTTACTCTTCCAGTCTTGCCCCTTAACAGTTTTTCCTTTGTTC" "7783" "1" "0.163407" "1.5349584" "-4.42" "0.31612696" "" "ACAGAAGACAGAACTTCAAGCCCGGCTAGCCATGTTGTGGAGCAACATGCCCAAGTTTTA" "23445" "1" "0.16342" "-1.5349039" "-4.42" "-0.12746801" "240283" "CTCTGTATGTGGTATAACTTTTATGTTATTAGAGAAAGTCAAACTGAATAACAGGGCAGC" "44969" "1" "0.163424" "1.5348863" "-4.42" "1.31641301" "69816" "TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA" "46633" "1" "0.163447" "-1.5347925" "-4.42" "-0.16969731" "212772" "GTGGTCAGAAAGGTACCTGTTAAATGTTACTAACGAAACAAATGCTCTTCAGACTACTTT" "24319" "1" "0.163462" "-1.5347292" "-4.42" "-0.16861788" "" "TTTCTCACCACTCTGAGTTTGACGACAACTGCACATTGCTGGTGTCCTTTGATGAAACCT" "53663" "1" "0.163493" "-1.5346003" "-4.42" "-0.17886927" "" "ACAGCAGTACAGCAGCAGTACAACCATACAGATAACCAGTGTCACTTTTACTACCAGCCT" "2868" "1" "0.163506" "1.5345493" "-4.42" "0.18252509" "18127" "GATCAGCAACGCTACCACGAGGACATTTTCGGACTCACATTGCGCACCCAGGAGGTGACA" "5224" "1" "0.163514" "1.5345168" "-4.42" "0.19370457" "70484" "AATGCCTGCTTCATGCTCATCCCAACTGTCATTATTAGCGTCTCTACTGGAGACTTTCAG" "31408" "1" "0.163523" "-1.5344759" "-4.42" "-0.24858276" "" "TGTTATATAAGTGAGGGTATGTTCGCATCTCTTGATGACAGGGCAAAAGCTCTACATAGT" "43202" "1" "0.163545" "-1.5343862" "-4.42" "-0.23580466" "93877" "TCAGCGGTATGGGGACATTGTCCCAGAGCTACCAGTATGAGGTGTGTCTGAGCGGAGACT" "60539" "1" "0.163559" "-1.5343282" "-4.42" "-0.13872664" "" "ATTTATGGCTGGTTCTTCAGTGCAACGGTGAATTGGCTTTGGCCCATGATTGAATGGAAG" "19901" "1" "0.163598" "1.5341681" "-4.42" "0.89888579" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "6651" "1" "0.163604" "1.5341416" "-4.42" "0.74376247" "230073" "GTTGAAATTAAAATCTTTCACCATGCCTGGCTCTAGCTATTTTCAATAAAGGCTCATGTT" "25277" "1" "0.163606" "1.5341347" "-4.42" "0.50860088" "231252" "TGTCATGACCGTCTTGATCATAGCAAGAGCAGATTAGAAAGAAAGAGGAGGAGTGGGTTG" "14504" "1" "0.163608" "-1.5341267" "-4.42" "-0.26915344" "67897" "CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT" "5000" "1" "0.163615" "1.534097" "-4.42" "0.16653598" "" "ACCCAGACAGCAGAGGAGTACCAGAAGAGCCTGGGATGTGGCTCAGGATGAGAAAACCCA" "13139" "1" "0.163623" "-1.5340668" "-4.42" "-0.19745851" "" "CTGATTTGTATGAGTACTTCCCCTTTGAATAGTTTGTACAGGTGGATTTCTGCATAATTT" "12904" "1" "0.163626" "1.5340514" "-4.42" "0.86062796" "20128" "CATATTGCTTCTAGCAGATAGAAGGTATCAGATACTGTATCTGTTAAGTTTTTTCTACCC" "6463" "1" "0.163645" "1.5339731" "-4.42" "0.78302462" "229320" "GGACCTATGCCTACAGAACACAAAACGAAAACTATACCACCTCATTCTGGGTTGTTTTCA" "9716" "1" "0.163693" "-1.5337781" "-4.42" "-0.34448935" "" "AAAGCTATATATGATACAGCCTGCTGCATGCTAAGGCTCTGTGTTCTAGCCTGCTACACA" "15846" "1" "0.163718" "-1.5336723" "-4.42" "-0.16593786" "" "GAGCTGATCGGGAGAATACAGCGTGAGGTTCAGAGAAAATCTGAGGAGCCCACCAACCAG" "26727" "1" "0.16372" "-1.5336652" "-4.42" "-0.11793194" "51797" "CAATGGGCATGACCATGTGCCTACAGTATGGTGGTTAGCTTGATGCATATCTAACTTAAT" "25165" "1" "0.163721" "1.533661" "-4.42" "0.4939902" "667635" "TTTGTCTTATGGCAATACCTCATTCTGAACACATAATGCTCTAAGCTTCGTGACTCTTCT" "31724" "1" "0.163728" "1.5336338" "-4.42" "0.20268089" "" "ACCTATTATGTCTTACTGAGGTAGCTGGGGGCTCAAAAAGACCCACCTACAGTTCTCATA" "29187" "1" "0.163728" "-1.5336307" "-4.42" "-0.29463592" "16508" "AAATATACTGTGTTGGTGGTGAATGACTTTTGATGACGGTGTTAAGTGCAACTGTACTGT" "20128" "1" "0.163747" "1.5335551" "-4.42" "0.62133415" "27027" "GGATTACCCACACTCCTTATAAGTAACTCCTCTCCCTAATAAACCCATTGATTCTAATTG" "31813" "1" "0.163747" "-1.5335548" "-4.42" "-0.1636637" "74443" "AACGTCAAAGACCCTGCAGGTCCTCTGTCCTACTGCAGACTGAAGTTCTGGCCGACCTCT" "55934" "1" "0.163748" "-1.5335479" "-4.42" "-0.15395244" "" "TGGCAATATTGAGTTTTGGAGTTGATGAGCTACATCTGACTTTGCTAGTTTAGTCGTTCT" "60836" "1" "0.163754" "1.5335252" "-4.42" "0.40403998" "228911" "CATGACTGTACATCTTACCTTATTGAATGGAAAGCTATTTTGCATCTGTTGAGCCCAATG" "35610" "1" "0.163755" "-1.5335188" "-4.42" "-0.13213045" "12995" "ATCTTCCGGAAGGAGCCATTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATA" "35504" "1" "0.163764" "-1.5334823" "-4.42" "-0.20020875" "" "ACACAAATGACCTGCCCTATTGGAACTCAGGCAGGCACCTCCCCAGGAAGTACCAGGATC" "59019" "1" "0.163844" "-1.5331525" "-4.42" "-0.14741839" "100043332" "TCAAAACAGCAACAAAAAGAAGAAGAGAATCCGAGGTTCCACCCGGTTTAACCATGCCCA" "29736" "1" "0.163851" "-1.5331228" "-4.42" "-0.2661721" "" "TGAAAGTCCATGCCTGGAACCTGTTGAACAAATGTATGAGAACCGTCAAGATTCTTCCCG" "5019" "1" "0.163858" "-1.5330953" "-4.42" "-0.19989335" "22411" "GAAACTGATAGGATTAAAAATAACCTGGCAGCCTGGGGCCTGAGTGCCACATGTTGCCTT" "34385" "1" "0.163921" "-1.5328371" "-4.42" "-0.20254026" "" "TGGGTCTGATGCAATACTGGTGCCAGCATCGTTGTCACTGTCAGATGCCATGGCGAATGG" "5216" "1" "0.163925" "1.5328201" "-4.42" "0.18768334" "" "TAAATAATTCCTTAGCATGAGGCTGCAGCCCTGGTTTCATCCCCAGAATAGTGTTCCCTT" "54018" "1" "0.163949" "-1.5327228" "-4.42" "-0.13784354" "" "AAAGGTCCTAGAAGTAGCACTGAGCCCTCTAAGTTACTAATGAGAACCATGGTGGGCAAA" "36029" "1" "0.163961" "-1.5326704" "-4.42" "-0.21394987" "" "AATTATGCCCAGAAGTGTGGACATCAGGGAAAGATTGCCTCAAGCTCCTCTCATTAAACA" "8779" "1" "0.163962" "1.5326678" "-4.42" "0.16080614" "" "TCTGTTTTTTAGCGCGTTGGAAATAGTCAATAGGTATTAGAGGAAATCATCCCCCAAAAC" "46864" "1" "0.163982" "-1.5325842" "-4.42" "-0.42864609" "" "CCAGCTGGAAATGGCAGTATATACCTGAAATCCTAACACTCAATTAAAAAGTTAACAACT" "6357" "1" "0.164012" "1.5324606" "-4.42" "0.17962207" "18550" "AATGGACACGAGATAATGTTAGAGGTTTTAAAGTGATTAAACGTGCAGACTATGCAAACC" "56507" "1" "0.164016" "-1.5324451" "-4.42" "-0.12936335" "" "TTCAAAGATAGAAGGGAGTTTTCAGAAAGCTACAATAGTGGAGTCGCTCGACAGGAGCAG" "16048" "1" "0.164026" "-1.5324027" "-4.42" "-0.2143408" "217692" "GAGTTTTGCAACCGAGTTCTTGTTTGAAGTCTCTGAAGACTACTTGTAAAATTCAAACAA" "7627" "1" "0.164029" "-1.5323921" "-4.42" "-0.18434055" "72125" "TCTATCTCTAGGAAGAAAACAGAGGTTTAGTATGGCTGGCTCAGATCGTTGGTCTGAGGA" "62299" "1" "0.164059" "1.5322674" "-4.42" "0.410764" "20377" "TTAAAATAGTCATTCCGGAGAGTCAGGGAAAGCTAAACCCACCAAACTTTTGGGAACTAT" "1380" "1" "0.164074" "1.5322068" "-4.42" "0.39911347" "245386" "CTACTCTTCCGGCACTGAACTGCTCTGTTGAAAATGCCCATCCAACTGTTTCTTACTATG" "49274" "1" "0.164075" "-1.5322018" "-4.42" "-0.16211695" "380705" "AACTTCCTGGTTCTTCGTTAAGTTGGCTGAGGTTGCTGAGTCCCTGATCCCGGTCCCAGG" "30697" "1" "0.164089" "-1.5321457" "-4.42" "-0.31081736" "" "AAAGCAATACTGCCACCAGAAGACTAAAAAGAAAAGTAACCACTAACAACTCCAACTAAT" "20654" "1" "0.16409" "1.5321406" "-4.42" "0.31577946" "" "GCCCCACCTCAAGAAAACAAGGACTTTTTGTGTTAGATGGATATTCGTCACCCTCTTAGG" "5463" "1" "0.164144" "1.5319195" "-4.42" "1.04975721" "117586" "CCAGAGATGCTATCCTGTACTATGTGAACTTGAAGGAACTGGATAACCCAGGTCCTTTCA" "6960" "1" "0.164144" "-1.5319168" "-4.42" "-0.13527768" "68732" "CAAAAAAGTCTCCTCGGACAAGGAGCGTGACGGCCAGAACAGCTCACAGTCCAGTCCTAG" "56287" "1" "0.164149" "1.5318978" "-4.42" "0.12928064" "233913" "CAGTCCCGTGTTTCACCCCAAGTTTTAGGTCTACACCGAGAATCATAGTTCTTCAGTTCT" "4806" "1" "0.164149" "1.5318959" "-4.42" "0.43210853" "" "GTAAGACAACGTCAAAGCAACATTCGTCCTGAAAATTTTCCCTTGTGAATTCAAATGAAC" "30154" "1" "0.164155" "-1.5318734" "-4.42" "-0.13770373" "72117" "CGAACATTCAGTGAACTCATTTACTGTCCTCAACAATTCAAGACATATGAGTTAAGTATG" "19150" "1" "0.164169" "-1.531815" "-4.42" "-0.11346376" "" "TAATAACACCCATGTCTCCTACTTATATATAGTCCTCTCAGAACCTGCTGGATCCTGGGC" "7744" "1" "0.164174" "-1.5317947" "-4.42" "-0.1597855" "234678" "AATTAACTCATGTACAGCCTCATCTTGTATAGTTCATGATGAATGTGCAGGGGACCTGCC" "26754" "1" "0.164197" "1.5317005" "-4.42" "0.57763525" "20344" "ATGCCTGCTTTAAGATCTCCTGGGTCTTCCATGTTTCATATCAATGAGGTTGTTTACACC" "19787" "1" "0.164199" "-1.5316916" "-4.42" "-0.17706696" "227867" "GAGTATAGTGTAGAATTATATTGCAAGGGGGTTTTGGAAGTCCTGGGAAATGTAAATATT" "37560" "1" "0.164249" "-1.5314863" "-4.42" "-0.17922241" "" "TCAGGATTCAGAAGGGAAGGGTGCAGCCACAAAGACTGAGAGTTGCAGAAGCCCAGTGAT" "458" "1" "0.164252" "1.5314752" "-4.42" "0.19589301" "" "AACGCAACATGCGATTCTTCTCAACAGCTTTATTTCTGGAACGCCTTGATGCTACGGGAA" "62532" "1" "0.164254" "-1.5314656" "-4.42" "-0.38281205" "74665" "TGAAAGAAATATCACTGACTTGGTGGGACTATTTATTGAAAATGTCCAAAGTCTGATTGC" "37036" "1" "0.164312" "-1.5312282" "-4.42" "-0.17179823" "" "TCTATCTCAGATTAAGATCTGAGTATCGAGAAAGTGAAGTGTGCAGAGGCCAGCACAGTC" "56362" "1" "0.164331" "1.53115" "-4.42" "0.70352666" "11576" "GTGAGCCTTTTGGCTTAACTGTAACTGCTAGTACTTTAACCACATGGTGAAGATGTCCAT" "45537" "1" "0.16436" "-1.5310305" "-4.42" "-0.18307123" "" "CTGCAATTTATCTAAAGAAATGTTAGTGTGTATAGTTAAGGGGAAACATAAAGGGGCGAA" "13857" "1" "0.164364" "-1.5310147" "-4.42" "-0.19898883" "21771" "CTTTTGGATGAAAGGACACTTGTGGCAGTAGAGCGACCCCTGGACGACATCATTGCTCAA" "38208" "1" "0.164376" "-1.5309657" "-4.42" "-0.17220177" "" "AATGATGCCACATCAAGTTGGCTCAATAAAGATGCGCTTTGTGCATTTGCTTGCTTCAGA" "31185" "1" "0.16439" "-1.530908" "-4.42" "-0.20019072" "213575" "TGATGTTTACCAGCAAGTCAGAAGCTCTGTTACTGAAGATACGCGGTGTTATCAACCAGT" "62973" "1" "0.164398" "1.5308731" "-4.42" "0.14543849" "" "" "16509" "1" "0.164405" "1.5308444" "-4.42" "0.7285128" "104759" "TGCATGTGCGCTTACTGGTCAGCTGCTGGTTCAACACAGACCCCACCATGTTCGCTTATC" "25310" "1" "0.164409" "-1.5308296" "-4.42" "-0.12159924" "" "CGCTTGGATTCACAGGTCTATTCCCAGAGCACTTGGTGAGCGGGCATTTTTAGCCCTGCT" "30680" "1" "0.164427" "-1.5307535" "-4.42" "-0.1247236" "" "" "33133" "1" "0.164428" "-1.5307506" "-4.42" "-0.21922732" "110876" "ACACACGGAAAGGGTATACTTCTCATTTCAGGATGTTTTTAGATTTTTTGAGGTGCTTAA" "1814" "1" "0.164451" "1.5306559" "-4.42" "0.17714865" "71890" "ACTGTGCCATGCGTTATTGTTAATAAAGTGGCCCCAAGGGCTGACTACCTTGTCATTAAC" "42596" "1" "0.164465" "-1.5305999" "-4.42" "-0.21028233" "433938" "CCGTATTCACGCATACTGTATATACGTGTATATGTTTTGCTGAGCAGCTTAAATAACAAT" "11906" "1" "0.164466" "1.5305961" "-4.42" "1.00774166" "" "AGCCTGGAGCCTGAAGATTTTGCAATGTATTACTGTCAACAGCATAATGAATACCCGTAC" "13263" "1" "0.16447" "-1.5305775" "-4.42" "-0.16066181" "74718" "GAGAGAATTTCTTTGTCTGGATGATCCACCAGGTCCATTTGATAGCCTAGAAGAAAGCAG" "28914" "1" "0.164472" "-1.5305712" "-4.42" "-0.1380124" "" "CCGCCTCTTGTCTAACTTTTTCTTGGCTGTCAGCTTGTTACCTCGCTTCCTTGCATGTTT" "42275" "1" "0.164489" "-1.5304988" "-4.42" "-0.13749761" "320661" "ATTTATTCACGGTATATCCTCAGTCTTCTGCTGCATGACAGCTATGACTACGACCTGCAG" "25176" "1" "0.164491" "1.5304932" "-4.42" "0.45174231" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "58653" "1" "0.164511" "1.5304101" "-4.42" "0.43565586" "434484" "ATGAAAAGAGTTGACTAAAATCAGAGACATGGCTGGTGTCACCTGGCCATGTCTGTCTCA" "40385" "1" "0.16459" "1.5300843" "-4.42" "0.14261438" "" "GTTGGCACCCCAAACCGCAAAGTCACACTGACAAAAACCCCAGCAGAGATGACCTATTAG" "41509" "1" "0.164592" "-1.5300765" "-4.42" "-0.19804679" "" "CCATTCTCTCGTCTCTCCTGGGTCACTCCTTGTCCTTGATTTGGAAAGAAAAATAGGAAC" "52662" "1" "0.164606" "-1.5300204" "-4.42" "-0.16829072" "" "ATTTGGAGTCTGTTGTCTCTGGGGGTCCATGCATTTTCTGCAAAAGTAATGATGACAGTG" "58316" "1" "0.164606" "1.5300197" "-4.42" "0.13530069" "113862" "ATAAGTTCAGATAAGAGAGTAATCAATGTGATGAAAACCTTGCAGTCAAAATGCCACTAG" "1419" "1" "0.16462" "1.5299606" "-4.42" "1.08345102" "12655" "TGAACATCTTTTGCTTCCTGTAAAACCACCATGCTTGTTTCTTGCTCTCACAATAAATTC" "19408" "1" "0.164624" "-1.5299455" "-4.42" "-0.17410712" "22232" "GGGCTGTCTTTGCTATATGTAAATAGGGCCACTGGATCTTTATTTTTGATTAATTTGTTC" "24160" "1" "0.164656" "-1.5298154" "-4.42" "-0.19340389" "404315" "GCTACCACAGCCCAAAACAGGATAACGTTGTATCCCTTTTCTATAGCCTCATCACCCCTA" "24379" "1" "0.164658" "-1.529808" "-4.42" "-0.16980613" "52665" "ACAGCTCTCAACTATCAACACCCCAGTTCCTCACATTAAATAAATTTCAGCAGAGACATG" "35500" "1" "0.16467" "1.5297585" "-4.42" "0.18955645" "228801" "AGGAGTGTGGAAGCCTACTGTGTAGACTACCCCCCTGCAGTTAATAAACACTTGCCCGTG" "30171" "1" "0.16467" "-1.5297575" "-4.42" "-0.12213365" "" "AGAAAGACACAGAGAAGGCGCCTGTGTTGCTCCGGGGGACACAGACCAGTCATTCAGAAG" "53864" "1" "0.164671" "1.5297526" "-4.42" "0.13554602" "" "AAACAACACTCTTGGTGACGAGGAACACAAGGAAACCCAACGTAGAGCATGTGTCTTAGT" "44833" "1" "0.164683" "1.529703" "-4.42" "0.81536959" "" "TTTCCGAAAAGAGACCAACAATGCCGCCATCATAATGAAAGTGGACAAAGACCGGCAGAT" "12981" "1" "0.164683" "-1.5297017" "-4.42" "-0.18637778" "100039660" "GATGACAAATTCCTTTGGCTGTCAGTACTCCAGCATGCAATCAGAAGCAGTATGAAGTAA" "52157" "1" "0.164696" "-1.5296523" "-4.42" "-0.1465406" "" "CTGAATTTACTTTCGGAAAACTTCAGCTCCAAAACCAGAGCCCTGAGAAGGTGGGAAACT" "9146" "1" "0.16471" "-1.5295911" "-4.42" "-0.16214213" "230234" "ACAGTTCTGTCACCAGGGAGTAAACTGTTAATAAACCGTTCCTCGACTTTTTAAAAGGTG" "39633" "1" "0.164731" "-1.529505" "-4.42" "-0.18894056" "" "TCAAACATAAGTCAGAAAGGAAACCATGGACCGCTGGATGGGAGACAAGTCTACATACAG" "49649" "1" "0.164754" "-1.5294128" "-4.42" "-0.16668199" "" "AAACAAAAATGAGTGTTTTTTGCTGCCTTGAAAGCTGGTAAACTTGCTTGGAAAATATCC" "54428" "1" "0.164768" "1.5293541" "-4.42" "0.1715092" "80706" "ATGGCTGCAGAGAATCAATCTACAGTGACAGAGTTTATCCTCAGAGGGCTAACTAACAGG" "45515" "1" "0.164771" "-1.5293444" "-4.42" "-0.21996093" "20604" "AAGACATTCACATCCTGTTAGCTTTAATATTGTTGTCCTAGCCAGACCTCTGATCCCTCT" "62392" "1" "0.164784" "-1.5292873" "-4.42" "-0.2846804" "72795" "CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA" "50534" "1" "0.164791" "-1.5292615" "-4.42" "-0.27558417" "" "TCTGCTCTCGACCAGCAAGAACGACATGACACAGTTGGATTCTGTTCAACAGCCTTTATT" "27743" "1" "0.164797" "-1.5292357" "-4.42" "-0.16267325" "70291" "TGAGGGCCGTTGAGACAGAACAGTTGGGTTTGTTGCCTTTAGACGGTAGTACAGATTTAT" "3363" "1" "0.164803" "1.5292115" "-4.42" "0.66925328" "" "CCCTGGGTCATCTTACTAGATAACACTTTGTAAAAATTGGTTCTGAAAACCCTGTTTATT" "9117" "1" "0.164809" "-1.5291854" "-4.42" "-0.21031301" "75710" "GCACATCCTACTTTGGCATCACTTAGCAATTTTTGTTTATAAAGAAGAAGTCTTGGATAC" "1176" "1" "0.164813" "-1.52917" "-4.42" "-0.31292468" "" "TTTAAAACCAATGTTGAATTCACCTTCTCCTATTCTGACTCGGGGCTGCCTCACCTAGAG" "19406" "1" "0.164817" "-1.5291551" "-4.42" "-0.2108834" "620631" "CCTGCTGTCATAGAACAGCCCTTGGAGGAAGAAAGAATGCACATTGGAAAAAATACAGTC" "46943" "1" "0.164818" "1.5291517" "-4.42" "0.18413766" "" "ACAACCAGGTATTCCTCAAGATCTCCAGTGTGGTCACTGCAGATACTATCACATACTACT" "15061" "1" "0.164831" "1.529097" "-4.42" "0.62875529" "68509" "GTCCATATGCCACACCGTGACTGTGTCACACACAGTCAAGGCCATCAAGAACAAGCCTCA" "48608" "1" "0.164831" "1.5290963" "-4.42" "0.16667602" "17172" "CTGGACTTTACCAACTGGTTCTGAGGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAA" "57594" "1" "0.164846" "-1.5290359" "-4.42" "-0.17730806" "68039" "ACACAAAGTCTTTCCTGCTGTATTTCTTGCTTCCCTGGTGAAGTGGTGAATAAAAATACT" "60767" "1" "0.164851" "-1.5290152" "-4.42" "-0.13424827" "" "CAAAATAGGGCACTGCCAGTTATTTCCATCGGCTTTAGAAATGCTGTTGTTATATTCTAA" "61155" "1" "0.164874" "1.5289213" "-4.42" "0.15471445" "75974" "GGTACATCAAGTAACAGAGGTTATGGTTCCCCAAGATACGCGGAAGTATGAAGAGATTTG" "17441" "1" "0.164886" "1.5288714" "-4.42" "0.3317689" "" "TTACACCAGTCAGGATTTGGGAGCGTCTCTCCTAGTTATCCACTCTGTAATCCCCTTATT" "32763" "1" "0.164901" "-1.5288114" "-4.42" "-0.1305814" "20482" "TGCCAATGCATATAGTTTTATGATTAAAATTGCTGTGGTTGGTTGCATTACATGACACAC" "16590" "1" "0.164903" "-1.5288027" "-4.42" "-0.23628479" "" "TTCAGAATAACTGCCATGGAAGGATGCTCCTCCTGCCAATTGGCACTTATCAATGACATC" "14225" "1" "0.164923" "-1.5287213" "-4.42" "-0.14422047" "" "ACACATTCTTGGGTGTGCTTGGCAGCCTATTTTAGGATAGAGTGGGAACATTGGCTTCAT" "53520" "1" "0.16493" "1.5286918" "-4.42" "0.68167871" "" "AGCAGAGGGGAAGCTGTTAAACTGTCAGTCAAAGCAGTTTGGGAAATAAAAGAGACTGGG" "35289" "1" "0.164932" "-1.5286814" "-4.42" "-0.14965314" "" "AAGTATTACCATTCAGGAAGGCTATGGGGAGGAGATTTAAGTAGAGAGAGCTGATGGAAG" "12133" "1" "0.164937" "1.5286626" "-4.42" "0.95628388" "226691" "GCTCTACTAAAAGCAGCACTTAATTCTAAGAAATGGGGCTTTCTTATATGCTTTACACAT" "49136" "1" "0.164943" "1.5286384" "-4.42" "1.75959175" "" "TAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGTATGCAAGGTCTAGAATATCCTCT" "18644" "1" "0.164944" "-1.5286318" "-4.42" "-0.26761591" "217733" "CCTCTGATCAAGGGGCAGCTGGAACAAGCCTGGGAAGTGACTGAGGCCTTCTGTGTTTCT" "46374" "1" "0.164948" "1.528618" "-4.42" "0.32647111" "69169" "CGTTTTCCTTATAGGATCCCTGTCATGGCGTATGTCCTATACCCTAGGTCGACTCTCACC" "21653" "1" "0.164952" "-1.5286017" "-4.42" "-0.12282329" "67328" "AATCTACACTCGATGTAAACTGGCAAAAATCTTTGCAAAGGCCGGCCTGGACAATTACGG" "60457" "1" "0.164959" "1.5285711" "-4.42" "0.16600314" "381668" "AATTTAGCTTTGTATCTTTTCCCCCTTCACAAGTGACAAAAGCATTTTTAATGGTTTTGT" "43672" "1" "0.164968" "1.5285352" "-4.42" "0.19958024" "170788" "CTGTGTTCGCCTGTCAGCCTCAGAATTAGCAAAACATCTAGCAGACAGAGAACACAGTAT" "45145" "1" "0.165003" "-1.5283917" "-4.42" "-0.11585625" "" "CCACCCTCGCCTGGATGTGTTGCCTTTTTATTTTTTAAAAAAGTCCAACCTTCTTTGTTT" "41500" "1" "0.16501" "-1.5283648" "-4.42" "-0.17594642" "" "TTGAAAACATTTGAAAGGTCTGCCCAAGCCTGTGGACTGCCTCTCGTGTAGTTCCTTATT" "29502" "1" "0.165015" "-1.5283431" "-4.42" "-0.18080294" "13848" "CACCCCCAAATCCTGCTCTTCCAACAGCCTCCCCCATATTAAAGGGAAAGAAGGGAATTT" "26615" "1" "0.165044" "-1.5282253" "-4.42" "-0.12798497" "" "GGATCCGGACACGGTGGTGGTTGTTGGGCTCCTCGTTCCGCTGGTCCGTCGTCGCCATGG" "24490" "1" "0.165047" "1.5282113" "-4.42" "0.19000697" "" "TCACTAACCACCAAGCAGATCAATAGGAAGCAACCGTGACTTCCATTTAACTTTTTAAGG" "13858" "1" "0.165077" "-1.528089" "-4.42" "-0.17213253" "80292" "TGATTTAGGAATCCAAGTGTAAAACTTGCAGGGAAAATAAAAGGAGATGTAGATGTCTGT" "45310" "1" "0.165087" "1.5280473" "-4.42" "0.19334394" "" "TTGAAAACGGACACAGTTTCAAATGGGTCTCTCCGTGCCAGTAGGTAACAGAACAACTGT" "221" "1" "0.165103" "-1.5279804" "-4.42" "-0.23111945" "381418" "CTGTGCTGTTGGAGAGAAAATCATTCCATTCATGACATTCAATAAACATCTATGATTGGT" "9183" "1" "0.165123" "-1.5278994" "-4.42" "-0.39389768" "56419" "TCCAGTCGCCAAGGAGCTTAATTATAATCTAGACACTCATGCGTCTACAGGGAGGATCAA" "45151" "1" "0.165125" "1.5278914" "-4.42" "0.17124189" "" "ATTCCCATGCATTGAGGGGGTGAAACTCAGGGTAGCTTTGTGTTAAGGTTGCATACACTT" "50158" "1" "0.165132" "1.5278625" "-4.42" "0.56908381" "" "TACTGAAGGCTTCATGAGAGCAGACCAGTGTGGTTGGAGAAGGGACTGTCCAGGGAAGAG" "47293" "1" "0.165144" "1.5278166" "-4.42" "0.14545346" "108075" "GCTTTTACACACGTGCCCCTATTCCCAAAATAATGACTCTGAGACTTATTTATTTATGAA" "17343" "1" "0.165217" "-1.5275142" "-4.42" "-0.13542028" "67883" "ACAAAGCCATCCACTACTTCCGGAAGGAATTAGAGTACCAGGCTAATAACCAGTACATCC" "1517" "1" "0.165233" "1.5274517" "-4.42" "0.69357961" "238217" "GGTACTGTTTGTTATCTTGGATTAAGAGTGGCTAGAGAAGTTGGAAGACGTGTGAGAAGT" "23183" "1" "0.165237" "1.5274356" "-4.42" "0.13087028" "378462" "GAAGCTGGAAAGATGACAAGATGAATGGCTTTGGAAGACTTGAACATTTTTCGGGCGCTG" "34027" "1" "0.165251" "1.5273755" "-4.42" "0.38467929" "77777" "CCTACTTCACCACAATCCAGTGTATGTGGAACTATGATTCAATGTCTCTGTCCTCGGAAG" "52749" "1" "0.165262" "-1.5273335" "-4.42" "-0.12386194" "74626" "CTGGCTACCTAGGAAGCTAAGCTAGATTGTATGTGTGCCTCTGATGGTGAAGTGTCAAAA" "36854" "1" "0.165274" "-1.5272848" "-4.42" "-0.13741723" "" "AACTGTGGCTCGCAAAGAATAATCTCAGATGTGCAGGATGCTCTGGGCACGTGTCAGAAC" "32893" "1" "0.165274" "1.527281" "-4.42" "0.13803131" "18815" "GAGGGCTTAGGGTGTTTGGAAAAACTGACAGTAATCAAACTGGGACACTACACTGAACCA" "12191" "1" "0.165309" "-1.5271382" "-4.42" "-0.14632047" "114713" "AAGTGAACACACCTTCTAAATTGCTTTAAGTACTATTGAATAGCCTAAAAGATGGACTCC" "1511" "1" "0.165319" "1.5270997" "-4.42" "0.87701269" "" "TAACCCACCAACAGGAAAAGGAAATTGCTAGAGAAAGGGAGGGTCTACAGAACCAGGATA" "17141" "1" "0.16532" "-1.5270929" "-4.42" "-0.21917777" "" "AAACTAGGAGAGATGTGGAACAACGCTACAGCAGATGACAGACAGCCTTTTGAGAAGAAG" "275" "1" "0.165321" "1.5270893" "-4.42" "0.17262772" "382062" "AAACTCATAGATCCACCTGCCTCTGCCTCCAGATCGCTAGAATTAAAGTTACTGCCATAA" "41062" "1" "0.165323" "1.5270838" "-4.42" "0.17401914" "" "AGGACTAGTCCATCAGCAGAACACCTACTCCAATGAGGCATGCCTATATTTATCCTGAAC" "16598" "1" "0.165324" "-1.5270788" "-4.42" "-0.14604523" "" "GGGAATGCAAGAACATTAACTCATCAAAGCCTCTCCAAAACTAACTATGGAAATAGATAA" "19219" "1" "0.165361" "1.5269256" "-4.42" "0.30581634" "" "TATGAGGCTCCTTGGCATTGTGACATCCCCACGGCATAGTCTGAGATGCACGATAAAAAT" "50996" "1" "0.165364" "-1.5269155" "-4.42" "-0.20573918" "" "ATGGCGAGGGGGATGCTTTTCCTTCCTGCAGTCTTCCCTTTCTGCAGATGAATAGGAACG" "769" "1" "0.165369" "1.526894" "-4.42" "0.71391504" "" "CTGTGAGTTTGAGGCCATAGTCTTTGATTTTGTTTATAGCCCTTTTAAGGTGTAAGAATA" "8854" "1" "0.165371" "1.5268862" "-4.42" "0.31264847" "16772" "ATGTTGAACTAAAGCCACACGGACAACAGATACCTCTATTAAATGGTTTAAAACGTCAGT" "56113" "1" "0.165427" "-1.5266557" "-4.42" "-0.25860865" "" "GTGTGAATTGAGATATATTTTAAGTGTAAAACGCCCACCTGATTTGAAAGATGTGGTACA" "28618" "1" "0.165453" "1.5265519" "-4.42" "0.41852075" "" "TAGTAATGGTGGCATTAACACAGGAAACACAGCTGTTGAAGCTCTCACAGGTTTCTGGCA" "17272" "1" "0.165472" "1.526474" "-4.42" "0.14576055" "58181" "ATTGACATCAGAATTTTAAGGACGACTGAGTCTTTGAAAGACATAAAGTCTTTGGATAGG" "19537" "1" "0.165479" "-1.5264431" "-4.42" "-0.4323521" "56838" "GTTACTATACCACAAGTTACTTAAAGTACTAAGTCACCCAGGTTAATGTGTAAGCCTTTT" "14953" "1" "0.165482" "-1.5264314" "-4.42" "-0.12839764" "" "TTAAAATCCTAAACAGTGTACCAGGAAACCAGTTAATTGGTTATTATCCAAGTAAGATGA" "23242" "1" "0.165495" "-1.526379" "-4.42" "-0.21213469" "74106" "TGATGAAGTTATAACTCGGAATGAACTCATGCTGGAAGAGACTCGGAACACCATCACCGT" "43683" "1" "0.165497" "-1.5263729" "-4.42" "-0.19359153" "209456" "TGTCAAGATCATAGCTGGTTTTAAAAATGATTGTAATAAAATTAAACTTTATGACTCCAA" "22937" "1" "0.165501" "1.526357" "-4.42" "0.74393094" "20540" "CTCTTTCCTTTACAAGGGCCAACAATGCTCCAAACTTGTCTCCTTCAGAGGAACACAAAA" "8096" "1" "0.16553" "1.5262348" "-4.42" "0.16817548" "72045" "TGGGGGAGATAGGATTAGGACCATAGTTAGGGACTTAGTGTGTGAACATTGTATAAAAAA" "59561" "1" "0.165554" "1.5261406" "-4.42" "0.15997631" "" "TTCTTTGACCTCATCATACTTTGGACCTCTCTCAGGTTGTTTATGTACATCTGATTCCCA" "52741" "1" "0.165554" "-1.5261393" "-4.42" "-0.20107451" "12569" "CTGATGAGTCATGAAGCTCAGTTTGGCTGTAATTTAATTCCCCTTCCCTTATTTTTATTT" "5447" "1" "0.165562" "-1.5261043" "-4.42" "-0.150867" "" "GAAAAGCACACTAAGGTGTACTAGACCGTAACCACGCCGAGGAGAAGCCCACCGAAGTAA" "18752" "1" "0.165566" "-1.5260911" "-4.42" "-0.38118689" "" "CAACAATGACTTGTGGTCTGGGAAAACTATACATTCATTTTTATATCCTCTCCCCCCTGT" "8689" "1" "0.165579" "1.5260361" "-4.42" "0.17523687" "" "GCCTACTTATATTCCCTCTTGAAGACAAAAATAAAATTAATGATCTGAGTTATTTTCTAA" "2670" "1" "0.165585" "1.5260117" "-4.42" "0.16370956" "" "TACTTAGTTCTAACAGCTTTCTGTGGAGTGCACACTCTAATTATCCACCAACTGTGCCAC" "32484" "1" "0.165593" "-1.5259784" "-4.42" "-0.17208464" "14401" "CTTGTAGCCTTTCTGAACACACACATCATGCTCACTCCCCAATGGCTAGAAAATACAAAG" "45309" "1" "0.165595" "-1.5259713" "-4.42" "-0.15685592" "72185" "TTTCATGTGCACAAAGACAAACACACTGGCTGCTCTGACCACAAATCAAAGACTGTTTTG" "31384" "1" "0.165612" "-1.5259004" "-4.42" "-0.14472566" "381582" "ATTGCTTCAGAGAACTTCCCAGGGTGGCCCATAGGAACCAAGCCATCCACTTTGGGTCCC" "51006" "1" "0.165626" "1.5258458" "-4.42" "0.15638866" "57442" "TATTCTCTTTGTCATGTTCCTATTTGCCGTCACTGTGGGCAGTCTCATCCTGGGATATAC" "59241" "1" "0.165635" "-1.5258064" "-4.42" "-0.2292009" "" "AAGGAGGAGGAGACAAAGAGGGGAAAGCCTCTGTGGGATATAAGTCCTTGTACCTGGTGA" "6560" "1" "0.16565" "1.5257469" "-4.42" "0.72243125" "16541" "GGATATCCCTTCCTGAATGGGCAGTACTTCATTCAGTGTTCCAAGACGCCAACGCTTCCC" "61289" "1" "0.165673" "1.5256545" "-4.42" "0.18556252" "" "GAATTTCTATCAGGAAATGAGGATCTGAAGCCCCATCTTTAAGGATTCACAGTACACTTT" "44067" "1" "0.165675" "-1.5256437" "-4.42" "-0.14338072" "94062" "CGCCTGTCATTTATAGGTGTCATTCTTTAGACATATTTCCCAGTCTAGGTTTGCGTTTGT" "17951" "1" "0.165678" "-1.5256323" "-4.42" "-0.26101576" "72605" "GAAGGTCATACATTGTGTTTGGTTATTGTTAACAGCCCAATAAATGTGTTTAATGCGTTG" "29371" "1" "0.165696" "-1.5255586" "-4.42" "-0.27678334" "215919" "GCAACGACTTTACCTATGAGCATCATTATCTCTGCTTTTTTGGAGCTCATTCCTTTGTTT" "34973" "1" "0.165731" "-1.5254152" "-4.42" "-0.29536825" "" "ATATAAGAGTGAGAGGCCCGGGCTAGAGGGAGGATTATTATTCAAGAGAGGATTACTATT" "50397" "1" "0.165768" "-1.5252664" "-4.42" "-0.24405025" "77533" "GGAGGACATGAAGTTCTTGTCTGTAGTTTTATAGGTTAAGATTATTTTCATTGTTGTGGG" "61154" "1" "0.165772" "-1.5252489" "-4.42" "-0.17058352" "72215" "CATTTCCCATTTTCTGAAGACATTGCGTCACAAGGCTTGACCTGCGTCTTCAAGACAGAT" "61669" "1" "0.165776" "-1.5252322" "-4.42" "-0.16300522" "240518" "CCGACCTCCAGCTTAGACTGGTTGTGCCCTGAACCTGCCAATGCAGGAACAGCTATTCCT" "32749" "1" "0.165778" "-1.5252263" "-4.42" "-0.19467735" "666529" "AGAATACGGGCACACCATAGGCTTACGGCCCCGGCAACAGAGATACAGAAGCAAGCATGG" "4954" "1" "0.165791" "-1.5251731" "-4.42" "-0.18211022" "12916" "TAGATTTTTATAATCGTCACTTTGTAAAGAAAGTATTGTATTGCTGTCCTTGGGTGCCAC" "37180" "1" "0.165835" "-1.5249911" "-4.42" "-0.18961746" "" "AGAGAGGTCGGGGCATTCATTTTCCTGCACATTGTGAAGTTCCTGAATAAACTGCCTTGA" "27382" "1" "0.165843" "-1.5249591" "-4.42" "-0.18445576" "236727" "TGGGATTACACAAGCTCATTACACATATAACAACCTGTCAGTAGAATCTCGAAGTCGAAG" "38704" "1" "0.165907" "-1.5246969" "-4.42" "-0.11449365" "" "TGGATCCGACTTGCGACCAAGAGCTGAATGTGTGTGAAAACGTCCTCCTCCAGCCTCGGA" "31713" "1" "0.16594" "1.5245638" "-4.42" "0.55209304" "" "AGTCGATGTTTCTTTATTTCTCCACGGCACATGTGGATTTATCAAGTGAAGACTTTTTAT" "47443" "1" "0.165951" "-1.5245204" "-4.42" "-0.19813745" "" "TGGGTTGAAAATACAGAAGTCAAGACATTGGAATGCCCCACTGGCTGTTTGGATTGAGAG" "17422" "1" "0.165952" "1.5245145" "-4.42" "0.15678503" "" "CTGCTTTTCCCTTGGTTTTTTAAGGGTTTCCGTGAATATCTAATATCCCGTTGTGTTGTC" "14585" "1" "0.16596" "1.5244832" "-4.42" "0.68318228" "13036" "ACCTAGAATCGTCTCTCTTTCCAGCTCTCTTCATGTACTGGGAGCTGTAATGGTTACCTT" "54497" "1" "0.165975" "1.5244209" "-4.42" "0.2586748" "" "TGAGTTTATGTTCCTAGGCTCCAGAAGCTAACTCCTTCCTGTTCTGCTCCTTCAAGTGTT" "543" "1" "0.166002" "-1.5243128" "-4.42" "-0.24274328" "" "" "7514" "1" "0.166002" "1.5243118" "-4.42" "0.16248739" "" "CACCTTCAGCCTACCTTCCCACTTCAGAATCATCTAGAACTTATCAATATAAACAAGTTA" "43839" "1" "0.166006" "-1.5242946" "-4.42" "-0.25639228" "" "TTATGCTTGAGCCGGGACATGGGCAGGACATGGGGGACAGCCACAATTACCGATGTTCCT" "24601" "1" "0.166029" "-1.5242022" "-4.42" "-0.13728942" "76653" "ACTACCTGAAGCTGCAGCAAGAACTGCTCATGGACATGCTAACAGAGACTACGGCGCGCA" "54603" "1" "0.16604" "-1.524158" "-4.42" "-0.1635714" "" "AATATCTGACTTGAGAGGTATTATAAAGCTGGGGGGCGGTGGCTGTCCATTGTTTAAGGA" "40414" "1" "0.166043" "1.5241442" "-4.42" "0.24855415" "100169" "GTCGCATGTTAAGATGCTTCCCTACTGTACAGAATCCTGTAAAATACATAATTACGTTGT" "33521" "1" "0.166056" "1.524093" "-4.42" "0.55697474" "19106" "TCCTTGTTGTTCTTTCAGACTTGCTTTGTAGAATATTGGTAGTTACTTTGTGCCTTTGTA" "23248" "1" "0.166067" "-1.5240452" "-4.42" "-0.21863234" "432582" "AGCTCCTTTGCAGAGGGAACGCCAAAGCAATGCACCTTTTTTGTGGTGGACTGGCAGTAA" "55177" "1" "0.166085" "-1.523973" "-4.42" "-0.16324862" "258944" "AACAAGGATATGAAAGGGGCCCTAAAGAGGCTTCTATGTCATAGGAAATTTTTATCTTAA" "29008" "1" "0.16612" "-1.5238317" "-4.42" "-0.16385658" "" "GGGTTGGACTAATATGCTTGTTTGTACCTTGATCATTTCACTAGGGAACTTTTATAGTAT" "47" "1" "0.166124" "-1.5238134" "-4.42" "-0.17040233" "100040231" "TTTGGTGTTGTTGACCACTGAAGACGAATTTGAATAGGAGTTTCAAAGACTGACAGGCCC" "19700" "1" "0.166136" "1.5237677" "-4.42" "0.38791593" "667387" "GGGGTCAGAAAAAACTTTATGGAGAATGTTTTGTTTGTGGAATTTATTGCGCATGTAGTA" "57639" "1" "0.166144" "1.5237329" "-4.42" "0.14578514" "78911" "TAACACCAGATGGGCGTGGGAAGAACCGGGCTAAGTGGGGACTCCTGAAGAACATCCAGT" "22029" "1" "0.16615" "1.5237107" "-4.42" "1.62154986" "26388" "ATTGACCTCAAATGCAGATGAGTGGTTTCTGAGAGCTACGAGGTACAGTTACATGGAGGT" "25129" "1" "0.166176" "1.5236039" "-4.42" "0.55275943" "67705" "CAGTGATATGACTGCGTTTTCAAAAAACCACTTACTGTGAGCTCTTGGCGAAATCTTCGC" "26829" "1" "0.166219" "1.523427" "-4.42" "0.12956708" "" "ATCTGAATCAGACATAGAAGGAAACCCCTTGGAGCTCAAGCTTCTACTAGCTCTGGTTTG" "39411" "1" "0.166247" "1.5233125" "-4.42" "0.15357248" "13866" "GGCTATGCCAGGAACGTGCCCTGAGGAACCTCGCTCGATGCTTCAATCCTGAGTGGTTAA" "30770" "1" "0.166251" "-1.523297" "-4.42" "-0.26956697" "" "ATGGAAAAAACATGGTAAAATGATGGAGAAGAAGAGAAAAACGGATCTCTATCTCTCTCC" "7729" "1" "0.166267" "1.5232351" "-4.42" "0.17415677" "" "GACAAGACAATTCCATGGCTCTCCCAACCCTATTAAGTATAAAATTTCAAAAAGACAACA" "34959" "1" "0.166326" "-1.5229923" "-4.42" "-0.20175115" "68870" "CCTATACACAGTTTTTGAGTATATAGAGAGCGGGATCATTAATCCTCTGCCCAGGAAAGT" "5742" "1" "0.166338" "-1.522943" "-4.42" "-0.16095539" "20300" "AGGCAGAAGGAAAATCAAGTGGGTTCCATCTGCAGTGGTTTTTAAAAGGGCAAGAAGAAA" "61128" "1" "0.166342" "1.5229278" "-4.42" "0.15301204" "73614" "GGATTTGCTTACAAGGGGAGAGCTTGCAAGAACTTTGAATGTGCCTGAGGTCAAAGTGAA" "46357" "1" "0.166346" "-1.5229136" "-4.42" "-0.35197045" "13405" "CAACAGTTGGAGAAATGCTTGAAGTTGTCCCGTAAGATGAGAAAGGAAATGAATGTCTTA" "25867" "1" "0.166359" "-1.5228586" "-4.42" "-0.48320849" "15444" "TTCTGGGGTCTGCACTGTGTGTGTGTGTGGGCCTCTGGAGAAGTGAAACCTGCAAGGAAG" "795" "1" "0.166399" "-1.5226958" "-4.42" "-0.14745257" "" "GCCATTAATGTGGGGATGCGGATGAATGCGGGGTTCATCATGCTGAACCACTTCAGTCAG" "60317" "1" "0.166462" "1.5224392" "-4.42" "0.22881497" "" "GGACTCACATGAGCACAAGTTCAGAAATGAATAGTTTGAAAGTAGGTTCTTGGAAAATAA" "59212" "1" "0.166507" "-1.5222582" "-4.42" "-0.26947237" "" "AGCTGTGTGCCAGGCCCGGCTCCCTTCTATTTGATAAACAGTAAATATTTATGAAGTGAA" "11296" "1" "0.166528" "-1.5221736" "-4.42" "-0.41007245" "328092" "AGTCTGTGTGAAAAAGCCGTGGCCAACAACACCAAGAGTGTAGAAGCGGGGGTTGCGGTG" "12908" "1" "0.166573" "-1.521989" "-4.42" "-0.14369642" "" "TTCCAAGGCTTACCAGGTATCTAAAGTATGAACGAGACCAACCTAGCAAAGCGCTCTTCT" "7100" "1" "0.166601" "1.5218775" "-4.42" "0.14388095" "433492" "AACAGTTGGAGGAAATGGGCATTGTTGTAATCAGCTCCTTAATAAACACTCCCTGCATGC" "50589" "1" "0.166614" "-1.5218243" "-4.42" "-0.14306383" "" "CAGGCACGTGGTGCTAAACAGAGTACAACACAATGGCTTTTGATAAATTATATTTCATAT" "24025" "1" "0.166628" "-1.5217671" "-4.42" "-0.15503741" "271377" "AGAGAATGTTACCAACGCCTCCCAAGAGGACAGTGATACAGGAAACGATACATCACCTGA" "29543" "1" "0.166642" "1.5217093" "-4.42" "0.1331593" "74552" "TTCCTAATCACTCGAAACAGAAAGAAGGCCATTCCGTTCGAGCCCTATATTTCCATGGAC" "13753" "1" "0.166647" "-1.5216873" "-4.42" "-0.11872511" "66211" "GGCTGCATTGCAGGTACCAAGAAGCGAGTGATCACTCTGAGAAAGTCCCTTCTGGTGCAC" "49561" "1" "0.166651" "1.5216722" "-4.42" "0.13544295" "113851" "CAATTTCTCCATATCACCAGCTTTTCCCTCAAACCATCTGCAGAAAAAAGAGCCATGAGG" "26601" "1" "0.166677" "1.5215665" "-4.42" "0.27860368" "" "TTTAAGAGATTTAGGAAGCAACTCACTCCCAGCCACTTATCTGAGACACAGTGGAGGTGA" "25909" "1" "0.166679" "-1.5215603" "-4.42" "-0.16016188" "" "AAATACATCCCAACAGTGAACAACACTGTGTGGTATTGGTTCGCCTTGCTACTCCTTGCT" "25865" "1" "0.16669" "-1.5215163" "-4.42" "-0.19348962" "" "" "48875" "1" "0.166699" "-1.52148" "-4.42" "-0.1898793" "22761" "AGTGAGCCTGTGGGGCCGCACCACCAGGACCCTTGACACTTAATAAAGACATTCGGTGTG" "47399" "1" "0.166704" "-1.5214582" "-4.42" "-0.12076975" "" "ATTGTATCCTCCACATCTCTCAAAACACGGCGGGAGCTAAAGCGTAAGGCGGGCGGATAT" "48516" "1" "0.166716" "-1.5214081" "-4.42" "-0.13616106" "12874" "TTTTCGGATGTCTAGGAATTGTTACCAGCAATGTAAATACAGTGGCCATTGCTCACATGC" "51241" "1" "0.16672" "-1.5213937" "-4.42" "-0.1185614" "76413" "CTGGAGAAAATGATTGACAAGATTCGAAGAGCTATTGAAACTAAGCTCAAGAGAAGACAG" "4988" "1" "0.166735" "1.5213332" "-4.42" "0.1996428" "" "ATAATTAATGGTGCAGGTTTGAAGGAGAAAGGCTGCCAGGCTAATGGAACCTGAAGAGAG" "15500" "1" "0.166786" "1.5211262" "-4.42" "0.26519088" "215615" "CTCAGAAAGGCTTCACAGGCTTCCTGAAGAATTGCTCCTTCCCAAATTCATGTTCTCACT" "53540" "1" "0.166805" "-1.5210488" "-4.42" "-0.13004688" "73652" "GCCTGCAATAAGATTGTGTAAAGTCTTTGTTTTGAGATGTGCACATTTTTTGTATTTCCC" "10212" "1" "0.166813" "1.521016" "-4.42" "0.23903326" "66468" "TTCACGGCTTTGAAAGTTGACAAGAGGTTTTATGTGATTATGCACATTTTGCGGCATTGC" "35189" "1" "0.166814" "-1.5210125" "-4.42" "-0.14008743" "627908" "GAAGCGGTATATAATTGTATAATTTCGTGTGTAACTGAATGCTTGGGCTTTCAATACAGT" "28220" "1" "0.166817" "-1.5209983" "-4.42" "-0.13737938" "27359" "GGGATCTTGGGGGTCCAGAGAGATATACTTTTATCTTTTCATCTTATTATTGTCTTTTAG" "39059" "1" "0.166859" "-1.5208303" "-4.42" "-0.33489685" "80906" "AAGATGGACAGAAACAAGGACGGCGTGGTGACCATTGAGGAATTCATTGAGTCTTGTCAA" "21894" "1" "0.166865" "-1.5208054" "-4.42" "-0.16897689" "52705" "ATGGAAAGTTTTTATTATCGTACTTACTGCAGAGACTGTTGAGACACTTGTCATCTTTTG" "8155" "1" "0.166897" "-1.5206738" "-4.42" "-0.16963865" "20515" "TCTCCTAGAAGGTGGCTGGCCTGCATCCATTTCAGAAGGCTGCAGGCTAGTGTATGCTGA" "22310" "1" "0.166899" "-1.5206682" "-4.42" "-0.12277509" "320684" "ATTTCATATGAATAAATATGTGGGGGCTTACACTAAAATTCAGATCCCCTCACTTACTCT" "24276" "1" "0.166956" "-1.5204366" "-4.42" "-0.15030084" "77463" "AGATGTCCTACGTGTCCTAAATTCATCTTTTCATGGTAAATTATAACACCACAAGACTAG" "23836" "1" "0.166965" "1.5203986" "-4.42" "0.27522856" "216858" "GTGGAGTCATTCATCTATCACTGTGACTTACAAGAAGAAAAATAAATTGCTTTCAGAACC" "40241" "1" "0.166984" "1.5203219" "-4.42" "0.87932469" "19253" "CAGTGTGTTATGTATGAGTGGGACTTGTGGGCCTGATTCAAAATAAAAGTTTCTCAGGGC" "13419" "1" "0.166996" "-1.5202748" "-4.42" "-0.11843755" "15526" "TAAAGGGGTGGGATGGGGCTGTGAACCAATCATTAAGGTAGATTTGGTTTGTGCTGAAAT" "58170" "1" "0.167009" "-1.5202223" "-4.42" "-0.16042939" "72729" "CTTGTGCTCAGCACCAGAAGACAAGATGGACGTATTTTTATAATCTAAGCATACTTTTTT" "19932" "1" "0.16702" "1.5201748" "-4.42" "0.36586637" "56619" "ACTGGATTTCACCTGTACTTGTATCTACTGCGCAAGTAGAACCTGCTCAGTAGGTTCAAA" "10152" "1" "0.167031" "-1.5201301" "-4.42" "-0.16919145" "" "ACAACTAGTGCATGTGGAATACATAGCAGGCATGTTACATGCTGTGCACATGCACTCAAG" "62617" "1" "0.167059" "1.5200187" "-4.42" "0.16893138" "73827" "GATTCTCCTGACCAAGATCTATTTCCTGGTTTCCCAGACATAGTAAAGAAAATATATCTT" "8495" "1" "0.167064" "1.5199987" "-4.42" "1.10300387" "19039" "TACTGCAGTAGCCCCATCTGTCACAGTCACTCATCAAAAATCATTAAAGTCTCACGTGCT" "60198" "1" "0.167067" "-1.5199881" "-4.42" "-0.16636889" "" "TATTCTCCCTTGCCACTATCAAGAGGAAGTACGACATGTAAAGTAAACCACAAGGCGCAG" "21730" "1" "0.167085" "-1.5199119" "-4.42" "-0.14259332" "56292" "CTATGCAGATGGGGAAGATGCGTATGCAATGAAGCGGGACCTCACGCAGATGGCTGATGA" "17963" "1" "0.167088" "1.5199019" "-4.42" "1.55680706" "100046496" "AGCAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGTGCTCAAAATCTAGAACTTCCT" "49497" "1" "0.167106" "-1.5198272" "-4.42" "-0.13375944" "" "CATTATTGCTTGATACCCCGTTTCTTGGTTGTAACTATTGTTGAAGTAAGGCATTTTGTA" "47211" "1" "0.167142" "1.5196838" "-4.42" "0.15640044" "" "CCATTGGTTGTCACACCCATTAGTTTTGTGTGTTACTACAGAAATAAAAAATCACCATGA" "21124" "1" "0.167143" "1.5196777" "-4.42" "0.26181164" "53858" "TGAAGGTAATTTTGATGGTTCGACTTGCTAGGGATTTCCCACACTCTTCTGCCTTCACTA" "37797" "1" "0.167146" "1.5196666" "-4.42" "0.1821995" "" "CTGCTGACCTGGACATATTTTTTCTGGGGAAATTTTGCTACCCTAAGTCTTAGGGCTCTC" "30138" "1" "0.167151" "1.5196468" "-4.42" "0.34954651" "" "CAATCAGCCTCCGTCTCTTGCAGGTCAAGTCAGAGTCTCTTACATAGTAATGGAAACACA" "5542" "1" "0.167156" "1.5196267" "-4.42" "0.71550254" "" "AATGGCAGAGCAACAAAGAATCATATCCCTTAAACTTCAGGTACCTGGCTGCACCATGTG" "25871" "1" "0.167157" "-1.5196206" "-4.42" "-0.16710245" "" "GGACAGTGTTTGAGAAAGAGGTTTCAGGATGTGGTATATTTAAGAGGTTAATTAGACATT" "27548" "1" "0.167162" "-1.5196001" "-4.42" "-0.16366091" "" "GCTGATTGATGGTCATGAGAGAAAACAAAACTCATGCTCAGCATAACTTAGCTTTTAAAA" "21459" "1" "0.167195" "1.5194684" "-4.42" "0.1441235" "" "AGTAAATGGAAACAGATACAAGTCTTGAGAATAAATCCGACTGCTTACATAGCATGTATG" "16661" "1" "0.167203" "1.5194373" "-4.42" "0.23937888" "58206" "GTGAAGATTAACTGGGGACTGTCAATTTCATCACTATAATAAAGTTTCCTGTGCTCCAGT" "56030" "1" "0.167204" "1.519433" "-4.42" "0.26502394" "50914" "CGTAGCGCAGGCTTATAAAATTCGGTCATTAACGTTCTCATTAAAGTAAGCGGAGTTGGG" "35902" "1" "0.167233" "-1.5193144" "-4.42" "-0.17470105" "67236" "AACCTGTTGTGCCTCAAGGCCAGATACTTTGAGGGTCCTGGGATCACTCTTCCCGCTGCT" "16956" "1" "0.167258" "1.5192117" "-4.42" "0.2107027" "" "TAGAGATGTAGCATCAAACATTCACGGATGTCCAGGGAGCACGGGCACACAGGCTGCTGG" "3097" "1" "0.167263" "-1.5191936" "-4.42" "-0.16170761" "19252" "GCGTATGAGAGTTTTTACCTTTATTTATTTTTGTGTAGGTCGGTGGTTTCTGCCTTCACA" "46010" "1" "0.167276" "1.5191387" "-4.42" "0.65946547" "" "GAATTTCTGGAATTGGCCAGAAGACAACAGGGTTTGCTTATTTAACCTTTCAAATCAGTC" "47133" "1" "0.16728" "1.5191244" "-4.42" "0.1694025" "" "ATGAGTAATGTAAGTCAATACCCGCTAAAGTTCTCAAAGGCACTTCAATCCCTCCTCCAC" "41140" "1" "0.167284" "-1.5191098" "-4.42" "-0.24979445" "66725" "AGATGTTGCTTGATTATCTATGGACTCAGCGGAGTAGAATAAAATATCTGGTCAATTTCC" "42587" "1" "0.16729" "-1.5190856" "-4.42" "-0.2009223" "" "TTGTTCATAATCAAAGGCAGGCAGGAGGCTAATGGAAAAAGGCAGGAACTTGAAGGCAGA" "21131" "1" "0.167342" "1.5188735" "-4.42" "0.39243255" "66853" "AGAGTGTGTGAAGAATTATTTATTTTTGCCAAAGCAGATCTAATAAAAGCCACAGCTCAG" "18025" "1" "0.167373" "-1.5187497" "-4.42" "-0.16005975" "320022" "AAGAAAACTCCTCAACAGCCGAAATTTTAGCAAGTTTTTGCACTCATGTGCATACCAGTG" "62143" "1" "0.167375" "-1.5187416" "-4.42" "-0.20017855" "" "CAGACTGGTGATCTGGAGTCTAAATGAAGCAAGTCTTCACAACTAGCTAATATATTTATA" "43635" "1" "0.167398" "1.5186475" "-4.42" "0.29413655" "13082" "ATCTTCACTAACAAGGAGGAATTTAATCCCGACCGCTTTATAGTGCCTCATCCAGAGGAT" "62906" "1" "0.167425" "-1.5185364" "-4.42" "-0.16122822" "77558" "GACTACCTGTAACACCTCACCCATTGCTATGTAATAAGCCTAATAAAGTCGTTGGTTTCC" "377" "1" "0.167442" "1.5184696" "-4.42" "0.40261536" "83454" "CCACATTGGCAATTTTTCTGTCTCCCTCCAAAGTTGTTTGTGATTTCATAATAAAGAGTT" "15952" "1" "0.167446" "-1.5184511" "-4.42" "-0.15125061" "" "" "11679" "1" "0.167463" "1.5183841" "-4.42" "0.12695318" "233532" "AGTGTAATAAGCCAGGCCTAAGCCATTTTATAGCTATTGGCCTAACTGTGTAACTTTTTT" "36850" "1" "0.167467" "-1.5183688" "-4.42" "-0.16206562" "242785" "ATGTTAGGACAAAACTTAAGTTATGAGAGAAGTTCTGTGCCTAGTATTGATCTATAAGGG" "55095" "1" "0.167472" "1.5183464" "-4.42" "0.22928977" "" "AATGTGAAGGAAGGGGGCACATGGCTAGAGTTGTGGTAACGCCATTTAGAAAGGAGATTT" "9298" "1" "0.167488" "1.5182814" "-4.42" "0.97951623" "20556" "ACAGAGGAATGGGTGAAACTCCAGATGAATGCCCCATCAGGTTGAAGGGGGATTAATAAT" "48822" "1" "0.167493" "1.5182633" "-4.42" "0.3109223" "22779" "CTCAGGAACAAGCATATAATTTGTCCAAGATTTATTTCTTCTCAGAAGTGTAAGTGCAGT" "21810" "1" "0.167578" "1.5179193" "-4.42" "0.16162812" "" "GTGTGCAGTCCCTTAGTTCGCTGTTTCTACTTCCCTTTTAAAGAAAAAATAAACAAACTT" "38470" "1" "0.16758" "1.5179099" "-4.42" "0.15797918" "22418" "CCTAACCCAGAGGTTACCAGCCTGGTTTTGTGGGTTTTTTGTTTTGTTTTGTTTTTTCTT" "26948" "1" "0.167588" "-1.5178783" "-4.42" "-0.1675001" "14167" "TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT" "54957" "1" "0.167603" "1.5178191" "-4.42" "0.75575397" "" "GCAGTGGGTGCAAAAGATGCCAGGAAAGGGTTTTAAGTGGATTGGCTGGATAAACACCCA" "287" "1" "0.167616" "1.5177641" "-4.42" "0.74059257" "245839" "AACAAAGCTCATGGAGTTTTGTCTTATGTGAAATCCAAGAAGATCTCTTCAGGAGTCTTC" "58645" "1" "0.167627" "1.5177199" "-4.42" "0.14292976" "12807" "TTAATATGCATTGTAGCTGCTTTAAGGGTGCTTACCTTACCCTGTAATTGTAGCTGTTAG" "51050" "1" "0.167662" "-1.5175805" "-4.42" "-0.21948292" "66799" "GAATTTATCAGTTGTTGTGGGATTATAAGGAAAGTGAGGGATCCAACATTACATTGAAAG" "49829" "1" "0.167663" "1.517576" "-4.42" "1.35576301" "76681" "CATAGCTAAGGGCTGTCACTTACATCAGGTGGGTAAAGACCATGTTAAGGGAAGATTCCA" "27366" "1" "0.167668" "-1.5175564" "-4.42" "-0.24743976" "78425" "AATTGAGAGTTGCTATTCTACAAGTGAATTCTAGGCGTCTCGACCTTTCACTGACGGAGG" "12342" "1" "0.167671" "1.5175431" "-4.42" "0.12458913" "" "GTGTTAATAAGAAGTCTTGCAAGGAGGAAAATTCTTTTAATGTAAAGGTAGCACTGTGAC" "51729" "1" "0.167681" "-1.5175033" "-4.42" "-0.13255482" "73287" "CCTTTAACGCACGAATAGAGAAACTGAAGAAAGCCTGAAGACGCGGTACAAGCAAAGTGA" "35052" "1" "0.167689" "-1.5174704" "-4.42" "-0.16260147" "" "ATCTCAGTTTTCTCTCCCTACCGGCCTGGGAAGAGAGACAAGAGAAGCGCCCCTCAGTGA" "37351" "1" "0.167713" "-1.517373" "-4.42" "-0.16432025" "235493" "GTTTTCCTTTATAGTCAAGTGATGTTTGTCTCTAGTGTTCTAATGTAGCACAATCCTATG" "2372" "1" "0.167713" "-1.5173727" "-4.42" "-0.18043449" "" "TAAATTTGCCAGGAAGCTGCACCACAACTATGGCTTTTAAAGATACTGGGAAGACGCCAG" "32989" "1" "0.167729" "1.5173085" "-4.42" "0.15173178" "258631" "CTGATTTATAGCTTGAGGAATAAGGATGTGAAAGAGGCTCTTCAAAGACTGAAAATGAAA" "62625" "1" "0.167741" "-1.5172618" "-4.42" "-0.12129781" "" "TTAGACATGACGGCAGGCTTATGAGAGCCTTCGGGGATGCTTCCTCCGCAGCGTCAAAGA" "21575" "1" "0.167779" "-1.517109" "-4.42" "-0.17291641" "246179" "GACGAGTTCTGCCTTTCTGCTGTTTCAGCTGTACTACTACAAGCACTATTTGTCTGCAAG" "56754" "1" "0.167785" "-1.5170827" "-4.42" "-0.16271378" "" "" "1642" "1" "0.16779" "1.5170626" "-4.42" "0.17749834" "54721" "GCCATGACCTGAACAGACCTTGAATATGCAAAGGGGCTAATTGGGATTCCTGAGTCTATT" "11025" "1" "0.167808" "-1.5169923" "-4.42" "-0.12046735" "" "ATTTTCTGCGTGGAAGGAAACATGTCATGTCAGCTTTCCTCCTCCTTTCAGCCCAAGTAT" "55644" "1" "0.167812" "1.5169754" "-4.42" "0.91888153" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "35075" "1" "0.167824" "-1.5169263" "-4.42" "-0.13846631" "271377" "TATGCGGCAAAGAATTTTATGAAAAAGCTTTATTCAGAAGACATGTAAAGAAGGCCACCC" "57412" "1" "0.167839" "-1.5168668" "-4.42" "-0.1143953" "622675" "AAGAATATGTTTGAGCGCCATCTGCAAATCCACCTCATCACCCGGATGTTTGAGTGTGAT" "44192" "1" "0.16785" "-1.516821" "-4.42" "-0.19844346" "" "TGCTGCCTCAGATGGGAGCTCTGGCTGAAGCACTTGTCACACGCCTCACACTGGTAGGGC" "12262" "1" "0.167851" "1.5168177" "-4.42" "0.31847011" "12550" "ACATTCTAACGGGAAAAAGGAGACAAGACCTTTGAGAGTTTTCATTCAAAATGCAAATCT" "52559" "1" "0.167854" "1.5168043" "-4.42" "0.24097494" "26425" "GGATTTGAAGTCACTCATTAAGACACTGTAATCACCTATCTGCCTATTTCCTCGAGATCA" "42644" "1" "0.167856" "-1.5167967" "-4.42" "-0.12724282" "72284" "AACCAAGGGGGAAAGCACTCTTCCACCTCAATGCCCTTTGGCCATTTCCTGGAATGCTGA" "10048" "1" "0.167886" "-1.5166761" "-4.42" "-0.15478114" "102162" "AGCGCTGCACCAGTTACCCAGGGTTCCATCCCTACACCATCAACAAAATTATGATAAAGA" "28181" "1" "0.167893" "-1.5166483" "-4.42" "-0.53633288" "" "ACCACCTAATCTAACAATCCACACCCTTGATCTTTAAAACAGCCAATTAATAGATTTGCA" "59964" "1" "0.167896" "-1.5166346" "-4.42" "-0.24375572" "" "AAGTGGACCGCAGTGAGGCTGCGAGAGGCCGGAGCTGGGAATGCTGTCGATCCCAAGCTG" "17142" "1" "0.167905" "-1.5166015" "-4.42" "-0.14869579" "15510" "GTGGGAATGATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAAT" "13431" "1" "0.167944" "-1.5164445" "-4.42" "-0.14826141" "" "ACAATATACTCAACCATCACCTCTCCTCCAGGCTGCTCCAAGTAGCCGTGGTGGGCCATG" "55270" "1" "0.167949" "-1.5164243" "-4.42" "-0.1576024" "72836" "AAGACACTTGTTTTTGTGCTGTTCACTTACCATCCTTGGTTGGGTTTATATTCCTGTCCT" "40878" "1" "0.167949" "1.5164221" "-4.42" "0.12675431" "" "GATGAAAGGCGATTATGACACAGCCCTGAAGCTCCACAAGACCCACCTGTGCATCGCCCA" "19877" "1" "0.167953" "-1.5164054" "-4.42" "-0.17810363" "" "" "32332" "1" "0.167956" "1.5163928" "-4.42" "0.92169451" "66102" "TGTAAAGTTCTAGGTTCAACCCTCCCACTACCAGATCAATTTTAAAAAGTGTCTGCTTTT" "26474" "1" "0.167959" "-1.5163828" "-4.42" "-0.14646224" "70357" "TGTTCCAAAATGTCATGTAACTGAGGACACTGGCCATTCTGCTCTCAGAGACACTGACAA" "60039" "1" "0.167966" "-1.516353" "-4.42" "-0.13339853" "" "TAACATCTCTCATGCTCAGACTTGGAAGGACGAGTCCATCAGCAAAAAACCCACACCAAT" "48909" "1" "0.167977" "-1.5163109" "-4.42" "-0.14422176" "" "" "8335" "1" "0.168008" "1.5161838" "-4.42" "0.1911232" "791282" "GAGTTTTCATAAAATAGTTTGGGATGAAGGAGACGGAGAAAAAGAACAATGGGAAACCCC" "4923" "1" "0.16801" "-1.5161749" "-4.42" "-0.1792948" "72556" "TCTGTAGAGGCCCTCTAGACCGGAGAATGTCGAAACAGTTGACTTGTTGACAAACTTGTT" "59385" "1" "0.168028" "1.5161057" "-4.42" "0.20645133" "" "AAAGGAGGAGGAGGAGAAAAAAAGGAAAGAAGAAGAAGGAGGAGAGGAAGAAGAAGAAGA" "53947" "1" "0.16807" "-1.5159358" "-4.43" "-0.12150166" "" "GGTGAAGTCTTTGCACATTTTATAGTCTTCATCATCATGAAAGTATTCATACTGGAGAGA" "12374" "1" "0.168105" "-1.515793" "-4.43" "-0.21939878" "67455" "GATGTCCATGGTTTCCCTTCTTTTCTTCAATAAAAACATTTAATGTCATTCTGCTCTGTG" "46198" "1" "0.168108" "-1.5157834" "-4.43" "-0.11858599" "" "TAATCATGGTGGAAATGGGATGCACCCGCCTAAGGTTCTTCATTATGCTCTCGAACAAGT" "45358" "1" "0.16814" "-1.5156514" "-4.43" "-0.17620603" "98488" "TAAGCAGTGTAATTTATAAGACGATGTATGGACCAGTATCTTCTAACGGGACCTCATTGT" "14691" "1" "0.168164" "1.515558" "-4.43" "0.45527653" "20848" "CACTCTGTGAGCTGATACCCCAGGCTGGGAACTCCTGGCTCTGCACTTTCAACCTTGCTA" "5729" "1" "0.168197" "-1.5154254" "-4.43" "-0.26538059" "" "CCAAAAGACACTGAAAGCAGACTATCCAGGAAAAGGACAGGCTATGAGGTTTAAAAAAGA" "60757" "1" "0.168222" "1.5153221" "-4.43" "0.12649005" "" "TACAAGTGGGCAAAGGGCGAGTTCCGATGAGAAAAGATAAGAACAAAAGCTTAAGCACGC" "183" "1" "0.168229" "1.515296" "-4.43" "0.49232896" "12977" "TGTGGGGCTTACTTAGCCTTCTGGTTACAGACTATTTCCATGCTAGAAAATACATATTTT" "21842" "1" "0.168231" "-1.515285" "-4.43" "-0.14855997" "493583" "CTCTGACATAGTAACTTCAATGCTAATGAGCAATAAAGCAGAATAAATCATGTTCCTTGC" "15424" "1" "0.168243" "1.5152375" "-4.43" "0.27646112" "20401" "TTTTTTCTCTTGCCAATGTATTTTTGTAAGGCTCGTAAATAAATTATTTTGAACAAAAAA" "43433" "1" "0.168243" "-1.5152367" "-4.43" "-0.12171548" "69714" "TCCAGAGAAAGAGGGGCTTTCCCCATCCCAAAGGACAACTGCAACCTTAGACCCCACCAG" "35823" "1" "0.168272" "-1.5151234" "-4.43" "-0.15979561" "241989" "TGTGCTTGAGTGACTGCCTGCATGTGAAAACTATAGCAATTAAAAACATAAAATTCATCC" "44938" "1" "0.168275" "-1.5151086" "-4.43" "-0.18370388" "107371" "TGCTGAAGTACACCCTTTGCATATTCCGGATTTATGCTTGTAAGATGACCTGACTCTGTA" "5575" "1" "0.168278" "-1.515096" "-4.43" "-0.4135388" "74901" "GTTCTCCAAAGGAGCAACACAAGGGAGCCTCAGCTCAGGTCTGTCGGATGTGCAAACTGC" "34594" "1" "0.168283" "-1.515079" "-4.43" "-0.12820289" "102122" "GCGTTAGCTTCATATGTTGTTGTAGATGAATGGGTTTCTTGGTTCTACCATGTTGTGTGT" "420" "1" "0.1683" "-1.5150085" "-4.43" "-0.19330879" "621976" "GCTGTGAGTATACTTGACATGGATTCAGGTAACGTAGCCAGGCTTAGCTTTGTCGTGTTA" "58734" "1" "0.168321" "-1.5149233" "-4.43" "-0.12021454" "269470" "AAAGATCATGTTGTAGATCTTGGGGTACAGATGTCAGCCTTGGTTGAAGAAACCAACATG" "13136" "1" "0.168322" "-1.5149226" "-4.43" "-0.24831425" "93888" "GTACATGTGCCTAAATTTGTGAAAATCGAGGTAATTTGGGCATTAGAAGGTATCAAATAG" "13317" "1" "0.168343" "-1.5148379" "-4.43" "-0.25207048" "19055" "TTTATTGATAATGTTTTGCTACTCCTGTCAGACAATGGCTATAAACTGAATTAGGCAGTC" "878" "1" "0.168352" "-1.5148012" "-4.43" "-0.30711427" "" "TAAACTTTAGAAGAGATGAGAAAGAAAACCCACGTTTTCCTGGGAAGCCGTGAGCGAGAG" "58289" "1" "0.168353" "-1.5147959" "-4.43" "-0.1391149" "" "" "42264" "1" "0.168354" "-1.514791" "-4.43" "-0.18092444" "" "AAACAATGATCTTGAGGGTTTTTCTGGATTTAAGCTGAATACCATCTCCTTTAAGACTGT" "8237" "1" "0.168356" "-1.5147847" "-4.43" "-0.1440817" "72433" "GATATATTATATATATTTTTCACAAGTGAAAAATAAAACATTAAAAATGCTGTTTCCCTG" "25411" "1" "0.168363" "1.5147569" "-4.43" "0.47412899" "110006" "TTAGTTTTTTGGCCTTGGCTTTGTGAACTCTTGAAAGCCTGCTGTGTGAACATTCTCACT" "59333" "1" "0.16837" "-1.5147263" "-4.43" "-0.27990311" "22042" "TGAGCAAGATCACATTAACAAAGACTAGTTAACCATCATTACGCATCTAATCAGTTTTGC" "54383" "1" "0.168374" "1.5147101" "-4.43" "1.23228739" "99899" "ATGAATTCATTAAGAGAGTAGTGAGAGAACAGGGAATGAAGAAGGCACAGAGACTGTGCC" "45534" "1" "0.168378" "1.5146949" "-4.43" "0.26687656" "69834" "GTTGCCTTCCTGGATATGTCAGAGACAGTGTACAATTCAACCATTAAACATTTCTGTATT" "3115" "1" "0.168385" "-1.5146667" "-4.43" "-0.15142438" "" "TCTGTTACTTTTCTCTATAATAAAAACTCCATCACAGGTGAACAAGAAGGCTTGGACATA" "48811" "1" "0.168393" "1.5146348" "-4.43" "0.18274279" "20379" "CACAGTTGTCTGTGTGCATACTGTGTAAGACCTCCTGTTTTAAGAGTTTGACCTAAAATG" "22533" "1" "0.168393" "1.5146338" "-4.43" "0.38109872" "13709" "GAGGGGAAGTTGCATACAAAGATATATATCCAAGTTTCCGAAGTAGAGTTTTTAGATTAC" "48405" "1" "0.168403" "-1.5145947" "-4.43" "-0.39555264" "" "AAGTGTTGGCCAATTACAAAAGGAACATAATGAGAAGCTACTAACATCAAAGATGTTGCC" "37913" "1" "0.168442" "-1.5144373" "-4.43" "-0.16652271" "50912" "TAGAAAATGCTACTAAGAAGAGAGAACGAGCCACCAGTGACCTGAGGACTGTAGAGCAAA" "4037" "1" "0.168462" "-1.5143571" "-4.43" "-0.14043942" "" "AAACGCGAGCAGAGGCACCTCTAGGAAAAACAATGCGCTAGTATTTATTTAGAGAGCCTG" "27516" "1" "0.168475" "1.5143045" "-4.43" "0.18152871" "" "AACAAATGCCATGTTTATTAAGGAGAGGGCCGCATGTTTGCAGCCAAGTGTAATGGTGCA" "22919" "1" "0.168485" "-1.5142643" "-4.43" "-0.12041915" "98828" "TCGATTTCCTTAAGCTGAAAAGAAATGAGCAAGAGGACGACTGAGTGCTGCTTGGAGAAC" "27104" "1" "0.168533" "-1.5140727" "-4.43" "-0.18849397" "239133" "TTTCAAGCATATTGACTTACTGTTGACTTTCTGAAGTATACTTCTTTGGGGAGCTAATTG" "58409" "1" "0.168539" "1.5140478" "-4.43" "0.73537348" "329305" "GATGGACTCATAGACACAGAGCATGTGCAGGGAAATGAGGGCTGCAGCCCGAGGAAGCTT" "6831" "1" "0.168545" "-1.5140238" "-4.43" "-0.16606927" "" "ATAGTAGGGAGAAAGGTGACTCACTGTTGGAGAACTTCCTTCTCACACACCATTGTAAGG" "25845" "1" "0.168549" "1.5140097" "-4.43" "0.14521362" "268379" "TACTTTGTGGATAAGATAAAAGTTTTATCGGAAACATTTCTGAAGATATCCAAACTTTTC" "34056" "1" "0.168561" "1.5139612" "-4.43" "0.56107817" "239743" "ATGCCAGTAGAGGCTAAATGCATCAATGCAGTGAGTTTCCAGGATCACATCTATGTTGTT" "19282" "1" "0.168564" "-1.5139464" "-4.43" "-0.17706144" "" "ACATATGATGATCGCTTCAGCCTGAAGAGTATTGAGGAGCAGCTGAGGACAGAGATCAAA" "46330" "1" "0.16859" "-1.5138433" "-4.43" "-0.11442927" "" "AACATCATGGCAAGACACACCTTATGTTCTTCACTATCCACTAAGTGTCACAAAGCTCAC" "28420" "1" "0.168597" "1.513815" "-4.43" "0.11994912" "" "CCTTGAAAATAATTACAGTTGACATTTCCATCGGTGAGACCAAACGCTGGTCTCACACAG" "58549" "1" "0.168604" "1.5137852" "-4.43" "0.25458249" "56700" "CTGCGCCACAGGCGGTATTCTGAGTACCAGTCCATAAACTGAAACCCACTCTCCAGAGGG" "53517" "1" "0.168633" "1.5136689" "-4.43" "0.36461333" "" "TCTCCTTGCTTTCTTAAACCTATAGTAACAAATCTTCACTAGGTGAAAGGAGATTATCTC" "32180" "1" "0.168634" "-1.513668" "-4.43" "-0.15573572" "192195" "TAGTAAACACATCTTCATTACTCTTTTCCAATACTGGACCAATGATGTCCTAACTGTACA" "23820" "1" "0.168677" "-1.5134921" "-4.43" "-0.25283331" "104175" "AGGCTTAGAAGACAAACCACAGAGGAAACCTCCCCCTTTACAAGTTTTCTGTGAAGTACA" "12464" "1" "0.168701" "-1.5133981" "-4.43" "-0.12652807" "52202" "CTGTGTAACTGTTGAAATTCCTCCTTTAGAATGTGTGTGCTACTATGATTGTGTAAATCA" "24029" "1" "0.168703" "-1.5133878" "-4.43" "-0.12644997" "213993" "AGGCACACTTTCCTCAGAAGCATCTGATTTTAACAAAGTGCATTTGAGTAGACGCGGTGG" "42532" "1" "0.168721" "-1.5133165" "-4.43" "-0.16754205" "" "GCACAGAGGAAATCCTGGACATGGAGAAGAATACTCCAGAAACCAGCTGTGTTCTCAGGT" "23995" "1" "0.168734" "-1.5132649" "-4.43" "-0.19522049" "53404" "AAGAAGCTGTCCAAGTACGAGACACTGCAGATGGCGCTCAGCTACATCATCGCGCTCACC" "44341" "1" "0.168744" "-1.5132265" "-4.43" "-0.15836626" "52064" "TAAAACCAGCACGATTGCAATTCTCAAGTTTGTTCATAGTTTCTTCCATGACAGATGTTT" "54502" "1" "0.168774" "-1.5131037" "-4.43" "-0.16917828" "75659" "TTCATCTGTGTGGGAACGTGTTCCGGTCGAGTACTGGTCTTTGATATCCCCGCTAAGGGT" "59352" "1" "0.168778" "1.5130878" "-4.43" "0.44508231" "17305" "ATGAAGGAAAGGCCAAGACAATCTAAAGTTGTTCTCCCTAACACCTCATCTGTAAGAAAT" "215" "1" "0.168789" "-1.5130444" "-4.43" "-0.24793063" "" "GGATGAGAACATAGAACCCCAATTGCCTGAATGACGACACAGAGGCCCCAACTGTCTGGA" "46402" "1" "0.168795" "1.5130211" "-4.43" "0.25616989" "328795" "GGCTGTGATAATGGTTACAAAGGCATCCAATGATTACAAAGTTATCCTAGCCTCTCGCCC" "50278" "1" "0.168803" "-1.5129872" "-4.43" "-0.16959642" "" "GCCCCCCATCCATCCATCTTCATGGAACTTGCAAACAAGATCTACAAGCAGAGAAAGTGA" "24932" "1" "0.168812" "1.5129521" "-4.43" "0.45079535" "69537" "CATGCACTATACTACATGGCTCTGCCAGTGTTGTCAGGTTTAAAATATTCAATAAAATCA" "888" "1" "0.168832" "1.5128701" "-4.43" "0.57780525" "66681" "AAACTTATTTGGAAACCTGAGAAACTATGACGGGAAGAATAATTATCCCAAAATGTGTGG" "24680" "1" "0.16884" "1.5128412" "-4.43" "0.15494339" "" "ACATCTAGATCAGGAACTTCAAACCCAAATTCACATCCTATGGCCATAACAATCTCTACT" "27477" "1" "0.16884" "-1.5128402" "-4.43" "-0.21777017" "" "TATTGAGGTTGAGTGTCTGAGCCTAGTTTGTTAGGGTTACCAGGACACATGTTCTGACCT" "30895" "1" "0.168847" "1.5128111" "-4.43" "0.24741018" "435626" "TCTTGTGTTTCGCAGATTTACTGAGTCGTTGTTGACATAGAATAAACATTGTGTAAGTGT" "49648" "1" "0.168852" "-1.5127904" "-4.43" "-0.20309413" "71835" "GTGACTCTCCCCAGTATGTTTACTTATACTTGTTTGGTAGATACTATTATCTTTTTGACC" "7582" "1" "0.168861" "1.5127561" "-4.43" "0.65000142" "76681" "AATTGCAGAAGCTGAGGCAAGAGAAGGAAGACATTCTCAACAACCTGGCAGAGTCTGAAA" "20773" "1" "0.168863" "-1.512749" "-4.43" "-0.16159788" "" "ACTTAACAGAGGAGGAGGCTTTTTAGTGGGGAGGGGGAATTACTTGGAGCCTGTGGTTAG" "6127" "1" "0.168891" "1.5126361" "-4.43" "0.4934869" "12827" "CAGTCTTCCTAAAATGAGGCAGAGTCTAGGGGACAGCAAAGGAATCTATGGCCAATGATA" "58747" "1" "0.168947" "-1.5124096" "-4.43" "-0.1347812" "" "" "1708" "1" "0.168966" "1.5123344" "-4.43" "0.96972348" "" "GCACTAACGGAATCTTATCACTATGTATCACCAGAAAACATGAAGACCACTAAACTCAGA" "35810" "1" "0.16901" "1.512157" "-4.43" "0.65544928" "627607" "ACCAGACCAAAGGCCAAAAGGAAAGATGCCATGACCAGACCTAAGTGCGAGAAAATAAAA" "35626" "1" "0.169037" "-1.5120497" "-4.43" "-0.41630871" "" "CCCCAGTGTGGCATTATCAATGACTATCACAGACACTTTACTTTTCCAATTAATTTTCAA" "36370" "1" "0.169038" "-1.5120466" "-4.43" "-0.13386633" "" "CAGAAGTTCAGCCTACTTCAGACCTCACAGTTGCAGCAGAGCGCTGTCCAGTCTGTTTGA" "38457" "1" "0.169044" "-1.5120203" "-4.43" "-0.16877705" "627788" "GGCCTCATTCTCTGTACAAGCCTGTGGTTATAAAATTAGTTAAACAGCTTACATTTGTAT" "11227" "1" "0.169055" "1.5119792" "-4.43" "0.32296437" "13614" "CAGTAAAAATATGTTCCCGTATGTATTGTAACTGGCTAATGGAAGAGGTTAGATTGAATC" "29121" "1" "0.169081" "-1.5118755" "-4.43" "-0.46895061" "" "TGCTGGAATGAAAACAAATGTCTCTCCATCCAATAAAGTTTTCCCAGGATTCCAAAGATT" "2563" "1" "0.169084" "-1.5118628" "-4.43" "-0.18272843" "72421" "ACTATTCGATATAACCTGCACTTTTAAATCCTGTCAAGTGAGATTGTGTAAGAACCCAGG" "31145" "1" "0.169157" "-1.5115695" "-4.43" "-0.17458543" "26918" "ATGATGTCCGGCCTGGCCCATCTACATTCCTTACACATAGTACACCGTGACCTAAAGCCA" "31852" "1" "0.169162" "-1.5115498" "-4.43" "-0.17599748" "227580" "GACCTGACCTTTTCTTTAGATAAGTAAGCATTATTTTCTCTGTTTAGGCCGGAGAAAAAA" "24731" "1" "0.169302" "-1.5109869" "-4.43" "-0.16609376" "" "ATCTGTTTCTCTCTCATCTAACAAGCTTAAAACTCCTTCTCTACTGGCAACCGTTGCAAA" "28416" "1" "0.169308" "-1.5109645" "-4.43" "-0.23816076" "" "" "33179" "1" "0.169361" "-1.5107514" "-4.43" "-0.12199294" "80720" "AGGGAAGTTTCAGGAAGAAGCCACCATGTACACAGGGAAAGCATCCACAGTCACCAAGGC" "26511" "1" "0.169361" "1.5107506" "-4.43" "0.19428439" "241197" "CCGACGTTTTCAGCCAGAGTAAAGCTGATTTCTCAAACATGACTTCAGAGAGAAATCTAT" "10983" "1" "0.169377" "-1.5106901" "-4.43" "-0.16307925" "14266" "TGTGCATTTTTGATATCTGTGAAAAACTGAAGTCATTGTAAGTGGACACTACAACTTGAG" "24488" "1" "0.169391" "1.5106319" "-4.43" "0.58332494" "23871" "ACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTTCGCTACTATTATGACAAAA" "54914" "1" "0.169393" "-1.5106229" "-4.43" "-0.14954414" "12561" "AGAATCCTATTGACCTGTACATCTACGTCATTGACATGAACGACAACCGTCCCGAGTTCA" "32086" "1" "0.169416" "-1.5105318" "-4.43" "-0.16334491" "76156" "GGGGTTTTATCTGGGCTCGCACTCCAGAAACCCGTCATTCCAGGAACTGAGACCCAGACA" "35198" "1" "0.16942" "-1.5105177" "-4.43" "-0.18373045" "213582" "CTGTCTCTCGCCTCTCCCTGTCTTCTATGTTCCTTACATGTATATACATATATGTATGTG" "9652" "1" "0.169426" "-1.510492" "-4.43" "-0.20863522" "280645" "GATCCCTCATAAAACTGTGCTTTGAAAATATGAAGCTGGATTTCTATCTCACTGATAAGA" "28895" "1" "0.169444" "1.5104188" "-4.43" "0.33341571" "434171" "GGGAAGAAGATTGAGAAGAAAACTGGCATCCCTTCCTTCGGGGGTCTGAGAACCTCCACC" "9006" "1" "0.169475" "-1.5102969" "-4.43" "-0.13536604" "" "TTTCCAAATCAAGGACAAGGAGTGACCCAGGAGAGACGAGAGAATGGGGTTGTAAAAAGT" "19810" "1" "0.169476" "-1.5102915" "-4.43" "-0.16251799" "72341" "AGATGATCCTGATCACACCTCGTTCCGTAGTAAAGGTCACCTCAGAGGGAATGAATACAA" "38528" "1" "0.169489" "-1.5102396" "-4.43" "-0.15282431" "" "CAGAGCCCTCAACAGCCGTCACCCACCCAGCCTGGCTTGGGACTGTTCCGTGTCCAGCCC" "26439" "1" "0.169504" "-1.5101817" "-4.43" "-0.20588343" "12419" "GGTTGGTTGCTTTGGGAGATTTTATTATGACGATGACTTCAGTTTCTTGATTGTTATTAG" "41624" "1" "0.169511" "-1.5101534" "-4.43" "-0.18007536" "71242" "ATTTAGTCAGTAAAGAAGAATTCCATGAAATAGAGAAGAAACTGGTGGAGGAGAAAGCTG" "30672" "1" "0.169517" "1.5101294" "-4.43" "0.47819994" "12977" "TGTGGGGCTTACTTAGCCTTCTGGTTACAGACTATTTCCATGCTAGAAAATACATATTTT" "50265" "1" "0.169558" "1.5099644" "-4.43" "0.25124769" "16195" "ATCTTCTCACAGTAAGCAGTCTAGTTATGGGACTCTATCCATGTTCAGCTGTGACTTCCC" "24782" "1" "0.169593" "1.5098244" "-4.43" "0.36063132" "" "GGCATCTCCTGAGGCATCGAGATCATTTTATTTCATATAAACCAGCAAAGGAATTTTAAT" "54552" "1" "0.169612" "-1.5097509" "-4.43" "-0.26608874" "" "CTAAGCTTCTATAAAACTGTGGGTTGAGAACCCCATACAAAACTGTGTAAAGTGAATGTG" "60239" "1" "0.16962" "1.509717" "-4.43" "0.14621807" "628456" "CCCATCCCCAGCAAGTGATGGTTCAGCAGGAGTTCACAGCGAATGACAGTATCCTGGCTG" "38405" "1" "0.169625" "-1.5096951" "-4.43" "-0.20030397" "110196" "TCTTCATGGAACTTGCAAACAAGATCTACAAACGGAGAAAGTGACCCCGGAATTGGAGAG" "10313" "1" "0.169631" "-1.5096745" "-4.43" "-0.14450639" "" "CTTCCTGCACCATCTACGTCAGAGATCTGTTCCTTCCCCTGGCTCATTGCGCCGTGTTTA" "37291" "1" "0.169637" "1.509651" "-4.43" "0.28501851" "630845" "AAATGGACATTCCAGCATGTATTGAGAAAGCTGGTGTGTCATTGTGGAGGTTATTCTTGA" "40012" "1" "0.169658" "1.5095643" "-4.43" "1.37514634" "" "ATGAGGCACTTCAGAAACCCAGGAAACTGGAGAAAACAATATCCACGAGCCTTGGTAACA" "38572" "1" "0.169672" "-1.5095092" "-4.43" "-0.11633498" "68079" "CCCATGGAAGAATTCTGTGTTCTACAAGAAGACCCAGATGAATTTTTATTTAAGTAGAAC" "18791" "1" "0.169711" "1.509353" "-4.43" "0.13859278" "" "" "52567" "1" "0.169715" "-1.5093364" "-4.43" "-0.17446924" "70317" "GTGGTTGTGACCTCACCAGAAACAAGAATGTTCTCATTGATGGATTTATTCAATAAACTT" "25494" "1" "0.169725" "1.509297" "-4.43" "0.26802758" "258740" "AGGAATAAAGATGTCAAAGTTGCCTTCTATAAGGTTGTAGGAAGAAGAGAATTCATGTGA" "5790" "1" "0.169737" "1.5092492" "-4.43" "0.45526926" "14290" "TTCTTAATCACTCTCATTGCCATGGATCGTTGTACTTGTGTCCTGCACCCAGTATGGGTT" "34890" "1" "0.169747" "-1.5092111" "-4.43" "-0.14409935" "53978" "CCTCACAAGTTTGGACCACTAATATGTTTTTGTACAAATACAGGACATATGCATAGGACC" "17205" "1" "0.169752" "-1.5091884" "-4.43" "-0.16985141" "" "TAAAACCATGATGAAGTAGAAGGAGAAACTGGTCGTCAACGTGAGCATGCCAGACAAGTC" "31632" "1" "0.169753" "-1.5091855" "-4.43" "-0.15922507" "" "CATGGGAGACCTGGGTTTGTTCATATTATTACAGACAAGAATGTAAAGATAAAACTGTAC" "33541" "1" "0.169765" "-1.5091371" "-4.43" "-0.38082675" "494497" "CACTTCCTTGAAGGATCAATATTCCTGTTAAGAGAGAAAAATAAAAGCAATTGAAATAGC" "18501" "1" "0.169798" "1.5090062" "-4.43" "0.41018767" "217578" "TGAGCACATGGTTTCAACACTACACATGAATGAATCCAATTCTCTAGCTCTGACGTGCTG" "1132" "1" "0.16982" "1.5089203" "-4.43" "0.14102148" "" "ATAATCTGGAGAATGAGATGTTCCTCTGGGAGGATTTAATGCTGGGGGGTACAAGTGTTC" "56590" "1" "0.169823" "-1.508908" "-4.43" "-0.14942661" "258481" "TTCAACAAAAAGTTCTCAAGATCATGCCAAGTTCATTGCTCTCTTCTACACCGTTGTCAC" "40592" "1" "0.169837" "-1.5088491" "-4.43" "-0.21381679" "20604" "AAGACATTCACATCCTGTTAGCTTTAATATTGTTGTCCTAGCCAGACCTCTGATCCCTCT" "12974" "1" "0.169842" "-1.5088316" "-4.43" "-0.18508911" "20726" "GCTTAAATGGATCTTTTCCTCACATTTCCTACTGGAATTCCCTTTGTATAGTGTGTTTAA" "25476" "1" "0.169858" "-1.508767" "-4.43" "-0.14452922" "" "TTATAAAAAACAAGAAGGCACCCCCGAGGGATTCAGTCTCTAGTGACCCACAGTTGTCTT" "50632" "1" "0.16989" "-1.5086408" "-4.43" "-0.18823236" "68693" "GTGTTTTATCAGATGTCTGTTGTAGTTGTAGATGGAAAAGCTTGTAAACAAACAAACACC" "5037" "1" "0.169915" "-1.5085412" "-4.43" "-0.25847952" "245631" "GCTCTTTTATGTTCATCTCACACAGCTCTATGTTTATGTACAATTTGCAGAATTTGGGTA" "44442" "1" "0.169924" "1.5085044" "-4.43" "0.13121737" "271221" "GTGAAGGACCTTCAGGAGCAACTTTTTCATATCAAGAAGCTATTGAAGACTTGCAGGTTT" "8275" "1" "0.16993" "1.5084793" "-4.43" "0.91559455" "" "CCATGAGAAGTGGACTCAAAGTGTTGACCAGAAGTCGACCTCCGCTGATGCTCAGTACAA" "21089" "1" "0.169932" "-1.5084701" "-4.43" "-0.16032709" "271842" "TTGTTTATTATTTATTCTGGACATAAAATCTTAACAAAAGAATTAACAGCCCAATTACAA" "27261" "1" "0.169953" "-1.5083869" "-4.43" "-0.53869259" "67588" "TTTATCGTGCACCGAATGTAAATATAATGGAACTCTCCTGACACTTAAGTTGAGGGAAAG" "36455" "1" "0.169973" "-1.5083091" "-4.43" "-0.20575885" "56873" "CAATATTTAATGTATATAGGCAGAAGTATTATAGGGTCTTTAAATATGTGAACATATGTA" "61924" "1" "0.169989" "-1.5082458" "-4.43" "-0.17580127" "66580" "GTGAAAGATGGAAGCTGTGAACTTTCTTTCTGTGCTTAGTAATTTGCATGTAGAACTAAT" "4959" "1" "0.170009" "-1.5081644" "-4.43" "-0.12506878" "67872" "TGTAGCTTTTGATAGTTATTGGATCTGTCATGGTTGTCTTTGATTAAAGGAAATCCACTG" "11743" "1" "0.170041" "-1.5080362" "-4.43" "-0.14738095" "" "TCAGCTGGGCTCGGAAGGCTGCTCCACACCCCATCTTCAGGACTCACCAGCAAAGATATA" "17290" "1" "0.170041" "1.5080353" "-4.43" "0.14274999" "320099" "ATATGCTCCCAAAGACCTAGAAGAGGTTATCACTTAGGGAAGTGCACTTTCTACCCTGAG" "50375" "1" "0.170053" "-1.5079887" "-4.43" "-0.16430053" "233056" "CTGCACTTAACTGATAGTAAATTCTCAAAAGGGACCTGAGAGGAATGTGGAAATGCCCTT" "38390" "1" "0.170066" "-1.5079392" "-4.43" "-0.14098678" "69020" "TAGCGGGCTACAGAAAGAGCTGGATGCAGGCTGGGGCGGCTTGTGAGGAGTAAACTACTA" "10584" "1" "0.170068" "-1.5079292" "-4.43" "-0.16671605" "226646" "TTCTCTCTTCGGATTGATGAGGTGGAGGAGATGCTGACCAACAATAGAATCTGGCGAAAT" "28506" "1" "0.170073" "-1.5079094" "-4.43" "-0.18357408" "320563" "CGGAGCCCATGTCCTTTTCTAAATGCTTCTGTATGTAAACTGTCAATAAAATAATCGATT" "11561" "1" "0.170094" "1.5078266" "-4.43" "0.33980879" "" "CCAGAAAGCTGATAGACTTGGAGCAATTGTATTATAAGAAGCATCTACAAGAAAAACAAG" "32079" "1" "0.170104" "-1.5077866" "-4.43" "-0.18035344" "69861" "TTGCTATATGCCTGAGAAGCCCAAACATGCATATGGCTGCCTTTGGACTTCATGATATCC" "11960" "1" "0.170111" "-1.5077586" "-4.43" "-0.24758102" "" "AGAGAAGTTGCCAAGTGTCAATCCTACCACATCACGTTCCTACGTCTGCCCTGTCCTCCA" "2647" "1" "0.17012" "1.5077214" "-4.43" "0.26765244" "626995" "GACTGTGATACACGTTGTATCTATGGAAATCAGACCACATTTTGTGAATGCTTGGAGTAA" "50498" "1" "0.170135" "1.5076605" "-4.43" "0.30323043" "15248" "CTTTGTATATTCTCTACTCTGTACACAGGCTCTTCCAGAGCCGCTTCCATTTTCTATACT" "46242" "1" "0.17016" "1.5075635" "-4.43" "0.14747788" "78648" "TGAAGAAGCTGAATTGCAGAAGCTATCTCTGTCCTGTTAATCACCGGGTCCACAGTGAAA" "28104" "1" "0.17017" "-1.5075235" "-4.43" "-0.19061712" "" "GGAGCTCACCTGATTAGAAGACCAGTGTCACCCAGCTTCTTTGAAGTTCACATGGGTGTG" "1480" "1" "0.170192" "1.507437" "-4.43" "0.60571795" "21391" "TTGTGTCACGCTGATATAGAAGGCACGTGGGAAAGAGGAAGCACTTTGTAATGGTAACAT" "59272" "1" "0.170205" "-1.5073832" "-4.43" "-0.1487076" "70465" "GTACACGTGTGAGTGCGGTATATAGTTTGGAGTGGAGAAAATTATTCTTCAGCTTTCCCA" "41182" "1" "0.170222" "-1.5073148" "-4.43" "-0.14588645" "27373" "CGAACATAGATAGGCCTTGTCTTCTGGACACCAAGAAGGGTACATTGACTTGGGGCTCTT" "26752" "1" "0.170226" "-1.5072988" "-4.43" "-0.16135245" "" "AACTGAAGGTCCCAGCTATGGTATTCTAACCAGCCATGGCCAGCAAACGGCAGAGCTGGG" "26117" "1" "0.170233" "1.5072713" "-4.43" "0.2343259" "" "TAGCTTCCCAGGGAGATACAACTCTGTATTTTACAATTATAATGACGTGCTGACTCTAAG" "37801" "1" "0.170248" "-1.5072113" "-4.43" "-0.22331377" "53621" "AGTGAGTGGGGTACTTCATAAGGCAGAATGTAAAGTGATGCTTTGATAATGCAAAACTTC" "25244" "1" "0.170272" "-1.5071161" "-4.43" "-0.18852083" "" "GATAAGAGAACAAGAGGTTCTACTTCCTTGATCCCAAAGGTTTCAGTCAGATTCAGATCA" "44197" "1" "0.170281" "1.5070802" "-4.43" "0.13020796" "" "" "39493" "1" "0.170283" "-1.5070714" "-4.43" "-0.13372575" "93708" "CTTCAGCTTCTGCACTCCAGGCTCTGGGTTTTCACCTTGGAGACAGGACAGCACAGTTAC" "21123" "1" "0.170284" "-1.5070691" "-4.43" "-0.12963178" "71991" "CTGAGTTTGGGATATTTCCCTGTGTGCTTTAAAATGAGATCGATGTGTATGATACCCTGA" "1736" "1" "0.170284" "-1.5070678" "-4.43" "-0.33222165" "" "TAACAACAACAAAAAGTTGGGTCAGTGATTCTGCTGCAGAAGATAAGAGCCCTTCTGGCC" "4487" "1" "0.170286" "1.5070596" "-4.43" "0.17240908" "" "CTCACCTCCCAGCCCCTCCCTTACAAGTCCCTCCCCACCTGCTAGCCACCTGCACCCAGG" "5328" "1" "0.170307" "1.5069761" "-4.43" "0.30285256" "100042951" "TACCTAATCGCTAAAATTTTGCACTTTTTGGCTACTTCACTAACGAATTCGAGGTGAAGG" "9450" "1" "0.170311" "1.5069619" "-4.43" "0.17220434" "" "TGAGCATGGCTCTCTGTCAATGAATTCTTATCACATCCACGGACTTTATACTATATGGGC" "8558" "1" "0.170355" "-1.5067862" "-4.43" "-0.17188107" "" "TGATTTCAAACTCAGAAGTGTCTTACTGAGAGACCTTCTAGTAGATTACACATGATGACT" "35832" "1" "0.170369" "1.5067317" "-4.43" "0.2340033" "258363" "ATGTTGGTCAACTTTCTAAGTGAAAATAAGTCCATTTCATTCCTTGCATGTGCAACCCAA" "35074" "1" "0.170375" "1.5067071" "-4.43" "0.28407491" "" "TGCGAAAATCCCCTTAGCACTGCTCTTTCCTCTTTCCGCTCTTGACATTCAAATGCACTC" "33778" "1" "0.170375" "-1.5067047" "-4.43" "-0.13446586" "" "GCTGTGAACAAGTATGTCTCCCATCTTCATCAACAGTTAACAATGAATTAAATTCACATC" "10969" "1" "0.170378" "-1.5066929" "-4.43" "-0.11571936" "67630" "TTTTGTTTTTTCAGAGACAGGGTTTCTCTAATTCAGGGATCACCTGTCTTTGCCTCCCAT" "35471" "1" "0.170396" "-1.5066221" "-4.43" "-0.12094324" "66354" "CTAATCCAGCTGTAACCTTTTCTGTAAACGTTATGAATAACCTCACCTCAAATGGTGAGT" "27178" "1" "0.170397" "-1.5066182" "-4.43" "-0.17424674" "320506" "ATAGTGTTAGTGTCCTGAGCATGTGTATTCTAATTGGGTGATGTATTATTCTTCTCCGTC" "5365" "1" "0.170403" "-1.5065952" "-4.43" "-0.1777178" "272031" "AACCTAAGAGAAATAAATTCTGGAGTGAATGCTGTTCCTCTTTTTTAGTGGATTGCAGAA" "21736" "1" "0.170473" "1.5063151" "-4.43" "0.1576383" "100043726" "TGTCCTCAGGGGAAAGCTATTTTAGGTAGCAGTCAAAATAAAACTGAGATTAACCCAGAA" "17851" "1" "0.170488" "-1.5062557" "-4.43" "-0.18552874" "54156" "CATAACATGCCTTTTTTGTATCAAATGTACTAAGACTTGCCTATATATAGTGCCACTGTG" "52023" "1" "0.170523" "-1.5061166" "-4.43" "-0.25869873" "68149" "AGGCCAAGCCCTACAGCTTCCCTCAAGTGAAAACATTTCCCTAACATTAAACGTTTCTAT" "21168" "1" "0.170542" "-1.5060419" "-4.43" "-0.13846807" "11569" "GTGTTCCTCAAGGTTGACATTCTCTGCCTGAAGAAAATGTGTCTTTACAAATTTTACAAT" "42178" "1" "0.170555" "-1.5059913" "-4.43" "-0.17679624" "107515" "GCTCTGACATTTCCAAATTTGTTGAAGTTATCTATCATTCTGATTATACAGGAAGCACAC" "45303" "1" "0.170556" "1.5059881" "-4.43" "0.12669414" "21819" "AGAGTGAAGAGGAAGACTTGGAAGTTGGACCTGGATTAGAAGAAGACCTCTCAGGCTCAC" "27746" "1" "0.170561" "-1.5059668" "-4.43" "-0.36709469" "382156" "CATTAAGAGAACCTATCTCTGAAAGAAAAACTATGGCTAAATGTACACACGCACTTGTGT" "9483" "1" "0.170598" "1.5058207" "-4.43" "0.44906348" "14345" "ATGTTAATGAGATATTGGCCAGGCGTCTTAGTATTGTCGGAAGTCTACACTGGGTAGCAG" "42699" "1" "0.170621" "-1.5057292" "-4.43" "-0.14386892" "11739" "CCAATGTACTGAGAGGCATGGGTGGTGCTTTTGTATTGGTATTGTATGATGAGATCAAAA" "43227" "1" "0.170632" "-1.5056848" "-4.43" "-0.16739192" "26428" "ATTGAGCTACTCAAAAGAACTGCTATCTATGGAGAAAGCAATTCTGTACTCATTGTTGGA" "47801" "1" "0.170637" "-1.5056658" "-4.43" "-0.19062007" "320799" "CCTCGGCGGTACTTCCAATCTTTTAACTGTTCCTAAATAAAAATGTACAGACACTTCTTA" "16959" "1" "0.170641" "1.5056498" "-4.43" "0.65687756" "628900" "ATGATGAAAATAGAGGAACTAACTACACCCTACTTCCGGGATGATGAGCTGTCCTGCTCT" "2523" "1" "0.170672" "1.505526" "-4.43" "0.15906305" "" "AAACCTGTTCCTCATCTTAAAACAATCTATTTCCAACCGGAGAGAGTTAGGAGTCATTGA" "59870" "1" "0.170693" "1.5054415" "-4.43" "1.08849743" "19354" "TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG" "2835" "1" "0.170707" "-1.505388" "-4.43" "-0.15785523" "69478" "CTGTGTGTGTGTATGCAGTATTTATTTTTGATCCTTTAAAATAAAATGCTGGCAAAGCCG" "24067" "1" "0.170713" "-1.5053642" "-4.43" "-0.53188678" "15564" "TTTTAGGTATTGGTGAGCATTTGTTAGACCTCACATGTGACAAAGTTGATTTGCTTTTCC" "39255" "1" "0.170714" "-1.5053591" "-4.43" "-0.1459639" "74931" "TGGAAGTTCTGCGGAACAGCAAGGAGTACAGACGCGAAGGGATCGTCGGCAACGACATGT" "20123" "1" "0.170718" "-1.5053422" "-4.43" "-0.13944723" "72508" "TGGAAAGGTTTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAGATATTTGCCAT" "44754" "1" "0.170719" "-1.5053409" "-4.43" "-0.16773984" "" "AGCCGCTCCGACTCTGGCCCCGCACTGCCGAGCCCGCGCGCGGGAGGAGGGCGAGGGGCG" "54729" "1" "0.170724" "1.5053198" "-4.43" "0.14995217" "" "TATACACCACACATGGAACTATCTGATTAGGGAGAAATAAGATTTATACAGTCGGAGAAT" "924" "1" "0.170729" "-1.5052973" "-4.43" "-0.44284418" "12958" "GACACTGTTTGAGGGGGAAAACTTCCAGGGCTGCAAGTTTGAACTCAGTGATGACTACCC" "28274" "1" "0.170732" "1.5052863" "-4.43" "0.211651" "" "AACATTGTTAAACAGGACCTGAGAGAAGTTGCCATGTTCTAGCAAGGTAGGTATGGGGCA" "56297" "1" "0.170778" "-1.5051054" "-4.43" "-0.13478153" "57436" "CAATCTGTACGTCTGTTTTGTCAGCTTCAGGTTCTGGTACTTTGAAGTCAATGCTGTCAG" "59582" "1" "0.17078" "1.505098" "-4.43" "0.28659146" "76281" "GTATGATGGTATCCCATGTTCAACACTTGTGTCCAATAAACAACGCTGGAATTCAAAAAA" "36309" "1" "0.170782" "-1.5050883" "-4.43" "-0.1780541" "104662" "TCGAAAAATGAGGTAGACATTTGGGTTTGTTGTGATAAGTATGTGATCTACTGTCAGGGT" "57206" "1" "0.170786" "-1.5050727" "-4.43" "-0.37622607" "52348" "GCTTCAAGGAAAAGAGAACAATTTGCCACTGTAGAAGAGCTAAAGAAGAGAAGCTTCACC" "39760" "1" "0.170801" "-1.5050139" "-4.43" "-0.26838287" "24066" "AAACAAGTTAAAAACTGAATGTACTGATCTAGAAGATATCTATAAATATATATTGTTAAA" "50533" "1" "0.170811" "-1.5049717" "-4.43" "-0.21641424" "237250" "CAAGACATGGCTGCTGAGCAAGGCAGCTGCTCACACTGCCGTGTGGAAATTCCGCATTGA" "51639" "1" "0.170813" "-1.5049672" "-4.43" "-0.19111073" "" "ATATTGCTGCCTACAGAGCTAAAGGAAAACCTGATGCAGGTAAACATGGGGTGATCAAGG" "13754" "1" "0.170836" "-1.5048748" "-4.43" "-0.17872738" "" "ACAGAGAACAAATGGGAAAAAGTCTCCCCCTAGCAAAAATGTTGGCAGCACATTAAACAG" "49514" "1" "0.170836" "-1.5048745" "-4.43" "-0.16646802" "320595" "ATTTCTGATGCAGGGCCTTTTTATAAATAGGTTAGAGTAGCCTCATCCAGATTTCTCTGT" "15771" "1" "0.170868" "-1.5047471" "-4.43" "-0.16192274" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "56668" "1" "0.170871" "-1.5047342" "-4.43" "-0.20722107" "" "GAGTCAAGGTTTAATTAACATAACACCGCTGTCCAACTCAATAAAACTTGGTCTGTAGTG" "29258" "1" "0.1709" "1.5046211" "-4.43" "0.64610414" "" "AGTCAACCGCCAAGGTCTCCAGCAGACTGCGGACTCCCAGTAATTGACACAGTGAAGCCA" "6929" "1" "0.170906" "1.5045962" "-4.43" "0.66756182" "" "TTCTTTTGGTTTAACTTTGGAAGCTCGAATGGCCATGCTGGTGTGGGGGAGGGCCAGCCT" "3868" "1" "0.170915" "-1.5045606" "-4.43" "-0.21238321" "" "TATTTGATAACACATTCAAAATGGCACCTCTGCACCTAGAGCCCGGAGTAGGAACATGAC" "29702" "1" "0.17092" "-1.5045397" "-4.43" "-0.21370074" "" "AGGGCTATGAGCCAAGGCTCTGCCTCCATACAAGATCTTTCTGGACCAGTGTGGATGGGG" "4776" "1" "0.170923" "1.5045284" "-4.43" "0.17156265" "" "GCTGTCTAGTGGCTTCCGCAAGTTCCTGGTCCACAATATCAAGGAGCCGGAGGTGCTGTT" "41991" "1" "0.170928" "1.5045104" "-4.43" "0.3160555" "215798" "GCAAACTAGAATTAGTAGTGAGAAACTGCTAAAGCTGATTTGCCATTTTACTGAAATGGA" "643" "1" "0.170958" "1.504392" "-4.43" "0.31262796" "" "CTTTTGGACATATATTCAAGGAACAAAACAGAACCATACATGTTTGTAGGAACTATGGAG" "47817" "1" "0.17096" "-1.5043822" "-4.43" "-0.13967273" "" "TGCGACTTCAACAGCAACTCCCACTCCTTCGATGCCAGGGCTGGCATTGCTCTCAATGAC" "36123" "1" "0.170966" "1.5043587" "-4.43" "0.37810413" "18442" "ATTCCACTGTGGCCAATCCTATTTCAATTTAAAATTACCAATACAAAGGCGAACCCATTG" "7354" "1" "0.170968" "1.5043489" "-4.43" "0.1521226" "" "AAATGCTTTCCTTTTCTGGTATGTGCACTATCTCAATGAATCCCCTTGGCTACTCCTGCG" "5338" "1" "0.170982" "1.5042951" "-4.43" "0.210942" "19668" "GAGCAGGAAGGAGAGAGATAGCTCACCTGACCTCAGGCCACTCACTGTCCTCAGACATAC" "32804" "1" "0.171002" "1.5042163" "-4.43" "0.23931501" "434232" "CCTGCTACTGACAGAAGAAGAAGCAGCAGTCAGGATCCAGGCCTTCTGGAGAGCCTATCT" "5655" "1" "0.17102" "1.5041436" "-4.43" "0.86810096" "" "" "37818" "1" "0.171093" "-1.5038529" "-4.43" "-0.22305149" "15893" "TATGCTCGGTGTGCTGTTTTAATATTTACATGCCATTTTAATAAAATGAGAGGGTCAAGG" "4679" "1" "0.171095" "1.5038486" "-4.43" "0.15610923" "" "CTCAAAAGCATCCATAATAGAAATTTAACTAGGAAGAGATGAGCTAAGTGGACTTGTTAC" "19603" "1" "0.171107" "1.5037986" "-4.43" "0.31961255" "67268" "ATGTACCTTATAATACTGGAAATGGGACCTTCTGTCATTGTGATGAGAAAGTAAGTTCAT" "19699" "1" "0.171127" "-1.5037213" "-4.43" "-0.15691025" "" "GGGGCTTCTCTAGCTGGGCCCTAAGGCCCAAGGCTTATGGAAATTGTAGTTTCTTGGGCC" "8880" "1" "0.171129" "-1.5037141" "-4.43" "-0.14143074" "19016" "GCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCACTATTATTTTGAG" "22485" "1" "0.171129" "1.5037124" "-4.43" "0.44828218" "" "ACTGGTTAAGACCACCAAGACTAAATGAAGTTGTTTGTCACGGACATCTTGGGAGGAAGA" "44832" "1" "0.171162" "1.5035795" "-4.43" "0.27626316" "" "" "58054" "1" "0.171177" "-1.50352" "-4.43" "-0.20688388" "211556" "AGTGAATGATCTTTGAAAGATTTTTACACAGAACATATTCTGTGAATGATTTAAGAAAAC" "49921" "1" "0.17118" "1.5035083" "-4.43" "0.74901462" "11576" "GTGAGCCTTTTGGCTTAACTGTAACTGCTAGTACTTTAACCACATGGTGAAGATGTCCAT" "29010" "1" "0.171181" "-1.503508" "-4.43" "-0.16762296" "192191" "TCCCATTAACAGCAGTTTCATGAAACATTTGCATAGAATTCACGGGGTACATTAGGCCTG" "22321" "1" "0.171181" "1.5035054" "-4.43" "0.54450204" "216991" "TGGGGTGACCCATCTCGGAGGATCTGGCTGGCTACTGTGCATCTGAAGTTCTGGAGAAGT" "22032" "1" "0.171186" "-1.5034863" "-4.43" "-0.2884699" "" "CAAAATAGAAACATCAACCGGGAGAGAGGCCGGGAGTAGGTGGCGTTTGAGGCTCCTGCA" "49840" "1" "0.171207" "1.5034019" "-4.43" "0.19582994" "170716" "CGGGCCATCCCCAAAGGGAACATCTGTGTCATCAGCATTTTCGGGGTTCACCACAACCCT" "52336" "1" "0.171217" "-1.503362" "-4.43" "-0.13079293" "21399" "ACTTGTTTTGCTAGTAATAAGCAGTGGTTTTCACATCGTCTTCCTGACACAGATGTTGTA" "16091" "1" "0.171219" "-1.5033551" "-4.43" "-0.15287614" "" "GCCGATAGTCTATGAAGGAAATGTTCCTTTTCTGCTGTCAAGTACAAATATATTATATCC" "9250" "1" "0.17122" "-1.5033507" "-4.43" "-0.29662907" "224019" "TACTATGGAGGGGAGCAGCTAAGTCAACAGCGAGCGGAGCAGCAACTAGGGAACCAGCTT" "52675" "1" "0.171244" "-1.5032563" "-4.43" "-0.14710065" "67480" "CAGAGGTGCTCTTAATTCATATATTAAGCCATTTCGTTGTTCTACCAGTTCCTAATTTCT" "20521" "1" "0.171252" "1.5032231" "-4.43" "0.12690344" "233204" "CATCAATGAACTGACCATGAAGCTGAGTGTGGAGGATGTGCTGACACGGGCAGAGGCTCT" "13427" "1" "0.171258" "-1.5032019" "-4.43" "-0.14114571" "" "" "33397" "1" "0.171296" "-1.5030524" "-4.43" "-0.25569261" "234267" "TCGTGTTTGTTTTAACCTTGACTCTCTTTTGATTCTTTCTAATGCTACAAGAATGCTGTG" "38555" "1" "0.1713" "-1.5030345" "-4.43" "-0.23923744" "23827" "TTCTAAGTGAAGAAATGAAAAAGGGTTAGTTTCAAATGACTGTCCAAGTCATTTGTGCAG" "50904" "1" "0.171325" "1.5029357" "-4.43" "0.16472599" "12160" "ATAAAAAGCAGGGGAATGGGGAATTTCCTAAAATCAACCTGGGTCATTTCATCTCTCTAT" "55203" "1" "0.171328" "1.5029228" "-4.43" "0.17463644" "" "" "23938" "1" "0.171354" "1.50282" "-4.43" "0.62608018" "" "AATGTTCAGAGACAGTTTAACGGATTAAGAGAGTTCCTGGACTCCAAGGAGAATGGGGAG" "33786" "1" "0.171362" "1.5027908" "-4.43" "0.18643261" "" "AGATAGCTAGAGAAGGAAACTTTCTCACTGAGGGCGGGACGGACCCAAAACCCCGACGAG" "27428" "1" "0.171368" "1.5027652" "-4.43" "0.36018432" "" "GCGAGTAAAGGCAGCTAAGACAATCGTGGCAGTAATTATAAACAAATTAAAAATTGTCTG" "14656" "1" "0.171372" "-1.5027499" "-4.43" "-0.14576859" "" "ATAGTTGAGGTAGACACGGTCACATTCGGGGGTGCATCTGAGTCTGGCATCTTCCGGCCT" "3245" "1" "0.171407" "-1.502612" "-4.43" "-0.13133494" "" "AAAGTTTATTCTGTCCGTGCTCCTGCTGTGGAACTTTGGGTTGTTAATTGTAGACCGTAT" "17162" "1" "0.171408" "1.5026062" "-4.43" "0.14833031" "20526" "TAGTTTCTTTGATGTATTTTGCAAGGTTAAATGCTTGAGTTGTTCTTAGCTGTAGAGCTC" "25426" "1" "0.171411" "-1.5025969" "-4.43" "-0.16873733" "19070" "TCACTGGTGTGGCACTCATGGTTTTTAAATCAGTTTAGTATTATCTGTTGATAATGCCTG" "22594" "1" "0.171433" "-1.5025063" "-4.43" "-0.19050917" "243813" "TTCCCTTGGTAGAAATTTCCCTGAAATGACCGAGGTTTCATATTTCGGATAAAACAGGCC" "16247" "1" "0.171464" "-1.5023871" "-4.43" "-0.14696892" "69605" "TTCTTGATAATAGTACTGAGCAGAGAGATGACAAAATACCAGTTACAGAGCAGACAAGCC" "53692" "1" "0.171475" "-1.5023406" "-4.43" "-0.1735015" "" "GACTACGTACACAGTTCTTTTTCTCTTCCTTGTTTCTGGTTTGCTTTGCTCTTGATGGCT" "32337" "1" "0.171478" "-1.5023316" "-4.43" "-0.45703055" "" "ATAACTTGCTACACATTGGCCAAGGACAACATGACCCAAGTGGGTAGTTTGTGAACTCCA" "24153" "1" "0.171481" "-1.5023175" "-4.43" "-0.20649849" "14169" "GCTGGAGATGCACCTTAAAGATTTCATGCAAAGTGTTCTATAACAGATATAAAAAGCTTC" "1485" "1" "0.17151" "1.5022026" "-4.43" "0.14205759" "" "GGCATTTTCACCTTTGCCCTAATAAAATTGTGTGTAGAAATAAACAAGTATCCTGTTGTC" "45442" "1" "0.171533" "-1.5021127" "-4.43" "-0.19948371" "223664" "ATGGCAACCCTTTGTCTATGGCAGGACTTAAAGAACTGCTTCGGGACTCTGTGGTACAGG" "1820" "1" "0.171545" "1.5020664" "-4.43" "0.16030933" "" "CAGCAAGATCGTAATGGCTCATTTTTAGGTATTGAGCATTAATGATTTAGCCTCTTTTTG" "11366" "1" "0.17155" "-1.5020463" "-4.43" "-0.21008176" "14605" "CTGCTGTACGACTCCAGGATTTGGATTTGGATTTTTCAAATGTAGCTTGAAATTTCAATA" "46391" "1" "0.171558" "1.5020156" "-4.43" "0.40002126" "15216" "TGCCATTGGAGTGTTATATATATGGATCATCAATAAAGCCATGAAGGCTACACAACTGTG" "39971" "1" "0.171601" "1.5018435" "-4.43" "0.28926645" "" "TTTGAGAGAACATTTTGTGTCCCCTCGCACCACCTCAGGCAGCCGGTGTTCCTGGAGTGT" "61843" "1" "0.171606" "1.5018243" "-4.43" "0.18989424" "" "TAGTGAGTTCTGCAGCTCCTAGTTAGGAGGACTCTACAGGCTGTGAAGATTATATGACAC" "24258" "1" "0.171626" "-1.501743" "-4.43" "-0.15010794" "" "TATAAGGATAGAGGAGCCAGAAAGGCTAACGTACTCCCCAGCTTAAAGTTTCTCTCCCTA" "30855" "1" "0.171627" "1.5017405" "-4.43" "0.16515329" "" "TTAAAAGTTAAAGGTCAGAGGTCAGAGGCTCACTCTGAGGATGCAGCGGTTGTAAAAGGA" "34842" "1" "0.171639" "-1.5016915" "-4.43" "-0.26927133" "" "CAGCAGTGTTTCTATTGGAGCTATGCTATGTGGTTTTCTTTATTGGTCTTTTATGATGAA" "33755" "1" "0.171644" "-1.5016722" "-4.43" "-0.13633422" "13872" "AATGGCTTATTCTACCAAGCGACAGAGATTCCTAGTGGATCAAGGTTACAGCTTTAAGGT" "28350" "1" "0.171679" "-1.5015348" "-4.43" "-0.17027927" "258765" "AACAAGGATGTGAAGGAGGCAGCAAAAAGGTTGATTTGTAGGGAGAGCAGTACCTCATGA" "53324" "1" "0.17168" "-1.5015322" "-4.43" "-0.17151656" "" "AAGAGCTGCTTCTTCTTCCGATAGTGCATCTTGGACTTTTCCTTCTGTTTCTCCTCCAGA" "16074" "1" "0.171682" "-1.5015232" "-4.43" "-0.33241319" "93875" "GTGGTGCTTGCATACATGTAGATTGTGTACTTTGATCATACTCATCCCTGATCATCAGTC" "8042" "1" "0.171692" "-1.5014847" "-4.43" "-0.16604378" "" "CTGTAAGATTGTTCCTTGACTTCAAAGGCATAATTTTGGGTAGCCCAAGACTACAAAGAA" "52821" "1" "0.1717" "1.5014542" "-4.43" "0.18818618" "" "AAATTCATAACTTAGGGGTATTGTTCAAAGATTTCTTTTTAATCATTTCAATTCTTAGTT" "57387" "1" "0.171713" "1.5014025" "-4.43" "0.25057553" "" "TTCTTGTCATTTATGAAGCATGAGCATCTCAGACTTGAAGAAGCACAGTCAGAAAACAGT" "33095" "1" "0.171751" "-1.5012489" "-4.43" "-0.17140051" "75470" "TGTTCGCATCATCCAGGTTTATTGGCGTTGGCATAGTTGTCACACTCGTGGCTTTATTCA" "6413" "1" "0.171757" "-1.5012257" "-4.43" "-0.17273241" "19777" "TGTTGTGAACTTCCTGGTTTAGATTGTGTATAAAATGTCTTTGATTTGTGTATAGGCCAC" "25796" "1" "0.171766" "-1.5011935" "-4.43" "-0.14973697" "243078" "ATTGGTCTCAGTTCAGGTCAAAATTCAGCTATTGGTGTATTTCAATTATACCAAGTTTGC" "12410" "1" "0.171781" "-1.5011329" "-4.43" "-0.12608384" "11642" "CGAGGGCTGTGAAATCCCCAAGGTGATCGTCAGCAACCACAATCTGGCTGACACCGTTCA" "40556" "1" "0.171797" "1.5010693" "-4.43" "0.31034503" "" "TTACTTAGACCACAGAAGAGGATGCAAAAGGGTTTTGTGGGTTTTTGGAGTTCTGGAGTT" "12141" "1" "0.171799" "1.501062" "-4.43" "0.45371605" "12960" "ATAAGATCTGCCTGTTCGAAGGGGCCAACTTCAAGGGCAACACCATGGAGATCCAAGAGG" "41827" "1" "0.171803" "1.5010451" "-4.43" "0.14359089" "" "" "6165" "1" "0.171842" "-1.5008919" "-4.43" "-0.23129345" "78784" "GGGTGGGGAGGGTAAAGGATAAGAAGGGGGAATCAATTTCTGACAGTTCTCTACTCTTAA" "41202" "1" "0.171866" "1.5007984" "-4.43" "0.23364338" "" "CTGATGTCTACTGAGGCTTGAATATATCTTGAAACAATTCCCACATTTCCTAAAATTCTG" "11977" "1" "0.17187" "-1.5007801" "-4.43" "-0.2408812" "67897" "CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT" "7266" "1" "0.171887" "1.5007119" "-4.43" "0.33538548" "" "CTTCTGTGGAAAAGATAAAGAAGCTGGGCTGGCGTGGTCGCTGGGACAGAATGTTGTGGG" "1675" "1" "0.171944" "1.5004873" "-4.43" "0.83870003" "" "CTCTCAAACCAAAGAACAGCAACAACAACAAAATCCCATGAAAAGCAACTCAGCAGAAAC" "153" "1" "0.171957" "1.5004369" "-4.43" "0.17171912" "" "GGTATTTGGCAAATCTTCGTTTTATGTACTGTATGAGTAACTTATTCTTGAATAATGCAA" "18047" "1" "0.171962" "1.5004191" "-4.43" "0.15890517" "" "TTTTGAAGGGCTACAAGGGTTGGATAACACGCTGTCGTCACTACTGTACAACAAGAAGGA" "36046" "1" "0.171969" "-1.5003893" "-4.43" "-0.12335179" "223527" "CTTTAAGGGTGAATTAGAATGTGTTGGTCTGTGGATTTATTTCTGAAAGTAAAACTTGCC" "26668" "1" "0.172022" "1.5001819" "-4.43" "0.41816713" "20112" "ATTCTGTGGGACTATTGAATACATGGCGCCCGAGGTGGTGAACCGGCGTGGACACACACA" "9192" "1" "0.172035" "-1.5001281" "-4.43" "-0.14547002" "" "AAGATCACCATCAAAGAACCTAGCGTTGGCCAGGATGGTGTCCATAGCCAGAGTCTTCAC" "49789" "1" "0.172041" "1.5001076" "-4.43" "0.16547175" "70337" "TCTAGAACTTTCAGCCCAGTAAGTTATTTTTAATGGACTGTTTTAGTGAATATATGGGGC" "24963" "1" "0.172044" "1.5000936" "-4.43" "0.49955954" "" "TTTTCACAATCAAGATGCCCATTCATAAGATCCACCTTTTGAAAGAACACTGGATAGTCC" "33625" "1" "0.172054" "-1.5000533" "-4.43" "-0.11548081" "13877" "GTTAGTCATATAGCCTCTGGGAAAGTCTCAGTGAAAAATAAAGAAATGTTCTGTAGTTGT" "13687" "1" "0.172059" "-1.5000357" "-4.43" "-0.25695838" "16536" "TCTTGTCCATGGAAAAGAAGCTCGACTTCTTGGTGAGCATCTATACACAGAGAATGGGCA" "5256" "1" "0.172059" "1.5000349" "-4.43" "0.12112028" "" "GGACGACAAAATGCAACGTGAAGTATAGAAAATGACCTTTCAGTTTCATACAGAACAAAA" "34429" "1" "0.17206" "-1.5000317" "-4.43" "-0.14203669" "18484" "GTTTAGCTCATTTACATTTGGAGACCCTTTTGGTTTTTTGGTTTTGGTTTTGGTTTGGTT" "10276" "1" "0.172061" "-1.5000287" "-4.43" "-0.15521575" "" "ACCAGGATCTTACAAAACAAATGCTGCTGCTATGAATATGGGCCAACCATTCCCCCCAAA" "30462" "1" "0.172063" "1.5000184" "-4.43" "0.30747282" "105450" "ACTGTTTCTCAGAAGGAATGTCTACAGTGATGGGTTTGCCATGCAGAAAGGTCCCAGATT" "62453" "1" "0.172146" "-1.499693" "-4.43" "-0.16188281" "" "ACCCCCAGCCTAATCTTTGGAGCATTTTAGACATTAAAAGCAAATTTCTCTTAGGCAGTG" "42978" "1" "0.172175" "-1.4995764" "-4.43" "-0.18774088" "" "AGTTGATGACCTAAGTCTCCAAGGGCAAATCCCTCTTTTTCAGTTACGGAGAGGGAAAAA" "16529" "1" "0.172186" "-1.4995336" "-4.43" "-0.17257854" "433386" "CCAGGCAAGGAGCGCTGTTCGGTCAGAGAACGAGAGTGAGTGGATGGTTCAAGCTGACAA" "28191" "1" "0.172191" "-1.4995132" "-4.43" "-0.15083978" "" "" "25881" "1" "0.172205" "1.4994573" "-4.43" "0.20731635" "54354" "GGTAGTGCCTTCTATGGTTGTATTATTGCTCTGTATGTGTTCTTTTCAGGATATTTTCTT" "2529" "1" "0.172237" "-1.4993341" "-4.43" "-0.30058324" "" "TTCAGGGAGATCTCAGGACATAAGGAACAGGGTGAGCTTGTGGGGGGCTCACACTCAGCA" "26289" "1" "0.172253" "-1.4992693" "-4.43" "-0.15570239" "" "ATCAGAGGCCAACTGTCTTGTTCCTGGCAGGCTCAATTCTCAAAGTCTATGCAATTCGTT" "38333" "1" "0.172261" "-1.4992384" "-4.43" "-0.26232774" "241656" "AACAGATGTAGCAGCAGCGGAGAAGCAGATGAGGTACCGCGACTTCTCTGCTGACAGCCA" "24561" "1" "0.172266" "-1.4992184" "-4.43" "-0.12468455" "53600" "TAAATGTTGCCCTGTTTTCCAAATAAAGGGTGAAAACAGAACCAAAGTCATAATTCCAAC" "217" "1" "0.17227" "-1.4992045" "-4.43" "-0.2191234" "" "TTCCAGCCTGGGAGCGTCGTTGCCTGTGCAAACCAGGAGGGGGTAAACTGAGGCACAGCA" "56558" "1" "0.172273" "-1.4991901" "-4.43" "-0.12939233" "19946" "TAGCTGGTGTTTGACGCTCTGGATTATAATCCTCTCTTCTGTCCTCTGTGTATGCTAGGT" "8543" "1" "0.172274" "-1.4991859" "-4.43" "-0.24437661" "" "ACCCAGGTCTGGATGTGGTGGCATTTTTTCAGAGAGTGGAACTGAAGATGGATGAAGCAG" "36184" "1" "0.172284" "-1.4991475" "-4.43" "-0.22773833" "381290" "ATTCTGACAGCCCTCTGCCAAGCCTGGAGACACCGGTCTGAACTTCCATCCTCTGAGTAC" "771" "1" "0.172313" "1.4990325" "-4.43" "0.21200026" "234479" "TTTCAGCTTGTAGAATAAATGAGAAATGCCTGTTGGTTTAATTAAAAGAACCGCATTGGC" "7550" "1" "0.172339" "-1.4989323" "-4.43" "-0.15421853" "21947" "AACAGATAACTAATGAGCACAGTTTTGTTGTTTTATGGGTGTGTCGTTCAATGGACAGTG" "58611" "1" "0.17235" "1.4988896" "-4.43" "0.18201355" "" "AATCAGTCCTGTGTGAGGAATTTTGGGAATACTTGGCTATGTATCAACTTGAACATATTG" "15178" "1" "0.172365" "1.4988301" "-4.43" "0.12321452" "16369" "AGCAGACACAAACGAGTTCCTCACTTCCCAGAGTGCAGCCCAACCCACCCATTAAAGGTG" "556" "1" "0.172373" "1.4987979" "-4.43" "0.73263763" "" "AAAGAGAGGTGCTCTACTGTGACTTAATTAAGGGTAGTGCATCTGTCTGTCACAGAGGGT" "43917" "1" "0.172412" "-1.498643" "-4.43" "-0.15682515" "" "CGCCGCGGGCCCTACCCGACCTCTGCGACTTCTGCACCGCGGCCTTGCATTCGCAGGCCC" "18293" "1" "0.172421" "-1.4986089" "-4.43" "-0.13629158" "" "CTGGTTGGTAAGTGCTGCAGCCAGCTCCCGTCCTTGTTTGCTGAGGTACATGGTTAAGGG" "52142" "1" "0.172432" "-1.4985634" "-4.43" "-0.22957009" "75871" "AGAGTTGGACAGCCAGCTTCTAGGGAAAATGGCCTTCGAAGAGCAGAACAACAGCTCTCT" "17614" "1" "0.172434" "1.4985566" "-4.43" "0.12188042" "" "GGGGACGCTAGAGGCAACCTGCCCCAGCCCTGTGCTCGCCCCAGCCCTGAACAAACTTAG" "51109" "1" "0.172451" "1.4984907" "-4.43" "0.13295023" "" "" "59440" "1" "0.172462" "-1.4984481" "-4.43" "-0.18032288" "11431" "TAACTAAACCTCTGACCTTGCCGCAATTACAAAACAGTGGAACAAGCAAATATGGAACAA" "18072" "1" "0.172471" "1.4984129" "-4.43" "0.59118548" "233186" "GGCCAGCAAACATACAAGAAGGTAATCTCAGTCAGTGCTTGTCAATGAAATATAAATAAA" "37603" "1" "0.172475" "1.4983956" "-4.43" "0.2545999" "" "" "20102" "1" "0.172476" "1.4983937" "-4.43" "1.2912548" "69816" "TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA" "14734" "1" "0.17248" "1.4983741" "-4.43" "0.96381492" "12983" "TCACTCACATGATGGCAGACATAGAATGTGGCAGATCAAATGTCCCTTGGTCTCTGTTCA" "49210" "1" "0.172495" "-1.4983153" "-4.43" "-0.1253923" "67207" "TGAAAAGTGATCTCATTCTTTCATGGATGCCAACATGAAGAAATCATGGGATTTTGGTTT" "26521" "1" "0.172507" "-1.4982688" "-4.43" "-0.15643003" "258830" "TCAACCTTTGGCTGCTTAATACCGTTACAGGTACCATTGCCTCAGTCCCCTTTTTTCTGA" "920" "1" "0.172524" "-1.4982042" "-4.43" "-0.20670769" "195208" "ACCAGCCCTCAAGAGAATGAAGAGAACGAAGCAAACAAGGCCTCTTCTGCTGTGGCATAG" "39539" "1" "0.172601" "1.4979019" "-4.43" "0.25101618" "102680" "AGTCAGCCACTCTGTTTCACAGTCACTGCCTGCTGGTGGGAACTTCTTGGCTGGAGTGCT" "16992" "1" "0.172638" "1.4977556" "-4.43" "0.55733177" "72054" "GACCCTCCTATCCATCCACCCACCTGTGCCTTTACAGGAATAAAATTTTCGTGTCACCTT" "52758" "1" "0.172656" "1.4976843" "-4.43" "0.66451331" "" "AAAGCAGTTTGGGAAATAAAAGAGACTGGGCCCTGGGTCATCTTACTAGATAACACTTTG" "11085" "1" "0.172677" "1.4975993" "-4.43" "0.33685785" "" "CCTGACTCCTCACACATTAGCATCTCCAGATTTCTCTAGAGAATAGGGACCTGATAGATG" "43356" "1" "0.172692" "1.497544" "-4.43" "0.71766123" "17916" "AAGGGTCGGCTTCATGGCCAGGAAGGTCTCTTTCCAGGAAACTATGTGGAGAAGATCTGA" "30125" "1" "0.172705" "1.497491" "-4.43" "0.12353201" "" "" "45857" "1" "0.172732" "-1.497383" "-4.43" "-0.25583788" "50905" "TAATGAATAATCCGTTTGGGAGGCTCTCACTAATGTGTAGCTTCCTAAGAGAAGAAGCCT" "19843" "1" "0.172741" "-1.4973481" "-4.43" "-0.21718956" "" "TGTAGTCTCCATGTCACATACAGTCACCCAGTCACCTGTGTCAGCCTCCCTGTCCTTGTT" "54684" "1" "0.172744" "-1.4973376" "-4.43" "-0.17392811" "19070" "TCACTGGTGTGGCACTCATGGTTTTTAAATCAGTTTAGTATTATCTGTTGATAATGCCTG" "22757" "1" "0.172763" "1.4972623" "-4.43" "0.82584324" "83672" "GGGAGGCTACTGTCAACAGATAGATGTGGAAATGTTCTGATCTCAATAAACGCTCAACAC" "39348" "1" "0.172773" "-1.4972225" "-4.43" "-0.24341123" "227659" "TGTGGAGATCGTGACCCTGGGGGACACAGCCTTCAACTATCTTACCCTGATACCCCTGCT" "25950" "1" "0.172808" "1.4970854" "-4.43" "0.80599596" "" "AAATAATTGAGGAACTTAGAAGCTAGATAGAAAGCAAGTGTGGGACAGCGCTGGGGCCAA" "39476" "1" "0.172829" "-1.4970027" "-4.43" "-0.15573053" "56070" "CTCCAGGAAAACTGAAGTTGGAGTTTGTTTTTGATTTTGTTTTTTAAGCGGGTAAAAGAG" "34442" "1" "0.172877" "-1.4968161" "-4.43" "-0.21027267" "" "CTCCATTGCATTGTGGGAGGCTAAGCATCTCCTCTGCTTGTTCATCATTCGTTTTGGATG" "45560" "1" "0.17289" "1.4967647" "-4.43" "0.93015711" "12262" "TCTGGGAACCACCTAATGGTATTATTCCTGTGGCCATTTATCAATACCTTATGAGACTAT" "58355" "1" "0.172893" "-1.4967515" "-4.43" "-0.17474953" "69773" "AATTACCTTTCAAGCTAAAATATTAGGGAAGCAAAACTTCCCATATCAGGTAGCTTGTAG" "46028" "1" "0.172896" "1.4967394" "-4.43" "0.11636891" "" "TTGAGGTCCTAGAACTTCTGTCTGTCTTCTCCAAAATTTCAAGGAAATATGACATTTTCT" "54193" "1" "0.172912" "-1.4966768" "-4.43" "-0.15780927" "320343" "ACAGGGAACAGCATCTCTGTCACCAAACGCTGTGTCCCGCTGGAGGAGTGCTTATCCACA" "19436" "1" "0.172919" "1.4966491" "-4.43" "0.285864" "18753" "AACAGGAAACATCAGGATTCACCCCTTTTTCAAGACTATCAACTGGTCCCTCCTGGAGAA" "43976" "1" "0.17292" "1.4966478" "-4.43" "0.11152821" "" "AAGAGGTTACTCGTGACACAGCCTATTTTAAAGAGGAAGCTAGAGTCAGTGAGAAACGAA" "62503" "1" "0.172937" "1.4965787" "-4.43" "0.92552651" "" "ATGCCAATGACACTGTTTGTGGAGATAAGATTCAAGTACAGAAAATAAATGTGCACAGGC" "6257" "1" "0.172943" "1.4965564" "-4.43" "0.16219905" "103220" "CTGAGGAAAAGTTCCAACGTCAGGCTTCAGACTCACAAATATGGAATAGTCCAAGAAGAC" "59392" "1" "0.172945" "-1.4965477" "-4.43" "-0.21305863" "68720" "CTGCAAAGTTGTGACTTTCCCCTAAAATGACAAAATTGCAATAATAAAGTCTCCCCTTGC" "31893" "1" "0.172966" "1.4964638" "-4.43" "0.31200537" "" "AAATTACAGGAAATGAAAACCATCGTGGAAGAGGGAAGGGTCCAGAACCCATTTCCAGTG" "10474" "1" "0.17297" "-1.4964516" "-4.43" "-0.12474811" "20511" "AAGCAACTCTAATCAGTGTGTCTATGCCGCACACAACTCTGTCGTAATAGATGAGTGCAA" "35988" "1" "0.172985" "1.4963918" "-4.43" "0.15701922" "" "" "25810" "1" "0.173013" "-1.4962802" "-4.43" "-0.28431548" "72795" "CAGGGGGACACTTTCAGCAGTAAATCTAATCAGAACACTTAGTCTTCATTATGTTTGTGA" "37826" "1" "0.173014" "1.4962769" "-4.43" "1.16604223" "246256" "CCAAGAAGCGATTCTTCAGAATTTTACACTTTCTCTGCCCCAAACATTCCATTAGCGCAA" "27592" "1" "0.173015" "1.4962733" "-4.43" "0.21483165" "" "" "27496" "1" "0.173017" "-1.4962671" "-4.43" "-0.52488317" "" "TTGCCTATTTATCACATTGTCCTATGGAGCAGTTACTAATGTCCATGTCTGTCCCTTCAC" "6855" "1" "0.173017" "-1.4962639" "-4.43" "-0.36298325" "235281" "GAGAGAGACAGAGAGAGAGACAGAGACCTTCCTCTCACTTGTTTTATAAATGAGAAAGCC" "27238" "1" "0.173036" "-1.4961925" "-4.43" "-0.25602931" "231327" "GCGTGTTGTCTGACAACTTTAAAGGCAAAAGAATCGTTCTCATAGATGATTCGATTGTGA" "47235" "1" "0.173088" "-1.4959856" "-4.43" "-0.1442392" "94186" "AACCAAGATGTTTCTCCCCAAGATTCTTGATTTACCATGATTCCAAAACAAATGAACTAG" "8099" "1" "0.17312" "1.4958611" "-4.43" "0.13684075" "" "AAGAGAGGATAGGGCCTTTCAAGTTTCTGATCACCTATCATTTTCGTCAGTGGCAAGGCT" "41123" "1" "0.173127" "-1.495832" "-4.43" "-0.1243914" "69638" "CTGGGCCCCTTCTCTGGTCCTCCCACTGTTTGTTGGGTAATAAATGGAACTATGGCTTGC" "31671" "1" "0.173134" "1.4958062" "-4.43" "0.35920663" "" "TCTCCAGTGGTGGGATTAAAGGTATATACCACCAAGCTGAGCATAGATTTGACTCTTCAT" "54951" "1" "0.17314" "-1.4957823" "-4.43" "-0.26932259" "67252" "AGCGTGGACATCCTGTCAGCATGAATGAATTATTCAATCCATGCTTTTACACACACATAT" "51675" "1" "0.173152" "1.4957353" "-4.43" "0.6123651" "16160" "GCTCTTCAATCAGGGCTTCGTAGGTACATTAGCTTTTGTGACAACCAATAAGAACATAAT" "43686" "1" "0.173154" "-1.4957284" "-4.43" "-0.20598801" "58799" "ACAAAGTCTTGGTATGGTTTCAATGGTTCTGAACTATCTGTTGCTTTAATCAAGTCTTTC" "32044" "1" "0.173164" "1.4956886" "-4.43" "0.1687894" "71090" "TCACTCGACAGCTTAGGAAGATCTGACAGAAATCTATCTGGAAAAATAGGAAATCATTAA" "58165" "1" "0.17317" "1.4956661" "-4.43" "0.12953994" "66269" "CTCTATTTCTTGAAAAGACTTTTTACTGCTTCAACTACTGACACAAAGAAGCCAAGATGC" "28937" "1" "0.173175" "-1.495646" "-4.43" "-0.12017881" "107435" "AACAGTTCATAGATACTACATTTCATTTCCTACAGTTCTTGATATTACAGCGGAAGATCC" "23213" "1" "0.17319" "-1.4955874" "-4.43" "-0.23636483" "353237" "CACGTCATGTGGATTCATTTTTAATTGGTGCTATTGGTATTTCCTCTGTTCTTGCTAATA" "62387" "1" "0.173225" "1.4954514" "-4.43" "0.22275458" "" "AGTTTTTCTTCTTGGGAAAGGAGGAAGAAGAAAAAGGCAACTGTCTCGAATGTGCGCCTC" "28232" "1" "0.173244" "1.4953764" "-4.43" "0.22789805" "207521" "ACTTATATCTCAGTGGGGGTTTCTGGGAGAGGGCTGGTGAATGTCCAGATGTCAGGTGTT" "49566" "1" "0.173252" "1.4953424" "-4.43" "0.46789067" "20848" "CACTCTGTGAGCTGATACCCCAGGCTGGGAACTCCTGGCTCTGCACTTTCAACCTTGCTA" "61390" "1" "0.173277" "1.4952467" "-4.43" "0.41534518" "" "GACAAATCGGTAGTTTAGTAAAAACATCTCTGAAATTGTTGGCTGACATGGGGATAAAAA" "41386" "1" "0.17329" "-1.4951954" "-4.43" "-0.15500064" "68865" "TCCCTGTTGGTCGTGCTAAGTGGCTTACTGCTGGAGAGCATTGTGGTCTTCTTCTTCCAG" "18530" "1" "0.17331" "-1.4951169" "-4.43" "-0.18468929" "18514" "CGTCACCTTTGTGGTTTTCAGCCTAGCTCAAAGCTTTCTGGAAACTTTTATTATTTTATT" "55598" "1" "0.173343" "-1.4949863" "-4.43" "-0.13963688" "619294" "ACTCAATTTAGCCTTTGAGGAAAAATGACCATGTTGGTCTCTTATATTTTCTGTATTCTT" "2569" "1" "0.173354" "-1.4949445" "-4.44" "-0.12292045" "53317" "AGAAGAAACTCACCCAGTCAGCTGGAAACCAGAAATTATCAAGAGAAAGCGATTTTAGTG" "17310" "1" "0.173374" "1.4948655" "-4.44" "0.17621743" "" "CCTCAAAATTCATCCGTTCCTGCTATGAAGGGGACAAAGTAACCTAAAACCTTGACTCTA" "42889" "1" "0.173389" "-1.4948056" "-4.44" "-0.20252671" "" "TATGCTTCCTGCATGGACTCCAACCCTCTGAAACTGTAAGTCCCCAATAAATTCTTTCTT" "5816" "1" "0.173422" "1.4946784" "-4.44" "0.44223018" "20848" "CACTCTGTGAGCTGATACCCCAGGCTGGGAACTCCTGGCTCTGCACTTTCAACCTTGCTA" "31482" "1" "0.17343" "-1.4946454" "-4.44" "-0.17485783" "66358" "GTGAGTGAAGATAAAACTCAGAAGTGTTATTTCTGGATAATATATCCAGGTACTGAAAGC" "193" "1" "0.173454" "-1.4945541" "-4.44" "-0.17761273" "208650" "GCTTCTCTTGTTAGTTTAAGTTCTGTGACCTTTAGGTTCCCGAACTCTCCCTCTCATCCA" "13726" "1" "0.173469" "1.494492" "-4.44" "0.16496044" "74080" "CTGACTGTTTTAGAAGATCTTTTGAATGTTTTATGACTGCCTGCTTGTTTGAATATTGGC" "11881" "1" "0.173485" "1.4944306" "-4.44" "0.56662805" "99543" "TAAAGGACAACCAAATTCTCAAGCCCCTCTGTTTTATGCAGAACTCCAGATCCTGGGTAG" "24522" "1" "0.173486" "1.4944264" "-4.44" "0.5241157" "" "CTAACCTACTTGTGGGATCATAAGGCTTTTGTCTCTTAAGAGCCTCTTAAGAAGCAGTGT" "11756" "1" "0.173497" "1.4943824" "-4.44" "0.23588106" "27226" "TTACCCAAATAAGCATTTTTTAAATATACACTGTACTGTAGGATAGTGATGAACGCCTAG" "35163" "1" "0.173499" "1.4943769" "-4.44" "0.25166903" "381686" "GTTAGTCTGTTTCTTTTGATTGGGGAACTGAGATTATTAATATATAGTTATTAAAAAGCA" "42012" "1" "0.173518" "-1.494303" "-4.44" "-0.12845492" "" "ACCAAGAAGACCCAGATGATGACCTAGATATTTGACAGACAAATGGCAGAGGAAGGCTGT" "6967" "1" "0.173524" "1.4942798" "-4.44" "0.12811085" "" "AATTAATCAGAAGCAAGGTTGAGTATTAGGGCTTACACATATGCACACACATACACCCAA" "57498" "1" "0.173538" "1.4942241" "-4.44" "0.14461829" "" "GCTTTAGTTTAAGAAAATCACTAAACAGCTACTAGGAGGAAAATTTGGAACAGGGTCTTA" "23219" "1" "0.17354" "-1.4942148" "-4.44" "-0.20855949" "330998" "ACCTTCGTAGTTGGAAAGTAACCATGCAATTTTAATGGTTAGTATTTTCTGCCACAAAAG" "14819" "1" "0.173564" "-1.494121" "-4.44" "-0.12285681" "15404" "GACAGTTGGAAAAGCGTCTTTAAGAGACTCATTGATTTTAGTTACAAAAATGGGGGGAAA" "20372" "1" "0.173572" "-1.49409" "-4.44" "-0.14905241" "" "TGGTCCAAACTGTCTAAGCCCGGGTCCTTCATAAAATGCAAATTTCTCGAGAGCTTTGCA" "192" "1" "0.173586" "-1.4940352" "-4.44" "-0.1460869" "14167" "TTTACTCAACCATAGTGCACTGAGGGTCCACAGGAAGTGCCATTTCTGGAAACCACAATT" "11501" "1" "0.173604" "-1.4939653" "-4.44" "-0.18882726" "320145" "TGCAACAAACGCTTCATGCGCAGCGACCACCTGAGCAAGCACGTGAAGACACACAGTGGT" "16682" "1" "0.173605" "-1.4939627" "-4.44" "-0.13771785" "69528" "AGGGAAAGCAAAGCTGCAGAACTAGGCTCAAAACCAAGGACACAAAACCTCCCAGGACCA" "33643" "1" "0.17361" "-1.4939432" "-4.44" "-0.23237384" "" "" "46264" "1" "0.173614" "-1.4939248" "-4.44" "-0.11821915" "79560" "GCTCCTTTTAAATGAACAGGTGTACATTGTTCTTATGGGACTATTTCAGTGGTGTAAATA" "10556" "1" "0.173618" "1.4939111" "-4.44" "0.31159469" "" "GTACCTTTATAATACTGGAAATGGGACTTTCTGTCATTATCCGATGAGAAAGTAAGTTCA" "10493" "1" "0.173635" "1.4938439" "-4.44" "0.46412529" "12977" "TGTGGGGCTTACTTAGCCTTCTGGTTACAGACTATTTCCATGCTAGAAAATACATATTTT" "9658" "1" "0.173641" "1.4938209" "-4.44" "0.75025686" "66813" "TACCTCTAAATGTTGAGAACGGAAACCATCCTGTTGCTACACCAGTGGAAGCATTCGTTC" "4689" "1" "0.173646" "-1.4937992" "-4.44" "-0.1890138" "16563" "GAGGAGTTTTATTTTAGGATAATACATATATACATATGCAGTGTGTGTGCCAGTGGTGTT" "9512" "1" "0.173663" "1.4937324" "-4.44" "0.11575755" "" "" "39444" "1" "0.173679" "-1.4936718" "-4.44" "-0.13077349" "433102" "TGAACACGCCTTGATCTAGCAGGCTCCTGCCCTGCTGCAAGCTAATAAACGTGGAATTCA" "2117" "1" "0.173698" "1.4935954" "-4.44" "0.39966038" "" "ACAGTGAGAACCATGGTCCTCCGTGATAGCAGCCAACGTCAGAGAGCAAGCCCAGAGAGA" "21943" "1" "0.173705" "-1.4935679" "-4.44" "-0.20365803" "" "ATTTGTGTTAACCCAGAGCTCTGGAATGTAGGGAAAAATAAAATTGAATTAGACACCTTG" "32588" "1" "0.173706" "1.4935646" "-4.44" "0.20774723" "" "" "48911" "1" "0.173718" "-1.4935199" "-4.44" "-0.14526359" "69071" "GTGGTTGTTACTTATGTGTCTGATCCAAATAAAGGCAGCTGCTGATTTGTTGTTAAAAAA" "8406" "1" "0.173727" "-1.4934855" "-4.44" "-0.1520287" "78656" "CATGTATGTGTGCACACAAATGTAATGTGTTAATATGTCCTCAGTTCTAACTTCTGTTAC" "56269" "1" "0.173738" "1.493441" "-4.44" "0.55433726" "17755" "TCTACAGAGACTAAATCTTAGCGATAATCCTCCATTTCAATTTTAACCAATTCTGTCCTC" "53394" "1" "0.173746" "-1.4934079" "-4.44" "-0.20744844" "54646" "CTCCAAACAGGATACCCAGAAGCTTTAAAAGAAAGGTTAGATACATTTATTGCATGCAAA" "16052" "1" "0.17375" "1.4933943" "-4.44" "0.30581552" "241274" "CCCCAAGGAAACGTATGCTGACTTCCAGAGCACTGGGATTGAGCTAGACTCTGACTCGGA" "26171" "1" "0.173765" "-1.4933369" "-4.44" "-0.15079716" "106529" "TTTTGTGATCTGCCAGCTTGGGAACTTCTCCATCCACATGGCTCTTCGGGACCTTCGGCC" "9785" "1" "0.173774" "1.4932997" "-4.44" "0.37083659" "78151" "TCCAGAGTTGTTACAAGCCACCCCTCCTAGTCACTGAAAAATCCAAGAGGCTTCTAGACC" "56469" "1" "0.173788" "1.4932444" "-4.44" "0.25020904" "268749" "CTTACCAGGCCCGGCTATTACAGAAGCTGAGAGAAGAGGTACCCTTGGGACAGAGTATTG" "29646" "1" "0.173796" "-1.4932124" "-4.44" "-0.12852862" "384185" "CCTTCATCAGTTAATTAATCCAAATCCAGGGCTCCCTCTCGTTGTGTTTGCCAACAAACA" "4471" "1" "0.17386" "-1.4929635" "-4.44" "-0.19289447" "104458" "CCGGGAAGAGTTTAAGAAAATCTATGATGCATTGGACATCACTTTAATAGAGAGAGGAGA" "3727" "1" "0.173878" "-1.4928921" "-4.44" "-0.15791074" "230157" "CAGCCATTATTGGAGCAGTACAGATCGCCATTATAGTAGCAATCGTCATGTGCATAACAA" "42305" "1" "0.173888" "-1.492854" "-4.44" "-0.17021155" "" "TGAGTCTGGACTTCATCAAAATGTCAGCATTTTGGAGACCCCACCCTAAGGTGAAAGTTG" "23950" "1" "0.17389" "-1.4928471" "-4.44" "-0.11427351" "" "GTGATGATAACGGACTAAACCTTTTCAACCATAAGCCACCTCCAATTAAATATTTGCCTT" "58941" "1" "0.173922" "-1.4927198" "-4.44" "-0.1453092" "72640" "GCAAAGTAAAGGTGGGAAATAAAACAGACCCATGAATTAATCAAGTCAAAGTGATGTTGC" "35128" "1" "0.173925" "-1.4927083" "-4.44" "-0.1622224" "28042" "TTTCTGGAGTGTTGCAAGGCTTGTGATTCCATGTAGAGTAGAATATTCTCGGTAGTTTGA" "3139" "1" "0.173949" "1.4926157" "-4.44" "0.26376238" "" "CATTTCTATTGTTTGACTTACACCATACTTCCCTTTCCTTGTACTAAGGACATTCCCAAC" "15005" "1" "0.174013" "1.4923662" "-4.44" "0.27104389" "192193" "TATCCTAAAGCTATCAAGTACCTGTGAAACTCTGCTTCACTGCTCTTCTCCTTTTGAGAG" "18093" "1" "0.174023" "1.492328" "-4.44" "0.15783612" "" "TTAATGAGTCTTCATTCTGGTCCTAATACTGGCATGTGGTCCAAACCTCCTCCATCTCAG" "23286" "1" "0.174023" "1.4923265" "-4.44" "0.17922291" "667574" "TCAGGAGACCCAGTGGTTCAAGGAGTGAACAGCTTCGAGGCTGAGTTCAGCAAGAGTAAC" "42357" "1" "0.174028" "1.4923086" "-4.44" "0.24266699" "" "TTGTCTTCCTTCCTACACTCCTCCCGTTGGAGGGATGTATATACTCATAAAAGAGGGTGA" "867" "1" "0.174035" "-1.4922818" "-4.44" "-0.21639086" "72723" "TGGAAAAGCTTTCAGCCAAAAGTCACACCTTGTCAGACACCAGAGAATCCACACTCACTA" "60243" "1" "0.174037" "-1.4922709" "-4.44" "-0.35446485" "268729" "GCTGCATTGTTTTATAGGCTTTGGGTTTGGAGAATTAATGAACTATGCAATAAAACGACT" "26872" "1" "0.174093" "1.492052" "-4.44" "0.60117297" "105855" "TAGTTGGAATGGGAAAATATAATTAGCCAGTTGATTAATTAGGGTCGTGCCCATGCTTCC" "55996" "1" "0.174101" "1.4920238" "-4.44" "0.45173276" "234199" "GCCAAGTGATTTTATTCCAAATATTATTTAGTTGCCCTCATTGGGATCTCCTTTCTGTAA" "29706" "1" "0.174137" "-1.4918811" "-4.44" "-0.13614785" "" "TCCCCCACCCTTTGTCTCCTCCAAAAAGCACTAATGGGTATACTTGTGCATGTGAAAATA" "20235" "1" "0.174156" "-1.491809" "-4.44" "-0.11850891" "" "ACCAGTGGATGTGTACAGCGAATGGATAGATGCCTGTGAGGCAGCCAATTAGTAGCGATG" "22892" "1" "0.17416" "-1.4917911" "-4.44" "-0.15200362" "71200" "GCGCTGAGGAAGCAAAAACAACAGAAATGCTGAAAGAAGAAGGCTATCAGATTCAGCAGA" "32724" "1" "0.1742" "-1.4916379" "-4.44" "-0.18834826" "" "CTTCAGAAGTCAGCCATCTGTGTCCTGATCTGCTGTAAAAGATGAAGAGGTAAGTGACCT" "30160" "1" "0.17423" "-1.4915179" "-4.44" "-0.13763396" "105014" "GGTGCACATGGATATTTCAAAGACACTGCTACTATTTGGGGCTAATACAAAGTTCAGCAA" "11052" "1" "0.174237" "1.4914915" "-4.44" "0.14088067" "" "TCACTTGTATTACTCCTCCATATTGGAGCCTGCATTAAAGGCTACTCTACAGCAGCACTG" "36935" "1" "0.17424" "1.4914813" "-4.44" "0.16375006" "" "AGCATTATGGTCTACACCTTTCATCCCAGCACTAGAGGCAAAGACAGGCAGATCTTTGTT" "22874" "1" "0.174248" "1.4914505" "-4.44" "0.27284043" "" "GGAACAAGAGCAAAGCAGTTTTATGCTTGTTGTTGATAAATGAGGAAAACGATTAGCTTA" "37757" "1" "0.174248" "-1.4914501" "-4.44" "-0.15284253" "" "TCCTTTTCTCCACCCCCGCATTTATGTATCTGTAGACACACTTGGGCATTTAAGTGGAGA" "57262" "1" "0.174257" "-1.4914128" "-4.44" "-0.13471063" "" "CCAACTTGCAATTTTAATAAATACCGCATTCAAACTATGCATCCACTTTCAAAACACTGA" "2714" "1" "0.174263" "-1.4913921" "-4.44" "-0.64678414" "" "TATCTCTAGGTTTTTCCTCCTCAACAGAAACCGAGCTCAAAGAGAAGAGAGAAGAAAAAA" "20466" "1" "0.174263" "-1.4913917" "-4.44" "-0.13335968" "" "TCTAGACTACAGTGTAGGCCCATGAATGCTGCAGACTAAGAACCACAGAACAACCTTGTT" "21416" "1" "0.174267" "-1.4913733" "-4.44" "-0.29108701" "" "GTGTGGGAGGTAACAGAGGCATCTCAGAGGGCGGAGACACAAGGAGTACTGTGCATACAT" "48509" "1" "0.174278" "-1.4913321" "-4.44" "-0.13767494" "" "TTAATAGTACCAGTACACAGTTGTGGGTGAGGCACTAGTGAGAAGTGTGTGGGAAATGCA" "59526" "1" "0.174295" "1.4912671" "-4.44" "0.61284061" "16859" "ATATTACCACCGCCTGAAGAACTTGCAGGATATCAACACTCTAGAAGTGGCGGGTGATAT" "10793" "1" "0.174301" "-1.4912435" "-4.44" "-0.14049771" "68118" "GTGTTGCTGGGATCTCGGGGCTCTGGAACCTGCACTAGATCCTTGGTGAGACTTGAAGAG" "22222" "1" "0.174307" "-1.4912184" "-4.44" "-0.17748292" "269180" "CGTGGCAGATTCTTTTCCTTAGAGATTTATGTTTTATAGGTTCTGTTCATCGTAATTCTG" "31268" "1" "0.174317" "1.4911801" "-4.44" "0.19782547" "" "CAGTAGGTTATTTGCTTATTGTTTTTGGCGTGTAGCGAATGTCAAGAAAGAGATGTATAA" "20056" "1" "0.174318" "-1.4911775" "-4.44" "-0.13982799" "" "TGAAACTGAGAGCCCTGGATGGTGAAGAGAGGAAACTAGCAAAGATCCAGGTATGTTAGA" "20284" "1" "0.174349" "1.4910535" "-4.44" "0.28740318" "" "CTGGTGCTCAGCCCATTTCCTAACCTAATCTCTTTAGCTTCTCAATATATTGTTAAATTA" "16154" "1" "0.17436" "-1.4910127" "-4.44" "-0.3724525" "12854" "ATAGCACCCTGGCCACCCTGTGAGATGCCAACGAGACCTGAATAAAGACTGTCAATCAGC" "12381" "1" "0.174371" "1.4909694" "-4.44" "0.6606978" "" "ATAAACGGGTAACACGAGTGGTGAGGAACAAGGTCATATGCCAAGTGGTGGGAAATCAAA" "24551" "1" "0.174375" "-1.4909554" "-4.44" "-0.45512594" "17181" "GGGGGAAGGAATCCTGAATTCTGAGTTTACCATGAGAATAAATAAGCTGCGCAGTGTAGT" "57650" "1" "0.174377" "-1.490947" "-4.44" "-0.27258918" "67897" "CTGTTCAGATACGTCTAGGCCTGTCACACAGTGTATGCTCAGGTGTTTCCAAATGAAGAT" "28712" "1" "0.174385" "-1.4909157" "-4.44" "-0.16465766" "71991" "CCGTATTGCTTCATCTAATTCCAAACAATGTCATGTTAGAATGAAACTCAGAAATGCACA" "36534" "1" "0.174418" "-1.490787" "-4.44" "-0.18327467" "" "GATGGGAGGCTCAAGGGCTCCTGTTCTCTCTCCACAGGGATAAAACTCATCAGACATGCC" "24471" "1" "0.174428" "1.490747" "-4.44" "0.16795124" "" "CCCAAGAGTATCCATAATTCTAGAACCTAGAATATAGCTAGATATACAACAAGTCCCTAT" "61137" "1" "0.174431" "1.4907359" "-4.44" "0.24731571" "" "TTGGGGATCGGTGGCCACCAGGGGCACCACTCTGGCGAGGGCGCGGCCTGGACGCCCAGA" "28183" "1" "0.17444" "-1.4907017" "-4.44" "-0.36881258" "" "TCAAAAAAGAGATAAAACAACAAAAGACAAACCAGTAAGAGCAGTTGCTGTGTGGTGCCT" "8731" "1" "0.174454" "-1.4906464" "-4.44" "-0.1499227" "" "TCAGAGCTTATCCAGAAGTACCTAAGTGTGAGTGGTTGGCTCAGAGCTTATCCAGAAGTA" "27918" "1" "0.174491" "-1.4905017" "-4.44" "-0.15764954" "28000" "GCTTGGGGGTACAGATGTCCAGATCTACATCTGCAAACAATGGACAGAGATTCTTCACTT" "26197" "1" "0.174494" "-1.4904904" "-4.44" "-0.11596588" "" "TTCAAAACTCCCTCGCACCGGAAGTTGCGCTTGCACTTCCTAGTAGGGTCATGGCCAGGA" "54014" "1" "0.174495" "1.4904847" "-4.44" "0.27499309" "" "CTGGAAGATGACAGGACCAGCTCCTGGATGTCCTAGGAGGCCAGCAAAACAACTGCTTCT" "10309" "1" "0.174519" "-1.4903942" "-4.44" "-0.14853706" "81896" "ATCCGTCAGACCATTACCGTGCACACGTTGCCAACAGATTGCCTCAATAACGACAAATAA" "56019" "1" "0.174534" "1.4903341" "-4.44" "0.16872052" "" "GCATACAATTATTTCTTGTGAATATCTGAAGCAGTTTCAGTGCGCCTGCTGCTCCTGGAC" "23200" "1" "0.174536" "-1.4903255" "-4.44" "-0.18981853" "64113" "CAGGTCAAATACCTTACTACTTATCAGAAGACTGATGAAAAGCTGTCTGCCTATGTTCTA" "22768" "1" "0.174541" "-1.4903086" "-4.44" "-0.22317713" "14083" "TGGTTTTCTTTAGATGTCCAGTTGGTATACCATGCATTCTGTTAGGTGATTTTGAGAGCA" "32811" "1" "0.174574" "-1.4901805" "-4.44" "-0.19615855" "" "TGTGTGACTATCTGGATTAGGAGCAACCTGACCCGGCCAGTGACTGCTGCAGGAAGATGG" "21886" "1" "0.174582" "-1.4901479" "-4.44" "-0.23847491" "23827" "CCTCCATTACATAGCAAGACATGCCTAAACACAGAGAAGGAAAACAAAAAAGGAATTTAA" "269" "1" "0.174587" "-1.4901295" "-4.44" "-0.16410629" "628100" "GAAGGCTGGGCTGGTGGTGATGGCAAGGTTCCAAGCATCTTTAAAGTGCTATCTTTACCA" "7809" "1" "0.174629" "1.4899664" "-4.44" "0.12497024" "" "" "35103" "1" "0.174632" "-1.4899532" "-4.44" "-0.17838142" "66569" "GATGTCAGATTGGGAGATAAATTCAGTATAGAGTACTAGACGTCTTTTGCCTAAATTATG" "27519" "1" "0.174635" "-1.48994" "-4.44" "-0.2417739" "" "GGTCAAAATTTTAGATGTGATGTGAATATAGACAACCGTTACAACACTTGGGAGATTTGT" "3895" "1" "0.174641" "1.4899187" "-4.44" "1.65050536" "16161" "AGTTTCCCTATTAGAGTATTGGGCACTTAATAAATGGGCCTTCCCAGAGACTGAGAAACT" "13485" "1" "0.174651" "1.4898781" "-4.44" "0.37320635" "13713" "GGCCACACGGGTGTCGTTTTTACTGTAATACTGTTTTGC