/data/wwwroot/iBAD/data/iBAD_0000173/gene_expression_table/UP.txt

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 136

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 137

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 138

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 139

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 140

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 141

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

adj.P.Val P.Value t B logFC GENE_ID SEQUENCE change 32718 1 0.000942 5.0939206 -3.13 1.65387706 236312 CTGATAAAAGCAAGCTCTTTGGTTTAGGAAATGGCACTTATTCTTTCTACAGTTTTAGCA UP 62223 1 0.001452 4.7503055 -3.2 1.08917237 12966 GACTGGGGCTCTGTAGATGCTAAGGCGGGCTCTTTGCGGAGGGTGGTAGATTTATACTAA UP 910 1 0.001999 4.5046423 -3.26 1.21747063 216859 ATCTCGACATATTCCGAGACTTCTCCCTCATGGCGTCGGACGACCCAGAGAAACTGAGCC UP 885 1 0.005631 3.7513587 -3.47 1.32938607 NA GTGGGGCCAGTGTGATTTCTTTTAACTCCCAGAATAAAAGATAAATAAATCTCTTTTGAG UP 17137 1 0.006158 3.6889491 -3.49 1.71777123 215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG UP 24358 1 0.006954 3.604833 -3.52 1.58261154 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 18889 1 0.007587 3.5449083 -3.54 1.36859525 80782 CACATGGACTCTGAAAACACTGGGATTCTTAAAGGTTCTTCATTGTATAAATGGAAGTGT UP 2648 1 0.009515 3.3906349 -3.59 1.10608806 171170 CAGATGTTTGGACTTTTTCAAGTTATAGTGTTGTATGCCTGTTTGTGTTTAGAAGTGTTC UP 4415 1 0.010546 3.3212996 -3.62 3.05267439 100039796 AGAGGATTCATGCTTTCCCTTCTCCTGATCCAGAAGATCACCATGGCAAAGGCTTATAGT UP 36433 1 0.010933 3.2970659 -3.63 1.14615388 13449 TATAGATGTTTTGTTCCTGGGACAACCCTGGCTTCTGGTTAGCAGCGAGAGTAGCTGTTG UP 35786 1 0.011395 3.2693257 -3.64 1.19419832 26411 AGACGCACTAGTGGTCATGACATGACCTTATCTCCCAATAAACTTGACTTTAGTCTTGTC UP 34863 1 0.011426 3.267467 -3.64 1.23824882 14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA UP 705 1 0.012759 3.1938165 -3.66 1.32526856 53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT UP 6705 1 0.015904 3.0479164 -3.72 2.52859261 20307 ACCAGAAGTCTCAAATTCTGCAGCCTTGAACCTTCACACCTGAGTTAAGAGACAGCCAAA UP 2857 1 0.018017 2.9659446 -3.75 2.70517912 20304 TCTCAGCTGCTCCGAGGCTCTGCACAGCAAACCCAAGAAATCAGCATTTCATTGAAATTT UP 1049 1 0.018152 2.9610455 -3.76 1.28269166 NA GTAGCCAGCTTGAGCAATGGTGCTGGGATTTCTCCGGGAGCAGAGTGTTAGCGATTAAAA UP 37395 1 0.020471 2.8824744 -3.79 2.64868268 15945 GCTTTGCATTGTATATGGAAGAACTTGTGTCATCAAGTATGTATCAATGGGTAGTTAAAG UP 39876 1 0.021366 2.854603 -3.8 2.01979587 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 39813 1 0.023043 2.8054591 -3.82 2.89768164 17329 ATGGGATTTCATTATTAACTTGATCCCATCTTCAGAGCTTATTCTAAGTTTGCCTCTTCA UP 25342 1 0.023765 2.7854221 -3.83 1.22370917 11630 GGTAAGATATCCTATAAACGCCTGTTGAGTTTGTCTCTTGAATTAAACTTATTCCTGGTT UP 41351 1 0.024174 2.7743571 -3.83 1.34075415 21822 CATTAATAACCCCATGTGCTAACCAAACCCAGGCTCTTTGCTGACCATGGTAGTATTGGT UP 27462 1 0.02437 2.769121 -3.84 1.90256116 64380 ATCAGCAGTCTAACTCTGAACACTATCACCTCTGTGTTGGCTGCAACTGCAAGCATAATG UP 58783 1 0.024458 2.7667749 -3.84 2.09053389 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 7076 1 0.024523 2.7650742 -3.84 1.13563393 16428 ACTGCAGGTATGTCTTACCCTCTGTGGGGGCCACAAGTCAATCATTGCTTATGGAAAAAA UP 37670 1 0.024533 2.764806 -3.84 2.30164939 60361 CACTTCATTGCACTGGCTTTTGAGGTGAATATTAGATTTACTGTAAGTATGTAAGTCAAG UP 39628 1 0.026215 2.7218536 -3.86 2.00379147 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 33562 1 0.026918 2.704759 -3.86 2.61204612 17472 GTGTATATCAGCTATTATTTAAGCTACCTTGTGATATTGTTTCCACGGTACTGAGAGATA UP 34708 1 0.026948 2.7040366 -3.86 2.00622549 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 36166 1 0.029037 2.6558149 -3.88 1.9085246 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 5135 1 0.029441 2.6469091 -3.89 1.36727378 NA TCTCTAACCATCAGCAGCCTGGAGTCTGACGATACAGCAACTTATTACTGTCTACAGCAT UP 43380 1 0.029813 2.6388089 -3.89 2.1374348 17329 AAGTCGTCGTCGTTCAAGGAAGACTACATAAGAGACCATTACTTTACCAACAAGCACCCT UP 43840 1 0.03088 2.6161293 -3.9 1.0965017 17057 CTTTCACGTTTCTCAAGTTTCCAACACTTGGGAGGAAGGTCTAGTTGATTGTGATGGAAA UP 58128 1 0.031174 2.6100341 -3.9 1.2290231 22035 GGGAAATGTTAAACTTTGTAAACTCTGAAACGCACAAAGTGTTGCTTTGAATTTCACCTT UP 23453 1 0.031797 2.5972834 -3.91 1.87575865 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 35125 1 0.031893 2.5953443 -3.91 2.22456264 107350 ACTGAGGGAGCTATCTTTCACAGAGTGTATTCAGTGGTATACGTGGAGCTCAGAAGTAGA UP 39591 1 0.032102 2.5911408 -3.91 1.35521504 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 3471 1 0.032281 2.5875691 -3.91 1.93557646 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 35768 1 0.032482 2.5835632 -3.92 1.99967209 NA GGATTCAGTTCTCTTTCAATGATCTGTGCATGGCATTTTTGCAATTATTTCCTGTAAAGT UP 49139 1 0.033038 2.5726375 -3.92 2.45995712 15953 TACCACCTGCCTCTGTGTTAAGAGATAACCTGTTTCTGATCCATTTGTACCAATAAAAAA UP 37787 1 0.033423 2.5651974 -3.92 1.10219712 100033459 CCATAACTTGAGAGATGGTGAATTACTACAAGCAAATTGTTCTTCTGTCTGGATTAGAAT UP 35265 1 0.033691 2.5600435 -3.93 2.04007937 80901 ACAGAGCTTAAGACTTTAACAAATACAAGAGGACTCTGGTGGCTTTGCTCATCTAAAAAA UP 14034 1 0.033698 2.5599088 -3.93 1.96986735 72310 TCTCCATATTAGTGGCTATGGCAGTGTACACCAGTATGAGATGGAGCCAGACTCCATTTT UP 27840 1 0.033874 2.5565697 -3.93 1.23635455 434223 TTCCTCAAAGAAGCCATGAGCAAAGCTTTGGATCCTGCAATGAGGGAAGTAGAAGCGTAT UP 37789 1 0.034321 2.5481385 -3.93 1.12798173 NA GGACATATATAATCGGTTAGCCTGGTATCAGCAGAAACCAGGAAATGCTCCTAGGCTCTT UP 42345 1 0.034793 2.5393625 -3.94 1.63995868 16421 ATTTTTCAGAGTGACCTTCAGAGGGCAGCAGCCATTCCCACCACACGAAGGGCTGGTCCT UP 58792 1 0.035045 2.5347143 -3.94 1.50676563 12507 GACCAGTGGGGTTGGCTTTCTCCTTGGACTCTGACGCCATTGAACAAATGAGGAGGCGAT UP 47130 1 0.035349 2.5291705 -3.94 1.15961866 84544 TCTTTTTCTGCACACTATTGTTTGGGCTTGGAGTAAGAAAATGGTATCGGTATCAAAATG UP 27574 1 0.035366 2.5288487 -3.94 1.29395496 327957 GCAGGGATCCTTCAATACAATTCCTTATTTGTGGTGATCCTCAACCATAAAATTATTTTG UP 7843 1 0.035423 2.5278195 -3.94 1.93270516 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 30140 1 0.036049 2.5165705 -3.95 2.27546515 24108 AGCCGATTTCCTCTGAGCTATTACCAATCACATCTCTTGATGATATAAAAAATTAACGAG UP 49 1 0.036107 2.5155333 -3.95 1.78880175 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 29463 1 0.036251 2.5129769 -3.95 1.91888607 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 24394 1 0.037021 2.4994741 -3.95 1.75154276 NA GATCCCTGTCCATTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAATTTGGTAT UP 34821 1 0.037703 2.4877532 -3.96 1.6586051 16185 GTCTATTCTGGGGTGGGTTTTTCTGTGAAGCAGCTTCTTTGGGGTAACCTAGCCCCCTTG UP 32662 1 0.038061 2.4816884 -3.96 1.02429134 60504 TGCTGTGTAAACCTTGTTCCTTAATTTAATACCATTGGTTAAATAAAATTGGCTGCAACC UP 53433 1 0.038423 2.4756095 -3.97 1.24090302 NA AGAGCAGCTCTTATCCCTCAGTGTACTGTAATCTATTGTTCTCAATGAATAAAACATAGT UP 13090 1 0.038765 2.4699195 -3.97 2.07611045 60440 GATTATGTATCCACATTAGGTAGAGCAAGGGGATCAGATATGTATAAATAAACTGATAGC UP 58982 1 0.03893 2.4671847 -3.97 1.72766826 631323 AAGAGTTTGGTTCTCAGCGCCCATGCCAGACAACTCACAATTTCTTATAACTCCAGCTCT UP 46714 1 0.040863 2.4360885 -3.98 1.37848079 20306 TTCTGAGAACTGTTGATGAAATGTGTTGATCACGGTCCTAAGGGATAGGAGCTGTCTGTA UP 16964 1 0.041364 2.4282683 -3.99 1.93717315 12481 CCCCTAATTAAGAAGGCAGAGTTCGTCATTTCCAATAAAAAGCTGTGTGGATTTATCTTC UP 17076 1 0.042568 2.4098646 -4 1.8970129 80901 AATGTATAAAACAGAGCTTAAGACTTTAACAAATACAAGAGGACTCTGGTGGCTTTGCTC UP 18628 1 0.043066 2.4024091 -4 1.55340438 317677 ATCAACAGCATGGAACTCTGCATCTCTAACAAGATGCAGACAGGGAACACAGCCTTTTTT UP 36908 1 0.043677 2.3933723 -4 1.65003499 107526 AGATCTCACAAGTCAAATAATCCAGGTTGAACACAAGTTAGCAGCTCAGCAGGTGACATC UP 29504 1 0.04385 2.3908395 -4 1.81970854 20296 TGTAGGAGTGACCAGTGTGACAGTGAACTAGTGTGACTCGGACTGTGATGCCTTAATTAA UP 11385 1 0.045536 2.3666577 -4.02 1.38605096 56696 TTTCTCCTGATTCTGTCTGTTGTCCCCATCTCTTGGGGTGGAATTAAAAGGATGCATCAC UP 15813 1 0.045736 2.3638425 -4.02 1.2394274 100702 GAAATGTCAAGTTCAAAAGAATGAACTGTGTAAAGGAGAGAGAGAGATCTTGGTGCTGTT UP 56021 1 0.046942 2.3471619 -4.02 1.54780651 16362 CTGCTAAATGGTGTTTGGTCATGTGGTGGACCTGTGTAAATATGTATATTTGTCTTTTTA UP 3503 1 0.048071 2.3319187 -4.03 1.25969611 16818 AATCTTATGTCTCTGTGTGTTCTGTCCTGGTGCCTAGCACACACCAGGAGCTCAATAAAA UP 3765 1 0.048099 2.331544 -4.03 2.5111327 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 16784 1 0.048833 2.3218411 -4.04 1.25869856 12258 TGGGTAAACATTGTCACCCAAGCTTCAGCTCCTCCGGTTATTTCCTTGCCACTGCCTGCC UP 6284 1 0.048876 2.321269 -4.04 1.77828726 71898 AGCCGACACCCATCCTCAGGCATGTCATGGTCCCCTAAATAAACCGTTTCTGTTGTTCCT UP 44053 1 0.048934 2.3205209 -4.04 1.22575403 17857 ACTTTCCAAGGAAACTGGACGTTTCCACTTTAGCGCTTCCAATAAAATTCTTGCTAAGTG UP 19606 1 0.049175 2.317372 -4.04 2.48016442 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 60411 1 0.049759 2.3098022 -4.04 1.05710383 12772 GAAGCAGGGACAGAATTCTTGCTTTGAAAATAATACTTGGGAACATATCTTAATTACAGG UP 56403 1 0.049831 2.3088768 -4.04 2.10022584 100702 GGCTCTCTTAAATGGATTTTCTACAGTTCTTTTTCATTACCTTGTCCGTTATCTAAAGCA UP 4033 1 0.049857 2.308538 -4.04 1.33089247 74153 ATTCCTACATCTTCAGCTCACAGCAGATACTTCAACAATAAAAACTTGTTGACGGAAGGC UP 27293 1 0.049862 2.3084694 -4.04 2.0057857 15944 GCATTGTTCCACTGAGGGACAGGGACAAGTAGTGATTAAAATTCATTGACCATGATTCTT UP 11666 1 0.050116 2.305212 -4.04 2.53088094 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 34984 1 0.050418 2.3013663 -4.05 1.30392987 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 26035 1 0.050835 2.2960857 -4.05 1.74694096 20715 TGTCTCTTGTTGACCAACTACGTAGGACTGGTGGACACCTCTGCATTACTCACACAAATT UP 8265 1 0.050874 2.2955876 -4.05 2.47232216 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 39074 1 0.050967 2.2944182 -4.05 1.504447 60440 TGGGCTAGAGAGATGGCTCAGTAGATAAAGTAGAACTTGTAAGTTTGAAGACTTGAGTTC UP 51854 1 0.050975 2.2943245 -4.05 2.31525372 NA ACAAGCTCTGTCAAGTGACCCAGTTGATAATCGGTGCCTGATTCATGATTACTTCCCTTC UP 34320 1 0.051025 2.293685 -4.05 1.90531519 15944 AGAGAATAGCCAACGAGTCCTTGAAGAATTCTCTCGGTGTCAGAGATGATGACAACATGG UP 4150 1 0.051293 2.2903353 -4.05 1.18815502 NA ATACCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTA UP 41969 1 0.051468 2.2881511 -4.05 1.50053548 16182 TGTCACAACAGCTGTGTGTGAAAACCTAGCATCAGAAGAGAGTTGGGAGAGTTTGAGACT UP 53198 1 0.051533 2.2873346 -4.05 1.87722522 16912 CAGCTGCTGGTGTGGACCATCGAGTCATCCTGGGAGATGAGCTGCCAAAATTCTACGATG UP 46951 1 0.051737 2.2848108 -4.05 1.86595793 NA GAATGCCTCTCAAGATATATTCAGAAGTTCTGTTTGGCTAATGGGTACTTAGTTACTAAA UP 24191 1 0.052011 2.2814181 -4.06 1.04000167 78826 CACCAAAAGGAGGAATTAAAAGAAAATTTCTTGGTTTTGGGGGAATGAGATAGTTCTGTA UP 61800 1 0.052785 2.271944 -4.06 2.4404963 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 52412 1 0.053139 2.2676621 -4.06 1.85808949 16994 ATCTGTATTCATTCCTGGAGGATCGACTGACGGTGCGAATGTGTGAATCGTGATGTCCGG UP 54353 1 0.053217 2.2667179 -4.06 1.50859859 15978 CTTCCCTATACAGCTGAAAACTGTGACTACACCCGAATGACAAATAACTCGCTCATTTAT UP 6747 1 0.053379 2.264772 -4.06 2.47878862 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 23522 1 0.053496 2.2633674 -4.06 1.58709483 74748 GGGGTCTGAGTTCCTTGTGTTCAAGATGTTATTATAAGAAAAGGCAAAGAACAGGAAATG UP 29495 1 0.053813 2.2595818 -4.07 1.58359919 83408 CAATGCGTGCTTTAAAACTCGGCGTTTCAGCCTAATAAACAGAGACCTTGATAGGAAAGA UP 55485 1 0.054167 2.2553834 -4.07 1.40597962 20737 CGTGGGGTCGGGAAAATTAAATGATCTGTAAATACATCTGTAAGAAGCTACATCCTGCGT UP 42763 1 0.054347 2.2532455 -4.07 1.03057402 19260 ATGTGACAAACTTCCAGCAAACTTGTATTTTCATATTCCTTATATTTCACTGGGAACTGC UP 26790 1 0.054488 2.2515904 -4.07 1.17481982 19265 CATGCATGTTATGGTGAAACACAAGCTGCCCTGGACCTTCGTCACCCCACCCTTACATCA UP 407 1 0.054506 2.2513739 -4.07 2.42892338 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 55638 1 0.054525 2.2511489 -4.07 1.34853002 13041 AGTAAAGAAGGCACGGACCTCTTGTCCTCCCTGAAGGCAGCAGCCACTCTTCTGCTTCTC UP 32253 1 0.054826 2.2476186 -4.07 1.30326007 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 45982 1 0.055644 2.2381255 -4.08 1.51233077 671535 CTTGGTTGGACCGCGCCCTAGAGGGGTTCTCTGTCTTTGAATAAACCTGTACTTGAAACC UP 47126 1 0.055843 2.2358413 -4.08 1.49247527 12263 TCTCTAGTGTGGATGACCCGTGCTCCTTTTGCTTTCACACGGAATTTCCCAGTTATGTAA UP 29851 1 0.055851 2.2357458 -4.08 1.08072854 668139 TTGATCTTTGTTCTAGTGTTGTAGCAAGTGATTCTTTCTTCATTTTACATGACCGCCGGA UP 28499 1 0.055918 2.2349759 -4.08 1.21251224 223672 AGCCCACGCCCATCCTCAGGCATGTCATTGTCCCCTAAATAAACCGTTTCTGTTGTTCCT UP 21137 1 0.055952 2.2345865 -4.08 2.43520632 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 35838 1 0.056356 2.2299672 -4.08 1.03667638 80285 GCCTGTTATTTTCTAAAATGATAGCACAAACTAGGACAACAGGATGATTTCAGGTTTTCT UP 27410 1 0.056409 2.2293669 -4.08 2.46933557 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 62513 1 0.056539 2.2278869 -4.08 1.007552 NA GATGAAACACTACCAGGACCAGAAGGATAAAGCACCGAGAAATTGTCTAGCGAAGATTCA UP 17246 1 0.05673 2.2257245 -4.08 2.50680905 16145 ATATTCAACTGTAATAGCCCGTTCCTTCAAAGTGCAAGTATTTGCCAGGATAATCAGCCA UP 814 1 0.057039 2.2222466 -4.08 1.00616088 NA TCACTCCATCCCTGTCACTTCTGTGTCTGATCACAAATAAAATCAACTTGAATGGCTGCA UP 24673 1 0.057066 2.2219384 -4.08 1.00505131 69146 TGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCCCCAGGTGCACTGGGAACCAA UP 37117 1 0.057233 2.220062 -4.08 1.02895633 53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT UP 44979 1 0.057306 2.2192487 -4.08 1.31764061 NA AAATGAAGGAAAGCCACTCAACCCAGACTCAGTCAGGAGAAACTCTCTGGAACCATACTT UP 45386 1 0.057321 2.2190812 -4.08 1.02519401 16643 TCTCATACATTTGTACCCAAGTAATTTATACTTGATGGCTTCTTCACACGTGTGCATAAA UP 62849 1 0.058024 2.2112617 -4.09 1.48721268 12766 GCCAGGCGTTGTCAGCACTGAATGTGCCCATCTCAGTATCTCAATATTTGCCCAATTTTA UP 25510 1 0.058347 2.2077015 -4.09 1.47149846 547349 CTTTTGTGTTGAAGAGCAAGAGAAAAATAGGTGGAAAAGGAGGGGTCTATGCTCTGGCTG UP 36007 1 0.058657 2.2043012 -4.09 1.30481899 24047 ACCTCCAGACCAGCTCTGGGTGGATCGCATCATCCGAAGACTGAAGACGTCTTCTGCCAA UP 37304 1 0.058757 2.2032015 -4.09 1.5151236 231655 AAGGTAGGAGGGGATCAAGTTCCTTTCAAATGGAGAATAAAAAAGCCATTGTTTCTTCCC UP 8150 1 0.058815 2.2025698 -4.09 1.30549177 74558 CTCTTTGGATCATTGACATAGCTAGTCTTCAACATCCTCATACAAATTGAAGTTGCATTA UP 1101 1 0.058991 2.2006591 -4.09 1.98457005 NA AGTAAGAGTCTCCTGCATAGTAATGGCAACACTTACTTGTATTGGTTCCTGCAGAGGCCA UP 19213 1 0.059243 2.1979191 -4.09 1.04493419 NA TTCCATGCTACAGTGGCTACTGAAGCTGAGTTCTTCAGAGTGAAGGTTTTTGACACAGCT UP 47264 1 0.05998 2.1899842 -4.1 1.06309719 12703 GAGGGTCTCTGGCTTCATTTTTCTGCTGTGCAGAATATCCTATTTTATATTTTTACAGCC UP 12835 1 0.060234 2.18727 -4.1 1.52849612 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 60644 1 0.060256 2.1870362 -4.1 2.0895987 54396 GTGTCTTAGGTCATAGACATAGATTTTCTCTTTGCTGGTTGTATGTACATACCTATCTAT UP 5388 1 0.060756 2.1817373 -4.1 1.68902426 12500 GCAGCTGTATCAGCCTCTTCGAGATCGTGAAGATACCCAGTACAGCCGTCTTGGAGGGAA UP 23146 1 0.06141 2.1748638 -4.11 2.16389686 14962 TCTCATTGTTCACAAGAGAAGCCGCTTCATTCAAGTTGGTGTGATTAGCTGGGGAGTAGT UP 4493 1 0.061658 2.1722668 -4.11 1.61648643 225594 GTTGGCCGGAGTAGGACAACGACAATTATCTATCTTGTTTATGATTGTAAAGAAATGTTA UP 27937 1 0.061721 2.1716136 -4.11 1.24158122 NA TAAAACCTCTGTGTACAATTCACAGCCAAAGTCTGAAAAGGAGCTTCCATTCTATTTCCT UP 4409 1 0.061772 2.1710871 -4.11 1.36053209 50909 AACAGAAGATAAGTTAGCTTTCGATCTCAGGTTCGTCAGACTGCCTGTAGCTGACAGTGA UP 3683 1 0.062251 2.1661213 -4.11 1.76181018 16913 ACCTCAGTCCTGAAGAGGCCTACGACCTTGGCCGCAGAGCTATTGCTTATGCTACCCACA UP 13312 1 0.062354 2.1650647 -4.11 1.65077281 246177 AAGGCCAGGACTTGTCTACCCTTACATGGAACATTGCAAAATAAAGATGTTATATTTGTT UP 25487 1 0.062681 2.1617025 -4.11 1.26538838 74558 GGCTCAAGCTCACTCCTGCTATCTCTGTCAGCATATGGAAAATAATGGTTCAAAAAATAG UP 43375 1 0.06446 2.1437243 -4.12 1.62956126 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 24709 1 0.064605 2.1422879 -4.12 1.0632609 12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG UP 10129 1 0.064726 2.1410787 -4.12 1.36532003 15978 CTTCCCTATACAGCTGAAAACTGTGACTACACCCGAATGACAAATAACTCGCTCATTTAT UP 40550 1 0.064732 2.1410186 -4.12 1.4422192 16186 CATCAATCCTTTGATGGAACCTCAAAGTCCTATAGTCCTAAGTGACGCTAACCTCCCCTA UP 3661 1 0.064871 2.1396482 -4.12 1.02715079 14998 GGAAGTGAGCCCGAAGCTTGAAGGTCAAATCCCAGTGTCCAGAGGTTTGCCTGTGGCAGA UP 25174 1 0.064949 2.1388704 -4.12 1.09658684 57444 CCGCAATGTGTAAAACCAAGAACACTCCCCCATTACAGCAACTCTCTTGCTTTGAGGCAA UP 31806 1 0.065173 2.1366578 -4.12 1.76559122 434341 TAAACTCACAACACTCCATATCAAATGATCAATAAACGCAGATGTAACTGGTGTCTGATG UP 31902 1 0.06553 2.133148 -4.13 2.14684112 641221 TTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAAACA UP 49003 1 0.065672 2.1317619 -4.13 1.55991752 240328 GTTTTACAAAACTTGAACTAGACCTCGCCAAAGCAATCACAAATATGAAAAAGAATTACT UP 18110 1 0.065865 2.129875 -4.13 3.15193362 16061 TCGGGTAAACCCACCAATGTCAGCGTGTCTGTGATCATGTCAGAGGGAGATGGCATCTGC UP 23620 1 0.066238 2.1262397 -4.13 1.34149502 NA AGGCAGAGTCACCATTACTTGCAAGGCAAGTGACCACATTAATAATTGGTTAGCCTGGTA UP 14807 1 0.066308 2.1255661 -4.13 1.51772085 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 38594 1 0.066363 2.1250306 -4.13 1.09593622 12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG UP 58045 1 0.066399 2.1246831 -4.13 2.16502794 240327 CCATGTCATGTTCATGCCTGATATCACACATGGATATGCACACACAAAAAAGAAATTTTT UP 51732 1 0.06695 2.1193676 -4.13 1.18935765 21355 TCAGGATAAAGATTGGGACCGTTTTGGACTTTGTGTGTTTTTGTGGCCTTGATGGGTGAG UP 30588 1 0.067491 2.1141911 -4.14 1.33753007 12010 TTGAACCTGCTTAATTACAAATCCAGTTTCTAATATGCTATACAATTTATGCACGCAGAA UP 2722 1 0.067774 2.1115057 -4.14 1.64397239 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 16893 1 0.068541 2.1042645 -4.14 1.34973024 50908 AAAGAGTCTGCATGGAGGCAGGGTTGATCACTGAGCCGTGTTGGTTATTCAGTTACTATT UP 22544 1 0.069094 2.0991002 -4.14 1.71439287 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 25392 1 0.06916 2.0984839 -4.14 1.75859489 55932 CACATTGGCATATGTATCCCAGTTGTACACTACAGATAAATTGTTAAAAAGAGCTCTTGT UP 57618 1 0.069181 2.0982894 -4.14 1.35794229 246728 CTGGGGACTCTGCAGTTGGCTGTTCATTTATATGCTTCATAATAAATGGTTTCTTTGTGT UP 31767 1 0.06936 2.096624 -4.14 1.30437547 15051 GTTTTCATTTTGCTCATCATTTGTCTCTGTGTGGTTTGCATATGCATGAAGAAGAATGCA UP 51409 1 0.069559 2.0947858 -4.14 1.55205466 12502 ACCCTACAGGTAGACTGCAAGCAGAGAGGAAGAACTGTCAAAGAAATTTTGGTCTTTTTT UP 27138 1 0.069944 2.0912347 -4.15 1.09094854 53314 TATAGTCAATGTACTGGACTCTCCCAGGGAAGTTCGAGCCAATGTACTGGACCCAAAAAT UP 16404 1 0.070861 2.0828496 -4.15 1.71060366 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 7421 1 0.07113 2.0804098 -4.15 1.54594238 NA TGCAAGGCTTCTGGCTACACCTTCACTACCTATCCTATAGAGTGGATGAAGCAGAATCAT UP 42676 1 0.071162 2.0801242 -4.15 1.09771539 12046 AGAACCTAAAGTCATACTTGGATGACTTTCACGTGGAATCCATAGATACCACCAGAATAA UP 59544 1 0.071385 2.0781037 -4.15 1.02980979 NA TTGGGTGCAATGGATTTTTGGAGATATACAGAGCTTCCTGTGTCTCTGATGTGAACGTTA UP 19393 1 0.071472 2.0773234 -4.15 2.47145282 NA GCTAGCAGCTACCTGACCCTGACAGCAAGAGCATGGGAAAGGCATAGCAGTTACAGCTGC UP 4176 1 0.071662 2.0756113 -4.15 1.31692088 50909 TCTGACCAATTGTTGATAAGCACTATGATTCTCATATAAAAATCAAAGATGCAGAACGCG UP 62654 1 0.071975 2.0728104 -4.16 1.81592133 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 23038 1 0.072162 2.0711395 -4.16 1.68484127 15016 TGCAGAGAATGGAACCTTCCAGAAGTGGGCATCTGTGGTGGTGCCTCTTGGGAAGGAGCA UP 35689 1 0.072186 2.0709235 -4.16 1.49201071 16068 AAACTCAAGCTTCACTTCTACCCTAGATTATCATAGTAATTAAGTCCTTAGAGTTCTTCC UP 40492 1 0.0722 2.0707981 -4.16 1.77749855 76933 CCAAAAGGCACCTTCAGAACCCTCACTGATGTCAAAGAATGATGAAAACAACAAAGTATA UP 59744 1 0.072298 2.06992 -4.16 1.74698597 630499 ACTAAGTGACAGACAATGTCTTCACACATCTCCTGTGACATCCAGAGCCCTCAGTTTTCT UP 47223 1 0.07275 2.0659136 -4.16 1.84289574 66857 GATGACAGAAAGCTGCGAATAGGACACCAAAGGCACTCTTAGCTGTATTTTCCCATCTGT UP 56529 1 0.072837 2.0651423 -4.16 1.35720313 12010 TTGAACCTGCTTAATTACAAATCCAGTTTCTAATATGCTATACAATTTATGCACGCAGAA UP 33139 1 0.073642 2.0580583 -4.16 1.70030528 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 47504 1 0.073796 2.0567138 -4.16 1.20324816 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 17156 1 0.073881 2.0559774 -4.16 2.03048305 76074 GAGAAGTTGCTTCATTTATTTTTTCTCCCATTTCAATGATTGAAAAGGGTATAAGGTCCC UP 19315 1 0.074115 2.0539359 -4.16 1.12784843 12258 GTAAAGAGCAGCCAAGACATGCTGTCAGTCATGGAGAAACTGGAATTCTTTGACTTCACT UP 46966 1 0.074156 2.0535813 -4.16 1.93091909 547349 TGATAATCATAGAAGTTCTGATTGTCCTTGGAGCTGTGATCAACATTGGAGCTATGGTGG UP 10515 1 0.074482 2.050754 -4.17 1.80978498 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 62328 1 0.074559 2.0500904 -4.17 1.39872533 NA TACCTTCTGGAGAGGAGCAGAGATACACATGCCATGTGGACCATGAGAGGCTGCCTGAGG UP 43509 1 0.074565 2.0500335 -4.17 1.77269981 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 8818 1 0.07474 2.0485246 -4.17 1.02998439 21356 ATTAGGACGAAAGGTCTTCATAGCATCTTAAGATTCTAGAGACCTCAGGGACAGCCCACA UP 7098 1 0.075009 2.0462085 -4.17 1.74993989 NA ACTCAGGAAATGCAACATGTGGAGACCAGGCCTGCAGGGGATGGAAGCTTCCAGAAGTGG UP 24831 1 0.075033 2.0459991 -4.17 1.67973264 14963 AAGTTCTACCTAGAGGGCGAATGCGTGGAGTGGCTTCGCAGATACCTGGAGCTCGGGAAT UP 33459 1 0.075117 2.0452807 -4.17 1.67347714 15013 ATCCACTGACTCTTACATGGTGATCATTGCTGTTCTGGTTGTCCTTGGAGCTGTGATCAT UP 19061 1 0.07521 2.0444803 -4.17 1.72157701 15007 AAGACACATGTGACCCATCACCCAGGATCTGAAGGTGATGTCACCCTGAGGTGTTGGGCC UP 53019 1 0.075256 2.0440864 -4.17 1.0139768 14580 GGTTATATTAACAGAGCTAGCCTATGCTAAAGGTTAGGTTGTACTAATAGAGCTAGCCTA UP 50168 1 0.075471 2.0422482 -4.17 1.4473416 17067 TATTATAGTATCACCATCCACACATAAGTATCTGGGGTCCTGCAGGGTTCCCATGTATGC UP 37509 1 0.075609 2.0410686 -4.17 1.07320556 12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG UP 7059 1 0.075689 2.040391 -4.17 1.5364083 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 40931 1 0.075699 2.0403041 -4.17 1.53892092 NA GCCACCCTGTATGCTGTGCTTGTCAGTACACTGGTGGTGATGGCTATGGTAAGGAACAGG UP 5582 1 0.075897 2.0386176 -4.17 1.68865436 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 7635 1 0.076272 2.0354423 -4.17 1.27708687 NA GGACACTTGAAAGCAGTACCTCAGGCTTACTTTCACCTTCTCTGGGTTCTTAAGAAAAAA UP 16459 1 0.076609 2.0325966 -4.17 1.49579584 NA TATACCTTCAGTATACCTATGGTGGGAAAAACACAGGTGGAAAAGGAGGGGACTATGCTC UP 55272 1 0.076814 2.0308811 -4.18 1.14264758 NA CTTATCTTTTCTCACAAGCAAAGGGGACATTTGTGAGTGGAGAGTACTTAGTAATTAAGG UP 55028 1 0.076999 2.029328 -4.18 1.01799161 20821 GTGTCTTTGTTACATAAAAGTTACCTTGAGAAAGATCTCCAAGTATTGGTTCCAATTCTG UP 5497 1 0.077052 2.0288794 -4.18 1.75462711 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 46922 1 0.077162 2.0279593 -4.18 1.75510257 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 27737 1 0.077358 2.0263266 -4.18 1.69856579 NA GTTCTGGTTGTCCCTGGAGCTGTGGTCATCAATGTTGCTGTGGTGGCTTTTGTGAGGAGA UP 21228 1 0.077367 2.0262494 -4.18 1.63461688 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 61194 1 0.077379 2.0261523 -4.18 1.3986888 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 60164 1 0.077397 2.0259997 -4.18 1.57726899 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 12061 1 0.077557 2.0246634 -4.18 1.01979838 NA TTATCCCTTTTACACTTCCCATTTTGGAATCTGAGCCACCCTGCCTGGGTTTACATCTGT UP 36475 1 0.077711 2.0233912 -4.18 1.6503925 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 32984 1 0.078173 2.0195619 -4.18 1.93205487 231507 ATTGCTCTTTGACTTGGTTTCTTCTTGCTCCCATATCATCAAATATTGGAGCCTATAATT UP 18431 1 0.078419 2.0175334 -4.18 2.900287 16061 TTGCGTGTATCAGCTGAACTCTGGAAACAGGGTGACCAGTACTCCTGCATGGTGGGCCAC UP 59713 1 0.078502 2.0168512 -4.18 1.77779422 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 44300 1 0.079146 2.01158 -4.18 1.7873886 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 53090 1 0.079331 2.0100758 -4.19 1.00387468 22029 GGTCAGACATTAATGTGAATTTAACCTGCCCTGGACTGAGTTCCTATGTTAACAGACACG UP 53119 1 0.079423 2.009323 -4.19 1.1013802 57765 GAGGGGGGAGGCTATTTATTGTAGAGAGTGGTGTCTGGATGTATTTCTTCTGTTTTGCAT UP 46195 1 0.079912 2.0053596 -4.19 1.21150946 216445 GGTGATGCTTGTTCTCAGTATTCCTTTATTGTCAGGAAACTGTGTCATTATTAAAGTTTG UP 13983 1 0.079973 2.0048657 -4.19 1.58980936 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 35398 1 0.08 2.0046524 -4.19 1.76846071 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 17452 1 0.080214 2.0029286 -4.19 1.68685312 110557 GTAGCTATTCTGGTTGTCCTTGTAGCTTGGCCATCATTGGAGCTGTGGTGGATTTTGTGA UP 9405 1 0.080342 2.0018916 -4.19 1.80805973 229898 GTAAAGTTTAAAAATGATTTCTCACTATTCTAAGCCTGTCTCTGTTTCTGGGTCGATTTG UP 50535 1 0.080776 1.998413 -4.19 1.69781071 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 53395 1 0.080905 1.9973823 -4.19 1.65759825 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 17082 1 0.08101 1.9965504 -4.19 1.7169574 15040 ATCATCCTTGGAGCTGTGGTGGCTTTTGTGATGAAGAGGAGGAGACACATAGGTGTAAAA UP 11350 1 0.081116 1.9956998 -4.19 2.20800309 14969 GGCACTTCTGAGCCAGTCTGCTGTCATATGCTTTTTTACATTTTTCTCAAATAAACAAAT UP 3723 1 0.081188 1.9951323 -4.19 1.54575587 246730 TGATGTGTGGGTATGGTACCCATGTTTTATTAAAAAGGATGGTTCCCGAGTGAGCTCCTG UP 21776 1 0.081636 1.9915703 -4.19 1.756349 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 56794 1 0.081687 1.9911678 -4.19 1.16677835 54167 CTTCTCCATTGTAAAGGGATTCTGCTCCTGAACAGCCAATAAATATGCTTTGTGAGAGAA UP 11443 1 0.081799 1.990282 -4.2 2.09803335 110454 TATGAGTTATAGAAGCTCCAAGGTGGGAGTAGTGTGTGAAATACCATGTTTTGCCTTTAT UP 40949 1 0.081879 1.9896542 -4.2 1.65790477 630499 TCACACATCTCCTGTGACATCCAGAGACCTCAGTTCTCTTTAGTCAAGTGTCTGATGTTC UP 17592 1 0.082022 1.9885234 -4.2 1.68816258 14972 GCTGCAATAGTCACTGGAGCTGTGGTGGCTTTTGTGATGAAGATGAGAAGGAGAAACACA UP 27032 1 0.082141 1.9875858 -4.2 1.47840905 12775 CAGCCACTGATACCTTTCCTCATGTTCTGCTTTTGATTCATATATCTTTTATGAAGAAAC UP 53349 1 0.082345 1.9859864 -4.2 2.07480293 634650 CTGGAAACTACTTAAACATCCCTGAGTTAGATTGGCAACAAATTTTTATATGGCTTGATC UP 41353 1 0.0825 1.9847696 -4.2 1.6689301 100044874 TTTGTGATGAAGATGAGAAGGAACACAGGTGGAAAAGGAGTGAACTATGCTCTGGCTCCA UP 10613 1 0.082577 1.9841652 -4.2 1.50888531 69368 ACCCCTCCTCCCATTGTTAGCTGCTTTGAAGACAGAATGACTCCTGTGGATTTATCCTAA UP 41622 1 0.082748 1.9828293 -4.2 1.77179866 14972 TGAATGTAACCTTGATTGTTATCATCTTGACCTAGGGCTGATTTCTTGTTAATTTCATGG UP 11755 1 0.082953 1.9812292 -4.2 1.00888553 14204 CTCTTCAGGGCAGACAGACCACCTACACTAATAGCCCACAATAAAGTTATTTTTGTTAAA UP 34151 1 0.083048 1.9804898 -4.2 1.22755165 12511 AGCCAGGCTACAGTGGCCTGTCCTGAGTTCCAGAGATTAAACGATTACTGAGTGAAAACT UP 25693 1 0.083388 1.9778469 -4.2 1.41988135 381308 GTCACCTCTAAATGACAGCTTTAGTAGTATATCCAACCATTGATTAATCTTCATACCTGA UP 53197 1 0.083497 1.9770038 -4.2 1.04881392 12481 TCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCCTTCTATGTCACAGTGGGG UP 15780 1 0.083532 1.9767354 -4.2 1.28438215 15024 TGGTACCAAAAGCCTTGGATTTGGATTGTTGCCACGGTTTTTTCCATTTTGCTCATTTGT UP 41345 1 0.083818 1.9745251 -4.2 1.63070835 14999 TCCTTGTCACGAGGGCACCGTGTCTTAGGTGATCACTAAGAAATAAACTGGTGGACTTTT UP 26013 1 0.08407 1.9725819 -4.2 1.01861177 NA ATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTACTGCGTGC UP 14854 1 0.084411 1.9699629 -4.2 1.66313343 NA ATTCTGGTTGTCCTTGTAGCTTGGCCATCATTGGAGCTGTGGTGGATTTTGTGATGAAGA UP 2409 1 0.085249 1.9635737 -4.21 1.95142912 14469 GTTTCTCCTGTATAATCTTAAGTGTTCCTCTTTCCTACAGATAGCTTCTGTAATCACAGA UP 28023 1 0.085558 1.9612278 -4.21 1.09544629 20287 TCTCTAGGACCCTGGCTGGAGTAGGGATTGGTTGTCCTTGGCATCAATAAAAAAGGAATT UP 59208 1 0.085983 1.9580206 -4.21 1.66005575 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 52980 1 0.086597 1.9534146 -4.21 1.37384797 NA CTTCGGCTTCATCTAACATTCCTTCGGCTAAGGGTACTCACTTCTTCAAAACACTTAACA UP 14136 1 0.0869 1.9511553 -4.21 2.11938916 15019 GACATGGACATCTACACTAGGCTGGTTCCCCCAGTTTCTAGAACTTTCCAAAGAATACAG UP 965 1 0.08708 1.949816 -4.21 1.63680516 100529082 TTTGGAGCTGTGATCATCATTGGAGCTGTGGTGGCTTTTATGATGAAGAGGAGAAACACA UP 10304 1 0.087106 1.9496216 -4.21 1.61952241 23833 GGGAAGGGTTGATAGCAGATATCCAAGGAGGCTAAAGTTGACAGCCAATGGCCGGAATGG UP 20807 1 0.087106 1.9496205 -4.21 1.1729421 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 1802 1 0.087221 1.9487675 -4.22 1.59945819 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 6649 1 0.087979 1.9431626 -4.22 1.10718404 NA TCACGTGTGAACCAGGCAATAAACTTAGACTTGTCTGCTTTGAATTGAATCTCATTGAAG UP 48411 1 0.08836 1.9403582 -4.22 1.43355437 227929 GACTCTCATTATTTTCGCCCATTTCAATTTTTATTTTCTGCCTGAACATTCATGCCAAGG UP 34253 1 0.088415 1.9399576 -4.22 1.7981263 60533 TTGATGAGTCTCATGTTAATGTCTTGTTTGTATGAAGTTTAAGAAAATATCGGGTTGGGC UP 56761 1 0.088493 1.9393869 -4.22 1.71431503 246730 TGTCCACCTGTTGGAAGGTTCTGTCTGACAAAGTCTGATCAACAATAAACCACAGCAGGT UP 21707 1 0.088718 1.9377378 -4.22 1.19584945 215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG UP 15900 1 0.088827 1.9369465 -4.22 1.8086569 68487 TATTTTGTTCAGTGCCTGTATATCAGAAAACCTACGTGGCAATGAGTTCTTCATTCTGTG UP 45851 1 0.088981 1.9358254 -4.22 1.58444657 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 19957 1 0.089038 1.935408 -4.22 1.66969433 NA ATAGAGCTTGTGGAGACCAGACCTGCAGGGGATGGAAACTTCCAGAAGTGGGCAGCTCTG UP 20886 1 0.089478 1.9322104 -4.22 1.17985124 215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG UP 51092 1 0.090225 1.9268188 -4.23 1.62566573 NA TGAGCCCCTCACCCTGAGATGGAGTAGACCTCCTCAGTCTTTCATTTTCATCATAATAGT UP 61553 1 0.090439 1.9252825 -4.23 1.59136973 243262 CCTGTCCACCTGTTGGGAGGTTCTGTCCAATGTCTGATGCACAATAATAAATCACAGAGA UP 19331 1 0.090871 1.9221952 -4.23 1.03416612 12870 TCTGATGTCTTTGACCTTTTCCCTGGAACATACCAAACCCTAGAAATGTTTCCCCAAACA UP 21544 1 0.091153 1.9201818 -4.23 1.47158374 67775 CTTTCCTGGACATGCTCTGAAAATAGCCTAAACCATGGCCCACACATAATGGACCCAATA UP 23798 1 0.091212 1.9197672 -4.23 1.07989296 16985 TCTTGGGTCCTGCCCTGTTTACGGATCCCTCATTTTGTGTAATAAAGTGCATTGAGTGTC UP 57427 1 0.091499 1.9177276 -4.23 1.86307178 58203 CAAGCTGGTCTTGAACCCACAGAGATCTTCTTGCTTCTGCCTATTAAATTCTGGGATTAA UP 51219 1 0.091693 1.9163544 -4.23 1.60875141 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 43145 1 0.091804 1.9155636 -4.23 1.41539961 58203 ACAGATGTGACATGAAAGTACATGTAACACCAACCAGGGGATGAGGATGGTGCATGGGGA UP 41421 1 0.092186 1.9128698 -4.23 1.04126303 14744 AGCCACTCCATGTACTGGGTTATAAAAGAAATGTTCTCATGAACTTTCATGAAGTTTACA UP 14747 1 0.092208 1.9127169 -4.23 1.05161983 100039796 TTACATTCTCACTGGCAGCCCTGATTGTCACATTGCCAAGTGGTATTTTGGAAACAGGGA UP 30889 1 0.092277 1.9122282 -4.23 1.75158766 NA AGAAACACAGGTGGACAAGGAGGGGACTATGCTCCAGCTCCAGGCACAGAAGAGCTCTGA UP 39970 1 0.092937 1.9076075 -4.24 1.45917937 12047 CACTTGGCATTTCCATTTACAAACATGAAACTTGTCTTTCCAGAGTTGCAGATATTTTGT UP 29609 1 0.093062 1.9067305 -4.24 1.60009952 NA TAGGGGACATCTGCATTCTGTCACCTCCATGCTGCCCTGAGCTGCAGCTCCTCACTTCTA UP 20820 1 0.0938 1.9015998 -4.24 1.09461955 12260 ATTCTGGGGACTACGGGGCTACACAGAAAGTCGCCTTCTCTGCCCTGAGGACCATCAACA UP 44757 1 0.094173 1.8990258 -4.24 1.08565294 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 2380 1 0.094907 1.8939805 -4.24 2.11035145 16149 CTATAAAGGCCCGCAGACAGGGACAAGGGATGCCCTACCCTTAACCTAGGCTGGACACAT UP 41933 1 0.09576 1.8881656 -4.24 1.16808021 NA AATTATTGAAACAGCTCAAAGCTCACTCTCATGGATCCCTGAACAACAATGGTAATGATG UP 36741 1 0.095825 1.8877182 -4.25 1.74669615 15018 TGCACTGAGTGACAGACGATGTGTTCATGTCTCTCCTGTGACATCCAGAGCCCTCAGTTC UP 1050 1 0.096083 1.885972 -4.25 1.50443369 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 7020 1 0.096095 1.8858938 -4.25 2.1565288 NA AGGGGCACAGACTGAGGATGAGGCAATATATTTCTGTGCTCTATGGTACAGCAACCATTT UP 55334 1 0.096212 1.8851026 -4.25 1.20470786 80885 CCCAGGAGGGACTGAACTCAGTGCTGGAGAGAAACAATAACAAATTCAGCTGAGCTTTAA UP 26065 1 0.096481 1.8832853 -4.25 1.12899147 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 58367 1 0.096489 1.8832273 -4.25 1.11735214 12363 CCAGCCTAAGCAACACAGTGGGATTCTGTTCCATAGACAAGCAAACAAGCAAAAATAAAA UP 27176 1 0.097435 1.8768861 -4.25 1.12938668 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 28007 1 0.09753 1.8762468 -4.25 1.54199512 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 5928 1 0.097801 1.8744472 -4.25 1.10299723 384059 CCGCGGGGTATGTGACATTCCCAAGATCTTCAAATCCTCAGTAAACTTGCTAAATTCATG UP 774 1 0.098198 1.8718089 -4.25 1.08415507 NA ACACCCTTTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTA UP 60268 1 0.098773 1.8680083 -4.25 1.32991282 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 13140 1 0.098778 1.8679706 -4.25 1.4905727 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 42490 1 0.098878 1.8673163 -4.25 1.47706318 69550 AGGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGT UP 53879 1 0.098906 1.8671321 -4.26 1.49087481 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 41497 1 0.099083 1.865967 -4.26 1.0775971 NA TGGAAGGGCGTTATACGTTGTAACGGGGAGACATTAAGACATCTGGAGCAGGTATTGTAA UP 45022 1 0.10005 1.8596402 -4.26 1.59265006 15013 AGATCCCCCAAAGGCACATGTGACTCATCACCCCAGATCTCAAGGTGATGTCACCCTGAG UP 27252 1 0.100194 1.8587058 -4.26 1.5548387 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 62350 1 0.100696 1.8554467 -4.26 1.16681371 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 48312 1 0.10075 1.8550956 -4.26 1.24267079 320832 AAATACTGCTGTTAATTGCTGCCACTGTCATTTACATGCATAAGAAGCAAAATGCCTGAA UP 10119 1 0.100837 1.8545332 -4.26 1.49548571 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 58147 1 0.101281 1.8516733 -4.26 1.07177267 215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG UP 10609 1 0.102523 1.8437245 -4.27 1.38465329 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 10693 1 0.102612 1.8431598 -4.27 1.36884118 547253 TGACTAGCCAACCAATGTTACAGACACTTTCATTCAAAGTAAATATGTCATTGTCTTCAC UP 15493 1 0.102862 1.8415699 -4.27 1.47135004 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 42360 1 0.10287 1.8415182 -4.27 1.47564689 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 21803 1 0.103139 1.8398183 -4.27 1.48369448 21354 TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG UP 2477 1 0.103556 1.8371841 -4.27 1.21203994 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 34259 1 0.10363 1.836714 -4.27 1.25076779 21936 CCACCAAGAGCACCACGTTTAGCACAAGATCTTGTACAAGAATAAATACTTGTCTAGTAA UP 62971 1 0.104573 1.8308005 -4.27 1.26330308 238393 AAGGTTTAAGAAGGGAACCTGCAACTGTGGTCCTATCTGCAGCATCTGAAATGTTTGGTG UP 49448 1 0.10491 1.8287003 -4.27 1.35334325 15951 AGTCGGGAGAACCTCTCTGGAACCATACTTCTGAAAACCTGAATGCCAATGATATTTTTT UP 47889 1 0.105396 1.825681 -4.28 1.250144 23900 GATCCTGTGGGTTTGGGGTGCGTGGGAACGCACTTCTTCAGGACAGGAATAAAGCGATTC UP 46472 1 0.106118 1.8212244 -4.28 1.66009617 NA ACTGATTTCACACTGAGAATCAGCAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGT UP 37134 1 0.10677 1.8172213 -4.28 1.06420264 15900 AACAGACAGGGTCGACAGAGTGTGTGATACATGCAAACAGAATCCTTGGAGTGTGTGATA UP 52170 1 0.107041 1.8155593 -4.28 1.39552021 229900 GGAGAAGAATAGCTCATTGGGTGCAAAAATCCTTGATGGGTTTGGAGATGTATTAATTTC UP 61227 1 0.107112 1.8151315 -4.28 1.06956922 65972 GGATGATATGGAGAAGAAACTGGGACCGTGCCTGCAGGTGTATGCTCCTGAGGTGTCACC UP 26098 1 0.107347 1.8136982 -4.28 1.28593616 17071 TTTCAAATATGTACTTCCTAGAATGCCATTTTGTGTGGCTTGCTAATCTTGGCCCTGGAG UP 29602 1 0.107459 1.8130158 -4.28 2.34233072 NA ATCAACAGTGTGGAGTCTGAAGATATTGCAGATTATTACTGTCAACAAAGTAATAGCTGG UP 52196 1 0.108101 1.809117 -4.28 1.80099901 105892 GCCCTACTGCGTGCAGAAAGAGTTCAGGGGCTGGAATGCTACCAGTGTTTTGATGTCCCA UP 26766 1 0.108193 1.8085596 -4.28 1.17238347 14190 AAATACTATGTGTTCATCCTGAGTGTGTCTTTCTCAGGGTAACAATGAATCCATGTAAAT UP 14851 1 0.108464 1.8069245 -4.28 2.1475712 16069 CTGTACTAGTCTTTCTCTTAACCTCTCACTGTGTAGAGAAAACAGCCAATGAACACAGGA UP 55669 1 0.108916 1.8042037 -4.29 1.26970248 668101 CTCTGCATATGTATTGCTATCCCAGAACTTTAAAGCTGTGCATATTGAATTGTATTCTTG UP 31711 1 0.108919 1.8041862 -4.29 2.06408293 14961 TAGTAAACCAATGTATGCTTATCCCCACCTAGATTACAAATAAACGAGACTCAGACTCTG UP 54978 1 0.109192 1.8025483 -4.29 1.13955305 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 9035 1 0.109223 1.8023623 -4.29 1.46415007 NA ATGTGAAGTCTTCCAGAACTTTCTCCAGTCACAAGCCATCATTGAGAGTTCCATCCTGCA UP 11485 1 0.110549 1.7944636 -4.29 1.05966152 574428 CCCTAAAGGAAAACATTCCAAGGCCCAGGGAAGACTGATTGTCGGAACACAAAAGGTTAA UP 50140 1 0.110779 1.7931007 -4.29 2.13397748 14961 AATGTATGCTTATCCCCACCTAGATTACAAATAAACGAGACCCAGACTCTGGTTATTTGA UP 58992 1 0.111304 1.7900029 -4.29 1.10958602 236451 TATTAAAACTCCATCAGCATAGAGCAGAAGCTGTCCTGTGCATTGCTTGCTGTTACCCTG UP 61412 1 0.111479 1.7889722 -4.29 1.14620302 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 40208 1 0.111742 1.7874282 -4.29 2.24388153 14960 TTTGGCCAATTGGCAAGCTTTGACCCCCAAGGTGGACTGCAAAACATAGCTGTAGTAAAA UP 35165 1 0.111954 1.7861883 -4.29 1.19543103 327959 CCTTCAACCCTTGCATTTATGGACTCTGGAAATCGAAGATCCACAGTGAGTAAAGATGTT UP 15141 1 0.112186 1.78483 -4.3 1.12095239 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 27304 1 0.113424 1.777633 -4.3 1.05105958 NA TCTTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGT UP 26438 1 0.113427 1.777618 -4.3 1.01584103 NA TATCAACAAAAACCAGGGCAATCTCCTAAACTACTGATTTACTGGGCATCCACCCGGCAC UP 50425 1 0.113961 1.7745322 -4.3 1.04889447 215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG UP 20259 1 0.11434 1.7723544 -4.3 1.23289067 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 5390 1 0.114574 1.7710132 -4.3 1.0911005 12363 CTAAGCAACACAGTGGGATTCTGTTCCATAGACAAGCAAACAAGCAAAAATAAAACAAAA UP 62525 1 0.115719 1.7644881 -4.31 1.14288285 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 49926 1 0.115851 1.763739 -4.31 1.45546947 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 49741 1 0.116615 1.7594166 -4.31 1.9358044 15001 GTGTTGACCTCGAGTGGCATCAACCTCTGTTCACCAAATCCCAGGAGAACATTGTGGGCG UP 14689 1 0.118241 1.7503193 -4.31 1.70311684 NA GAATCAGCAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGTGCTCAACTGCTAGAAC UP 24619 1 0.118796 1.7472378 -4.31 1.30554691 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 36354 1 0.118878 1.7467804 -4.31 1.20762161 54123 GCATAAGGTGTACGAACTTAGCCGGGAGCTTGGATCTACTGTGGGCCCAGCCACGGAAAA UP 17656 1 0.12015 1.7397811 -4.32 1.41774959 NA TACAGCAAGCTCACTGTGGATACAGACAGTTGGTTGCAAGGAGAAATTTTTACCTGCTCC UP 23942 1 0.120611 1.7372566 -4.32 1.41737436 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 12637 1 0.121271 1.733662 -4.32 1.10913311 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 45856 1 0.121628 1.7317255 -4.32 1.52179378 NA AACTTTAATGTGAATACCTCCTGTTGCAAGGAAGACCTCTGCAATGCAGCAGTTCCCACT UP 50829 1 0.123235 1.7230765 -4.33 1.37223384 20293 CCTGAAGTTCCCCACGGGCAGTGTGATATTTATTATGATATCTAAAAAGAGATGTTTTTA UP 58951 1 0.124463 1.7165373 -4.33 1.09886429 109032 ATGGCAAAGTGCATGAATACTAGACAGTAAAAATAAAGCTGTTGGTGTCTCTGTGCGTTT UP 3880 1 0.125158 1.7128593 -4.33 1.06780402 215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG UP 44092 1 0.127158 1.7023908 -4.34 1.39439571 270152 AAAGCATCCAGTTTGGTCCGCTCTTCAGTCAGATCCAAGTAATGTGGTTGAAAAGAAAAA UP 46476 1 0.128396 1.6959851 -4.34 1.00164818 63986 CCTTTGAGCCAGGGATTTGGAATCCTTACTTCTGAAGGCTCAGATTGATAGGATATGAAC UP 23899 1 0.128659 1.6946315 -4.34 1.18100051 654818 GTATGTAACAATGTTGAGATAGTCCTGGTTATAGTCGTTTGGTTTTTAACGCAAAGACAA UP 3094 1 0.129244 1.69163 -4.34 1.25437455 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 2486 1 0.1293 1.6913406 -4.34 1.07363705 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 48249 1 0.129473 1.690459 -4.34 1.68645713 NA GGTGCTTTCACCTCAGGTACCTGCAGTTCGCCTATGATGGCCTTGATTACATTGCCCTGA UP 42582 1 0.130099 1.6872651 -4.34 1.64005019 14964 CAGTTCTCTTTACACAACATTGTCTGATGTTCCCTGTGAGCTTGGGTTCAGTGTGAAGAA UP 2166 1 0.13022 1.6866514 -4.34 1.04870721 64697 CTGGAGAAGTAGCCCGTCATCTAAAAAGATGTTTTCAAAAATGATTCTTTCTCACGCCAC UP 22455 1 0.130342 1.6860302 -4.34 1.39705814 NA TGTGGCTAGTGTTTGTGTGGAAGACTGGAATAACAGGAAGGAATTTGTGCGTACTGTGAC UP 52682 1 0.130868 1.6833636 -4.34 1.10136707 434484 TGTAGGAACCTGCTCCCAGTGGATAGAGTCGTGTACGACATCCTCAGCAATGTACAGAAG UP 1957 1 0.131282 1.6812706 -4.35 1.21083208 NA TTTTTTGAAGTGCTTGAACATGAGCTGATAGTCATCTGACTCCTCTTCATTCTGGTCCTC UP 16289 1 0.131395 1.680699 -4.35 1.40181772 NA TTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTGCCAGAAA UP 29078 1 0.131875 1.6782838 -4.35 1.12605536 11433 CTTTCTTGGGAACGGGCTTTCCTTTCAGTCAAGTCTTACTGTCACTGCTATTCAATAAAA UP 11320 1 0.133099 1.6721619 -4.35 1.15374634 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 21031 1 0.133237 1.6714758 -4.35 1.22491272 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 2463 1 0.133358 1.670873 -4.35 1.16190037 NA CCTTTACTTACCTGTACTTATACATATAATTAAGCCCAGCTTATTGCATTTGCCTTATGG UP 43448 1 0.133949 1.667938 -4.35 1.10208734 NA ATGGGTTGCAGCTGAAGTCTGTAAGGCACAGTTACATGCAGGTACAACCCTTAAGAAACA UP 35746 1 0.133977 1.6678017 -4.35 1.20084231 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 37881 1 0.134492 1.6652539 -4.35 1.02647069 545030 TGCATGGGAAATTTCTACGTGGCTCACTTCACCAAGGCTTATTGCACTGGGAAAAGAAGA UP 9239 1 0.134667 1.6643906 -4.35 1.05731133 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 39602 1 0.135531 1.660146 -4.36 1.20629076 NA GTTACATGTACAGGTACCAGCAGAAGCCAGGATCCTCACCCAAACCCTGGATTTATGGCA UP 59845 1 0.136811 1.6539004 -4.36 1.17631997 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 23975 1 0.138184 1.6472635 -4.36 1.12200969 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 44517 1 0.13889 1.6438753 -4.36 1.14232045 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 31573 1 0.141887 1.6296569 -4.37 1.0069553 215900 TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG UP 54833 1 0.142058 1.6288559 -4.37 1.26826524 15951 GTAGAAGCCTATTGAAATATCAGTCCTATAAAGACCATCTCTTAATTCTAGGAAATGGTG UP 43139 1 0.142377 1.6273617 -4.37 1.34862162 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 2003 1 0.144826 1.6159838 -4.38 1.02432747 NA UP 51315 1 0.146027 1.6104691 -4.38 1.15561438 16365 AGACAGTTTGACTTGGGGTGGTGAACAGTGTGGCATAAGACCCAAGGTTTCATTCTCTAT UP 16230 1 0.146188 1.6097334 -4.38 1.06130742 66141 CTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTT UP 51905 1 0.146768 1.6070842 -4.38 1.63253232 55985 GATTTATTGTCTTGCATTAAAACCAGTAACAATTGAAAGATCCTCAGCTTAAAGGTCCAG UP 14005 1 0.147644 1.6031085 -4.38 1.28187878 NA TTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACTGCCATATACTACTGTGCCAAAAA UP 30539 1 0.148099 1.6010488 -4.38 1.16370202 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 40553 1 0.149194 1.5961192 -4.39 2.08130202 NA AGCAATGGGCATACAGAGGAGAACTACAAGGACACCGCACCAGTCCTGGACTCTGACGGT UP 32600 1 0.150306 1.5911487 -4.39 1.04563723 NA GAATTGAATCTCATTGAAGATGGGTTGCAGCTGAAGTCTGTAAGGCACAGTTACATGCAG UP 33315 1 0.151294 1.5867599 -4.39 1.2129895 219132 CCATGGGTTTATGCTCACTATCATATCACATTGCCAATATTTAGCACACTTAATAAATGC UP 7475 1 0.151952 1.5838483 -4.39 1.0914118 11433 GCTTTCCTTTCAGTCAAGTCTTACTGTCACTGCTATTCAATAAAACAATGCTTTGTCTCC UP 21219 1 0.152345 1.5821166 -4.39 1.00208812 NA ACTTCAGGAGTTTCCAAAAGCGGATGCTGACGTTCGAGGTCAGGCCATTGGGAGAGTCGG UP 30282 1 0.153176 1.578467 -4.4 1.13908556 100038882 TGTAGACACGCTTAAGAAGAAGGTGTCCAGCGGAACAAGTCACGAAGACCAGTTCTGGCT UP 31416 1 0.155436 1.5686343 -4.4 1.45635416 71957 CCTACATAGCTGTAGATTAATCTCTGCCGAGCACAATAAATGTTGTACAATCTCCACTTC UP 61191 1 0.155628 1.5678082 -4.4 1.3729208 NA CAAATTATCATTCAGCTCTCATATCCAGACTGAGCATCAGCAAGGATAACTCCAAGAGCC UP 48250 1 0.156137 1.5656112 -4.4 1.48915836 100048271 CCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGTGGAGGCACAAA UP 43041 1 0.156167 1.5654825 -4.4 1.20380254 268482 GACGGAACCGTATGGGTTTAACAACACTAACTTTAATTAAAGATTAATGGCAATGAAGTG UP 60952 1 0.156575 1.5637274 -4.4 1.86799032 NA ACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAAGATTGGTCCTGGAA UP 59292 1 0.156619 1.5635405 -4.4 1.24054992 620078 AGCAAAACACATCTGAAGGCCTACCCGGAAATCAGGAATCAGGTTCACCAGCTGTAAAAA UP 31403 1 0.157053 1.5616775 -4.4 1.64848553 NA GCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTGCTAGA UP 12106 1 0.158101 1.5572043 -4.41 1.1161041 219131 ACACTGATACCCTGGGTTTATGCTCACTATCATACCAGATTGCCAATATTTAGCACACTT UP 17153 1 0.158239 1.5566162 -4.41 1.08202591 15957 CACACATTACTGGAAAGATACTAAGAACCAAGAAGACTTTTGGCTTCCTAGAGAATTAAA UP 60461 1 0.159492 1.5513088 -4.41 1.27460272 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 15285 1 0.159528 1.5511583 -4.41 1.56318293 NA TGGCGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGACTACAACAT UP 11080 1 0.159729 1.5503064 -4.41 1.62017409 NA GCTCAAGTATAAGTTCCAATTACTTGCATTGGTATCAGCAGAAGCCAGGATTCTCCCCTA UP 20075 1 0.160052 1.5489472 -4.41 1.12365939 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 5349 1 0.160096 1.5487612 -4.41 1.09947145 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 7924 1 0.160384 1.5475497 -4.41 1.03961663 19039 AGCAGCTTCCGTGTGGTCATACGCCCCTTCTACCTCACTAACTCCACTGACATGGTGTAA UP 30391 1 0.163094 1.536249 -4.42 1.07103016 NA UP 44969 1 0.163424 1.5348863 -4.42 1.31641301 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 5463 1 0.164144 1.5319195 -4.42 1.04975721 117586 CCAGAGATGCTATCCTGTACTATGTGAACTTGAAGGAACTGGATAACCCAGGTCCTTTCA UP 11906 1 0.164466 1.5305961 -4.42 1.00774166 NA AGCCTGGAGCCTGAAGATTTTGCAATGTATTACTGTCAACAGCATAATGAATACCCGTAC UP 1419 1 0.16462 1.5299606 -4.42 1.08345102 12655 TGAACATCTTTTGCTTCCTGTAAAACCACCATGCTTGTTTCTTGCTCTCACAATAAATTC UP 49136 1 0.164943 1.5286384 -4.42 1.75959175 NA TAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGTATGCAAGGTCTAGAATATCCTCT UP 22029 1 0.16615 1.5237107 -4.42 1.62154986 26388 ATTGACCTCAAATGCAGATGAGTGGTTTCTGAGAGCTACGAGGTACAGTTACATGGAGGT UP 8495 1 0.167064 1.5199987 -4.42 1.10300387 19039 TACTGCAGTAGCCCCATCTGTCACAGTCACTCATCAAAAATCATTAAAGTCTCACGTGCT UP 17963 1 0.167088 1.5199019 -4.42 1.55680706 100046496 AGCAGAGTGGAGGCTGAGGATGTGGGTGTTTATTACTGTGCTCAAAATCTAGAACTTCCT UP 49829 1 0.167663 1.517576 -4.42 1.35576301 76681 CATAGCTAAGGGCTGTCACTTACATCAGGTGGGTAAAGACCATGTTAAGGGAAGATTCCA UP 54383 1 0.168374 1.5147101 -4.43 1.23228739 99899 ATGAATTCATTAAGAGAGTAGTGAGAGAACAGGGAATGAAGAAGGCACAGAGACTGTGCC UP 40012 1 0.169658 1.5095643 -4.43 1.37514634 NA ATGAGGCACTTCAGAAACCCAGGAAACTGGAGAAAACAATATCCACGAGCCTTGGTAACA UP 59870 1 0.170693 1.5054415 -4.43 1.08849743 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 20102 1 0.172476 1.4983937 -4.43 1.2912548 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 37826 1 0.173014 1.4962769 -4.43 1.16604223 246256 CCAAGAAGCGATTCTTCAGAATTTTACACTTTCTCTGCCCCAAACATTCCATTAGCGCAA UP 3895 1 0.174641 1.4899187 -4.44 1.65050536 16161 AGTTTCCCTATTAGAGTATTGGGCACTTAATAAATGGGCCTTCCCAGAGACTGAGAAACT UP 5898 1 0.17511 1.4880936 -4.44 1.30322542 NA CTATAATGCAGCTTTCATATCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGT UP 8439 1 0.175486 1.4866368 -4.44 1.02086674 NA ATGTATGGCATCTACAAACTCCCTTTTCCAGAGACACCTCTAGAAGGAAGAACCCAGTAT UP 28041 1 0.17714 1.4802541 -4.44 1.30752384 26388 CTGCTCAAATATAATACATACAACATCCAGCTCTTAGTTGTGGGAACAATACTTTAGCTT UP 57590 1 0.177484 1.4789296 -4.44 1.27569098 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 18398 1 0.177533 1.4787433 -4.44 1.00318023 NA ATTTCTTGCCAAAGGATGGTTTCAACAGGCATCCTGTCTTTAAGAATGAGTGGCTCCCCA UP 27970 1 0.179063 1.4728969 -4.45 1.58881953 NA ATCTCACAACAGTTTTACCTGCCAAGTTACACATGAAGGGGACACTGTGGAGAAGAGTCT UP 7388 1 0.1809 1.4659367 -4.45 1.14821656 24110 CCAAGCTGGTTGGAGCCTCCAGCCTTCAAAATTCTGAATCTAATAAACATTAATGCACAC UP 15746 1 0.183138 1.4575381 -4.45 1.40070817 NA TTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACACCATGCACTG UP 2114 1 0.183551 1.4559986 -4.45 1.24748573 100038882 GGACCAGTGTGCCTAAGGCCCCCATCCAGAGCCAGTGTTGGTTATAAAAGATGATGGGGG UP 14666 1 0.184527 1.4523747 -4.46 1.85077759 14990 GTGGCCCATTATTCCCAAAGACACAATTCTGAATGTCATAACTGAAACATTTTAATCTCA UP 8291 1 0.185963 1.4470684 -4.46 1.28016431 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 29326 1 0.186973 1.4433609 -4.46 1.06309765 19354 TCAGAAAAGCACAGAACAAATCTACTTCAGTAAATCTCTCATCTGCCCAGCCAAGTGAGG UP 40595 1 0.188295 1.4385299 -4.46 1.28350882 23962 TGCTCTAGAATGGTACCAATCCAGTATCAATGTATGACAAGTGCTTGTTAAATAAAGAAG UP 20777 1 0.18968 1.4335045 -4.46 1.44068408 NA GGCAACAAGTTCATGGCCAGCAGCTTCCTACATTTGACATCGGACCAGTGGAGATCTCAC UP 29241 1 0.189875 1.4328002 -4.46 1.28441887 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 9262 1 0.192987 1.4216312 -4.47 1.04615718 27083 TAATCTCGTAACACCTGGAAGAAAGAAGCTCAACCACCATGAAATGACTTCATGATATTT UP 16225 1 0.196213 1.4102188 -4.47 1.81768103 NA GGGCCTTGAGTGGATTGGATATATTTATCCTTACAATGATGGTACTAAGTACAATGAGAA UP 12383 1 0.197867 1.4044332 -4.48 1.06095994 NA CAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTAATCCTAGCAATGGTGGTACT UP 39293 1 0.199731 1.3979625 -4.48 1.17764448 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 39820 1 0.204421 1.3819109 -4.49 2.02908201 NA GCCACTCACAAGACATCAACTTCACCCATTGTCAAGAGCTTCAACAGGAATGAGTGTTAG UP 31648 1 0.205882 1.376973 -4.49 1.06974968 14728 GCCATCATGAATACCTCATGTGTTATCAGAAGCTTCTCAGAATTTTGGGAATATACTTTA UP 138 1 0.205884 1.3769686 -4.49 1.46375962 NA CTGCCAAGTTACACATGAAGGGGACACTGTGGAGAAGAGTCTGTCTCCTGCAGAATGTCT UP 8424 1 0.208009 1.3698435 -4.49 1.96072639 20568 TTACTGTTTTACCACTAACATCTCCTTTTGGCTCAGCATTCACCGATCTTTAGGGAAATG UP 54806 1 0.213309 1.352346 -4.5 1.32683935 640979 AAGTTGTCCTGCAAGGCTTCTGGCTACACTTTCACCAGCTACTGGATGCACTGGGTGAAG UP 37355 1 0.213435 1.3519352 -4.5 1.26030428 NA AAACCTGTCACACAGAACATCAGTGCAGAGGCCTGGGGCCGAGCAGACTGTGGAATCACT UP 62829 1 0.215257 1.3460091 -4.5 1.30362679 435333 TTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACAAGCTACGATATAAACTG UP 3794 1 0.21538 1.3456111 -4.5 1.11844804 69816 TGGCCCAGAGAGAAGAGCTTTAGTCCAACCTGCTGCACTTCTGGATCTTCTCTAATTTTA UP 23436 1 0.215853 1.3440816 -4.51 2.41481293 NA TTACTTCGTCTACAGCAAGCTCAATGTGCAGAAGAGCAACTGGGAGGCAGGAAATACTTT UP 34137 1 0.217461 1.3389005 -4.51 1.10402225 66949 GCTCATTCTATTCTGCTTATAAACAACTTGAGTAGGCTGATCTATGTAATTAACGGAAAC UP 12330 1 0.225282 1.3141562 -4.52 1.84302083 NA AGCAGTGTGCAGGCTGAAGACCTGGCAGTTTATTACTGTCAGCAACATTATAGTACTCCT UP 1073 1 0.230103 1.2992681 -4.53 1.16289607 NA GGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGTAGTGG UP 827 1 0.230293 1.2986881 -4.53 1.69228013 NA CAGTGTGCAGGCTGAAGACCTGGCAGTTTATTACTGTCAGAATGATCATAGTTATCCTCC UP 1296 1 0.23352 1.2888765 -4.53 1.58382284 NA GCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTACAGTGGTTACCCATCCA UP 23857 1 0.234341 1.2863982 -4.53 1.99457689 NA GTAATGATGTAGCTTGGTACCAACAGAAGCCAGGGCAGTCTCCTAAACTGCTGATATACT UP 27489 1 0.236819 1.2789629 -4.53 1.37289247 NA AATCAGCAGCATGGAGGCTGAAGATGCTGCCACTTATTACTGTCAACAGTGGAGTAGTTA UP 38790 1 0.24561 1.2531089 -4.55 1.15084443 NA TAGCTGTGTCAGTTGGAGAGAAGGTTACTATGAGCTGCAAGTCCAGTCAGAGCCTTTTAT UP 46141 1 0.245746 1.2527133 -4.55 1.15366181 NA TAATACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACACATCCTC UP 37356 1 0.254714 1.2271373 -4.56 1.08778287 15442 CCACTGAATTTAGTACATTGATGAAGCTAGAACCTAAAGTTTGTATGCTTCAATACTCTC UP 53623 1 0.255428 1.2251316 -4.56 1.14036652 NA GCATGGAGGCTGAAGATGCTGCCTCTTATTTCTGCCATCAGTGGAGTAGTTACCCACCCC UP 19998 1 0.265068 1.1985213 -4.57 1.11470613 NA AGCCTGACATCTGAGGACTCTGCCATCTATTACTGTAATCTAAGAGTAAAGTGGTGCTGA UP 45400 1 0.27807 1.1638625 -4.58 1.3680907 677484 ATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTGAGCAGCCTGACATATGA UP 43865 1 0.28077 1.1568313 -4.59 1.20837657 NA CTCCCCCAAAAGATGGATTTATGACACATCCAAACTGGCTTCTGGAGTCCCTGCTCGCTT UP 20308 1 0.283411 1.1500081 -4.59 1.02023274 12458 ACACGAGAGCACAAAGCAACATTGCCCCAAAAGCCTTGGTGAAACTTGCTATTACATATG UP 1336 1 0.286915 1.1410316 -4.59 1.08775472 74481 ACGGTGTGTGAGAACAGGACCCACTCCTGGATCAGAGCATGGTTCTTGGCACATGGGATG UP 50162 1 0.287341 1.1399477 -4.6 1.49162064 NA AAACTCTTACTCTCTCACGATCAGCAGCATGGAGGCTGAAGATGTTGCCACTTATTACTG UP 47793 1 0.287958 1.1383783 -4.6 1.18367905 12266 TGCAGAAAGGGAAGAAGTACCTCATGTGGGGCCTCTCCTCTGACCTCTGGGGAGAAAAGC UP 49684 1 0.288822 1.1361863 -4.6 1.40163941 NA ATTCAACTTGGCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTA UP 6562 1 0.289307 1.1349574 -4.6 1.06137693 NA AATGACTGTAGACAAATCCTCCAGCACAGCCTATATGGAACTTGCCAGACTGACATCTGA UP 43523 1 0.29659 1.1167016 -4.6 1.11723267 100505009 ACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGACACAGTGCTACAAACACATCCTGA UP 40030 1 0.303646 1.0993556 -4.61 1.56484919 NA ACCTCTGAGGACTCTGCGGTCTATTTCTGTGCAAGACCTCCTCTCATAGATGTTCAGTAA UP 23054 1 0.312331 1.078437 -4.62 1.20954914 NA GACACATCCTCCAGCACAGCCTACATGCAGCTCAGAAGCCTGACTATGAGGACTCTGTGA UP 26642 1 0.316041 1.0696412 -4.62 1.1406786 NA TCAAAAGTTCAAGGACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACAT UP 18930 1 0.332419 1.0317522 -4.64 1.16342327 NA TGGATCTGGGCAAGATTATTCTCTCACCATCAGCAGCCTGGAGTATGAAGATATGGGAAT UP 62101 1 0.334975 1.0259704 -4.64 1.21412482 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 58857 1 0.336203 1.0232034 -4.64 1.23163629 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 57243 1 0.339564 1.0156743 -4.65 1.20509039 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 16391 1 0.340927 1.0126379 -4.65 1.21545329 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 10714 1 0.342173 1.0098673 -4.65 1.19867014 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 9929 1 0.344575 1.004553 -4.65 1.21545589 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 55021 1 0.346223 1.0009221 -4.65 1.20229389 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 6158 1 0.346692 0.9998909 -4.65 1.19270029 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 50543 1 0.34927 0.9942431 -4.65 1.3984107 NA GCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTGGAGTAGTAACCCACCCA UP 45447 1 0.349931 0.9928009 -4.65 1.19071003 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 21267 1 0.352466 0.9872858 -4.66 1.54826559 NA CCATATCCATGCATCCCTTGTATAAATAAAGCACCCAGCAAAGCCTGGGACCATGTAAAA UP 56997 1 0.353335 0.9854029 -4.66 1.18005347 12266 ATTCACAGAATCTATGGTGGTTTATGGTTGTCCCAACTGACTACAGCCCAGCCCTCTAAT UP 59252 1 0.355284 0.9811921 -4.66 1.07025768 56644 TTAATACCACCCTTATTTCCAGTGTGGACTTCCAAATTGCTGGGGATCTGTTTATAGCTT UP 60865 1 0.356843 0.9778357 -4.66 1.5224347 NA TGGTCAAGGGCTATTTCCCTGAGCCAGTGACAGTGACCTGGAACTCTGGATCCCTGTCCA UP 46024 1 0.372024 0.9457166 -4.67 1.12677948 NA TTATTCTCTCACAATCAGCAGTGTGGAGGCTGAAGATGCTGCCGATTATTACTGCCATCA UP 19343 1 0.379262 0.9307439 -4.68 1.14203408 13011 AGAGAGTCCTTTGATGACATTACTGGAGCACGTGCAGAGCAAAGCAGATACAGTCAACAA UP 25158 1 0.406258 0.8766804 -4.7 1.18281779 NA CAGTGTGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTACAGTGGTTACCCACT UP 29780 1 0.433313 0.8250154 -4.72 1.1428728 100504362 TTCCCTTGTCCTTGCACCTATGATTTATACCTAACTGAATAAAAAGGTGATCCAGCCTCA UP 20662 1 0.439007 0.81443 -4.72 1.74869999 NA AAGCTGAGAGTGGAAAAGAAGAACTGGGTGGAAAGAAATAGCTACTCCTGTTCAGTGGTC UP 4366 1 0.450709 0.7929688 -4.73 1.32822019 NA CACGAGGGTCTGCACAATCACCTTACGACTAAGACCATCTCCCGGTCTCTGGGTAAATGA UP 21613 1 0.473023 0.7530653 -4.74 1.03544228 545611 GACAGACTCTGAGCAGGACATGGAAGACAGTCAAAGCAAGGAATCCATTGTCCCAGAACC UP 16772 1 0.477262 0.7456276 -4.74 1.01500599 545611 ATTCAATTAAACTCAAGATGAAGAGCAAAGCACACACGGAGCCATCCACGGTCTCTACAC UP