/data/wwwroot/iBAD/data/iBAD_0000173/gene_expression_table/DOWN.txt

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 136

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 137

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 138

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 139

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 140

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

A PHP Error was encountered

Severity: Warning

Message: Cannot modify header information - headers already sent by (output started at /data/wwwroot/iBAD/application/controllers/Home.php:229)

Filename: helpers/download_helper.php

Line Number: 141

Backtrace:

File: /data/wwwroot/iBAD/application/controllers/Home.php
Line: 230
Function: force_download

File: /data/wwwroot/iBAD/index.php
Line: 315
Function: require_once

adj.P.Val P.Value t B logFC GENE_ID SEQUENCE change 22754 1 0.008993 -3.4288739 -3.58 -1.29017619 17926 CAGTAAGACCCTGACCATCCCATTCACGAATCGCTACAAGTACAGCAGTATGATTGACTA DOWN 47567 1 0.029881 -2.6373274 -3.89 -1.23935927 67320 TCTATGACATAAAGGAAACAAGGAAACAACAGCAAAAGGAAAAGGAAAAGGAAGAGGAAG DOWN 37290 1 0.045224 -2.3710577 -4.01 -2.69600537 30939 CCGCCTGTTTGTTACGATGCAGATATTTAAACTTCTTACTTCTTTGTAGTTTCTGTATGT DOWN 1370 1 0.098949 -1.8668446 -4.26 -1.15918161 245839 AACAAAGCTCATGGAGTTTTGTCTTATGTGAAATCCAAGAAGATCTCTTCAGGAGTCTTC DOWN 57381 1 0.101993 -1.8471048 -4.26 -1.01330444 238692 CCTGTACCTCTGTATCTGTTGTTGTGGTATAAACTGCTCCTGGAATAGGCACCTATGTAT DOWN 16949 1 0.129519 -1.6902218 -4.34 -1.37284721 66898 GCTTATCAGATTCTCAGATCTCACCGAGAAATTATCCCCAAATTGGTCCGGGTCTATGTA DOWN 60396 1 0.132339 -1.675956 -4.35 -1.20732222 16573 CCTGTTATACTAAATCATACACTATAATTTGTTTAGTTAGAAATAGTAAACTGTTTGCAA DOWN 28184 1 0.267591 -1.1916871 -4.57 -1.56675858 NA TTCAGAAACGGTAATGTGGTTTCTCCAATCCTTGTCACATGTGCAGTGGTGCTACAGTAA DOWN 18030 1 0.316329 -1.0689637 -4.62 -1.19835728 NA ATACGATGCATATGAAAGTTGACCTTGGAGGTCAGGTTGGGCTGCTGAGTGAGTTTTAGT DOWN 26822 1 0.331098 -1.0347543 -4.64 -1.26867861 NA CTTGCCTTTATTCCTTCAGCGCTCTTGGGTTTCTCTCTGAATGGTTGGTGGCTTGCCACC DOWN 12006 1 0.334347 -1.0273881 -4.64 -1.37627787 70829 TCTTTCAAGAAAACTCTACAATCGGTCAGAAAATTGCTCTATCGGAAAAGATTGTCTCCG DOWN 3417 1 0.35311 -0.9858898 -4.66 -1.05774983 NA TGTACATACTTTCTGTGCTTTTGTGCTGGAGTATACCAGAAACTGCTGTCCATGCTTGGG DOWN 22046 1 0.36269 -0.9653457 -4.67 -1.15534416 NA GGGCTTGAGGATCTTTTAGGGGATCTTCTCCTAGTCTACGAGTTGTCAGTTTGAATAAAG DOWN